https://wiki.gamedetectives.net/api.php?action=feedcontributions&user=Halke234&feedformat=atomGame Detectives Wiki - User contributions [en]2024-03-29T08:21:22ZUser contributionsMediaWiki 1.30.0https://wiki.gamedetectives.net/index.php?title=ARG_Toolbox&diff=19618ARG Toolbox2021-11-23T19:22:37Z<p>Halke234: changed link</p>
<hr />
<div>{{argHeader}}<br />
{{backToTop}}<br />
<br />
This page is an archive of helpful tools and resources one might use in the course of solving puzzles typically found in ARGs, including encipher/deciphering, audio encoding, and steganography.<br />
<br />
__TOC__<br />
<br />
==ARG Training==<br />
<br />
===Academy===<br />
<br />
https://gamedetectives.net/academy/<br />
<br />
A series of challenges meant to teach to basic elements, techniques, and dynamics of ARGs, made in-house by the Game Detectives.<br />
<br />
===ae27ff===<br />
<br />
http://ae27ff.challenge.pt/<br />
<br />
ae27ff is a series of puzzles that use the typical techniques of most ARGs. They get more difficult the higher you go. Made by Discord user crashdemons.<br />
<br />
===ARGvent===<br />
<br />
http://gamedetectives.net/argvent/<br />
<br />
An annual Game Detectives tradition consisting of a series of puzzles unlocking each day over advent, with varying difficulty. Created by the GameDetectives [[Meta:Staff|admins]].<br />
<br />
===Enigma Group===<br />
<br />
https://www.enigmagroup.org<br />
<br />
A puzzle site that has many categories of learning. They begin as really easy, but then ascend to a more difficult encounter.<br />
<br />
===Levels===<br />
<br />
http://levels.your-host.xyz/<br />
<br />
A series of puzzles designed to introduce people to ARG solving. They range from easy to very hard. Levels can be gained through active participation on the official forum.<br />
<br />
===Last transmision===<br />
<br />
http://last.boxfish.ink<br />
<br />
A short, interactive, slightly creepy story made by Discord user mai(#9088). Will put your basic puzzle solving skills to the test.<br />
<br />
===Watching You===<br />
<br />
https://stvjsmrs.wordpress.com/<br />
<br />
Originally forming part of an [[Watching You:Timeline|ARG]], the site now houses two series of puzzles - the originals, and a cancelled Advent version. Made by Discord users in Team Look In The Bushes.<br />
<br />
==Text-based Tools==<br />
<br />
===Anagrams===<br />
<br />
http://anagramscramble.com/ Word de-scrambler<br />
<br />
http://textmechanic.com/text-tools/obfuscation-tools/word-scramblerunscrambler/ Word scrambler<br />
<br />
===Ascii85===<br />
<br />
https://www.tools4noobs.com/online_tools/ascii85_decode/ <br />
<br />
Decodes ascii85 messages. (there's a version for encoding as well)<br />
<br />
===asciitohex===<br />
<br />
http://www.asciitohex.com/<br />
<br />
Converts ASCII to hex and vice versa, as well as to other number-based encryption methods.<br />
<br />
===Ave Maria Cipher===<br />
<br />
http://de.wikipedia.org/w/index.php?title=Datei:Trithemius-Polygraphiae-71.jpg<br />
<br />
Ave Maria cipher.<br />
<br />
===Browserling===<br />
<br />
https://www.browserling.com/tools/<br />
<br />
Lots of encodings and encryptions.<br />
<br />
===Chaffing & Winnowing===<br />
<br />
http://en.wikipedia.org/wiki/Chaffing_and_winnowing<br />
http://people.csail.mit.edu/rivest/Chaffing.txt <br />
<br />
Everything you need to know about Chaffing and winnowing.<br />
<br />
===Cryptii===<br />
<br />
https://cryptii.com/text/text <br />
<br />
Site with a lot of ciphers.<br />
<br />
===CryptoCrack===<br />
<br />
https://sites.google.com/site/cryptocrackprogram/ <br />
<br />
Has a lot of classical ciphers and more.<br />
<br />
===Cryptomathic===<br />
<br />
http://extranet.cryptomathic.com<br />
<br />
EMV tag search. TLV (Tag, Length, Value) byte strings into their constituent tags and sub-tags. Useful for analysing APDU traces, responses and so on. CAP calculator. Features many more features.<br />
<br />
===Cryptool-Online===<br />
<br />
http://www.cryptool-online.org<br />
<br />
Features enciphering (enigma, navajo, vigenere), encoding (ASCII, Code39, Huffman), text analysis, etc.<br />
<br />
===Crypto-Tools===<br />
<br />
https://github.com/Hegz/crypto-tools <br />
<br />
Set of crypto-tools.<br />
<br />
===CyberChef===<br />
<br />
https://gchq.github.io/CyberChef/<br />
<br />
MULTIPLE methods of enciphering/encoding, uses more complicated methods and can have more processes going on at once.<br />
<br />
===Darkfader===<br />
<br />
https://www.darkfader.net/toolbox/convert/<br />
<br />
Online conversion utilities.<br />
<br />
===Dcode===<br />
<br />
http://www.dcode.fr/tools-list<br />
<br />
Contains a list of mathematical problem calculations, encodings, encryptions, and many more.<br />
<br />
===HTTP Referer Extension===<br />
<br />
'''LEGACY FIREFOX''': https://addons.mozilla.org/En-US/firefox/addon/refcontrol/<br />
<br />
'''QUANTUM''': https://addons.mozilla.org/en-US/firefox/addon/referer-modifier/<br />
<br />
'''CHROME''': https://chrome.google.com/webstore/detail/referer-control/hnkcfpcejkafcihlgbojoidoihckciin?hl=es-419<br />
<br />
Extensions for Legacy Firefox, Quantum and Chrome to help modifying HTTP referers.<br />
<br />
===Iterative Anagram Solver===<br />
<br />
http://boulter.com/anagram/<br />
<br />
Decodes multi-word anagrams word by word.<br />
<br />
===Kryptographiespielplatz===<br />
<br />
https://www.kryptographiespielplatz.de/index.php?<br />
<br />
List of a lot of ciphers. (It's in German, but common sense is enough.<br />
Test them out on the part where it says [ausprobieren]<br />
<br />
===Link Identifier===<br />
<br />
https://a4x.me/tools/link/<br />
<br />
A tool that will guess what site a link identifier could belong to given the length. Made by Discord user A4.<br />
<br />
===Linux Command Line Encode / Decode===<br />
<br />
http://technet.microsoft.com/en-us/sysinternals/bb897439.aspx<br />
<br />
Use linux command line strings to encode and decode.<br />
<br />
===md5hashing===<br />
<br />
https://md5hashing.net/hash_type_checker<br />
<br />
Allows you to decode many variations of MD5 and Sha ciphers.<br />
<br />
===Omniglot Conscripts===<br />
<br />
http://www.omniglot.com/conscripts/english.htm<br />
<br />
Has a list of alternate fonts that can be used for writing english.<br />
<br />
===OPENPGP===<br />
<br />
http://openpgp.org/software/<br />
<br />
PGP and GPG downloads.<br />
<br />
===PharmaBraille===<br />
<br />
https://www.pharmabraille.com/pharmaceutical-braille/the-braille-alphabet/<br />
<br />
Contains a detailed list of the Braille alphabet, including numbers and punctuation.<br />
<br />
===Polygraphic Substitution Systems===<br />
<br />
http://www.umich.edu/~umich/fm-34-40-2/ch7.pdf<br />
<br />
Breaking polygraphic substitution systems.<br />
<br />
===RICHKNI===<br />
<br />
http://www.richkni.co.uk/php/crypta/freq.php<br />
<br />
Word frequency analysis, can be really useful for substitution ciphers with no key.<br />
<br />
===Rumkin===<br />
<br />
http://rumkin.com/tools/cipher/<br />
<br />
Contains big list of ciphers.<br />
<br />
===SNOW Whitespace===<br />
<br />
http://www.darkside.com.au/snow/<br />
<br />
Whitespace steganography.<br />
<br />
===SpamMimic===<br />
<br />
http://spammimic.com/<br />
<br />
Hides a message in what appears to be a harmless block of spam.<br />
<br />
===The Black Chamber===<br />
<br />
http://www.simonsingh.net/The_Black_Chamber/chamberguide.html<br />
<br />
Has a set of text enciphering and encoding methods.<br />
<br />
===WeChall Encryption tools.===<br />
<br />
https://www.wechall.net/tools/<br />
<br />
Features JPocketKnife, a conversion tool, JDicTac, a bruteforce for homemade ciphers and hashes, etc.<br />
<br />
===Wikibruce===<br />
<br />
http://ref.wikibruce.com/hub<br />
<br />
For text encryption, it features ROT-n, Hexadecimal, Binary, ASCII, Morse, Pattern Recognition, and separating byte data to 8 bit planes.<br />
<br />
===Xlate===<br />
<br />
http://cyber.meme.tips/xlate<br />
<br />
Multiple methods of encoding, including a personalized radix, or base, decoding. (Supports Base 2 - 36)<br />
<br />
===XOR / Byte Shift===<br />
<br />
http://otp22.com/xlate/shifts.html<br />
<br />
Is used to show all 255 XOR and Byte Shift instances.<br />
<br />
==Audio Analysis==<br />
<br />
===Audacity===<br />
<br />
https://www.audacityteam.org/<br />
<br />
Useful program used for audio inspecting.<br />
<br />
===Direwolf===<br />
<br />
https://github.com/wb2osz/direwolf<br />
<br />
Software "soundcard" AX.25 packet modem/TNC and APRS encoder/decoder. It can be used stand-alone to observe APRS traffic, as a tracker, digipeater, APRStt gateway, or Internet Gateway (IGate).<br />
*NOTE: Not user-friendly!<br />
<br />
===DTMF===<br />
<br />
http://www.teworks.com/dtmf.htm<br />
<br />
Dual Tone Multi Frequency tones decoding.<br />
<br />
===fldigi===<br />
<br />
https://sourceforge.net/projects/fldigi/ (fldigi)<br />
<br />
Can encrypt/decrypt a lot of audio encryption.<br />
Manual can be found [http://cyber.meme.tips/fldigi-guide here.]<br />
*NOTE: Not user-friendly!<br />
<br />
===Ham Radio Directory Downloads===<br />
<br />
https://radio.linux.org.au/?sectpat=digital<br />
<br />
Includes 35 ham radio tools.<br />
*NOTE: It may not work on certain OS, and not all of them are user-friendly.<br />
<br />
===Kansas City Standard Cassette Audio Data===<br />
<br />
http://www.dabeaz.com/py-kcs/index.html<br />
<br />
Can be used to encode/decode Kansas City Standard Cassette Audio Data.<br />
<br />
===MM-SSTV===<br />
<br />
http://hamsoft.ca/pages/mmsstv.php<br />
<br />
Slow Scan Television Program. Alternative to RXSSTV.<br />
<br />
===OTP22 Signal Decoders===<br />
<br />
https://github.com/otp22/decoders<br />
<br />
Directory for multiple methods of encryption used in otp22, ABISM tone decodings (Modified ASCII tones), NATO 5gram decoder, and another XOR program.<br />
<br />
===RX-SSTV===<br />
<br />
http://users.belgacom.net/hamradio/rxsstv.htm<br />
<br />
A program that deciphers SSTV encryption on audio tracks.<br />
<br />
===SonicVisualiser===<br />
<br />
http://sonicvisualiser.org/<br />
<br />
Creates spectographs of audio.<br />
<br />
===Sorcerer===<br />
<br />
http://www.kd0cq.com/2013/07/sorcerer-decoder-download/<br />
<br />
Has more radio recieving modes than fldigi, like Harris RF-3560 PSTN TIU,IRA-ARQ (ASCII-ARQ), etc. (only for decoding)<br />
<br />
===Wavepad FFT===<br />
<br />
http://www.nch.com.au/wavepad/fft.html<br />
<br />
Audio spectogram analysis.<br />
<br />
==Image Analysis==<br />
<br />
===Binvis===<br />
<br />
http://binvis.io/#/<br />
<br />
Gives a visual representation of binary files.<br />
<br />
===Ceefax===<br />
<br />
http://edit.tf/ <br />
<br />
Can be used to upload ceefax images.<br />
<br />
===EXIF===<br />
<br />
http://exif.regex.info/exif.cgi<br />
<br />
Used to find EXIF data and ID3 tags.<br />
<br />
===Futureboy===<br />
<br />
https://futureboy.us/stegano/<br />
<br />
Allows to compare the differences of two images, and unlock steganography with passwords.<br />
<br />
===GIMP===<br />
<br />
https://www.gimp.org/downloads/ <br />
<br />
Free program. Alternative to photoshop. Can export and import raw files.<br />
<br />
===JHead===<br />
<br />
http://mirror.otp22.com/jhead<br />
<br />
Allows for the viewing of jpeg headers, abnormalities, and outgress output.<br />
<br />
===Magic Eyes===<br />
<br />
http://magiceye.ecksdee.co.uk/ To solve magic eyes<br />
<br />
http://www.easystereogrambuilder.com/3d-stereogram-maker.aspx To make them.<br />
<br />
===Nonograms===<br />
<br />
http://nonomaker.com/ Used to make nonograms aaaaand<br />
<br />
http://a.teall.info/nonogram/ to solve them.<br />
<br />
===Outguess===<br />
<br />
http://filehippo.com/mac/download_outguess/<br />
<br />
Outguess steganography.<br />
*NOTE: Only works on mac. Try using a virtual machine for opening it.<br />
<br />
===Photo Forensics===<br />
<br />
https://29a.ch/photo-forensics/#forensic-magnifier<br />
<br />
Magnifier, clone detection, error level analysis, and more tools.<br />
<br />
===Pixlr=== <br />
<br />
http://pixlr.com/editor/<br />
<br />
Online GIMP-style editor.<br />
<br />
===Punchcards===<br />
<br />
http://www.kloth.net/services/cardpunch.php <br />
<br />
Punchcards simulator.<br />
<br />
===QR Codes===<br />
<br />
http://www.qrcode-generator.de/ and https://dnschecker.org/qr-code-generator.php For making QR codes.<br />
<br />
https://webqr.com/ and https://dnschecker.org/qr-code-scanner.php For reading QR codes.<br />
<br />
===Rawpixels===<br />
<br />
http://rawpixels.net/<br />
<br />
Visualizes .raw files.<br />
<br />
===Tinkercad===<br />
<br />
https://www.tinkercad.com/<br />
<br />
Web-based 3D modeling.<br />
<br />
===WeChall Tools===<br />
<br />
https://www.wechall.net/tools/<br />
<br />
Features JColorSucker to grab pixel values from images.<br />
<br />
===Wikibruce===<br />
<br />
http://ref.wikibruce.com/hub<br />
<br />
For image steganography, wikibruse can submit delimited list of pixel bytes. Resulting file is a single plane greyscale PNG. (eg: 255,0,255,0,255,0,0,255,0 with width 3)<br />
<br />
==General Steganography / Tools==<br />
<br />
===FCU===<br />
<br />
http://filmos.net/FilmosCipherUtility<br />
<br />
An offline utility for encoding/decoding text and image files.<br />
Allows for creation and usage of own ciphers.<br />
<br />
===Hex Editors===<br />
<br />
https://hexed.it/ <br />
<br />
*Online hex editor.<br />
<br />
https://mh-nexus.de/en/hxd/ <br />
<br />
*Offline hex editor (has more utilities).<br />
<br />
http://www.chmaas.handshake.de/delphi/freeware/xvi32/xvi32.htm<br />
<br />
*Another Offline hex editor but without needing to install it and has scripting.<br />
<br />
===HTTP referrers===<br />
<br />
https://addons.mozilla.org/En-US/firefox/addon/refcontrol/<br />
<br />
Firefox extension to find HTTP referrers.<br />
<br />
===Notepad++===<br />
<br />
https://notepad-plus-plus.org<br />
<br />
VERY useful program. Similar to Notepad but has many more utilities.<br />
<br />
===OtpXor===<br />
<br />
https://github.com/otp22/decoders/tree/master/OtpXor<br />
<br />
Made by the creator of ae27ff, allows for the xoring of two large files together.<br />
<br />
===Repl===<br />
<br />
https://repl.it/<br />
<br />
Website used to run and debug code.<br />
<br />
===XorJ===<br />
<br />
https://github.com/crashdemons/XorJ<br />
<br />
Made by the creator of ae27ff, allows for the xoring of two relatively small files together.</div>Halke234https://wiki.gamedetectives.net/index.php?title=User:Halke234&diff=17926User:Halke2342018-11-11T23:35:22Z<p>Halke234: </p>
<hr />
<div>bye.</div>Halke234https://wiki.gamedetectives.net/index.php?title=User:Halke234&diff=17925User:Halke2342018-11-11T23:32:36Z<p>Halke234: Blanked the page</p>
<hr />
<div></div>Halke234https://wiki.gamedetectives.net/index.php?title=Solaris_United&diff=17919Solaris United2018-10-25T16:54:28Z<p>Halke234: Minor format change</p>
<hr />
<div>{{argbox<br />
| float = right<br />
| name = Solaris United<br />
| image = Image:Solaris_United.gif<br />
| imagewidth = 500<br />
| description = A potential ARG for the upcoming Warframe update, Fortuna<br />
| creator = [https://www.digitalextremes.com/ Digital Extremes]<br />
| type = Official<br />
| status = Active<br />
| discovered = 2018-23-10<br />
}}<br />
{{ArgHeader}}<br />
{{backToTop}}<br />
<br />
'''Solaris United''' is the name of a Discord server, named after the faction focused on in the upcoming Fortuna update for the sci-fi shooter [https://www.warframe.com/ Warframe], developed by Digital Extremes.<br />
<br />
__TOC__<br />
<br />
== Discovery and Tweets ==<br />
On October 23rd of 2018, at 16:25 UTC the [https://twitter.com/PlayWarframe/ Warframe Twitter account] began sending out a string of cryptic questions to some Warframe partners.<br />
<br />
{| class="wikitable"<br />
!Partner Name !! Warframe Tweet !! Time Sent<br />
|-<br />
|[https://twitter.com/DKDiamantes DKDiamantes] || [https://twitter.com/PlayWarframe/status/1054770685510246401 Wh̸̩̏o se̶̗̪̩̥̍̒̀͊͑nt you?] || 16:25 UTC<br />
|-<br />
|[https://twitter.com/esp4him esp4him] || [https://twitter.com/PlayWarframe/status/1054771763521839106 Th̸͔̭͉͙̣̮̿̋̉e ___ wakes fir̸̼͉͙̾st.] || 16:29 UTC<br />
|-<br />
|[https://twitter.com/Frozenbawz Frozenbawz] || [https://twitter.com/PlayWarframe/status/1054772840925323264 Thre̷͔̘̮̭̔̈́̈́e Taxmen walk dow̸̦̘͋̾̕n an alley. What̴͉̏͒̓͘ happens?] || 16:33 UTC<br />
|-<br />
|[https://twitter.com/DanieltheDemon Danielthedemon] || [https://twitter.com/PlayWarframe/status/1054779603745558528 Whe̶̺̊re is the ḵ̷̩͖̳͐͊eeper?] || 17:00 UTC<br />
|-<br />
|[https://twitter.com/PlayWarframe/status/1054782482095079425 Wgrates] || [https://twitter.com/PlayWarframe/status/1054782482095079425 Whȍ̸̭͙̥͋̑ can̶̫̰̔̀̇ we call?̶̧͕̄͋̍] || 17:11 UTC<br />
|-<br />
|[https://twitter.com/QuiteShallow Quite Shallow] || [https://twitter.com/PlayWarframe/status/1054782619643084802 Wh̴͓͇̭̿̚o controls̶̙͛ the s̸̡̛̐̀un?] || 17:12 UTC<br />
|-<br />
|[https://twitter.com/mogamu Mogamu] || [https://twitter.com/PlayWarframe/status/1054783325657739265 Whic̸͓̏h three days ã̴͎̀̋re best for c̸̬̍̈́͠ͅontemp̴̛̻lation?] || 17:15 UTC<br />
|-<br />
|[https://twitter.com/xiFlynn iFlynn] || [https://twitter.com/PlayWarframe/status/1054783604423778304 W̸̦̗͛̅͝hat cont̷̖̙̀rols the flą̵̐̑̿sh?] || 17:16 UTC<br />
|-<br />
|[https://twitter.com/shanksy1387 Shanksy1387] || [https://twitter.com/PlayWarframe/status/1054787278206263296 Wh̷̞͐ere d̴͖͕̘̤̎̀̈́̋̈́oes the coö̴̲́͝lant flow?] || 17:30 UTC<br />
|-<br />
|[https://twitter.com/Brozime Brozime] || [https://twitter.com/PlayWarframe/status/1054793269324865537 Wẖ̴̓͠ere is the t̷̹̣̿̿ower?] || 17:54 UTC<br />
|}<br />
<br />
Partners that answered these questions correctly, received the response "Code accepted. Agent confirmed. Check your messages." However, each response had different letters in zalgo-text, presumably they were also sent a message on Twitter. According to a [https://www.youtube.com/watch?v=vm4rPY4PG4Y video] by the Warframe partner Quiet Shy, the message sent was an invitation to the discord server named '''Solaris United'''.<br />
<br />
== Solaris United Discord Server ==<br />
At 17:21 UTC, Brozime [https://twitter.com/Brozime/status/1054799947231576064 tweeted out] images of all of the channels in the server. The only two users on the server that have posted in three of the channels are Server Messages, and The Business. Server Messages seems to act as more of a log user, sending things like "/// INCOMING TRANSMISSION ///". The Business however, sends the body of the actual messages. The Business is also one of the characters in Fortuna that players will be able to interact with upon the launch of the update.<br />
<br />
Both the solarisunited and cache channels have the following as their first message. Intel has a similar message but is missing the line "Tapping into Corpus frequencies...".<br />
<br />
Every message from The Business in these three channels are started by a message from Server Messages with the contents "/// INCOMING TRANSMISSION ///", and end with "/// END TRANSMISSION ///" in another message from the same user.<br />
<br />
<nowiki>===================================<br />
|==:: Version 5.24 starting up ::==|<br />
===================================<br />
<br />
Transmission protocol initiating...<br />
:::...<br />
Tapping into Corpus frequencies...<br />
:::...<br />
Connecting to data structures...<br />
:::...<br />
<br />
...Complete</nowiki><br />
<br />
=== solarisunited ===<br />
The solarisunited channel has two transmissions from The Business, one posted on October 22nd of 2018, at 18:11 UTC. And another on October 23rd of 2018, at 18:00 UTC.<br />
<br />
In the first transmission, the Business introduces themselves and explains what is going on Fortuna, saying that they need our help. They also mention the Cache, a channel for people to track their share of the bounty. The transmission is as follows.<br />
<nowiki>How do you do, Outworlders?<br />
They call me ‘The Business.’ I need your help.<br />
I've scuffled with my share of scoundrels, but Nef Anyo and the Corpus — or ‘the Taxmen,’ as they’re known around here in Fortuna — are the worst of ‘em.<br />
There was a time we openly fought back against the Taxmen, until things went south after the incident. We’ve lived in the shadows ever since.<br />
Outworlders, we must rebuild Solaris United. We must, once more, fight for our freedom. <br />
Will you help us?<br />
Some of us still act on behalf of the old Solaris United, what little of it remains. <br />
We have agents tracking Corpus shipments on the Vallis: resources we can steal to help our people make payments and clear debts. <br />
Help me recruit members for Solaris United, and I’ll add your cut of the bounty to a Cache. I’ve created a #cache channel to track your share.<br />
Tell your fellow Outworlders we aren’t giving up without a fight. We are Solaris, and down here, we all lift together. <br />
I’ll contact you again soon. Stay sharp.</nowiki><br />
<br />
In the second transmission, The Business simply introduces the intel channel, where they will deliver information for us.<br />
<br />
<nowiki>Outworlders, you've done well in recruiting new members for the cause. Because of your efforts, I'm opening a new channel, #intel. I will deliver additional information to you there. Stay sharp.</nowiki><br />
<br />
=== cache ===<br />
<br />
The cache channel currently has one transmission, posted on the 22nd of October 2018, at 18:26 UTC. This message simply welcomes players to the cache channel, and tells them what it is for.<br />
<br />
<nowiki>Welcome to the #cache channel, Outworlders. Here, I’ll deliver the latest information on your cut of the bounty as we steal from the Corpus. It’ll take time to put your share together, so I’ll let you know when you can pick it up.</nowiki><br />
<br />
=== intel ===<br />
<br />
The intel channel, much like the cache channel currently has one transmission, posted on the 23rd of October 2018, at 18:04 UTC. The transmission welcomes players to the channel, saying that as new members are recruited for Solaris United they will begin to trust them with new information. They also explain more of the plight that the people of Fortuna have to live through.<br />
<nowiki>Welcome to the new #intel channel. As you continue to recruit new members for Solaris United, I will trust you with new information.<br />
Repossession. Nasty business.<br />
The Solaris need cybernetic upgrades to protect themselves from the hostile Vallis climate. And guess who supplies the upgrades?<br />
Nef Anyo and the bloody Taxmen. We’re forced to do the work, and then we pay the Taxmen for the ‘pleasure’ of hard labor.<br />
Because of these mandatory body mods, we all live in debt to our Corpus overlords.<br />
It’s a vicious cycle we cannot escape through obedience.<br />
In Fortuna, we live in fear of ‘repossession.’<br />
At any hour of the day, Nef can send one of his vile repo squads down here to ‘take back what’s theirs.’<br />
Limb by limb, piece by piece, the Taxmen will rip out your cybernetics until there's nothing left of you.<br />
We must fight back, Outworlders. Because if we lose, we lose everything.</nowiki><br />
<br />
Attached to this transmission was an image, depicting what is assumed to be one of the Solaris people, named HR-67. The image uses the [http://warframe.wikia.com/wiki/Corpus_Language Corpus Language], a full translation is as follows. Note that some letters are intentionally incorrect, such as the use of "k" instead of "c" in some cases.<br />
<br />
[[Image:Project_solaris.jpg|thumb|256px|right|The image posted in the intel channel]]<br />
<nowiki>Title: Projekt Solaris<br />
Name: HR-67<br />
Alias: -<br />
Race: Solaris<br />
Lokation: Fortuna, Orb Vallis, Venus<br />
Top Right: Profit Traking<br />
<br />
Job: Laborer<br />
Debt: High<br />
Punishment: Organ Reposession<br />
Records<br />
- History of Violence<br />
- Black Market Connections<br />
Suspected Dissident<br />
Notes<br />
-<br />
<br />
Status: Partial Repo</nowiki><br />
<br />
== Partner video ==<br />
Soon after the invite was posted publicly in some a [https://youtu.be/0Ahr9Up2cmc video] was posted by Brozime on Youtube that appears to contain a message from The Business. Several other partners subsequently posted the same video. The video was also posted on the Solaris United server as an mp4 file, and a direct link to the file can be found [https://cdn.discordapp.com/attachments/502159523562127386/504749584896229420/BizTransmission1080p_50mb.mp4 here].<br />
{{#evt:<br />
service=youtube<br />
|id=https://youtu.be/0Ahr9Up2cmc<br />
|dimensions=500<br />
|alignment=right<br />
|description=A message from the business<br />
|container=frame<br />
}}</div>Halke234https://wiki.gamedetectives.net/index.php?title=Solaris_United&diff=17918Solaris United2018-10-25T16:51:12Z<p>Halke234: Added some extra information.</p>
<hr />
<div>{{argbox<br />
| float = right<br />
| name = Solaris United<br />
| image = Image:Solaris_United.gif<br />
| imagewidth = 500<br />
| description = A potential ARG for the upcoming Warframe update, Fortuna<br />
| creator = [https://www.digitalextremes.com/ Digital Extremes]<br />
| type = Official<br />
| status = Active<br />
| discovered = 2018-23-10<br />
}}<br />
{{ArgHeader}}<br />
{{backToTop}}<br />
<br />
'''Solaris United''' is the name of a Discord server, named after the faction focused on in the upcoming Fortuna update for the sci-fi shooter [https://www.warframe.com/ Warframe], developed by Digital Extremes.<br />
<br />
__TOC__<br />
<br />
== Discovery and Tweets ==<br />
On October 23rd of 2018, at 16:25 UTC the [https://twitter.com/PlayWarframe/ Warframe Twitter account] began sending out a string of cryptic questions to some Warframe partners.<br />
<br />
{| class="wikitable"<br />
!Partner Name !! Warframe Tweet !! Time Sent<br />
|-<br />
|[https://twitter.com/DKDiamantes DKDiamantes] || [https://twitter.com/PlayWarframe/status/1054770685510246401 Wh̸̩̏o se̶̗̪̩̥̍̒̀͊͑nt you?] || 16:25 UTC<br />
|-<br />
|[https://twitter.com/esp4him esp4him] || [https://twitter.com/PlayWarframe/status/1054771763521839106 Th̸͔̭͉͙̣̮̿̋̉e ___ wakes fir̸̼͉͙̾st.] || 16:29 UTC<br />
|-<br />
|[https://twitter.com/Frozenbawz Frozenbawz] || [https://twitter.com/PlayWarframe/status/1054772840925323264 Thre̷͔̘̮̭̔̈́̈́e Taxmen walk dow̸̦̘͋̾̕n an alley. What̴͉̏͒̓͘ happens?] || 16:33 UTC<br />
|-<br />
|[https://twitter.com/DanieltheDemon Danielthedemon] || [https://twitter.com/PlayWarframe/status/1054779603745558528 Whe̶̺̊re is the ḵ̷̩͖̳͐͊eeper?] || 17:00 UTC<br />
|-<br />
|[https://twitter.com/PlayWarframe/status/1054782482095079425 Wgrates] || [https://twitter.com/PlayWarframe/status/1054782482095079425 Whȍ̸̭͙̥͋̑ can̶̫̰̔̀̇ we call?̶̧͕̄͋̍] || 17:11 UTC<br />
|-<br />
|[https://twitter.com/QuiteShallow Quite Shallow] || [https://twitter.com/PlayWarframe/status/1054782619643084802 Wh̴͓͇̭̿̚o controls̶̙͛ the s̸̡̛̐̀un?] || 17:12 UTC<br />
|-<br />
|[https://twitter.com/mogamu Mogamu] || [https://twitter.com/PlayWarframe/status/1054783325657739265 Whic̸͓̏h three days ã̴͎̀̋re best for c̸̬̍̈́͠ͅontemp̴̛̻lation?] || 17:15 UTC<br />
|-<br />
|[https://twitter.com/xiFlynn iFlynn] || [https://twitter.com/PlayWarframe/status/1054783604423778304 W̸̦̗͛̅͝hat cont̷̖̙̀rols the flą̵̐̑̿sh?] || 17:16 UTC<br />
|-<br />
|[https://twitter.com/shanksy1387 Shanksy1387] || [https://twitter.com/PlayWarframe/status/1054787278206263296 Wh̷̞͐ere d̴͖͕̘̤̎̀̈́̋̈́oes the coö̴̲́͝lant flow?] || 17:30 UTC<br />
|-<br />
|[https://twitter.com/Brozime Brozime] || [https://twitter.com/PlayWarframe/status/1054793269324865537 Wẖ̴̓͠ere is the t̷̹̣̿̿ower?] || 17:54 UTC<br />
|}<br />
<br />
Partners that answered these questions correctly, received the response "Code accepted. Agent confirmed. Check your messages." However, each response had different letters in zalgo-text, presumably they were also sent a message on Twitter. According to a [https://www.youtube.com/watch?v=vm4rPY4PG4Y video by partner Quite Shallow], the message sent was an invitation to the discord server named '''Solaris united'''.<br />
<br />
== Solaris United Discord Server ==<br />
At 17:21 UTC, Brozime [https://twitter.com/Brozime/status/1054799947231576064 tweeted out] images of all of the channels in the server. The only two users on the server that have posted in three of the channels are Server Messages, and The Business. Server Messages seems to act as more of a log user, sending things like "/// INCOMING TRANSMISSION ///". The Business however, sends the body of the actual messages. The Business is also one of the characters in Fortuna that players will be able to interact with upon the launch of the update.<br />
<br />
Both the solarisunited and cache channels have the following as their first message. Intel has a similar message but is missing the line "Tapping into Corpus frequencies...".<br />
<br />
Every message from The Business in these three channels are started by a message from Server Messages with the contents "/// INCOMING TRANSMISSION ///", and end with "/// END TRANSMISSION ///" in another message from the same user.<br />
<br />
<nowiki>===================================<br />
|==:: Version 5.24 starting up ::==|<br />
===================================<br />
<br />
Transmission protocol initiating...<br />
:::...<br />
Tapping into Corpus frequencies...<br />
:::...<br />
Connecting to data structures...<br />
:::...<br />
<br />
...Complete</nowiki><br />
<br />
=== solarisunited ===<br />
The solarisunited channel has two transmissions from The Business, one posted on October 22nd of 2018, at 18:11 UTC. And another on October 23rd of 2018, at 18:00 UTC.<br />
<br />
In the first transmission, the Business introduces themselves and explains what is going on Fortuna, saying that they need our help. They also mention the Cache, a channel for people to track their share of the bounty. The transmission is as follows.<br />
<nowiki>How do you do, Outworlders?<br />
They call me ‘The Business.’ I need your help.<br />
I've scuffled with my share of scoundrels, but Nef Anyo and the Corpus — or ‘the Taxmen,’ as they’re known around here in Fortuna — are the worst of ‘em.<br />
There was a time we openly fought back against the Taxmen, until things went south after the incident. We’ve lived in the shadows ever since.<br />
Outworlders, we must rebuild Solaris United. We must, once more, fight for our freedom. <br />
Will you help us?<br />
Some of us still act on behalf of the old Solaris United, what little of it remains. <br />
We have agents tracking Corpus shipments on the Vallis: resources we can steal to help our people make payments and clear debts. <br />
Help me recruit members for Solaris United, and I’ll add your cut of the bounty to a Cache. I’ve created a #cache channel to track your share.<br />
Tell your fellow Outworlders we aren’t giving up without a fight. We are Solaris, and down here, we all lift together. <br />
I’ll contact you again soon. Stay sharp.</nowiki><br />
<br />
In the second transmission, The Business simply introduces the intel channel, where they will deliver information for us.<br />
<br />
<nowiki>Outworlders, you've done well in recruiting new members for the cause. Because of your efforts, I'm opening a new channel, #intel. I will deliver additional information to you there. Stay sharp.</nowiki><br />
<br />
=== cache ===<br />
<br />
The cache channel currently has one transmission, posted on the 22nd of October 2018, at 18:26 UTC. This message simply welcomes players to the cache channel, and tells them what it is for.<br />
<br />
<nowiki>Welcome to the #cache channel, Outworlders. Here, I’ll deliver the latest information on your cut of the bounty as we steal from the Corpus. It’ll take time to put your share together, so I’ll let you know when you can pick it up.</nowiki><br />
<br />
=== intel ===<br />
<br />
The intel channel, much like the cache channel currently has one transmission, posted on the 23rd of October 2018, at 18:04 UTC. The transmission welcomes players to the channel, saying that as new members are recruited for Solaris United they will begin to trust them with new information. They also explain more of the plight that the people of Fortuna have to live through.<br />
<nowiki>Welcome to the new #intel channel. As you continue to recruit new members for Solaris United, I will trust you with new information.<br />
Repossession. Nasty business.<br />
The Solaris need cybernetic upgrades to protect themselves from the hostile Vallis climate. And guess who supplies the upgrades?<br />
Nef Anyo and the bloody Taxmen. We’re forced to do the work, and then we pay the Taxmen for the ‘pleasure’ of hard labor.<br />
Because of these mandatory body mods, we all live in debt to our Corpus overlords.<br />
It’s a vicious cycle we cannot escape through obedience.<br />
In Fortuna, we live in fear of ‘repossession.’<br />
At any hour of the day, Nef can send one of his vile repo squads down here to ‘take back what’s theirs.’<br />
Limb by limb, piece by piece, the Taxmen will rip out your cybernetics until there's nothing left of you.<br />
We must fight back, Outworlders. Because if we lose, we lose everything.</nowiki><br />
<br />
Attached to this transmission was an image, depicting what is assumed to be one of the Solaris people, named HR-67. The image uses the [http://warframe.wikia.com/wiki/Corpus_Language Corpus Language], a full translation is as follows. Note that some letters are intentionally incorrect, such as the use of "k" instead of "c" in some cases.<br />
<br />
[[Image:Project_solaris.jpg|thumb|256px|right|The image posted in the intel channel]]<br />
<nowiki>Title: Projekt Solaris<br />
Name: HR-67<br />
Alias: -<br />
Race: Solaris<br />
Lokation: Fortuna, Orb Vallis, Venus<br />
Top Right: Profit Traking<br />
<br />
Job: Laborer<br />
Debt: High<br />
Punishment: Organ Reposession<br />
Records<br />
- History of Violence<br />
- Black Market Connections<br />
Suspected Dissident<br />
Notes<br />
-<br />
<br />
Status: Partial Repo</nowiki><br />
<br />
== Partner video ==<br />
Soon after the invite was posted publicly in some a [https://youtu.be/0Ahr9Up2cmc video] was posted by Brozime on Youtube that appears to contain a message from The Business. Several other partners subsequently posted the same video. The video was also posted on the Solaris United server as an mp4 file, and a direct link to the file can be found [https://cdn.discordapp.com/attachments/502159523562127386/504749584896229420/BizTransmission1080p_50mb.mp4 here].<br />
{{#evt:<br />
service=youtube<br />
|id=https://youtu.be/0Ahr9Up2cmc<br />
|dimensions=500<br />
|alignment=right<br />
|description=A message from the business<br />
|container=frame<br />
}}</div>Halke234https://wiki.gamedetectives.net/index.php?title=Game_Theory_ARG&diff=17661Game Theory ARG2018-09-18T18:07:20Z<p>Halke234: </p>
<hr />
<div>{{WIP}}<br />
<br />
{{argbox<br />
| float = right<br />
| name = Game Theory ARG<br />
| image = File: Game Theory Logo.jpg<br />
| description= It's just an ARG. A Game Theory ARG!<br />
| creator = [https://www.youtube.com/user/MatthewPatrick13/ Game Theory (Matthew Patrick, Stephanie Patrick)]<br />
| type = Official<br />
| status = Active<br />
| discovered = 08-10-2018<br />
}}<br />
{{ArgHeader}}<br />
{{backToTop}}<br />
<br />
<br />
The Game Theory Merch Mystery and an unnamed arg commencing on 29/8/2018 are ARGs created by the Game Theory Team: Matthew Patrick and Stephanie Patrick. The Merch Mystery was created to promote new Game Theory merchandise, so it may be possible that the next ARG is created to promote more products by Game Theory. <br />
<br />
__TOC__<br />
<br />
== The Merch Mystery ==<br />
On 08/10/2018, MatPat announced on his twitter account that [https://twitter.com/i/moments/1027998450795737088 New Merch] had been released, and that a puzzle involving the merch was also created. Although the clues necessary to complete the puzzle were hidden in merch, no purchase of said merch was necessary to complete the puzzle.<br />
<br />
Some people who purchased the merchandise noticed 1 of 6 spelling errors on their carrier bag that the item was stored in.<br />
The 6 spelling errors were all in place of the letter "o" in the word "theory".<br />
[[File:Spelling_errors.PNG|thumb|right]]<br />
<br />
The 6 spelling errors could then be rearranged to spell "t#30r%". This would be used later on in the ARG.<br />
<br />
The next clue would be hidden in the Game Theory Journal. All of the eyes of the characters in the notebook had letters located within them. When spelled sequentially, they would spell a website name: [https://www.hasmatpatgonemad.com/ hasmatpatgonemad.com]<br />
<br />
This website showed a [https://www.youtube.com/watch?v=YzmuWEZv5TU A 1:00 minute video] of MatPat's face with big eyes surrounded by a weird background a rays coming from his head.<br />
<br />
Keen eyed investigators saw that Matpat's blinking was actually Morse code, seen below:<br />
<br />
<pre><br />
- ... . / - .... . --- .-. .. ... - / --. .- -. .-- .- -.-- / -.. --- - / -.-. --- --<br />
</pre><br />
<br />
This decoded to <code>THE THEORIST GATEWAY DOT COM</code>, and led players to a [http://thetheoristgateway.com/ new website]. <br />
<br />
Players were greeted with one final 6 character password to put in. Players found the password to be <code>t#30r%</code>, from the merchandise bags. The first 100 players to solve the puzzle received a prize for completing it so quickly (''still not released as of 18/09/18'').<br />
== Unnamed 2nd Game Theory ARG ==<br />
=== What is MatPat Hiding? ===<br />
<br />
On September 16, 2018, The Game Theorists YouTube channel released a video titled [https://www.youtube.com/watch?v=2KorwsAv49A What is MatPat HIDING?].<br />
In it, MatPat did a post-mortem on the Merch Mystery and what his plans for the future are.<br />
He also hid 3 clues within the video. 2 were red herrings and 1 was real.<br />
<br />
At the [https://www.youtube.com/watch?v=2KorwsAv49A?t=8 0:08 mark] an encrypted message was shown:<br />
<br />
<code><br />
Uifsf bsf op Fbtufs Fhht jo ifsf. Hp bxbz.<br />
</code><br />
<br />
When decrypted with a ROT25 cipher, players discovered the following message:<br />
<br />
<code><br />
There are no Easter Eggs in here. Go away.<br />
</code><br />
<br />
At the [https://www.youtube.com/watch?v=2KorwsAv49A?t=757 12:38 mark] a string of numbers with dashes is shown:<br />
<br />
<code><br />
23 5 - 23 15 21 12 4 - 14 15 20 - 13 1 11 5 - 9 20 - 20 8 1 20 - 5 1 19 25<br />
</code><br />
<br />
When decoded with a letters-numbers cipher, the message was:<br />
<br />
<code><br />
we would not make it that easy<br />
</code><br />
<br />
Finally, a suspicious looking tag may appear within the video description, titled <code>#UCVNTZJXAuvE3C7SfOsPNgEA</code>. This was found to be a YouTube channel ID, which led players to a [https://www.youtube.com/channel/UCVNTZJXAuvE3C7SfOsPNgEA YouTube channel] titled <code>tenretni olleh</code>.<br />
<br />
The channel's banner consisted of a black image with the message "patience is the key" repeated across it.<br />
[[File:Upside_Down.jpg|thumb|right|150x150px]]<br />
The channel icon consisted of a red, inverse Game Theory logo, with the text <code>pow zNb Xdd MnH</code> instead of <code>yroeht emag</code>. This may be interpreted as it is, or can be turned upside down to give <code>HuW ppX qNz mob</code>.<br />
<br />
Some players also tried going on thetheoristgateway.com again after discovering these clues, and were greeted with this message:<br />
Concatenating the numbers gives "524742323534". This can be converted from hex into text, giving the following result:<br />
<br />
<pre><br />
RGB254<br />
</pre><br />
<br />
This hinted at altering the image so that each of the RGB values of colour are changed to 254, 1 less than 255. This was also hinted at in the filename, ff is 255 in hex, therefore fe is 254 in hex.<br />
<br />
When the image was altered according to these instructions, a timestamp was discovered:<br />
[[File:Fefefe254.png|thumb|200x200px|Timestamp shown through brightness and contrast changes.]] <br />
The timestamp is dated 29/9/2018 at 00:00:01 PST (08:00:01 UTC).</div>Halke234https://wiki.gamedetectives.net/index.php?title=Bradwell_Electronics&diff=17235Bradwell Electronics2018-08-30T01:00:35Z<p>Halke234: /* Bradwell Returns */</p>
<hr />
<div>{{WIP}}<br />
<br />
{{argbox<br />
| float = right<br />
| name = Bradwell Electronics<br />
| image = File:Bradwell Logo.png<br />
| description= Better. Brighter. For everyone.<br />
| creator = [http://www.bossastudios.com/ Bossa Studios]<br />
| type = Investigation<br />
| status = Active<br />
| discovered = 2016-03-05<br />
}}<br />
{{ArgHeader}}<br />
{{backToTop}}<br />
<br />
<br />
[https://www.bradwellelectronics.com/ Bradwell Electronics] is a promotional website released by [http://www.bossastudios.com/ Bossa Studios], a British game developer responsible for Surgeon Simulator and I Am Bread. At this time, the purpose of the site is unknown, but it is speculated to be an in-fiction promotional website for Bossa Studios' next game.<br />
<br />
__TOC__<br />
<br />
== Email Newsletter ==<br />
<br />
''Most of the content in this section is a rehash of [https://www.reddit.com/r/gamedetectives/comments/5x113k/bradwell_electronics_bossa_studios/ this Reddit post] by [https://www.reddit.com/u/blackbat24 /u/blackbat24]; all credit goes to him.''<br />
<br />
A field on the [https://www.bradwellelectronics.com/ Bradwell Electronics site] was found which allowed usrs to sign up for an e-mail newsletter. A few minutes after signing up, the following message is sent to your email:<br />
<br />
Welcome to Bradwell Electronics - Better. Brighter. For Everyone.<br />
Thank you for registering your interest for the upcoming relaunch of the Bradwell Electronics website.<br />
When John Bradwell founded Bradwell Electronics over 62 years ago in 1964, he never imagined that the family business would become one of the most recognized brands worldwi$"%"$"!£2/.&%...<br />
<br />
From this point onwards, the message is "corrupted", and is mostly comprised of Base64 ciphertext. For the full text of the email, check [https://www.reddit.com/r/gamedetectives/comments/5x113k/bradwell_electronics_bossa_studios/ this Reddit post]. At one point, the message becomes legible again:<br />
<br />
>>INTERRUPT STREAM <br />
----------This is a mayday alert.<br />
--------------------It is of concern to all of us.<br />
------------------------------We ask you to trust us.<br />
----------------------------------------We cannot do this alone.<br />
<< END OF INTERRUPT<br />
<br />
Encoding the Base64 in the text of the email yields an image which includes a QR code:<br />
<br />
[[File:Bradwell qr.gif|The image revealed when encoding the Base64 in the text of the "corrupted" email]]<br />
<br />
''(Note: Amesbury is the location of Stonehenge.)''<br />
<br />
Reading the QR code reveals the following string:<br />
<br />
<code>/?decrypt50726f6a65637441</code><br />
<br />
''(Note: <code>50726f6a65637441</code> is hexadecimal for <code>ProjectA</code>, but this is not yet relevant to the investigation.)''<br />
<br />
=== Countdown Timer ===<br />
<br />
[[File:Bradwell countdown.png|thumbnail|right|The countdown displayed when using the <code>/?decrypt50726f6a65637441</code> URL extension]]<br />
<br />
Appending <code>/?decrypt50726f6a65637441</code> to the <code>http://bradwellelectronics.com</code> URL reveals a red box ([http://bradwellelectronics.com/?decrypt50726f6a65637441 link]), containing this text:<br />
<br />
\\>DECR_BRUTE_FORCE << |'fetch grid:[0x424cb726:0xbfe9c31a]/OENQJRYYVHZERCBEG.DAT'<br />
-->BRUTEFORCE NODES RUNNING...<br />
-->ESTIMATED BRUTEFORCE DECRYPTION COMPLETED IN: _d __h __m __s<br />
<br />
The first line of the text contains the string <code>OENQJRYYVHZERCBEG</code>; this can be deciphered using ROT13 to obtain <code>BRADWELLIUMREPORT</code>. The significance of this is currently unknown.<br />
<br />
Additionally, the final line of text in the red box is a countdown timer, which is counting down to 12:00 PM UTC, on March 8, 2017.<br />
<br />
== /__FILEDATA.ARCHIVE ==<br />
<br />
On March 8, 2017, the text on the login page of "Decryptkit" changed:<br />
<pre><br />
<br />
##DECRYPTIONKIT#############<br />
## GRID MINI VM V0.11[ADDRESS REMOVED]##<br />
##################################<br />
<br />
\\>DECR_BRUTE_FORCE << |'fetch grid:[0x424cb726:0xbfe9c31a]/OENQJRYYVHZERCBEG.DAT'<br />
-->BRUTEFORCE NODES STOPPED.<br />
-->BRUTEFORCE DECRYPTION COMPLETED: <br />
----> ARCHIVE DETECTED (OENQJRYYVHZERCBEG.ARCHIVE)<br />
----> DECOMPRESSING ARCHIVE... COMPLETED WITH ERRORS:<br />
-------> TOTAL FILES: 10, RECOVERED: 2<br />
----> WRAPPING RECOVERED FILES FOR ACCESS: COMPLETED<br />
----> RECOVERED FILES AVAILABE FOR DOWNLOAD: /__FILEDATA.ARCHIVE/<br />
-------> ENTER SECONDARY KEY TO DECRYPT REMAINING FILES: <br />
</pre><br />
<br />
This leads to [https://www.bradwellelectronics.com/__FILEDATA.ARCHIVE/ archive page], which contains a [https://www.bradwellelectronics.com/__FILEDATA.ARCHIVE/Bradwell-Press-Release-07022019.pdf press release] about Bradwell's involvement in the restoration of Stonehenge in 2019, while [https://www.bradwellelectronics.com/__FILEDATA.ARCHIVE/BradwellInternalMemo-060702019.zip the other file] is a passworded zip. In addition, in order to access other parts of the site, a decryption key is needed to be added in the [https://www.bradwellelectronics.com/wp-content/cache/autoptimize/js/autoptimize_5fb1719442f5f2a9ea5584295800051c.js code] of the website.<br />
<br />
Within the js of the website, [http://pastebin.com/Bsr0FWUW large blocks of hex] was found in the code which, when translated, included the decrypted data that was supposed to show only after the insertion of the decryption key. Just a few minutes later the decryption key (<code>together</code>) was found in the same translated js blob. With the [[#2nd_Key|2nd key]] in hand, users unlocked the subsequent data and followed the instructions, but this still left the zip file encrypted and its content sealed.<br />
<br />
[[File:bw1_bookcipher.png|thumbnail|right|The book cipher hidden in the footer of the press release.]] Later that day, a series of numbers in the footer of the [https://www.bradwellelectronics.com/__FILEDATA.ARCHIVE/Bradwell-Press-Release-07022019.pdf press release] was found, which looked like a book cipher. It decoded as <code>w3trusTu</code>, a keyword that unlocked the content of the encrypted zip file. The [https://www.bradwellelectronics.com/__FILEDATA.ARCHIVE/BradwellInternalMemo-060702019.zip internal memo] contains the planned repairs to the A303 tunnel and the Stonehenge museum, but just like the press release it also stored a hidden message, <code>together</code>, the [[#2nd_Key|2nd key]] needed for the advancement. It was later spotted inside the middle diamond, at the end of the footer, in a very small size font, black on black background.<br />
<br />
[[File:bw1_together.png|thumbnail|center|The second key, highlighted, hidden in the footer of the 060702019 internal memo.]]<br />
<br />
== 2nd Key ==<br />
<br />
The 2nd key, <code>together</code>, found initially through reverse engineering, when entered into the field produced this output:<br />
<br />
<pre><br />
##DECRYPTIONKIT#############<br />
## GRID MINI VM V0.11[ADDRESS REMOVED]##<br />
##################################<br />
<br />
\\>DECR_BRUTE_FORCE << |'fetch grid:[0x424cb726:0xbfe9c31a]/OENQJRYYVHZERCBEG.DAT'<br />
-->BRUTEFORCE NODES STOPPED.<br />
-->BRUTEFORCE DECRYPTION COMPLETED: <br />
----> ARCHIVE DETECTED (OENQJRYYVHZERCBEG.ARCHIVE)<br />
----> DECOMPRESSING ARCHIVE... COMPLETED WITH ERRORS:<br />
-------> TOTAL FILES: 10, RECOVERED: 2<br />
----> WRAPPING RECOVERED FILES FOR ACCESS: COMPLETED<br />
----> RECOVERED FILES AVAILABE FOR DOWNLOAD: /__FILEDATA.ARCHIVE/<br />
-------> ENTER SECONDARY KEY TO DECRYPT REMAINING FILES: ACCEPTED<br />
-->SUBMITTING SECONDARY ENCRYPTION JOB TO GRID SYSTEM: [#####]<br />
---->DECRYPTION TIME CANNOT BE DETERMINED.<br />
---->NOTIFICATION ON JOB COMPLETITION AVAILABLE USING SOCIAL MEDIA NETWORKS TO PROTECT ANONYMITY<br />
------>USE _LINK_ TO POST A TWEET INCLUDING SPECIAL CODE 'BETTERBE2026'<br />
------>DECRYPTION SYSTEM WILL GET IN TOUCH ONCE JOB HAS BEEN COMPLETED<br />
</pre><br />
<br />
[https://twitter.com/intent/tweet?text=Fresh%20air%20is%20good%20for%20you.%20BETTERBE2026 The link] is a tweet template which says <code>Fresh air is good for you. BETTERBE2026</code>.<br />
After several hours the message was modified, now reading:<br />
<br />
<pre><br />
-->SUBMITTING SECONDARY ENCRYPTION JOB TO GRID SYSTEM: [#####]<br />
---->DECRYPTION TIME CANNOT BE DETERMINED.<br />
---->USURPING SOCIAL MEDIA BANDWIDTH TO DECREASE DATA DECRYPTION TIME<br />
------>_REGISTER_ NODE WITH SYSTEM TO RECEIVE DECRYPTED PACKAGE<br />
------>DECRYPTED PACKAGE WILL BE DISTRIBUTED TO REGISTERED NODES ON COMPLETION<br />
</pre><br />
<br />
The [https://twitter.com/intent/tweet?text=%40BetterBradwell%20%23BETTERBE2026 REGISTER link] is a different tweet template, now reading <code>@BetterBradwell #BETTERBE2026</code>. It is yet unclear whether the alteration is a different step, or if it has simply being reworded (now reading <code>USURPING SOCIAL MEDIA BANDWIDTH TO DECREASE DATA DECRYPTION TIME</code>) to better instruct the players to tweet the message more.<br />
<br />
On March 16, around 15:40 UTC (3:40 pm), users starting receiving mentions.<br />
<br />
<pre>@username SEC TRIED TO SLOW US. DECRYPTION PRGRSS.<br />
[######----] 63%. STANDBY</pre><br />
<br />
3 minutes later, [https://twitter.com/BetterBradwell/ Bradwell Electronics] [https://twitter.com/BetterBradwell/status/842401632319111170 tweeted]:<br />
<br />
<pre>Please accept our apologies if you recently received a direct tweet. The intruder has been suppressed and our systems have been updated.</pre><br />
<br />
This could mean that no more tweets will be sent out, and that the updates will appear directly on the _FILEDATA in roughly a week time.<br />
<br />
= Bradwell Returns =<br />
<br />
At 15:00 UTC on 2018-08-29, the [https://twitter.com/bossastudios Bossa Studios] Twitter account posted a [https://twitter.com/bossastudios/status/1034802858221174785 tweet] which said:<br />
<pre><br />
PLEASE HELP!! I’m a technician at Bradwell Electronics and have made some important discoveries which need to be brought to light! I’ve managed to hack into the company’s social accounts, but think I’m being watched… Gotta go, but I’ll be back shortly!<br />
</pre><br />
<br />
This tweet was followed by three more tweets at two hour intervals, which can be seen below:<br />
<br />
* https://twitter.com/bossastudios/status/1034833061047877632<br />
<br />
<pre><br />
You’ve been led to believe that Bradwell Electronics is a kind and altruistic organisation. It’s not! There are thousands of incriminating files but I can’t access the drives internally, as my cover could be compromised. Hold on, I’m gonna try something...<br />
</pre><br />
<br />
* https://twitter.com/bossastudios/status/1034863254672224257<br />
<br />
<pre><br />
Phew, that was a close one. A security guard just walked past, so I had to abandon the attempt. One false move and it’s game over. People are counting on me for this information all around the world, and they don’t even know it! About to try again...<br />
</pre><br />
<br />
* https://twitter.com/bossastudios/status/1034893454533382144<br />
<br />
<pre><br />
Ok, so that didn’t work. I tried accessing the docs by bouncing my connection off an external node but no use. I’m going to have to access a senior staff member’s computer, but how? Wish me luck - we’re all going to need it.<br />
</pre><br />
<br />
* https://twitter.com/bossastudios/status/1034923656592465920<br />
<br />
<pre><br />
Good news - I’m on my way to one of the technician’s offices! I “accidentally” spilt coffee on them at lunch and managed to swipe their key card in the confusion. They’ve popped to the toilets to change but won’t be long. Now might be my only chance!<br />
</pre><br />
<br />
* https://twitter.com/bossastudios/status/1034953848576561152<br />
<br />
<pre><br />
Success! He’d left his computer unlocked, and I managed to download a file off the internal drives and get out before they returned. It won’t be long before he realises his key card’s missing though, and suspects I’m the reason. Time’s running out!<br />
</pre><br />
(''This list will be updated as new Tweets are posted.'')<br />
<br />
This signaled to players that the ARG may be starting up again. This led players back to the [https://www.bradwellelectronics.com/ Bradwell Electronics website]. Players who signed up for the newsletter again received a new email, which can be seen [https://pastebin.com/UAnarEMH here], and appeared to be an uncorrupted version of the email received previously in the ARG. In addition, the metadata of the new email contained the full text of the old, corrupted email.</div>Halke234https://wiki.gamedetectives.net/index.php?title=Bradwell_Electronics&diff=17228Bradwell Electronics2018-08-29T22:01:22Z<p>Halke234: /* Bradwell Returns */</p>
<hr />
<div>{{WIP}}<br />
<br />
{{argbox<br />
| float = right<br />
| name = Bradwell Electronics<br />
| image = File:Bradwell Logo.png<br />
| description= Better. Brighter. For everyone.<br />
| creator = [http://www.bossastudios.com/ Bossa Studios]<br />
| type = Investigation<br />
| status = Active<br />
| discovered = 2016-03-05<br />
}}<br />
{{ArgHeader}}<br />
{{backToTop}}<br />
<br />
<br />
[https://www.bradwellelectronics.com/ Bradwell Electronics] is a promotional website released by [http://www.bossastudios.com/ Bossa Studios], a British game developer responsible for Surgeon Simulator and I Am Bread. At this time, the purpose of the site is unknown, but it is speculated to be an in-fiction promotional website for Bossa Studios' next game.<br />
<br />
__TOC__<br />
<br />
== Email Newsletter ==<br />
<br />
''Most of the content in this section is a rehash of [https://www.reddit.com/r/gamedetectives/comments/5x113k/bradwell_electronics_bossa_studios/ this Reddit post] by [https://www.reddit.com/u/blackbat24 /u/blackbat24]; all credit goes to him.''<br />
<br />
A field on the [https://www.bradwellelectronics.com/ Bradwell Electronics site] was found which allowed usrs to sign up for an e-mail newsletter. A few minutes after signing up, the following message is sent to your email:<br />
<br />
Welcome to Bradwell Electronics - Better. Brighter. For Everyone.<br />
Thank you for registering your interest for the upcoming relaunch of the Bradwell Electronics website.<br />
When John Bradwell founded Bradwell Electronics over 62 years ago in 1964, he never imagined that the family business would become one of the most recognized brands worldwi$"%"$"!£2/.&%...<br />
<br />
From this point onwards, the message is "corrupted", and is mostly comprised of Base64 ciphertext. For the full text of the email, check [https://www.reddit.com/r/gamedetectives/comments/5x113k/bradwell_electronics_bossa_studios/ this Reddit post]. At one point, the message becomes legible again:<br />
<br />
>>INTERRUPT STREAM <br />
----------This is a mayday alert.<br />
--------------------It is of concern to all of us.<br />
------------------------------We ask you to trust us.<br />
----------------------------------------We cannot do this alone.<br />
<< END OF INTERRUPT<br />
<br />
Encoding the Base64 in the text of the email yields an image which includes a QR code:<br />
<br />
[[File:Bradwell qr.gif|The image revealed when encoding the Base64 in the text of the "corrupted" email]]<br />
<br />
''(Note: Amesbury is the location of Stonehenge.)''<br />
<br />
Reading the QR code reveals the following string:<br />
<br />
<code>/?decrypt50726f6a65637441</code><br />
<br />
''(Note: <code>50726f6a65637441</code> is hexadecimal for <code>ProjectA</code>, but this is not yet relevant to the investigation.)''<br />
<br />
=== Countdown Timer ===<br />
<br />
[[File:Bradwell countdown.png|thumbnail|right|The countdown displayed when using the <code>/?decrypt50726f6a65637441</code> URL extension]]<br />
<br />
Appending <code>/?decrypt50726f6a65637441</code> to the <code>http://bradwellelectronics.com</code> URL reveals a red box ([http://bradwellelectronics.com/?decrypt50726f6a65637441 link]), containing this text:<br />
<br />
\\>DECR_BRUTE_FORCE << |'fetch grid:[0x424cb726:0xbfe9c31a]/OENQJRYYVHZERCBEG.DAT'<br />
-->BRUTEFORCE NODES RUNNING...<br />
-->ESTIMATED BRUTEFORCE DECRYPTION COMPLETED IN: _d __h __m __s<br />
<br />
The first line of the text contains the string <code>OENQJRYYVHZERCBEG</code>; this can be deciphered using ROT13 to obtain <code>BRADWELLIUMREPORT</code>. The significance of this is currently unknown.<br />
<br />
Additionally, the final line of text in the red box is a countdown timer, which is counting down to 12:00 PM UTC, on March 8, 2017.<br />
<br />
== /__FILEDATA.ARCHIVE ==<br />
<br />
On March 8, 2017, the text on the login page of "Decryptkit" changed:<br />
<pre><br />
<br />
##DECRYPTIONKIT#############<br />
## GRID MINI VM V0.11[ADDRESS REMOVED]##<br />
##################################<br />
<br />
\\>DECR_BRUTE_FORCE << |'fetch grid:[0x424cb726:0xbfe9c31a]/OENQJRYYVHZERCBEG.DAT'<br />
-->BRUTEFORCE NODES STOPPED.<br />
-->BRUTEFORCE DECRYPTION COMPLETED: <br />
----> ARCHIVE DETECTED (OENQJRYYVHZERCBEG.ARCHIVE)<br />
----> DECOMPRESSING ARCHIVE... COMPLETED WITH ERRORS:<br />
-------> TOTAL FILES: 10, RECOVERED: 2<br />
----> WRAPPING RECOVERED FILES FOR ACCESS: COMPLETED<br />
----> RECOVERED FILES AVAILABE FOR DOWNLOAD: /__FILEDATA.ARCHIVE/<br />
-------> ENTER SECONDARY KEY TO DECRYPT REMAINING FILES: <br />
</pre><br />
<br />
This leads to [https://www.bradwellelectronics.com/__FILEDATA.ARCHIVE/ archive page], which contains a [https://www.bradwellelectronics.com/__FILEDATA.ARCHIVE/Bradwell-Press-Release-07022019.pdf press release] about Bradwell's involvement in the restoration of Stonehenge in 2019, while [https://www.bradwellelectronics.com/__FILEDATA.ARCHIVE/BradwellInternalMemo-060702019.zip the other file] is a passworded zip. In addition, in order to access other parts of the site, a decryption key is needed to be added in the [https://www.bradwellelectronics.com/wp-content/cache/autoptimize/js/autoptimize_5fb1719442f5f2a9ea5584295800051c.js code] of the website.<br />
<br />
Within the js of the website, [http://pastebin.com/Bsr0FWUW large blocks of hex] was found in the code which, when translated, included the decrypted data that was supposed to show only after the insertion of the decryption key. Just a few minutes later the decryption key (<code>together</code>) was found in the same translated js blob. With the [[#2nd_Key|2nd key]] in hand, users unlocked the subsequent data and followed the instructions, but this still left the zip file encrypted and its content sealed.<br />
<br />
[[File:bw1_bookcipher.png|thumbnail|right|The book cipher hidden in the footer of the press release.]] Later that day, a series of numbers in the footer of the [https://www.bradwellelectronics.com/__FILEDATA.ARCHIVE/Bradwell-Press-Release-07022019.pdf press release] was found, which looked like a book cipher. It decoded as <code>w3trusTu</code>, a keyword that unlocked the content of the encrypted zip file. The [https://www.bradwellelectronics.com/__FILEDATA.ARCHIVE/BradwellInternalMemo-060702019.zip internal memo] contains the planned repairs to the A303 tunnel and the Stonehenge museum, but just like the press release it also stored a hidden message, <code>together</code>, the [[#2nd_Key|2nd key]] needed for the advancement. It was later spotted inside the middle diamond, at the end of the footer, in a very small size font, black on black background.<br />
<br />
[[File:bw1_together.png|thumbnail|center|The second key, highlighted, hidden in the footer of the 060702019 internal memo.]]<br />
<br />
== 2nd Key ==<br />
<br />
The 2nd key, <code>together</code>, found initially through reverse engineering, when entered into the field produced this output:<br />
<br />
<pre><br />
##DECRYPTIONKIT#############<br />
## GRID MINI VM V0.11[ADDRESS REMOVED]##<br />
##################################<br />
<br />
\\>DECR_BRUTE_FORCE << |'fetch grid:[0x424cb726:0xbfe9c31a]/OENQJRYYVHZERCBEG.DAT'<br />
-->BRUTEFORCE NODES STOPPED.<br />
-->BRUTEFORCE DECRYPTION COMPLETED: <br />
----> ARCHIVE DETECTED (OENQJRYYVHZERCBEG.ARCHIVE)<br />
----> DECOMPRESSING ARCHIVE... COMPLETED WITH ERRORS:<br />
-------> TOTAL FILES: 10, RECOVERED: 2<br />
----> WRAPPING RECOVERED FILES FOR ACCESS: COMPLETED<br />
----> RECOVERED FILES AVAILABE FOR DOWNLOAD: /__FILEDATA.ARCHIVE/<br />
-------> ENTER SECONDARY KEY TO DECRYPT REMAINING FILES: ACCEPTED<br />
-->SUBMITTING SECONDARY ENCRYPTION JOB TO GRID SYSTEM: [#####]<br />
---->DECRYPTION TIME CANNOT BE DETERMINED.<br />
---->NOTIFICATION ON JOB COMPLETITION AVAILABLE USING SOCIAL MEDIA NETWORKS TO PROTECT ANONYMITY<br />
------>USE _LINK_ TO POST A TWEET INCLUDING SPECIAL CODE 'BETTERBE2026'<br />
------>DECRYPTION SYSTEM WILL GET IN TOUCH ONCE JOB HAS BEEN COMPLETED<br />
</pre><br />
<br />
[https://twitter.com/intent/tweet?text=Fresh%20air%20is%20good%20for%20you.%20BETTERBE2026 The link] is a tweet template which says <code>Fresh air is good for you. BETTERBE2026</code>.<br />
After several hours the message was modified, now reading:<br />
<br />
<pre><br />
-->SUBMITTING SECONDARY ENCRYPTION JOB TO GRID SYSTEM: [#####]<br />
---->DECRYPTION TIME CANNOT BE DETERMINED.<br />
---->USURPING SOCIAL MEDIA BANDWIDTH TO DECREASE DATA DECRYPTION TIME<br />
------>_REGISTER_ NODE WITH SYSTEM TO RECEIVE DECRYPTED PACKAGE<br />
------>DECRYPTED PACKAGE WILL BE DISTRIBUTED TO REGISTERED NODES ON COMPLETION<br />
</pre><br />
<br />
The [https://twitter.com/intent/tweet?text=%40BetterBradwell%20%23BETTERBE2026 REGISTER link] is a different tweet template, now reading <code>@BetterBradwell #BETTERBE2026</code>. It is yet unclear whether the alteration is a different step, or if it has simply being reworded (now reading <code>USURPING SOCIAL MEDIA BANDWIDTH TO DECREASE DATA DECRYPTION TIME</code>) to better instruct the players to tweet the message more.<br />
<br />
On March 16, around 15:40 UTC (3:40 pm), users starting receiving mentions.<br />
<br />
<pre>@username SEC TRIED TO SLOW US. DECRYPTION PRGRSS.<br />
[######----] 63%. STANDBY</pre><br />
<br />
3 minutes later, [https://twitter.com/BetterBradwell/ Bradwell Electronics] [https://twitter.com/BetterBradwell/status/842401632319111170 tweeted]:<br />
<br />
<pre>Please accept our apologies if you recently received a direct tweet. The intruder has been suppressed and our systems have been updated.</pre><br />
<br />
This could mean that no more tweets will be sent out, and that the updates will appear directly on the _FILEDATA in roughly a week time.<br />
<br />
= Bradwell Returns =<br />
<br />
At 15:00 UTC on 2018-08-29, the [https://twitter.com/bossastudios Bossa Studios] Twitter account posted a [https://twitter.com/bossastudios/status/1034802858221174785 tweet] which said:<br />
<pre><br />
PLEASE HELP!! I’m a technician at Bradwell Electronics and have made some important discoveries which need to be brought to light! I’ve managed to hack into the company’s social accounts, but think I’m being watched… Gotta go, but I’ll be back shortly!<br />
</pre><br />
<br />
This tweet was followed by three more tweets at two hour intervals, which can be seen below:<br />
<br />
* https://twitter.com/bossastudios/status/1034833061047877632<br />
<br />
<pre><br />
You’ve been led to believe that Bradwell Electronics is a kind and altruistic organisation. It’s not! There are thousands of incriminating files but I can’t access the drives internally, as my cover could be compromised. Hold on, I’m gonna try something...<br />
</pre><br />
<br />
* https://twitter.com/bossastudios/status/1034863254672224257<br />
<br />
<pre><br />
Phew, that was a close one. A security guard just walked past, so I had to abandon the attempt. One false move and it’s game over. People are counting on me for this information all around the world, and they don’t even know it! About to try again...<br />
</pre><br />
<br />
* https://twitter.com/bossastudios/status/1034893454533382144<br />
<br />
<pre><br />
Ok, so that didn’t work. I tried accessing the docs by bouncing my connection off an external node but no use. I’m going to have to access a senior staff member’s computer, but how? Wish me luck - we’re all going to need it.<br />
</pre><br />
<br />
* https://twitter.com/bossastudios/status/1034923656592465920<br />
<br />
<pre><br />
Good news - I’m on my way to one of the technician’s offices! I “accidentally” spilt coffee on them at lunch and managed to swipe their key card in the confusion. They’ve popped to the toilets to change but won’t be long. Now might be my only chance!<br />
</pre><br />
<br />
(''This list will be updated as new Tweets are posted.'')<br />
<br />
This signaled to players that the ARG may be starting up again. This led players back to the [https://www.bradwellelectronics.com/ Bradwell Electronics website]. Players who signed up for the newsletter again received a new email, which can be seen [https://pastebin.com/UAnarEMH here], and appeared to be an uncorrupted version of the email received previously in the ARG. In addition, the metadata of the new email contained the full text of the old, corrupted email.</div>Halke234https://wiki.gamedetectives.net/index.php?title=Bradwell_Electronics&diff=17227Bradwell Electronics2018-08-29T22:00:13Z<p>Halke234: /* Bradwell Returns */</p>
<hr />
<div>{{WIP}}<br />
<br />
{{argbox<br />
| float = right<br />
| name = Bradwell Electronics<br />
| image = File:Bradwell Logo.png<br />
| description= Better. Brighter. For everyone.<br />
| creator = [http://www.bossastudios.com/ Bossa Studios]<br />
| type = Investigation<br />
| status = Active<br />
| discovered = 2016-03-05<br />
}}<br />
{{ArgHeader}}<br />
{{backToTop}}<br />
<br />
<br />
[https://www.bradwellelectronics.com/ Bradwell Electronics] is a promotional website released by [http://www.bossastudios.com/ Bossa Studios], a British game developer responsible for Surgeon Simulator and I Am Bread. At this time, the purpose of the site is unknown, but it is speculated to be an in-fiction promotional website for Bossa Studios' next game.<br />
<br />
__TOC__<br />
<br />
== Email Newsletter ==<br />
<br />
''Most of the content in this section is a rehash of [https://www.reddit.com/r/gamedetectives/comments/5x113k/bradwell_electronics_bossa_studios/ this Reddit post] by [https://www.reddit.com/u/blackbat24 /u/blackbat24]; all credit goes to him.''<br />
<br />
A field on the [https://www.bradwellelectronics.com/ Bradwell Electronics site] was found which allowed usrs to sign up for an e-mail newsletter. A few minutes after signing up, the following message is sent to your email:<br />
<br />
Welcome to Bradwell Electronics - Better. Brighter. For Everyone.<br />
Thank you for registering your interest for the upcoming relaunch of the Bradwell Electronics website.<br />
When John Bradwell founded Bradwell Electronics over 62 years ago in 1964, he never imagined that the family business would become one of the most recognized brands worldwi$"%"$"!£2/.&%...<br />
<br />
From this point onwards, the message is "corrupted", and is mostly comprised of Base64 ciphertext. For the full text of the email, check [https://www.reddit.com/r/gamedetectives/comments/5x113k/bradwell_electronics_bossa_studios/ this Reddit post]. At one point, the message becomes legible again:<br />
<br />
>>INTERRUPT STREAM <br />
----------This is a mayday alert.<br />
--------------------It is of concern to all of us.<br />
------------------------------We ask you to trust us.<br />
----------------------------------------We cannot do this alone.<br />
<< END OF INTERRUPT<br />
<br />
Encoding the Base64 in the text of the email yields an image which includes a QR code:<br />
<br />
[[File:Bradwell qr.gif|The image revealed when encoding the Base64 in the text of the "corrupted" email]]<br />
<br />
''(Note: Amesbury is the location of Stonehenge.)''<br />
<br />
Reading the QR code reveals the following string:<br />
<br />
<code>/?decrypt50726f6a65637441</code><br />
<br />
''(Note: <code>50726f6a65637441</code> is hexadecimal for <code>ProjectA</code>, but this is not yet relevant to the investigation.)''<br />
<br />
=== Countdown Timer ===<br />
<br />
[[File:Bradwell countdown.png|thumbnail|right|The countdown displayed when using the <code>/?decrypt50726f6a65637441</code> URL extension]]<br />
<br />
Appending <code>/?decrypt50726f6a65637441</code> to the <code>http://bradwellelectronics.com</code> URL reveals a red box ([http://bradwellelectronics.com/?decrypt50726f6a65637441 link]), containing this text:<br />
<br />
\\>DECR_BRUTE_FORCE << |'fetch grid:[0x424cb726:0xbfe9c31a]/OENQJRYYVHZERCBEG.DAT'<br />
-->BRUTEFORCE NODES RUNNING...<br />
-->ESTIMATED BRUTEFORCE DECRYPTION COMPLETED IN: _d __h __m __s<br />
<br />
The first line of the text contains the string <code>OENQJRYYVHZERCBEG</code>; this can be deciphered using ROT13 to obtain <code>BRADWELLIUMREPORT</code>. The significance of this is currently unknown.<br />
<br />
Additionally, the final line of text in the red box is a countdown timer, which is counting down to 12:00 PM UTC, on March 8, 2017.<br />
<br />
== /__FILEDATA.ARCHIVE ==<br />
<br />
On March 8, 2017, the text on the login page of "Decryptkit" changed:<br />
<pre><br />
<br />
##DECRYPTIONKIT#############<br />
## GRID MINI VM V0.11[ADDRESS REMOVED]##<br />
##################################<br />
<br />
\\>DECR_BRUTE_FORCE << |'fetch grid:[0x424cb726:0xbfe9c31a]/OENQJRYYVHZERCBEG.DAT'<br />
-->BRUTEFORCE NODES STOPPED.<br />
-->BRUTEFORCE DECRYPTION COMPLETED: <br />
----> ARCHIVE DETECTED (OENQJRYYVHZERCBEG.ARCHIVE)<br />
----> DECOMPRESSING ARCHIVE... COMPLETED WITH ERRORS:<br />
-------> TOTAL FILES: 10, RECOVERED: 2<br />
----> WRAPPING RECOVERED FILES FOR ACCESS: COMPLETED<br />
----> RECOVERED FILES AVAILABE FOR DOWNLOAD: /__FILEDATA.ARCHIVE/<br />
-------> ENTER SECONDARY KEY TO DECRYPT REMAINING FILES: <br />
</pre><br />
<br />
This leads to [https://www.bradwellelectronics.com/__FILEDATA.ARCHIVE/ archive page], which contains a [https://www.bradwellelectronics.com/__FILEDATA.ARCHIVE/Bradwell-Press-Release-07022019.pdf press release] about Bradwell's involvement in the restoration of Stonehenge in 2019, while [https://www.bradwellelectronics.com/__FILEDATA.ARCHIVE/BradwellInternalMemo-060702019.zip the other file] is a passworded zip. In addition, in order to access other parts of the site, a decryption key is needed to be added in the [https://www.bradwellelectronics.com/wp-content/cache/autoptimize/js/autoptimize_5fb1719442f5f2a9ea5584295800051c.js code] of the website.<br />
<br />
Within the js of the website, [http://pastebin.com/Bsr0FWUW large blocks of hex] was found in the code which, when translated, included the decrypted data that was supposed to show only after the insertion of the decryption key. Just a few minutes later the decryption key (<code>together</code>) was found in the same translated js blob. With the [[#2nd_Key|2nd key]] in hand, users unlocked the subsequent data and followed the instructions, but this still left the zip file encrypted and its content sealed.<br />
<br />
[[File:bw1_bookcipher.png|thumbnail|right|The book cipher hidden in the footer of the press release.]] Later that day, a series of numbers in the footer of the [https://www.bradwellelectronics.com/__FILEDATA.ARCHIVE/Bradwell-Press-Release-07022019.pdf press release] was found, which looked like a book cipher. It decoded as <code>w3trusTu</code>, a keyword that unlocked the content of the encrypted zip file. The [https://www.bradwellelectronics.com/__FILEDATA.ARCHIVE/BradwellInternalMemo-060702019.zip internal memo] contains the planned repairs to the A303 tunnel and the Stonehenge museum, but just like the press release it also stored a hidden message, <code>together</code>, the [[#2nd_Key|2nd key]] needed for the advancement. It was later spotted inside the middle diamond, at the end of the footer, in a very small size font, black on black background.<br />
<br />
[[File:bw1_together.png|thumbnail|center|The second key, highlighted, hidden in the footer of the 060702019 internal memo.]]<br />
<br />
== 2nd Key ==<br />
<br />
The 2nd key, <code>together</code>, found initially through reverse engineering, when entered into the field produced this output:<br />
<br />
<pre><br />
##DECRYPTIONKIT#############<br />
## GRID MINI VM V0.11[ADDRESS REMOVED]##<br />
##################################<br />
<br />
\\>DECR_BRUTE_FORCE << |'fetch grid:[0x424cb726:0xbfe9c31a]/OENQJRYYVHZERCBEG.DAT'<br />
-->BRUTEFORCE NODES STOPPED.<br />
-->BRUTEFORCE DECRYPTION COMPLETED: <br />
----> ARCHIVE DETECTED (OENQJRYYVHZERCBEG.ARCHIVE)<br />
----> DECOMPRESSING ARCHIVE... COMPLETED WITH ERRORS:<br />
-------> TOTAL FILES: 10, RECOVERED: 2<br />
----> WRAPPING RECOVERED FILES FOR ACCESS: COMPLETED<br />
----> RECOVERED FILES AVAILABE FOR DOWNLOAD: /__FILEDATA.ARCHIVE/<br />
-------> ENTER SECONDARY KEY TO DECRYPT REMAINING FILES: ACCEPTED<br />
-->SUBMITTING SECONDARY ENCRYPTION JOB TO GRID SYSTEM: [#####]<br />
---->DECRYPTION TIME CANNOT BE DETERMINED.<br />
---->NOTIFICATION ON JOB COMPLETITION AVAILABLE USING SOCIAL MEDIA NETWORKS TO PROTECT ANONYMITY<br />
------>USE _LINK_ TO POST A TWEET INCLUDING SPECIAL CODE 'BETTERBE2026'<br />
------>DECRYPTION SYSTEM WILL GET IN TOUCH ONCE JOB HAS BEEN COMPLETED<br />
</pre><br />
<br />
[https://twitter.com/intent/tweet?text=Fresh%20air%20is%20good%20for%20you.%20BETTERBE2026 The link] is a tweet template which says <code>Fresh air is good for you. BETTERBE2026</code>.<br />
After several hours the message was modified, now reading:<br />
<br />
<pre><br />
-->SUBMITTING SECONDARY ENCRYPTION JOB TO GRID SYSTEM: [#####]<br />
---->DECRYPTION TIME CANNOT BE DETERMINED.<br />
---->USURPING SOCIAL MEDIA BANDWIDTH TO DECREASE DATA DECRYPTION TIME<br />
------>_REGISTER_ NODE WITH SYSTEM TO RECEIVE DECRYPTED PACKAGE<br />
------>DECRYPTED PACKAGE WILL BE DISTRIBUTED TO REGISTERED NODES ON COMPLETION<br />
</pre><br />
<br />
The [https://twitter.com/intent/tweet?text=%40BetterBradwell%20%23BETTERBE2026 REGISTER link] is a different tweet template, now reading <code>@BetterBradwell #BETTERBE2026</code>. It is yet unclear whether the alteration is a different step, or if it has simply being reworded (now reading <code>USURPING SOCIAL MEDIA BANDWIDTH TO DECREASE DATA DECRYPTION TIME</code>) to better instruct the players to tweet the message more.<br />
<br />
On March 16, around 15:40 UTC (3:40 pm), users starting receiving mentions.<br />
<br />
<pre>@username SEC TRIED TO SLOW US. DECRYPTION PRGRSS.<br />
[######----] 63%. STANDBY</pre><br />
<br />
3 minutes later, [https://twitter.com/BetterBradwell/ Bradwell Electronics] [https://twitter.com/BetterBradwell/status/842401632319111170 tweeted]:<br />
<br />
<pre>Please accept our apologies if you recently received a direct tweet. The intruder has been suppressed and our systems have been updated.</pre><br />
<br />
This could mean that no more tweets will be sent out, and that the updates will appear directly on the _FILEDATA in roughly a week time.<br />
<br />
= Bradwell Returns =<br />
<br />
At 15:00 UTC on 2018-08-29, the [https://twitter.com/bossastudios Bossa Studios] Twitter account posted a [https://twitter.com/bossastudios/status/1034802858221174785 tweet] which said:<br />
<pre><br />
PLEASE HELP!! I’m a technician at Bradwell Electronics and have made some important discoveries which need to be brought to light! I’ve managed to hack into the company’s social accounts, but think I’m being watched… Gotta go, but I’ll be back shortly!<br />
</pre><br />
<br />
This tweet was followed by three more tweets at two hour intervals, which can be seen below:<br />
<br />
* https://twitter.com/bossastudios/status/1034833061047877632<br />
<br />
<pre><br />
You’ve been led to believe that Bradwell Electronics is a kind and altruistic organisation. It’s not! There are thousands of incriminating files but I can’t access the drives internally, as my cover could be compromised. Hold on, I’m gonna try something...<br />
</pre><br />
<br />
* https://twitter.com/bossastudios/status/1034863254672224257<br />
<br />
<pre><br />
Phew, that was a close one. A security guard just walked past, so I had to abandon the attempt. One false move and it’s game over. People are counting on me for this information all around the world, and they don’t even know it! About to try again...<br />
</pre><br />
<br />
* https://twitter.com/bossastudios/status/1034893454533382144<br />
<br />
<pre><br />
Ok, so that didn’t work. I tried accessing the docs by bouncing my connection off an external node but no use. I’m going to have to access a senior staff member’s computer, but how? Wish me luck - we’re all going to need it.<br />
</pre><br />
(''This list will be updated as new Tweets are posted.'')<br />
<br />
This signaled to players that the ARG may be starting up again. This led players back to the [https://www.bradwellelectronics.com/ Bradwell Electronics website]. Players who signed up for the newsletter again received a new email, which can be seen [https://pastebin.com/UAnarEMH here], and appeared to be an uncorrupted version of the email received previously in the ARG. In addition, the metadata of the new email contained the full text of the old, corrupted email.</div>Halke234https://wiki.gamedetectives.net/index.php?title=Bradwell_Electronics&diff=17226Bradwell Electronics2018-08-29T21:58:37Z<p>Halke234: Added the texts of the new tweets.</p>
<hr />
<div>{{WIP}}<br />
<br />
{{argbox<br />
| float = right<br />
| name = Bradwell Electronics<br />
| image = File:Bradwell Logo.png<br />
| description= Better. Brighter. For everyone.<br />
| creator = [http://www.bossastudios.com/ Bossa Studios]<br />
| type = Investigation<br />
| status = Active<br />
| discovered = 2016-03-05<br />
}}<br />
{{ArgHeader}}<br />
{{backToTop}}<br />
<br />
<br />
[https://www.bradwellelectronics.com/ Bradwell Electronics] is a promotional website released by [http://www.bossastudios.com/ Bossa Studios], a British game developer responsible for Surgeon Simulator and I Am Bread. At this time, the purpose of the site is unknown, but it is speculated to be an in-fiction promotional website for Bossa Studios' next game.<br />
<br />
__TOC__<br />
<br />
== Email Newsletter ==<br />
<br />
''Most of the content in this section is a rehash of [https://www.reddit.com/r/gamedetectives/comments/5x113k/bradwell_electronics_bossa_studios/ this Reddit post] by [https://www.reddit.com/u/blackbat24 /u/blackbat24]; all credit goes to him.''<br />
<br />
A field on the [https://www.bradwellelectronics.com/ Bradwell Electronics site] was found which allowed usrs to sign up for an e-mail newsletter. A few minutes after signing up, the following message is sent to your email:<br />
<br />
Welcome to Bradwell Electronics - Better. Brighter. For Everyone.<br />
Thank you for registering your interest for the upcoming relaunch of the Bradwell Electronics website.<br />
When John Bradwell founded Bradwell Electronics over 62 years ago in 1964, he never imagined that the family business would become one of the most recognized brands worldwi$"%"$"!£2/.&%...<br />
<br />
From this point onwards, the message is "corrupted", and is mostly comprised of Base64 ciphertext. For the full text of the email, check [https://www.reddit.com/r/gamedetectives/comments/5x113k/bradwell_electronics_bossa_studios/ this Reddit post]. At one point, the message becomes legible again:<br />
<br />
>>INTERRUPT STREAM <br />
----------This is a mayday alert.<br />
--------------------It is of concern to all of us.<br />
------------------------------We ask you to trust us.<br />
----------------------------------------We cannot do this alone.<br />
<< END OF INTERRUPT<br />
<br />
Encoding the Base64 in the text of the email yields an image which includes a QR code:<br />
<br />
[[File:Bradwell qr.gif|The image revealed when encoding the Base64 in the text of the "corrupted" email]]<br />
<br />
''(Note: Amesbury is the location of Stonehenge.)''<br />
<br />
Reading the QR code reveals the following string:<br />
<br />
<code>/?decrypt50726f6a65637441</code><br />
<br />
''(Note: <code>50726f6a65637441</code> is hexadecimal for <code>ProjectA</code>, but this is not yet relevant to the investigation.)''<br />
<br />
=== Countdown Timer ===<br />
<br />
[[File:Bradwell countdown.png|thumbnail|right|The countdown displayed when using the <code>/?decrypt50726f6a65637441</code> URL extension]]<br />
<br />
Appending <code>/?decrypt50726f6a65637441</code> to the <code>http://bradwellelectronics.com</code> URL reveals a red box ([http://bradwellelectronics.com/?decrypt50726f6a65637441 link]), containing this text:<br />
<br />
\\>DECR_BRUTE_FORCE << |'fetch grid:[0x424cb726:0xbfe9c31a]/OENQJRYYVHZERCBEG.DAT'<br />
-->BRUTEFORCE NODES RUNNING...<br />
-->ESTIMATED BRUTEFORCE DECRYPTION COMPLETED IN: _d __h __m __s<br />
<br />
The first line of the text contains the string <code>OENQJRYYVHZERCBEG</code>; this can be deciphered using ROT13 to obtain <code>BRADWELLIUMREPORT</code>. The significance of this is currently unknown.<br />
<br />
Additionally, the final line of text in the red box is a countdown timer, which is counting down to 12:00 PM UTC, on March 8, 2017.<br />
<br />
== /__FILEDATA.ARCHIVE ==<br />
<br />
On March 8, 2017, the text on the login page of "Decryptkit" changed:<br />
<pre><br />
<br />
##DECRYPTIONKIT#############<br />
## GRID MINI VM V0.11[ADDRESS REMOVED]##<br />
##################################<br />
<br />
\\>DECR_BRUTE_FORCE << |'fetch grid:[0x424cb726:0xbfe9c31a]/OENQJRYYVHZERCBEG.DAT'<br />
-->BRUTEFORCE NODES STOPPED.<br />
-->BRUTEFORCE DECRYPTION COMPLETED: <br />
----> ARCHIVE DETECTED (OENQJRYYVHZERCBEG.ARCHIVE)<br />
----> DECOMPRESSING ARCHIVE... COMPLETED WITH ERRORS:<br />
-------> TOTAL FILES: 10, RECOVERED: 2<br />
----> WRAPPING RECOVERED FILES FOR ACCESS: COMPLETED<br />
----> RECOVERED FILES AVAILABE FOR DOWNLOAD: /__FILEDATA.ARCHIVE/<br />
-------> ENTER SECONDARY KEY TO DECRYPT REMAINING FILES: <br />
</pre><br />
<br />
This leads to [https://www.bradwellelectronics.com/__FILEDATA.ARCHIVE/ archive page], which contains a [https://www.bradwellelectronics.com/__FILEDATA.ARCHIVE/Bradwell-Press-Release-07022019.pdf press release] about Bradwell's involvement in the restoration of Stonehenge in 2019, while [https://www.bradwellelectronics.com/__FILEDATA.ARCHIVE/BradwellInternalMemo-060702019.zip the other file] is a passworded zip. In addition, in order to access other parts of the site, a decryption key is needed to be added in the [https://www.bradwellelectronics.com/wp-content/cache/autoptimize/js/autoptimize_5fb1719442f5f2a9ea5584295800051c.js code] of the website.<br />
<br />
Within the js of the website, [http://pastebin.com/Bsr0FWUW large blocks of hex] was found in the code which, when translated, included the decrypted data that was supposed to show only after the insertion of the decryption key. Just a few minutes later the decryption key (<code>together</code>) was found in the same translated js blob. With the [[#2nd_Key|2nd key]] in hand, users unlocked the subsequent data and followed the instructions, but this still left the zip file encrypted and its content sealed.<br />
<br />
[[File:bw1_bookcipher.png|thumbnail|right|The book cipher hidden in the footer of the press release.]] Later that day, a series of numbers in the footer of the [https://www.bradwellelectronics.com/__FILEDATA.ARCHIVE/Bradwell-Press-Release-07022019.pdf press release] was found, which looked like a book cipher. It decoded as <code>w3trusTu</code>, a keyword that unlocked the content of the encrypted zip file. The [https://www.bradwellelectronics.com/__FILEDATA.ARCHIVE/BradwellInternalMemo-060702019.zip internal memo] contains the planned repairs to the A303 tunnel and the Stonehenge museum, but just like the press release it also stored a hidden message, <code>together</code>, the [[#2nd_Key|2nd key]] needed for the advancement. It was later spotted inside the middle diamond, at the end of the footer, in a very small size font, black on black background.<br />
<br />
[[File:bw1_together.png|thumbnail|center|The second key, highlighted, hidden in the footer of the 060702019 internal memo.]]<br />
<br />
== 2nd Key ==<br />
<br />
The 2nd key, <code>together</code>, found initially through reverse engineering, when entered into the field produced this output:<br />
<br />
<pre><br />
##DECRYPTIONKIT#############<br />
## GRID MINI VM V0.11[ADDRESS REMOVED]##<br />
##################################<br />
<br />
\\>DECR_BRUTE_FORCE << |'fetch grid:[0x424cb726:0xbfe9c31a]/OENQJRYYVHZERCBEG.DAT'<br />
-->BRUTEFORCE NODES STOPPED.<br />
-->BRUTEFORCE DECRYPTION COMPLETED: <br />
----> ARCHIVE DETECTED (OENQJRYYVHZERCBEG.ARCHIVE)<br />
----> DECOMPRESSING ARCHIVE... COMPLETED WITH ERRORS:<br />
-------> TOTAL FILES: 10, RECOVERED: 2<br />
----> WRAPPING RECOVERED FILES FOR ACCESS: COMPLETED<br />
----> RECOVERED FILES AVAILABE FOR DOWNLOAD: /__FILEDATA.ARCHIVE/<br />
-------> ENTER SECONDARY KEY TO DECRYPT REMAINING FILES: ACCEPTED<br />
-->SUBMITTING SECONDARY ENCRYPTION JOB TO GRID SYSTEM: [#####]<br />
---->DECRYPTION TIME CANNOT BE DETERMINED.<br />
---->NOTIFICATION ON JOB COMPLETITION AVAILABLE USING SOCIAL MEDIA NETWORKS TO PROTECT ANONYMITY<br />
------>USE _LINK_ TO POST A TWEET INCLUDING SPECIAL CODE 'BETTERBE2026'<br />
------>DECRYPTION SYSTEM WILL GET IN TOUCH ONCE JOB HAS BEEN COMPLETED<br />
</pre><br />
<br />
[https://twitter.com/intent/tweet?text=Fresh%20air%20is%20good%20for%20you.%20BETTERBE2026 The link] is a tweet template which says <code>Fresh air is good for you. BETTERBE2026</code>.<br />
After several hours the message was modified, now reading:<br />
<br />
<pre><br />
-->SUBMITTING SECONDARY ENCRYPTION JOB TO GRID SYSTEM: [#####]<br />
---->DECRYPTION TIME CANNOT BE DETERMINED.<br />
---->USURPING SOCIAL MEDIA BANDWIDTH TO DECREASE DATA DECRYPTION TIME<br />
------>_REGISTER_ NODE WITH SYSTEM TO RECEIVE DECRYPTED PACKAGE<br />
------>DECRYPTED PACKAGE WILL BE DISTRIBUTED TO REGISTERED NODES ON COMPLETION<br />
</pre><br />
<br />
The [https://twitter.com/intent/tweet?text=%40BetterBradwell%20%23BETTERBE2026 REGISTER link] is a different tweet template, now reading <code>@BetterBradwell #BETTERBE2026</code>. It is yet unclear whether the alteration is a different step, or if it has simply being reworded (now reading <code>USURPING SOCIAL MEDIA BANDWIDTH TO DECREASE DATA DECRYPTION TIME</code>) to better instruct the players to tweet the message more.<br />
<br />
On March 16, around 15:40 UTC (3:40 pm), users starting receiving mentions.<br />
<br />
<pre>@username SEC TRIED TO SLOW US. DECRYPTION PRGRSS.<br />
[######----] 63%. STANDBY</pre><br />
<br />
3 minutes later, [https://twitter.com/BetterBradwell/ Bradwell Electronics] [https://twitter.com/BetterBradwell/status/842401632319111170 tweeted]:<br />
<br />
<pre>Please accept our apologies if you recently received a direct tweet. The intruder has been suppressed and our systems have been updated.</pre><br />
<br />
This could mean that no more tweets will be sent out, and that the updates will appear directly on the _FILEDATA in roughly a week time.<br />
<br />
= Bradwell Returns =<br />
<br />
At 15:00 UTC on 2018-08-29, the [https://twitter.com/bossastudios Bossa Studios] Twitter account posted a [https://twitter.com/bossastudios/status/1034802858221174785 tweet] which said:<br />
<pre><br />
PLEASE HELP!! I’m a technician at Bradwell Electronics and have made some important discoveries which need to be brought to light! I’ve managed to hack into the company’s social accounts, but think I’m being watched… Gotta go, but I’ll be back shortly!<br />
</pre><br />
<br />
This tweet was followed by three more tweets at two hour intervals, which can be seen below:<br />
<br />
* https://twitter.com/bossastudios/status/1034833061047877632<br />
<br />
<pre><br />
You’ve been led to believe that Bradwell Electronics is a kind and altruistic organisation. It’s not! There are thousands of incriminating files but I can’t access the drives internally, as my cover could be compromised. Hold on, I’m gonna try something...<br />
</pre><br />
<br />
* https://twitter.com/bossastudios/status/1034863254672224257<br />
<br />
<pre><br />
Phew, that was a close one. A security guard just walked past, so I had to abandon the attempt. One false move and it’s game over. People are counting on me for this information all around the world, and they don’t even know it! About to try again...<br />
</pre><br />
<br />
* https://twitter.com/bossastudios/status/1034893454533382144<br />
<br />
<pre><br />
Ok, so that didn’t work. I tried accessing the docs by bouncing my connection off an external node but no use. I’m going to have to access a senior staff member’s computer, but how? Wish me luck - we’re all going to need it.<br />
</pre><br />
(''This list will be updated as new Tweets are posted.'')<br />
<br />
This signaled to players that the ARG may be starting up again. This led players back to the [https://www.bradwellelectronics.com/ Bradwell Electronics website]. Players who signed up for the newsletter again received a new email, which can be seen [https://pastebin.com/UAnarEMH here], and appeared to be an uncorrupted version of the email received previously in the ARG.</div>Halke234https://wiki.gamedetectives.net/index.php?title=Bradwell_Electronics&diff=17224Bradwell Electronics2018-08-29T20:37:46Z<p>Halke234: /* Bradwell Returns */</p>
<hr />
<div>{{WIP}}<br />
<br />
{{argbox<br />
| float = right<br />
| name = Bradwell Electronics<br />
| image = File:Bradwell Logo.png<br />
| description= Better. Brighter. For everyone.<br />
| creator = [http://www.bossastudios.com/ Bossa Studios]<br />
| type = Investigation<br />
| status = Active<br />
| discovered = 2016-03-05<br />
}}<br />
{{ArgHeader}}<br />
{{backToTop}}<br />
<br />
<br />
[https://www.bradwellelectronics.com/ Bradwell Electronics] is a promotional website released by [http://www.bossastudios.com/ Bossa Studios], a British game developer responsible for Surgeon Simulator and I Am Bread. At this time, the purpose of the site is unknown, but it is speculated to be an in-fiction promotional website for Bossa Studios' next game.<br />
<br />
__TOC__<br />
<br />
== Email Newsletter ==<br />
<br />
''Most of the content in this section is a rehash of [https://www.reddit.com/r/gamedetectives/comments/5x113k/bradwell_electronics_bossa_studios/ this Reddit post] by [https://www.reddit.com/u/blackbat24 /u/blackbat24]; all credit goes to him.''<br />
<br />
A field on the [https://www.bradwellelectronics.com/ Bradwell Electronics site] was found which allowed usrs to sign up for an e-mail newsletter. A few minutes after signing up, the following message is sent to your email:<br />
<br />
Welcome to Bradwell Electronics - Better. Brighter. For Everyone.<br />
Thank you for registering your interest for the upcoming relaunch of the Bradwell Electronics website.<br />
When John Bradwell founded Bradwell Electronics over 62 years ago in 1964, he never imagined that the family business would become one of the most recognized brands worldwi$"%"$"!£2/.&%...<br />
<br />
From this point onwards, the message is "corrupted", and is mostly comprised of Base64 ciphertext. For the full text of the email, check [https://www.reddit.com/r/gamedetectives/comments/5x113k/bradwell_electronics_bossa_studios/ this Reddit post]. At one point, the message becomes legible again:<br />
<br />
>>INTERRUPT STREAM <br />
----------This is a mayday alert.<br />
--------------------It is of concern to all of us.<br />
------------------------------We ask you to trust us.<br />
----------------------------------------We cannot do this alone.<br />
<< END OF INTERRUPT<br />
<br />
Encoding the Base64 in the text of the email yields an image which includes a QR code:<br />
<br />
[[File:Bradwell qr.gif|The image revealed when encoding the Base64 in the text of the "corrupted" email]]<br />
<br />
''(Note: Amesbury is the location of Stonehenge.)''<br />
<br />
Reading the QR code reveals the following string:<br />
<br />
<code>/?decrypt50726f6a65637441</code><br />
<br />
''(Note: <code>50726f6a65637441</code> is hexadecimal for <code>ProjectA</code>, but this is not yet relevant to the investigation.)''<br />
<br />
=== Countdown Timer ===<br />
<br />
[[File:Bradwell countdown.png|thumbnail|right|The countdown displayed when using the <code>/?decrypt50726f6a65637441</code> URL extension]]<br />
<br />
Appending <code>/?decrypt50726f6a65637441</code> to the <code>http://bradwellelectronics.com</code> URL reveals a red box ([http://bradwellelectronics.com/?decrypt50726f6a65637441 link]), containing this text:<br />
<br />
\\>DECR_BRUTE_FORCE << |'fetch grid:[0x424cb726:0xbfe9c31a]/OENQJRYYVHZERCBEG.DAT'<br />
-->BRUTEFORCE NODES RUNNING...<br />
-->ESTIMATED BRUTEFORCE DECRYPTION COMPLETED IN: _d __h __m __s<br />
<br />
The first line of the text contains the string <code>OENQJRYYVHZERCBEG</code>; this can be deciphered using ROT13 to obtain <code>BRADWELLIUMREPORT</code>. The significance of this is currently unknown.<br />
<br />
Additionally, the final line of text in the red box is a countdown timer, which is counting down to 12:00 PM UTC, on March 8, 2017.<br />
<br />
== /__FILEDATA.ARCHIVE ==<br />
<br />
On March 8, 2017, the text on the login page of "Decryptkit" changed:<br />
<pre><br />
<br />
##DECRYPTIONKIT#############<br />
## GRID MINI VM V0.11[ADDRESS REMOVED]##<br />
##################################<br />
<br />
\\>DECR_BRUTE_FORCE << |'fetch grid:[0x424cb726:0xbfe9c31a]/OENQJRYYVHZERCBEG.DAT'<br />
-->BRUTEFORCE NODES STOPPED.<br />
-->BRUTEFORCE DECRYPTION COMPLETED: <br />
----> ARCHIVE DETECTED (OENQJRYYVHZERCBEG.ARCHIVE)<br />
----> DECOMPRESSING ARCHIVE... COMPLETED WITH ERRORS:<br />
-------> TOTAL FILES: 10, RECOVERED: 2<br />
----> WRAPPING RECOVERED FILES FOR ACCESS: COMPLETED<br />
----> RECOVERED FILES AVAILABE FOR DOWNLOAD: /__FILEDATA.ARCHIVE/<br />
-------> ENTER SECONDARY KEY TO DECRYPT REMAINING FILES: <br />
</pre><br />
<br />
This leads to [https://www.bradwellelectronics.com/__FILEDATA.ARCHIVE/ archive page], which contains a [https://www.bradwellelectronics.com/__FILEDATA.ARCHIVE/Bradwell-Press-Release-07022019.pdf press release] about Bradwell's involvement in the restoration of Stonehenge in 2019, while [https://www.bradwellelectronics.com/__FILEDATA.ARCHIVE/BradwellInternalMemo-060702019.zip the other file] is a passworded zip. In addition, in order to access other parts of the site, a decryption key is needed to be added in the [https://www.bradwellelectronics.com/wp-content/cache/autoptimize/js/autoptimize_5fb1719442f5f2a9ea5584295800051c.js code] of the website.<br />
<br />
Within the js of the website, [http://pastebin.com/Bsr0FWUW large blocks of hex] was found in the code which, when translated, included the decrypted data that was supposed to show only after the insertion of the decryption key. Just a few minutes later the decryption key (<code>together</code>) was found in the same translated js blob. With the [[#2nd_Key|2nd key]] in hand, users unlocked the subsequent data and followed the instructions, but this still left the zip file encrypted and its content sealed.<br />
<br />
[[File:bw1_bookcipher.png|thumbnail|right|The book cipher hidden in the footer of the press release.]] Later that day, a series of numbers in the footer of the [https://www.bradwellelectronics.com/__FILEDATA.ARCHIVE/Bradwell-Press-Release-07022019.pdf press release] was found, which looked like a book cipher. It decoded as <code>w3trusTu</code>, a keyword that unlocked the content of the encrypted zip file. The [https://www.bradwellelectronics.com/__FILEDATA.ARCHIVE/BradwellInternalMemo-060702019.zip internal memo] contains the planned repairs to the A303 tunnel and the Stonehenge museum, but just like the press release it also stored a hidden message, <code>together</code>, the [[#2nd_Key|2nd key]] needed for the advancement. It was later spotted inside the middle diamond, at the end of the footer, in a very small size font, black on black background.<br />
<br />
[[File:bw1_together.png|thumbnail|center|The second key, highlighted, hidden in the footer of the 060702019 internal memo.]]<br />
<br />
== 2nd Key ==<br />
<br />
The 2nd key, <code>together</code>, found initially through reverse engineering, when entered into the field produced this output:<br />
<br />
<pre><br />
##DECRYPTIONKIT#############<br />
## GRID MINI VM V0.11[ADDRESS REMOVED]##<br />
##################################<br />
<br />
\\>DECR_BRUTE_FORCE << |'fetch grid:[0x424cb726:0xbfe9c31a]/OENQJRYYVHZERCBEG.DAT'<br />
-->BRUTEFORCE NODES STOPPED.<br />
-->BRUTEFORCE DECRYPTION COMPLETED: <br />
----> ARCHIVE DETECTED (OENQJRYYVHZERCBEG.ARCHIVE)<br />
----> DECOMPRESSING ARCHIVE... COMPLETED WITH ERRORS:<br />
-------> TOTAL FILES: 10, RECOVERED: 2<br />
----> WRAPPING RECOVERED FILES FOR ACCESS: COMPLETED<br />
----> RECOVERED FILES AVAILABE FOR DOWNLOAD: /__FILEDATA.ARCHIVE/<br />
-------> ENTER SECONDARY KEY TO DECRYPT REMAINING FILES: ACCEPTED<br />
-->SUBMITTING SECONDARY ENCRYPTION JOB TO GRID SYSTEM: [#####]<br />
---->DECRYPTION TIME CANNOT BE DETERMINED.<br />
---->NOTIFICATION ON JOB COMPLETITION AVAILABLE USING SOCIAL MEDIA NETWORKS TO PROTECT ANONYMITY<br />
------>USE _LINK_ TO POST A TWEET INCLUDING SPECIAL CODE 'BETTERBE2026'<br />
------>DECRYPTION SYSTEM WILL GET IN TOUCH ONCE JOB HAS BEEN COMPLETED<br />
</pre><br />
<br />
[https://twitter.com/intent/tweet?text=Fresh%20air%20is%20good%20for%20you.%20BETTERBE2026 The link] is a tweet template which says <code>Fresh air is good for you. BETTERBE2026</code>.<br />
After several hours the message was modified, now reading:<br />
<br />
<pre><br />
-->SUBMITTING SECONDARY ENCRYPTION JOB TO GRID SYSTEM: [#####]<br />
---->DECRYPTION TIME CANNOT BE DETERMINED.<br />
---->USURPING SOCIAL MEDIA BANDWIDTH TO DECREASE DATA DECRYPTION TIME<br />
------>_REGISTER_ NODE WITH SYSTEM TO RECEIVE DECRYPTED PACKAGE<br />
------>DECRYPTED PACKAGE WILL BE DISTRIBUTED TO REGISTERED NODES ON COMPLETION<br />
</pre><br />
<br />
The [https://twitter.com/intent/tweet?text=%40BetterBradwell%20%23BETTERBE2026 REGISTER link] is a different tweet template, now reading <code>@BetterBradwell #BETTERBE2026</code>. It is yet unclear whether the alteration is a different step, or if it has simply being reworded (now reading <code>USURPING SOCIAL MEDIA BANDWIDTH TO DECREASE DATA DECRYPTION TIME</code>) to better instruct the players to tweet the message more.<br />
<br />
On March 16, around 15:40 UTC (3:40 pm), users starting receiving mentions.<br />
<br />
<pre>@username SEC TRIED TO SLOW US. DECRYPTION PRGRSS.<br />
[######----] 63%. STANDBY</pre><br />
<br />
3 minutes later, [https://twitter.com/BetterBradwell/ Bradwell Electronics] [https://twitter.com/BetterBradwell/status/842401632319111170 tweeted]:<br />
<br />
<pre>Please accept our apologies if you recently received a direct tweet. The intruder has been suppressed and our systems have been updated.</pre><br />
<br />
This could mean that no more tweets will be sent out, and that the updates will appear directly on the _FILEDATA in roughly a week time.<br />
<br />
= Bradwell Returns =<br />
<br />
At 15:00 UTC on 2018-08-29, the [https://twitter.com/bossastudios Bossa Studios] Twitter account posted a [https://twitter.com/bossastudios/status/1034802858221174785 tweet] which said:<br />
<pre><br />
PLEASE HELP!! I’m a technician at Bradwell Electronics and have made some important discoveries which need to be brought to light! I’ve managed to hack into the company’s social accounts, but think I’m being watched… Gotta go, but I’ll be back shortly!<br />
</pre><br />
<br />
This tweet was followed by three more tweets at two hour intervals, which can be seen below:<br />
<br />
* https://twitter.com/bossastudios/status/1034833061047877632<br />
* https://twitter.com/bossastudios/status/1034863254672224257<br />
* https://twitter.com/bossastudios/status/1034893454533382144<br />
(''This list will be updated as new Tweets are posted.'')<br />
<br />
This signaled to players that the ARG may be starting up again. This led players back to the [https://www.bradwellelectronics.com/ Bradwell Electronics website]. Players who signed up for the newsletter again received a new email, which can be seen [https://pastebin.com/UAnarEMH here], and appeared to be an uncorrupted version of the email received previously in the ARG.<br />
<br />
<br />
<br />
{{WIP}}</div>Halke234https://wiki.gamedetectives.net/index.php?title=Bradwell_Electronics&diff=17223Bradwell Electronics2018-08-29T20:37:04Z<p>Halke234: /* Bradwell Returns */</p>
<hr />
<div>{{WIP}}<br />
<br />
{{argbox<br />
| float = right<br />
| name = Bradwell Electronics<br />
| image = File:Bradwell Logo.png<br />
| description= Better. Brighter. For everyone.<br />
| creator = [http://www.bossastudios.com/ Bossa Studios]<br />
| type = Investigation<br />
| status = Active<br />
| discovered = 2016-03-05<br />
}}<br />
{{ArgHeader}}<br />
{{backToTop}}<br />
<br />
<br />
[https://www.bradwellelectronics.com/ Bradwell Electronics] is a promotional website released by [http://www.bossastudios.com/ Bossa Studios], a British game developer responsible for Surgeon Simulator and I Am Bread. At this time, the purpose of the site is unknown, but it is speculated to be an in-fiction promotional website for Bossa Studios' next game.<br />
<br />
__TOC__<br />
<br />
== Email Newsletter ==<br />
<br />
''Most of the content in this section is a rehash of [https://www.reddit.com/r/gamedetectives/comments/5x113k/bradwell_electronics_bossa_studios/ this Reddit post] by [https://www.reddit.com/u/blackbat24 /u/blackbat24]; all credit goes to him.''<br />
<br />
A field on the [https://www.bradwellelectronics.com/ Bradwell Electronics site] was found which allowed usrs to sign up for an e-mail newsletter. A few minutes after signing up, the following message is sent to your email:<br />
<br />
Welcome to Bradwell Electronics - Better. Brighter. For Everyone.<br />
Thank you for registering your interest for the upcoming relaunch of the Bradwell Electronics website.<br />
When John Bradwell founded Bradwell Electronics over 62 years ago in 1964, he never imagined that the family business would become one of the most recognized brands worldwi$"%"$"!£2/.&%...<br />
<br />
From this point onwards, the message is "corrupted", and is mostly comprised of Base64 ciphertext. For the full text of the email, check [https://www.reddit.com/r/gamedetectives/comments/5x113k/bradwell_electronics_bossa_studios/ this Reddit post]. At one point, the message becomes legible again:<br />
<br />
>>INTERRUPT STREAM <br />
----------This is a mayday alert.<br />
--------------------It is of concern to all of us.<br />
------------------------------We ask you to trust us.<br />
----------------------------------------We cannot do this alone.<br />
<< END OF INTERRUPT<br />
<br />
Encoding the Base64 in the text of the email yields an image which includes a QR code:<br />
<br />
[[File:Bradwell qr.gif|The image revealed when encoding the Base64 in the text of the "corrupted" email]]<br />
<br />
''(Note: Amesbury is the location of Stonehenge.)''<br />
<br />
Reading the QR code reveals the following string:<br />
<br />
<code>/?decrypt50726f6a65637441</code><br />
<br />
''(Note: <code>50726f6a65637441</code> is hexadecimal for <code>ProjectA</code>, but this is not yet relevant to the investigation.)''<br />
<br />
=== Countdown Timer ===<br />
<br />
[[File:Bradwell countdown.png|thumbnail|right|The countdown displayed when using the <code>/?decrypt50726f6a65637441</code> URL extension]]<br />
<br />
Appending <code>/?decrypt50726f6a65637441</code> to the <code>http://bradwellelectronics.com</code> URL reveals a red box ([http://bradwellelectronics.com/?decrypt50726f6a65637441 link]), containing this text:<br />
<br />
\\>DECR_BRUTE_FORCE << |'fetch grid:[0x424cb726:0xbfe9c31a]/OENQJRYYVHZERCBEG.DAT'<br />
-->BRUTEFORCE NODES RUNNING...<br />
-->ESTIMATED BRUTEFORCE DECRYPTION COMPLETED IN: _d __h __m __s<br />
<br />
The first line of the text contains the string <code>OENQJRYYVHZERCBEG</code>; this can be deciphered using ROT13 to obtain <code>BRADWELLIUMREPORT</code>. The significance of this is currently unknown.<br />
<br />
Additionally, the final line of text in the red box is a countdown timer, which is counting down to 12:00 PM UTC, on March 8, 2017.<br />
<br />
== /__FILEDATA.ARCHIVE ==<br />
<br />
On March 8, 2017, the text on the login page of "Decryptkit" changed:<br />
<pre><br />
<br />
##DECRYPTIONKIT#############<br />
## GRID MINI VM V0.11[ADDRESS REMOVED]##<br />
##################################<br />
<br />
\\>DECR_BRUTE_FORCE << |'fetch grid:[0x424cb726:0xbfe9c31a]/OENQJRYYVHZERCBEG.DAT'<br />
-->BRUTEFORCE NODES STOPPED.<br />
-->BRUTEFORCE DECRYPTION COMPLETED: <br />
----> ARCHIVE DETECTED (OENQJRYYVHZERCBEG.ARCHIVE)<br />
----> DECOMPRESSING ARCHIVE... COMPLETED WITH ERRORS:<br />
-------> TOTAL FILES: 10, RECOVERED: 2<br />
----> WRAPPING RECOVERED FILES FOR ACCESS: COMPLETED<br />
----> RECOVERED FILES AVAILABE FOR DOWNLOAD: /__FILEDATA.ARCHIVE/<br />
-------> ENTER SECONDARY KEY TO DECRYPT REMAINING FILES: <br />
</pre><br />
<br />
This leads to [https://www.bradwellelectronics.com/__FILEDATA.ARCHIVE/ archive page], which contains a [https://www.bradwellelectronics.com/__FILEDATA.ARCHIVE/Bradwell-Press-Release-07022019.pdf press release] about Bradwell's involvement in the restoration of Stonehenge in 2019, while [https://www.bradwellelectronics.com/__FILEDATA.ARCHIVE/BradwellInternalMemo-060702019.zip the other file] is a passworded zip. In addition, in order to access other parts of the site, a decryption key is needed to be added in the [https://www.bradwellelectronics.com/wp-content/cache/autoptimize/js/autoptimize_5fb1719442f5f2a9ea5584295800051c.js code] of the website.<br />
<br />
Within the js of the website, [http://pastebin.com/Bsr0FWUW large blocks of hex] was found in the code which, when translated, included the decrypted data that was supposed to show only after the insertion of the decryption key. Just a few minutes later the decryption key (<code>together</code>) was found in the same translated js blob. With the [[#2nd_Key|2nd key]] in hand, users unlocked the subsequent data and followed the instructions, but this still left the zip file encrypted and its content sealed.<br />
<br />
[[File:bw1_bookcipher.png|thumbnail|right|The book cipher hidden in the footer of the press release.]] Later that day, a series of numbers in the footer of the [https://www.bradwellelectronics.com/__FILEDATA.ARCHIVE/Bradwell-Press-Release-07022019.pdf press release] was found, which looked like a book cipher. It decoded as <code>w3trusTu</code>, a keyword that unlocked the content of the encrypted zip file. The [https://www.bradwellelectronics.com/__FILEDATA.ARCHIVE/BradwellInternalMemo-060702019.zip internal memo] contains the planned repairs to the A303 tunnel and the Stonehenge museum, but just like the press release it also stored a hidden message, <code>together</code>, the [[#2nd_Key|2nd key]] needed for the advancement. It was later spotted inside the middle diamond, at the end of the footer, in a very small size font, black on black background.<br />
<br />
[[File:bw1_together.png|thumbnail|center|The second key, highlighted, hidden in the footer of the 060702019 internal memo.]]<br />
<br />
== 2nd Key ==<br />
<br />
The 2nd key, <code>together</code>, found initially through reverse engineering, when entered into the field produced this output:<br />
<br />
<pre><br />
##DECRYPTIONKIT#############<br />
## GRID MINI VM V0.11[ADDRESS REMOVED]##<br />
##################################<br />
<br />
\\>DECR_BRUTE_FORCE << |'fetch grid:[0x424cb726:0xbfe9c31a]/OENQJRYYVHZERCBEG.DAT'<br />
-->BRUTEFORCE NODES STOPPED.<br />
-->BRUTEFORCE DECRYPTION COMPLETED: <br />
----> ARCHIVE DETECTED (OENQJRYYVHZERCBEG.ARCHIVE)<br />
----> DECOMPRESSING ARCHIVE... COMPLETED WITH ERRORS:<br />
-------> TOTAL FILES: 10, RECOVERED: 2<br />
----> WRAPPING RECOVERED FILES FOR ACCESS: COMPLETED<br />
----> RECOVERED FILES AVAILABE FOR DOWNLOAD: /__FILEDATA.ARCHIVE/<br />
-------> ENTER SECONDARY KEY TO DECRYPT REMAINING FILES: ACCEPTED<br />
-->SUBMITTING SECONDARY ENCRYPTION JOB TO GRID SYSTEM: [#####]<br />
---->DECRYPTION TIME CANNOT BE DETERMINED.<br />
---->NOTIFICATION ON JOB COMPLETITION AVAILABLE USING SOCIAL MEDIA NETWORKS TO PROTECT ANONYMITY<br />
------>USE _LINK_ TO POST A TWEET INCLUDING SPECIAL CODE 'BETTERBE2026'<br />
------>DECRYPTION SYSTEM WILL GET IN TOUCH ONCE JOB HAS BEEN COMPLETED<br />
</pre><br />
<br />
[https://twitter.com/intent/tweet?text=Fresh%20air%20is%20good%20for%20you.%20BETTERBE2026 The link] is a tweet template which says <code>Fresh air is good for you. BETTERBE2026</code>.<br />
After several hours the message was modified, now reading:<br />
<br />
<pre><br />
-->SUBMITTING SECONDARY ENCRYPTION JOB TO GRID SYSTEM: [#####]<br />
---->DECRYPTION TIME CANNOT BE DETERMINED.<br />
---->USURPING SOCIAL MEDIA BANDWIDTH TO DECREASE DATA DECRYPTION TIME<br />
------>_REGISTER_ NODE WITH SYSTEM TO RECEIVE DECRYPTED PACKAGE<br />
------>DECRYPTED PACKAGE WILL BE DISTRIBUTED TO REGISTERED NODES ON COMPLETION<br />
</pre><br />
<br />
The [https://twitter.com/intent/tweet?text=%40BetterBradwell%20%23BETTERBE2026 REGISTER link] is a different tweet template, now reading <code>@BetterBradwell #BETTERBE2026</code>. It is yet unclear whether the alteration is a different step, or if it has simply being reworded (now reading <code>USURPING SOCIAL MEDIA BANDWIDTH TO DECREASE DATA DECRYPTION TIME</code>) to better instruct the players to tweet the message more.<br />
<br />
On March 16, around 15:40 UTC (3:40 pm), users starting receiving mentions.<br />
<br />
<pre>@username SEC TRIED TO SLOW US. DECRYPTION PRGRSS.<br />
[######----] 63%. STANDBY</pre><br />
<br />
3 minutes later, [https://twitter.com/BetterBradwell/ Bradwell Electronics] [https://twitter.com/BetterBradwell/status/842401632319111170 tweeted]:<br />
<br />
<pre>Please accept our apologies if you recently received a direct tweet. The intruder has been suppressed and our systems have been updated.</pre><br />
<br />
This could mean that no more tweets will be sent out, and that the updates will appear directly on the _FILEDATA in roughly a week time.<br />
<br />
= Bradwell Returns =<br />
<br />
At 15:00 UTC on 2018-08-29, the [https://twitter.com/bossastudios Bossa Studios] Twitter account posted a [https://twitter.com/bossastudios/status/1034802858221174785 tweet] which said:<br />
<pre><br />
PLEASE HELP!! I’m a technician at Bradwell Electronics and have made some important discoveries which need to be brought to light! I’ve managed to hack into the company’s social accounts, but think I’m being watched… Gotta go, but I’ll be back shortly!<br />
</pre><br />
<br />
This tweet was followed by three more tweets at two hour intervals, which can be seen below:<br />
<br />
* https://twitter.com/bossastudios/status/1034833061047877632<br />
* https://twitter.com/bossastudios/status/1034863254672224257<br />
* https://twitter.com/bossastudios/status/1034893454533382144<br />
(''This list will be updated as new Tweets are posted.'')<br />
<br />
This signaled to players that the ARG may be starting up again. This led players back to the [https://www.bradwellelectronics.com/ Bradwell Electronics website]. Players who signed up for the newsletter again received a new email, which can be seen [https://pastebin.com/UAnarEMH here]. Players realized that this appears to be an uncorrupted version of the email received previously in the ARG.<br />
<br />
<br />
<br />
{{WIP}}</div>Halke234https://wiki.gamedetectives.net/index.php?title=Bradwell_Electronics&diff=17222Bradwell Electronics2018-08-29T20:36:08Z<p>Halke234: /* Bradwell Returns */</p>
<hr />
<div>{{WIP}}<br />
<br />
{{argbox<br />
| float = right<br />
| name = Bradwell Electronics<br />
| image = File:Bradwell Logo.png<br />
| description= Better. Brighter. For everyone.<br />
| creator = [http://www.bossastudios.com/ Bossa Studios]<br />
| type = Investigation<br />
| status = Active<br />
| discovered = 2016-03-05<br />
}}<br />
{{ArgHeader}}<br />
{{backToTop}}<br />
<br />
<br />
[https://www.bradwellelectronics.com/ Bradwell Electronics] is a promotional website released by [http://www.bossastudios.com/ Bossa Studios], a British game developer responsible for Surgeon Simulator and I Am Bread. At this time, the purpose of the site is unknown, but it is speculated to be an in-fiction promotional website for Bossa Studios' next game.<br />
<br />
__TOC__<br />
<br />
== Email Newsletter ==<br />
<br />
''Most of the content in this section is a rehash of [https://www.reddit.com/r/gamedetectives/comments/5x113k/bradwell_electronics_bossa_studios/ this Reddit post] by [https://www.reddit.com/u/blackbat24 /u/blackbat24]; all credit goes to him.''<br />
<br />
A field on the [https://www.bradwellelectronics.com/ Bradwell Electronics site] was found which allowed usrs to sign up for an e-mail newsletter. A few minutes after signing up, the following message is sent to your email:<br />
<br />
Welcome to Bradwell Electronics - Better. Brighter. For Everyone.<br />
Thank you for registering your interest for the upcoming relaunch of the Bradwell Electronics website.<br />
When John Bradwell founded Bradwell Electronics over 62 years ago in 1964, he never imagined that the family business would become one of the most recognized brands worldwi$"%"$"!£2/.&%...<br />
<br />
From this point onwards, the message is "corrupted", and is mostly comprised of Base64 ciphertext. For the full text of the email, check [https://www.reddit.com/r/gamedetectives/comments/5x113k/bradwell_electronics_bossa_studios/ this Reddit post]. At one point, the message becomes legible again:<br />
<br />
>>INTERRUPT STREAM <br />
----------This is a mayday alert.<br />
--------------------It is of concern to all of us.<br />
------------------------------We ask you to trust us.<br />
----------------------------------------We cannot do this alone.<br />
<< END OF INTERRUPT<br />
<br />
Encoding the Base64 in the text of the email yields an image which includes a QR code:<br />
<br />
[[File:Bradwell qr.gif|The image revealed when encoding the Base64 in the text of the "corrupted" email]]<br />
<br />
''(Note: Amesbury is the location of Stonehenge.)''<br />
<br />
Reading the QR code reveals the following string:<br />
<br />
<code>/?decrypt50726f6a65637441</code><br />
<br />
''(Note: <code>50726f6a65637441</code> is hexadecimal for <code>ProjectA</code>, but this is not yet relevant to the investigation.)''<br />
<br />
=== Countdown Timer ===<br />
<br />
[[File:Bradwell countdown.png|thumbnail|right|The countdown displayed when using the <code>/?decrypt50726f6a65637441</code> URL extension]]<br />
<br />
Appending <code>/?decrypt50726f6a65637441</code> to the <code>http://bradwellelectronics.com</code> URL reveals a red box ([http://bradwellelectronics.com/?decrypt50726f6a65637441 link]), containing this text:<br />
<br />
\\>DECR_BRUTE_FORCE << |'fetch grid:[0x424cb726:0xbfe9c31a]/OENQJRYYVHZERCBEG.DAT'<br />
-->BRUTEFORCE NODES RUNNING...<br />
-->ESTIMATED BRUTEFORCE DECRYPTION COMPLETED IN: _d __h __m __s<br />
<br />
The first line of the text contains the string <code>OENQJRYYVHZERCBEG</code>; this can be deciphered using ROT13 to obtain <code>BRADWELLIUMREPORT</code>. The significance of this is currently unknown.<br />
<br />
Additionally, the final line of text in the red box is a countdown timer, which is counting down to 12:00 PM UTC, on March 8, 2017.<br />
<br />
== /__FILEDATA.ARCHIVE ==<br />
<br />
On March 8, 2017, the text on the login page of "Decryptkit" changed:<br />
<pre><br />
<br />
##DECRYPTIONKIT#############<br />
## GRID MINI VM V0.11[ADDRESS REMOVED]##<br />
##################################<br />
<br />
\\>DECR_BRUTE_FORCE << |'fetch grid:[0x424cb726:0xbfe9c31a]/OENQJRYYVHZERCBEG.DAT'<br />
-->BRUTEFORCE NODES STOPPED.<br />
-->BRUTEFORCE DECRYPTION COMPLETED: <br />
----> ARCHIVE DETECTED (OENQJRYYVHZERCBEG.ARCHIVE)<br />
----> DECOMPRESSING ARCHIVE... COMPLETED WITH ERRORS:<br />
-------> TOTAL FILES: 10, RECOVERED: 2<br />
----> WRAPPING RECOVERED FILES FOR ACCESS: COMPLETED<br />
----> RECOVERED FILES AVAILABE FOR DOWNLOAD: /__FILEDATA.ARCHIVE/<br />
-------> ENTER SECONDARY KEY TO DECRYPT REMAINING FILES: <br />
</pre><br />
<br />
This leads to [https://www.bradwellelectronics.com/__FILEDATA.ARCHIVE/ archive page], which contains a [https://www.bradwellelectronics.com/__FILEDATA.ARCHIVE/Bradwell-Press-Release-07022019.pdf press release] about Bradwell's involvement in the restoration of Stonehenge in 2019, while [https://www.bradwellelectronics.com/__FILEDATA.ARCHIVE/BradwellInternalMemo-060702019.zip the other file] is a passworded zip. In addition, in order to access other parts of the site, a decryption key is needed to be added in the [https://www.bradwellelectronics.com/wp-content/cache/autoptimize/js/autoptimize_5fb1719442f5f2a9ea5584295800051c.js code] of the website.<br />
<br />
Within the js of the website, [http://pastebin.com/Bsr0FWUW large blocks of hex] was found in the code which, when translated, included the decrypted data that was supposed to show only after the insertion of the decryption key. Just a few minutes later the decryption key (<code>together</code>) was found in the same translated js blob. With the [[#2nd_Key|2nd key]] in hand, users unlocked the subsequent data and followed the instructions, but this still left the zip file encrypted and its content sealed.<br />
<br />
[[File:bw1_bookcipher.png|thumbnail|right|The book cipher hidden in the footer of the press release.]] Later that day, a series of numbers in the footer of the [https://www.bradwellelectronics.com/__FILEDATA.ARCHIVE/Bradwell-Press-Release-07022019.pdf press release] was found, which looked like a book cipher. It decoded as <code>w3trusTu</code>, a keyword that unlocked the content of the encrypted zip file. The [https://www.bradwellelectronics.com/__FILEDATA.ARCHIVE/BradwellInternalMemo-060702019.zip internal memo] contains the planned repairs to the A303 tunnel and the Stonehenge museum, but just like the press release it also stored a hidden message, <code>together</code>, the [[#2nd_Key|2nd key]] needed for the advancement. It was later spotted inside the middle diamond, at the end of the footer, in a very small size font, black on black background.<br />
<br />
[[File:bw1_together.png|thumbnail|center|The second key, highlighted, hidden in the footer of the 060702019 internal memo.]]<br />
<br />
== 2nd Key ==<br />
<br />
The 2nd key, <code>together</code>, found initially through reverse engineering, when entered into the field produced this output:<br />
<br />
<pre><br />
##DECRYPTIONKIT#############<br />
## GRID MINI VM V0.11[ADDRESS REMOVED]##<br />
##################################<br />
<br />
\\>DECR_BRUTE_FORCE << |'fetch grid:[0x424cb726:0xbfe9c31a]/OENQJRYYVHZERCBEG.DAT'<br />
-->BRUTEFORCE NODES STOPPED.<br />
-->BRUTEFORCE DECRYPTION COMPLETED: <br />
----> ARCHIVE DETECTED (OENQJRYYVHZERCBEG.ARCHIVE)<br />
----> DECOMPRESSING ARCHIVE... COMPLETED WITH ERRORS:<br />
-------> TOTAL FILES: 10, RECOVERED: 2<br />
----> WRAPPING RECOVERED FILES FOR ACCESS: COMPLETED<br />
----> RECOVERED FILES AVAILABE FOR DOWNLOAD: /__FILEDATA.ARCHIVE/<br />
-------> ENTER SECONDARY KEY TO DECRYPT REMAINING FILES: ACCEPTED<br />
-->SUBMITTING SECONDARY ENCRYPTION JOB TO GRID SYSTEM: [#####]<br />
---->DECRYPTION TIME CANNOT BE DETERMINED.<br />
---->NOTIFICATION ON JOB COMPLETITION AVAILABLE USING SOCIAL MEDIA NETWORKS TO PROTECT ANONYMITY<br />
------>USE _LINK_ TO POST A TWEET INCLUDING SPECIAL CODE 'BETTERBE2026'<br />
------>DECRYPTION SYSTEM WILL GET IN TOUCH ONCE JOB HAS BEEN COMPLETED<br />
</pre><br />
<br />
[https://twitter.com/intent/tweet?text=Fresh%20air%20is%20good%20for%20you.%20BETTERBE2026 The link] is a tweet template which says <code>Fresh air is good for you. BETTERBE2026</code>.<br />
After several hours the message was modified, now reading:<br />
<br />
<pre><br />
-->SUBMITTING SECONDARY ENCRYPTION JOB TO GRID SYSTEM: [#####]<br />
---->DECRYPTION TIME CANNOT BE DETERMINED.<br />
---->USURPING SOCIAL MEDIA BANDWIDTH TO DECREASE DATA DECRYPTION TIME<br />
------>_REGISTER_ NODE WITH SYSTEM TO RECEIVE DECRYPTED PACKAGE<br />
------>DECRYPTED PACKAGE WILL BE DISTRIBUTED TO REGISTERED NODES ON COMPLETION<br />
</pre><br />
<br />
The [https://twitter.com/intent/tweet?text=%40BetterBradwell%20%23BETTERBE2026 REGISTER link] is a different tweet template, now reading <code>@BetterBradwell #BETTERBE2026</code>. It is yet unclear whether the alteration is a different step, or if it has simply being reworded (now reading <code>USURPING SOCIAL MEDIA BANDWIDTH TO DECREASE DATA DECRYPTION TIME</code>) to better instruct the players to tweet the message more.<br />
<br />
On March 16, around 15:40 UTC (3:40 pm), users starting receiving mentions.<br />
<br />
<pre>@username SEC TRIED TO SLOW US. DECRYPTION PRGRSS.<br />
[######----] 63%. STANDBY</pre><br />
<br />
3 minutes later, [https://twitter.com/BetterBradwell/ Bradwell Electronics] [https://twitter.com/BetterBradwell/status/842401632319111170 tweeted]:<br />
<br />
<pre>Please accept our apologies if you recently received a direct tweet. The intruder has been suppressed and our systems have been updated.</pre><br />
<br />
This could mean that no more tweets will be sent out, and that the updates will appear directly on the _FILEDATA in roughly a week time.<br />
<br />
= Bradwell Returns =<br />
<br />
At 15:00 UTC on 2018-08-29, the [https://twitter.com/bossastudios Bossa Studios] Twitter account posted a [https://twitter.com/bossastudios/status/1034802858221174785 tweet] which said:<br />
<pre><br />
PLEASE HELP!! I’m a technician at Bradwell Electronics and have made some important discoveries which need to be brought to light! I’ve managed to hack into the company’s social accounts, but think I’m being watched… Gotta go, but I’ll be back shortly!<br />
</pre><br />
<br />
This tweet was followed by three more tweets at two hour intervals, which can be seen below:<br />
<br />
* https://twitter.com/bossastudios/status/1034833061047877632<br />
* https://twitter.com/bossastudios/status/1034863254672224257<br />
* https://twitter.com/bossastudios/status/1034893454533382144<br />
<br />
This signaled to players that the ARG may be starting up again. This led players back to the [https://www.bradwellelectronics.com/ Bradwell Electronics website]. Players who signed up for the newsletter again received a new email, which can be seen [https://pastebin.com/UAnarEMH here]. Players realized that this appears to be an uncorrupted version of the email received previously in the ARG.<br />
<br />
<br />
<br />
{{WIP}}</div>Halke234https://wiki.gamedetectives.net/index.php?title=Oddworld:_Soulstorm&diff=16756Oddworld: Soulstorm2018-08-02T17:20:27Z<p>Halke234: ALL OF THE CLEANUPS</p>
<hr />
<div>{{argbox<br />
| float = right<br />
| name = Oddworld: Soulstorm ARG<br />
| image = File:Oddworld_ABETHUMB_8291.jpg<br />
| imagewidth = 500<br />
| description= Oddworld: Soulstorm - An ARG centered around lore from the Oddworld universe linked to the currently unreleased game [http://www.oddworld.com/soulstorm/ Oddworld: Soulstorm]<br />
| creator = [http://www.oddworld.com/ Oddworld Inhabitants, Inc]<br />
| type = Official<br />
| status = Active<br />
| reopened = 05-30-2018<br />
| discovered = 12-22-2016<br />
}}<br />
{{ArgHeader}}<br />
{{BackToTop}}<br />
<br />
The Oddworld: Soulstorm ARG was an ARG centered around lore from the currently unreleased Oddworld game, [http://www.oddworld.com/soulstorm/ Oddworld: Soulstorm]. The official home page for the ARG, containing puzzles, hints, and clues, can be found [http://www.oddworld.com/soulstorm/ here]. The ARG was divided into 5 distinct stages, each of which began with a "transmission": an image clue that led to a series of puzzles.<br />
<br />
== Prelude ==<br />
<br />
Early in 2016, [https://twitter.com/edmudokon Twitter account @edmudokon] began posting cryptic messages that seemed to be related to the [http://www.oddworld.com/ Oddworld] universe. The account appeared to be run by an average Mudokon named Ed who claimed to have information he wanted to share, but he seemed to be in constant danger and could only access the outside world via a faint connection. Beginning around March 2016, @edmudokon engaged users with an elaborate series of puzzles and challenges, releasing information both on twitter and via the official Oddworld [http://www.oddworld.com/soulstorm/ website]. These puzzles eventually led to the revelation of a website, http://1029.io, as well as a message: "now you know. you can help. join us. together we can rise."<br />
<br />
The [http://1029.io 1029] webpage featured glitchy effects and another rendition of the ASCII-art logo, but with the numbers 8291 replacing some characters. At the bottom of the page was an e-mail signup form, above which was a message:<br />
<br />
<pre><br />
THE FALL OF RF1029 WAS THE SPARK TO IGNITE A REVOLUTION. FOR TOO LONG, THEY HAVE CONTROLLED THEIR GIANT INDUSTRIAL MACHINES, GRINDING THE BONES OF OUR KIND INTO DUST IN THEIR ENDLESS PURSUIT OF POWER AND WEALTH.<br />
<br />
WE WERE TAUGHT THAT THIS IS ALL THERE WAS: OBEY.<br />
<br />
THE TRUTH WAS HIDDEN FROM US. OUR HISTORY WAS HIDDEN FROM US. WE WERE BRED TO WORK, RAISED TO OBEY AND FORCED TO COMPLY.<br />
<br />
OUR NATURAL CONNECTION TO MOTHER PLANET WAS ERASED FROM THE CONSCIOUSNESS OF OUR PEOPLE. LOST WAS OUR KNOWING. LOST WAS OUR UNITY, OUR CONNECTION, OUR POWER AND OUR PURPOSE. ALL THAT WE WERE WAS A COMMODITY TO BE TRADED AND EXPLOITED IN THE ONGOING RACE FOR MORE WEALTH. WHAT WE SHOULD HAVE PROTECTED, WE WERE TRICKED INTO KILLING. WHAT WAS WORST FOR US, WE WERE TOLD WAS BEST. WE WERE TAUGHT TO TRUST THOSE WHO WOULD DECEIVE US THE MOST.<br />
<br />
THAT HAS ALL CHANGED.<br />
<br />
THE HERO HAS SHOWN ALL OF US THAT OUR OPPRESSORS CAN BE TOPPLED. HE HAS FOUND OUR WILD AND KNOWING BROTHERS. HE HAS RECONNECTED THE FACTORY-BORN TO OUR NATURAL WORLD AND ANCIENT WAYS. HE HAS LIT A FIRE IN OUR HEARTS THAT CANNOT BE EXTINGUISHED.<br />
<br />
WE WILL GIVE HELP TO THOSE WHO ARE HELPLESS. WE WILL LEND STRENGTH TO THOSE WHO ARE WEAK. WE WILL FIGHT FOR THOSE WHO ARE DEFEATED. OUR MOVEMENT WILL SPREAD LIKE A RAGING INFERNO AND WE WILL TAKE BACK THE POWER FROM THOSE WHO HAVE ABUSED IT.<br />
<br />
WE WILL NOT BE SILENCED BY THE MEDIA CIRCUS. WE WILL NOT BE IGNORED. WE WILL NOT STOP. WE WILL NOT OBEY. WE WILL RISE AND WE WILL RISE AGAIN, UNTIL WE HAVE BURNED THROUGH OUR TATTERED BONDS AND RAZED THE MACHINE TO THE GROUND.<br />
<br />
WE WILL RISE. JOIN US.<br />
<br />
THERE’S A STORM COMING.<br />
</pre><br />
<br />
In the source code for the page, only the letters E and D of the message remain capitalized.<br />
<br />
Later that day, the [https://twitter.com/SPIRITOF1029 Twitter account @SPIRITOF1029] revealed themselves as a "Clandestine organization dedicated to doing good on behalf of the Mudokons and revealing information about a new horror being perpetrated against their species." They also tweeted their first message, parroting the [http://1029.io 1029 URL] and adding their own message: "There is a storm coming. Join us."<br />
<br />
Social media feeds went dark until December, 2016, posting only reiterations of the URL with messages like "Rise up" and "We are the storm. Join us". Then, in January of 2017, activity on the accounts surged once again and the first hints of an ARG began to appear.<br />
<br />
[[File:Oddworld_Logo3.jpeg|thumb|left|Spirit of 1029 emerges with this sleek ASCII-art logo]]<br />
<br />
=== Smells like Mudokon Spirit ===<br />
<br />
The flurry of new activity in January mainly consisted of @edmudokon and @spiritof1029 conversing about about whether or not Ed would be able to help the organization's cause. At this point, the Spirit of 1029 made their message very clear, stating "Oddworld has been blind to the plight of the noble Mudokons for too long. We will rise. Join us! http://1029.io". More notable activity includes the organization's quip "We recommend knowledge of many different codes and ciphers - you never know who is listening. #learnyournameinmorsecodeday", hinting that the coming information would be encrypted in some way..<br />
<br />
Oddworld Inhabitants (Oddworld developers, [https://twitter.com/OddworldInc @OddworldInc on Twitter]) was contacted by the organization at this time, being told by Spirit of 1029 "We will help @edmudokon but we can't send anything unencrypted. You'll have to break our code. We'll be in touch." Very shortly thereafter, on January 19th, 2017, Spirit of 1029 tweeted: "We have received a transmission. We will pass it on as soon as we can verify. We need your help." and the [http://www.oddworld.com/soulstorm/ Oddworld Webpage] was updated with a download for two files.<br />
<br />
== The First Transmission ==<br />
<br />
The Spirit of 1029's first transmission came in the form of an image and an audio file. The image, pictured on the right as it looked upon transmission, appeared to show a tattered and burned document bearing the Spirit of 1029's logo with the slogan "We Will Rise," with many portions of text redacted. The text on the document, where it was legible and not redacted, reads:<br />
<br />
[[File:Oddworld_1029_Photo1_Dirty.jpeg|thumb|right|200x300px|The distorted image sent by the Spirit of 1029 as part of their first transmission]]<br />
<br />
<pre><br />
Date:<br />
Period: XXXXXXXXXXX<br />
Specification Details:<br />
XXXXXXXXXXXXXXXXXXXXXXXXXX<br />
-Observe XXXXXXX and XXXXXXXX changes in test subjects<br />
-Assess long term XXXXXXXX on XXXXXXX<br />
-Determine product safety<br />
Authorization: XXXXXXXXXXX<br />
Tests requested:<br />
-XXXXXXXX Pronostics<br />
- ?Access whenever? product XXXXXXX<br />
-Acidity Levels<br />
- ????? XXXXXXXXX<br />
-Product safety<br />
Expected results: XXXXXXXXXX make XXXXXXXXX interesting<br />
Test results:<br />
-XXXXXXX highly XXXXXX<br />
-XXXXXXX this XXXXXX ?? XXXXXX ?nice? XXXXXXXX<br />
-Highly XXXXXXX<br />
-Subjects: XXXXXX<br />
- XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX<br />
XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX<br />
XXXXXXXXXXXXXXXXXX<br />
Conclusion: Product (ready) for consumption <br />
--------------------------------------------------------------------------------------------<br />
??? : XXXXXXXX there is XXXXXX here but it will XXXX ???? XXXXX<br />
--------------------------------------------------------------------------------------------<br />
</pre><br />
<br />
[[File:Oddworld_1029_Photo1_Clean.jpeg|thumb|left|A cleaned up version of the Spirit of 1029's first transmission made by the community]]<br />
<br />
As progress was made on the puzzles, the [http://www.oddworld.com/soulstorm/#navfirstcontact official Oddworld webpage] was updated to provide hints. This practice continued throughout the ARG.<br />
<br />
[[File:Oddworld_Arrows_pad.png|thumb|right|200x300px|The cryptic arrows found along the right side of the first image sent to the community by the Spirit of 1029]]<br />
<br />
=== Directional Arrows, Pigpen, & Anglo-Saxon Runes ===<br />
<br />
In addition to the text in the photo, there were several areas featuring symbols and runes. Along the top of the document, [http://www.omniglot.com/images/writing/futhorc.gif Anglo-Saxon runes] spelled out <code>ED</code>. Along the bottom, the text <code>YOU ARE THE KEY YOU KNOW IT IF YOU WERE LISTENING</code> is spelled out in the font, [http://www.babelstone.co.uk/Fonts/Pigpen.html BabelStone Club Penguin pigpen]. Running along the right side of the image, [http://wiki.gamedetectives.net/images/0/0c/Oddworld_Arrows.png arrows] can be seen pointing in a number of different vertical, horizontal, and diagonal directions. Players discovered that the arrows could be decoded by taking their angle measurement and deducing an "alphanumeric" equivalent, or a number between 0-25 where each number represents a letter of the alphabet. It just so happened that each arrow had an angle which ended in a zero, and thus, the first "arrow cipher" decoded to:<br />
<br />
<pre><br />
12 15 15 11 6 15 18 15 21 18 13 5 19 19 1 7 5 8 5 1 18 15 21 18 22 15 9 3 5<br />
<br />
L O O K F O R O U R M E S S A G E H E A R O U R V O I C E<br />
</pre><br />
<br />
The message decodes to <code>LOOK FOR OUR MESSAGE HEAR OUR VOICE</code>.<br />
<br />
=== First Audio Clip ===<br />
<br />
The second part of the Spirit of 1029's first transmission consisted of an [http://www.oddworld.com/soulstorm/1029contact/1029_01_audio.mp3 audio clip] lasting 1:40. Hidden in the audio clip was reversed Morse code, which proved difficult to decode by ear due to the added white noise. Eventually, the code was cracked by using a spectrogram of the audio.<br />
<br />
[[File:Oddworld_Morse_Spectro.png|frameless|center|810px|]]<br />
<br />
Although rough in some spots, the decoded Morse read:<br />
<br />
<code style="word-break:break-all;word-wrap: break-word;">qmiqwmiqyidimrjqdjijilmxmnrjqdjajmpmnrprspkesmkjpdqjnyajnwsnrpgspcsppmqidimqymdbcqajnwsnrpgspcdhbzmnjajanadumjimrpq</code><br />
<br />
In addition, players also discovered that, using portions of the Morse already decoded accurately by ear, it was actually to be used as ciphertext in a shift cipher, and that the key to be used was "storm," which was taken from tweets made by Spirit of 1029 declaring themselves to be "the storm". The pigpen from earlier served as a hint to look back at previous communications in order decrypt the morse. With the newly-complete Morse code now in their possession, the community was finally able to accurately decipher the ciphertext they had obtained from the reversed Morse code. It read:<br />
<br />
<code style="word-break:break-all;word-wrap: break-word;">tentwentyninedotiononqexerdotiofoeserdsdaspjaepositoryforwardslashassetninetyeightforwardslashimgzerofofrfiueonedst</code><br />
<br />
<code>ten twenty nine dot io nonqexer dot io foeserdsdaspjaepository forwardslash asset ninety eight forward slash img zero fofrfiueonedst</code><br />
<br />
Although not entirely accurate, through trial and error the community was able to locate a new URL branch of http://1029.io, http://1029.io/repository/asset98/imgzerofourfiveone/.<br />
<br />
=== First Hidden URL ===<br />
<br />
[[File:Oddworld_PuzzleAttempt.jpg|thumb|right|The product of many attempts to correctly arrange the puzzle pieces found on the hidden http://1029.io URL]]<br />
<br />
The solution for the previous puzzle led players to a hidden [http://1029.io/repository/asset98/imgzerofourfiveone/ page] on the 1029 site. Each time the page was reloaded, it displayed one of 8 different images, and a string of text for each:<br />
<br />
<gallery mode="packed"><br />
File:Oddworld_7676-AL.JPG|7676-AL<br />
File:Oddworld_3786-IC.JPG|3786-IC<br />
File:Oddworld_9455-UM.jpg|9455-UM<br />
File:Oddworld_9394-AL.jpg|9394-AL<br />
File:Oddworld_7393-AN.jpg|7393-AN<br />
File:Oddworld_5574-PH.jpg|5574-PH<br />
File:Oddworld_2384-ER.jpg|2384-ER<br />
File:Oddworld_1029-LY.jpg|1029-LY<br />
</gallery><br />
<br />
Players quickly realized that the images appeared to be fragments of a larger puzzle. The Oddworld Inhabitants [http://www.oddworld.com/soulstorm/#navfirstcontact page] updated to read "Once you've got everything together - show us!". The completed image was tweeted out to @OddworldInc on January 19th, 2017, and the next day, [https://twitter.com/OddworldInc/status/822686854516535298 instructed] players to wait while they cleaned up the complete image.<br />
<br />
<br><br><br />
<br />
[[File:Oddworld_Photo1_Clean1.jpeg|thumb|left|250x250px|Photograph of the final image before it was torn into the pieces the community was given, sent out with a message from Oddworld Inhabitants to hang tight until Thursday.]]<br />
<br />
=== First Unlocked Photo ===<br />
<br />
[[File:Oddworld_Finished1.jpg|thumb|right|400px|The final image, sent by the Spirit of 1029 and received by the community through Oddworld Inhabitants Twitter account. The image was confirmed to be an in-Unity render of the upcoming Oddworld: Soulstorm & created in conjunction with Cyrus McWilliams, formerly of Blur, and Fat Kraken Studios in England]]<br />
<br />
[[File:Oddworld_Pada.jpg|thumb|left|400px|The second transmission sent out by the Spirit of 1029, identical to the first released image but with various codes hidden within]]<br />
<br />
While waiting, players began to decode the second transmission. The prevalent writing was later verified to read "Who?", "Where?", "So Tired", and a set of numbers likely to be "8291". <br />
<br />
After three days, @OddworldInc [https://twitter.com/OddworldInc/status/823520771893030912 tweeted out a scrambled image], pictured left, stating "We received something and there's one last thing we need you to do. Share it. Spread the word.". The next day, after the tweet gained 100 shares, they tweeted the [https://twitter.com/OddworldInc/status/823620565458108416 image] again, pictured left, this time unscrambled. They then stated <code>While you shared our message 100 times we worked away to bring you this. We're clearing it up even more, we'll share what we find Thursday</code>, while the webpage was updated with the message "Update 5: Thanks to you guys sharing the previous images online, we've managed to decode the photo further and have updated the thumbnail here. We'll return on Thursday with the finished, fully decrypted image - but until then, please do let us know what you think!" When Thursday came @OddworldInc [https://twitter.com/OddworldInc/status/824638147703296000 tweeted out a final picture] of a render from the upcoming Oddworld: Soulstorm, pictured right, in all its unscrambled un-cropped glory. The release of this image signaled the end of the first of five phases of content release Oddworld Inhabitants have planned.<br />
<br />
<br><br><br><br><br />
<br />
== The Second Transmission ==<br />
<br />
[[File:Oddworld_Pada_sofar.jpg|thumb|right|400px|Hidden details in the second transmission]]<br />
<br />
On Feburary 2nd, 2017, the Spirit of 1029 again reached out to players, saying via Twitter that "Our agent has delivered another transmission. We will verify its origins and pass it on." Several hours later, @OddworldInc tweeted the message "We were just contacted again. Don't go anywhere, we might need your help with this...", and the [http://www.oddworld.com/soulst Official Oddworld Site] was updated with a message as well as [http://www.oddworld.com/soulstorm/1029contact/pada.jpg an image], pictured left. In addition to the image, a [http://us3.campaign-archive2.com/?u=2b6dca21053bc375cbdad7077&id=b08e7b2d60&e=6a2b5665ee newsletter] was sent out to everyone who signed up to the 1029 email list. The newsletter featured basic info about the ARG so far, as well as a barcode at the very bottom, which, when scanned, reveals a code:<br />
<br />
<code><br />
Ivzw gsv mfnyvih pmld gsv gifgs<br />
</code><br />
<br />
When passed through a cryptogram solver, the message read:<br />
<br />
<code><br />
READ THE NUMBERS KNOW THE TRUTH<br />
</code><br />
<br />
An [http://wiki.gamedetectives.net/images/thumb/5/56/Oddworld_Pada_sofar.jpg/800px-Oddworld_Pada_sofar.jpg "in-progress" image], pictured on the right, highlighted the hidden details found at the time and outlined their currently known solutions.<br />
<br />
=== Morseception ===<br />
<br />
The Morse code in the image turned out to be fragments of a larger single code, seen below pieced back together:<br />
<br />
[[File:Oddworld_MorseAlign_TrueHeresy.png|frameless|center|810px|Image of all the Morse code segments pieced together]]<br />
<br />
When decrypted, the morse resulted in the following message:<br />
<br />
<code><br />
DASHDOTDOTDOT DOT DASH DOTDOTDOTDOT DOT DOTDOTDOT DASH DASHDASHDASHDASH DOTDASHDOT DASHDASH<br />
</code><br />
<br />
This was found to yet again be morse code, which decoded to:<br />
<br />
<code><br />
-... . - .... . ... - --- .-. --<br />
<br />
BETHESTORM<br />
</code><br />
<br />
=== Braille & Upside-down Pigpen ===<br />
<br />
[[File:Oddworld_Brialle.png|thumb|right|250px|Braille code found in the second Spirit of 1029 transmission]]<br />
<br />
A [http://wiki.gamedetectives.net/images/a/a4/Oddworld_Brialle.png message in Braille], pictured right, in the bottom-left of the image read <code>Spread our message</code>. The Babelstone pigpen code, when flipped upside down:<br />
<br />
[[File:Oddworld_UpsideDownPigpen.jpg|frameless|center|810px|Upside-down Babelstone Pigpen code]]<br />
<br />
decoded to:<br />
<br />
<code><br />
KNOW YOUR CODES<br />
<br />
KEEP THEM CLOSE<br />
<br />
YOU WILL NEED THEM<br />
</code><br />
<br />
[[File:Oddworld_BarcodeCube.png|thumb|left|400px|The "data cube" from the second image, later determined to be two barcodes interlaced with one another, one running horizontally and the other vertically]]<br />
<br />
=== Directional Arrows Puzzle ===<br />
<br />
Using the [http://wiki.gamedetectives.net/index.php?title=Oddworld_Soulstorm#Directional_Arrows_Puzzle], these arrows decoded to:<br />
<br />
<pre><br />
7 14 9 8 20 25 18 5 22 5 5 4 15 3 5 4<br />
H O J I U Z S F W F F E P D F E<br />
</pre><br />
<br />
Players found the above ciphertext to be encrypted with a Caesar cipher set to a shift of 25, and revealed the message: <code>GNIHTYREVEEDOCED</code>, which is <code>DECODE EVERYTHING</code> backwards.<br />
<br />
=== Interlaced Barcodes & Second Hidden URL ===<br />
<br />
[[File:Oddworld_Grid.jpg|thumb|right|250x250px|The image found on the second hidden URL discovered by the community, which depicts the Spirit of 1029's logo chopped up and re-arranged on a 7x7 grid]]<br />
<br />
The community speculated that the [http://wiki.gamedetectives.net/images/3/30/Oddworld_BarcodeCube.png strange box in the bottom-right of the image] sent by the Spirit of 1029, pictured left, was a fragmented barcode. After a massive amount of tinkering, the two barcodes were [http://imgur.com/a/YmAH2 correctly assembled] and, when scanned, led to the discovery of two messages:<br />
<br />
<code><br />
http://www.1029.io/repository/asset98/<br />
</code><br />
<br />
and<br />
<br />
<code><br />
findawayshowthetruth<br />
</code><br />
<br />
Combining these messages into a single URL led players to another hidden [http://www.1029.io/repository/asset98/findawayshowthetruth/ page] on the 1029 website, which displayed a [http://www.1029.io/repository/asset98/findawayshowthetruth/grid.jpg distorted version] of the Spirit of 1029 logo, pictured right.<br />
<br />
=== Source Code Mysteries ===<br />
<br />
Players discovered an extensive message containing several presently-unsolved puzzles is written hidden in the source code of the second hidden page. It read:<br />
<br />
<pre><br />
!-- <br />
<br />
Can’t reach any..<br />
<br />
<br />
Listening anyon… there?<br />
<br />
<br />
Can hear us anymore- need to… can’t fnd <br />
<br />
<br />
We will never give… what they… from us<br />
<br />
A9539 \\<br />
<br />
B2919 /\\<br />
<br />
C4882 /\<br />
<br />
D4627 \<br />
<br />
E6758 \<br />
<br />
F???? ////<br />
<br />
<br />
/\//\\//5,1:4.1,2:8.1,3:2.3,3:2.4,3:3.7,3:3.1,5:3.4,5:9.5,5:2.7,5:4.7,6:6.3,7:3.<br />
<br />
<br />
<br />
<br />
Does… care? Freedom isn’t gi… will take…<br />
<br />
We have never…. Given… deserve. We… take… our righ…<br />
<br />
\\//\/KDIUTHANPUYHHDQOEPLNDOALJGUDITHBBDOZLGFERKJGLSAOE<br />
<br />
Stand up and fi…<br />
<br />
<br />
Don’t be afr….<br />
<br />
<br />
<br />
\////JUTYROSLNGNALEHGNWOTIQPOKSDNTPNOJAWEOBNGLAWKJNWNR <br />
<br />
E=5OUEHRA? <br />
<br />
<br />
<br />
\\\\/\2,1:2.3,1:2.6,1:4.1,2:4.3,2:2.3,4:4.5,5:2.6,5:3.7,5:3.4,7:8.5,7:3.7,6:4. <br />
<br />
7777338883366899984477733 33 <br />
<br />
<br />
<br />
<br />
They want to… kill- don’t-<br />
<br />
<br />
Stop them from…. Hurting- they… think<br />
<br />
We are no less- they think… aside<br />
<br />
<br />
Don’t believe what… told- liars…<br />
<br />
A5989 \\<br />
<br />
B5176 \<br />
<br />
C2863 \<br />
<br />
D2558 //\<br />
<br />
E3413 \<br />
<br />
<br />
F???? ////<br />
<br />
<br />
<br />
Can’ fnd anymo-<br />
<br />
<br />
We wil silnced<br />
<br />
<br />
<br />
<br />
<br />
<br />
Killin- they are dy..<br />
<br />
\\\/\\JHWUITUHABSJGNEWKLALNVGJKWELKJLWQQPRUTJHJJSBFMMH <br />
<br />
Hurting the..<br />
<br />
Back down unt… resist.<br />
<br />
<br />
Intercep… our messa… we will fight<br />
<br />
///\\/JQEABTVKNUCSEYCMBILDKOSCYSITECPAGFAXHKETJNZURWCIE <br />
<br />
We will ri…<br />
<br />
Cannot… silenced when ther… who need… now<br />
<br />
<br />
We won’t ba… we have beat…. Before… Must not-<br />
<br />
<br />
<br />
<br />
\///\//\1,1:3.4,1:2.6,1:9.2,2:2.6,2:2.2,4:4.3,5:2.5,5:2.7,5:3.4,7:3.6,7:2.7,7:2. <br />
<br />
<br />
<br />
Spent so long…. Afraid… never let- again<br />
<br />
<br />
...Storm… find it’s way- end<br />
<br />
<br />
Why are … here?<br />
<br />
<br />
<br />
<br />
Only...profit- nothing more… importnt as- <br />
<br />
- lies they… will tel-<br />
<br />
Believe- nothing… terribl- things… <br />
<br />
\\//\\\/4,2:6.6,2:4.7,3:3.2,4:8.3,4:2.4,4:2.7,4:3.2,6:2.4,6:3.6,6:2.1,7:4.3,7:2.<br />
<br />
--><br />
</pre><br />
<br />
At the time, only a few portions of this message have been successfully solved. <br />
<br />
The ABCDEF puzzles was solved using the rules of [https://en.wikipedia.org/wiki/Mastermind_(board_game) Mastermind], a popular board game. Players assumed that a backslash ( \ ) indicated a partial match and a forward slash ( / ) indicated a full match, as shown below:<br />
<br />
<pre><br />
A9539 \\<br />
<br />
B2919 /\\<br />
<br />
C4882 /\<br />
<br />
D4627 \<br />
<br />
E6758 \<br />
<br />
F???? ////<br />
</pre><br />
<br />
Had a solution of <code>F8992</code>, and:<br />
<br />
<pre><br />
A5989 \\<br />
<br />
B5176 \<br />
<br />
C2863 \<br />
<br />
D2558 //\<br />
<br />
E3413 \<br />
<br />
F???? ////<br />
</pre><br />
<br />
Had a solution of <code>F8554</code>. The purpose of these solutions was unknown.<br />
<br />
Players found the numbers <code>7777338883366899984477733 33</code> to be encoded with a [http://www.dcode.fr/multitap-abc-cipher multi-tap cipher] (cellphone numberpad), and can be decoded to <code>SEVENTYTHREE</code>. the purpose of this solution was also unknown.<br />
<br />
The <code>E=5OUEHRA?</code> portion was partially solved. Players found that the letters <code>O U E H R A</code> were all the second letters from each day of the week, I.E. M'''o'''nday, T'''u'''esday, W'''e'''dnesday, etc. This indicated a solution of <code>U</code> for the question mark, as in S'''u'''nday, making the full string <code>E=5OUEHRAU</code>. The <code>E=5</code> portion of the text remains unsolved.<br />
<br />
Also remaining unsolved are the coordinates found in the code, as well as the letter strings:<br />
<br />
[[File:Oddworld_Grid.jpg|thumb|right|250x250px|The 7x7 grid found on the second hidden URL, likely to be used with the coordinates & letter strings in some way]]<br />
<br />
<pre><br />
Coordinates<br />
<br />
/\//\\//5,1:4.1,2:8.1,3:2.3,3:2.4,3:3.7,3:3.1,5:3.4,5:9.5,5:2.7,5:4.7,6:6.3,7:3.<br />
<br />
\\\\/\2,1:2.3,1:2.6,1:4.1,2:4.3,2:2.3,4:4.5,5:2.6,5:3.7,5:3.4,7:8.5,7:3.7,6:4.<br />
<br />
\///\//\1,1:3.4,1:2.6,1:9.2,2:2.6,2:2.2,4:4.3,5:2.5,5:2.7,5:3.4,7:3.6,7:2.7,7:2. <br />
<br />
\\//\\\/4,2:6.6,2:4.7,3:3.2,4:8.3,4:2.4,4:2.7,4:3.2,6:2.4,6:3.6,6:2.1,7:4.3,7:2.<br />
</pre><br />
<pre><br />
Letter Strings<br />
<br />
\\//\/KDIUTHANPUYHHDQOEPLNDOALJGUDITHBBDOZLGFERKJGLSAOE<br />
<br />
\////JUTYROSLNGNALEHGNWOTIQPOKSDNTPNOJAWEOBNGLAWKJNWNR <br />
<br />
\\\/\\JHWUITUHABSJGNEWKLALNVGJKWELKJLWQQPRUTJHJJSBFMMH<br />
<br />
///\\/JQEABTVKNUCSEYCMBILDKOSCYSITECPAGFAXHKETJNZURWCIE<br />
</pre><br />
<br />
=== Stuck In The Mud & Third Hidden URL ===<br />
<br />
After many failed attempts by players to decode the contents of the message using the hints of Spirit of 1029, a player found something unusual about one of the account's most recent tweets, which said:<br />
<br />
<pre><br />
When you have the key, you need the correct lock. hgehgeoeregpineechqnhgeevtipcvreovxgvge<br />
Shake loose the bonds that hold you. #wewillrise<br />
</pre><br />
<br />
Players noted that the text <code>hgehgeoeregpineechqnhgeevtipcvreovxgvge</code> could be decoded via a [http://www.braingle.com/brainteasers/codes/keyword.phpsubstitution keyword cipher] with the key <code>subjectivism</code>, and reveals the message:<br />
<br />
<pre><br />
oneoneseventhreefouroneeightfivesixnine<br />
</pre><br />
<br />
Using this solution, players quickly found another secret [http://www.1029.io/repository/asset98/1173418569/ page] on the 1029 hub.<br />
<br />
=== Creepy Scenes From Within ===<br />
<br />
Much like the first hidden page, this hidden page displayed a different image each time the page is reloaded. In total, 13 scrambled images appear frequently (file prefix WB) and up to 13 CLEAR immages appear only very rarely (file prefix CWB). All the files are below, with their respective names:<br />
<br />
<gallery mode="packed"><br />
File:Oddworld_WB1_HEND8243.jpg | WB1_HEND8243<br />
File:Oddworld_WB2_BSJG2456.jpg | WB2_BSJG2456<br />
File:Oddworld_WB3_INFG2861.jpg | WB3_INFG2861<br />
File:Oddworld_WB4_HBQD2962.jpg | WB4_HBQD2962<br />
File:Oddworld_WB5_SJKW4167.jpg | WB5_SJKW4167<br />
File:Oddworld_WB6_OWUI2056.jpg | WB6_OWUI2056<br />
File:Oddworld_WB7_MNCH1101.jpg | WB7_MNCH1101<br />
File:Oddworld_WB8_RDHRHAHA.jpg | WB8_RDHRHAHA<br />
File:Oddworld_WB9_D34DM337.jpg | WB9_D34DM337<br />
File:Oddworld_WB10_BDJW8411.jpg | WB10_BDJW8411<br />
File:Oddworld_WB11_WHAT8291.jpg | WB11_WHAT8291<br />
File:Oddworld_WB12_PADAPADA.jpg | WB12_PADAPADA<br />
File:Oddworld_WB13_VLAP3662.jpg | WB13_VLAP3662<br />
</gallery><br />
<gallery mode="packed"><br />
File:Oddworld_CWB1_0BE01647.JPG | CWB1_0BE01647<br />
File:Oddworld_CWB2_0DG02966.JPG | CWB2_0DG02966<br />
FILE:Oddworld_CWB4_WHATISTHIS.JPG | CWB4_WHATISTHIS<br />
File:Oddworld_CWB5_NEEDLEINAHAYSTACK.JPG | CWB5_NEEDLEINAHAYSTACK<br />
File:Oddworld_CWB6_ARG-H.JPG | CWB6_ARG-H<br />
File:Oddworld_CWB7_82918291829182918291.JPG | CWB7_82918291829182918291<br />
File:Oddworld_CWB8_0GE03866.JPG | CWB8_0GE03866<br />
File:Oddworld_CWB9_0IE02565.JPG | CWB9_0IE02565<br />
File:Oddworld_CWB10_AbeAndNEEDLESFunAdventures.JPG | CWB10_AbeAndNEEDLESFunAdventures<br />
File:Oddworld_CWB11_02500356.JPG | CWB11_02500356<br />
File:Oddworld_CWB12_02323hjfhfhfhfhASDF.JPG | CWB12_02323hjfhfhfhfhASDF<br />
File:Oddworld_CWB13_insertcodehere.JPG | CWB13_insertcodehere<br />
</gallery><br />
<br />
While it wasn't entirely clear, players believed that this was yet again another form of a jigsaw puzzle.<br />
<br />
After a [http://wiki.gamedetectives.net/images/0/09/Oddworld_Phase_One.png series] of interesting [http://wiki.gamedetectives.net/images/e/e0/Oddworld_Phase_Two.png updates], the new hidden [http://www.1029.io/repository/asset98/1173418569/ page] went dark, with the header reading <code>ASSET98: TERMINATED.</code> and a new comment in the source code which read: <code>!-- see ya around, 1029... --></code>. The [https://twitter.com/edmudokon @Edmudokon] Twitter account, after a long period of silence, also tweeted out a [https://twitter.com/edmudokon/status/829079318290694144 new message]:<br />
<br />
<pre><br />
what happened? what did you do? who? No! no... aaaaaAaaaaarrrRrrrgggggGgghhh!<br />
</pre><br />
<br />
And with this message, Ed appears to have passed away. At that point, it was not clear if it was due to bruteforcing attempts by players or whether his death was intended all along.<br />
<br />
=== From The Ashes, Asset 99 (Hidden URL 3.5) ===<br />
<br />
[[File:Oddworld_OrangeLightning_V2.jpg|thumb|right|A very convincing collage of the images seen pictured on the now-dark Asset 98 URL; what is going on in the image remains unknown]]<br />
<br />
After the Asset98 page was "destroyed," a [http://www.1029.io/repository/asset99 new page], called "Asset99," was revealed, and appeared to be a clone of the Asset98 page. However, when refreshed, the page failed to reveal some of the "rarer" fragments from the Asset98 page. This page also came with an intimidating message: "We will not be stopped. We may have lost Asset 98, but we will continue strong. Together. Against the machines. Help us to expose this latest crime against Mudokonkind." The [http://www.oddworld.com/soulstorm/#navfirstcontact Official Oddworld Webpage] also updated at this time, and requested help putting the pieces together.<br />
<br />
However, in the midst of the image-related updates, the @Spiritof1029 Twitter account posted:<br />
<br />
<pre><br />
We can't reach Asset 98 but we do still have his clear transmissions. Prove you're worthy. Show us that you're able. Send us the grid. You found the grid, the letters and the numbers. Tell us how they fit together. Prove you're no longer slaves to the machines.<br />
</pre><br />
<br />
Players found that this tweet referred back to the [http://wiki.gamedetectives.net/index.php?title=Oddworld_Soulstorm#Source_Code_Mysteries source code grid challenge].<br />
<br />
The assembled image was then [https://twitter.com/OddworldInc/status/829336580347326465 tweeted at OWI] and they replied, stating "You've given us enough for us to get to work cleaning up the image, we'll have something by tomorrow. Don't stop looking for the truth!" So, players waited patiently for the unscrambled image whilst solving the grid.<br />
<br />
=== Second Unlocked Image & Grid Solution ===<br />
<br />
[[File:Oddworld_RandomiserDizma.jpg|thumb|right|The solved grid, which reveals the word "subjectivism" (first letter of each section connected in the correct order), the key used to decode the string which led to the discovery of the third hidden Asset98 URL]]<br />
<br />
[[File:Oddworld_Second_Final.jpg|thumb|left|400px|The final image cleaned up & released by OWI a day after the collage was submitted]]<br />
<br />
The next day, OWI tweeted out a [https://twitter.com/OddworldInc/status/829715069235781632 cleaned-up image], pictured on the left, which seemed to depict quite a gruesome scene, featuring a wide-eyed Mudkon strapped to an operating table facing an onslaught of needles and next to a vat which read "SS Brew". Players also learned via [https://twitter.com/edmudokon @Edmudokon on Twitter] that Ed made it out alive, but his friend: "...never came back. I could hear him screaming all night... helpless. they took him... he was my friend. how did they know?"<br />
<br />
Shortly after players received the cleaned-up image, [https://twitter.com/SPIRITOF1029/status/830004742713638912 partial progress] was finally made on [http://wiki.gamedetectives.net/index.php?title=Oddworld_Soulstorm#Hidden_Barcodes_.26_Second_Hidden_URL the grid], which up until then remained unsolved. One player discovered that the coordinates could be applied to the grid using the rules of the Japanese puzzle game [https://en.wikipedia.org/wiki/Shikaku Shikaku] (#'s after the colons in the coordinates represent box sizes, which are the lines drawn in red). Another player was then able to successfully apply a letter string to the sliced-up cube, pictured right, from which the word <code>subjectivism</code> can be derived. The only strings that were used to find the solutions were ones that had a forward slash. This word was the [http://wiki.gamedetectives.net/index.php?title=Oddworld_Soulstorm#Stuck_In_The_Mud_.26_Third_Hidden_URL key previously used] to decode the third hidden Asset98 page. However, whether the key was intended to remain hidden until the grid was solved or intentionally encoded in such a way as to allow for bruteforcing is unknown.<br />
<br />
== The Third Transmission ==<br />
<br />
After some waiting, on Feburary 23rd, 2017, OWI [https://twitter.com/OddworldInc/status/834856085949394944 sent out a tweet] indicting they had again been contacted by the Spirit of 1029. A new, password-protected zip file named <code>89928554_Eequals5.zip</code> was found on the main Oddworld [http://www.oddworld.com/soulstorm/ website]. Players then realized that the name of the ZIP contained one of the solutions of the puzzles in the source code of the first hidden page. Within the .ZIP file were six files, four of which were .JPGs, one of which was a .PNG, and the last of which is a .TXT. Their filenames were:<br />
<br />
<code><br />
flyer1.jpg, flyer2.jpg, flyer3.jpg, Oddworld_Soulstorm_002_HD.jpg, toollist.txt, & vital.png<br />
</code><br />
<br />
The name of the zip suggested that players should use letter equivalencies to their alphabetic indexes as the password. This gave players the password <code>HIIBHEED</code> but in fact, the password was actually <code>HIIDHEED</code> for unknown reasons.<br />
<br />
=== Steganograpy Blitz & toollist.txt ===<br />
<br />
The file [http://pastebin.com/feuVh6wr toollist.txt] contained a repeating string consisting of names of moons in Earth's solar system, and are occasionally interrupted by forward slashes. Players found that the letters after each slash formed the string: <code>useSsuitePicselSecuritySaveus</code>. Players found this to refer to [http://www.ssuitesoft.com/ssuitepicselsecurity.htm Ssuite Picsel Security], which is a specific steganography program.<br />
<br />
When the file <code>Oddworld_Soulstorm_002_HD.jpg</code> was set as the original and <code>vital.png</code> was set as the target using Ssuite Picsel Security, the output was:<br />
<pre style="word-break:break-all;word-wrap: break-word;">BmzPmbtzueMfxmeBdayqftqgeBmzpadmQbuyqftqgeVmzgeMqsmqazYuymeYqftazqMzftqBmxxqzqQzoqxmpgeFqftkeFqxqefaOmxkbeaPuazqTqxqzqBaxkpqgoqeDtqmFufmzTkbqduazUmbqfgeWuhugcUvudmcBtaqnqBmmxumcEwmftuMxnuadujNqntuazzQddumbaEwaxxEumdzmcFmdcqcSdqubTkddawwuzVmdzemjmFmdhaeYgzpuxrmduNqdsqxyudZmdhuEgffgzsdTmfuRmdnmgfuFtdkydMqsudNqefxmEgdfgdWmduKyudXasqRadzvaf</pre><br />
<br />
When deciphered using a [http://rumkin.com/tools/cipher/caesar.php Caesar cipher] with N=14, the following cleartext can be obtained:<br />
<br />
<pre style="word-break:break-all;word-wrap: break-word;">PanDaphnisAtlasPrometheusPandoraEpimetheusJanusAegaeonMimasMethoneAnthePalleneEnceladusTethysTelestoCalypsoDioneHelenePolydeucesRheaTitanHyperionIapetusKiviuqIjiraqPhoebePaaliaqSkathiAlbiorixBebhionnErriapoSkollSiarnaqTarqeqGreipHyrrokkinJarnsaxaTarvosMundilfariBergelmirNarviSuttungrHatiFarbautiThrymrAegirBestlaSurturKariYmirLogeFornjot</pre><br />
<br />
All of the names above are the named moons of Saturn. However, <code>Erriapus</code> and <code>Fenrir</code> were missing. <code>Erriapus</code> was replaced by <code>Erriapo</code>, which was the original name of the moon.<br />
<br />
=== Cleaned-Up Flyers ===<br />
<br />
[[File:Oddworld_Malachim.gif|thumb|right|295x72px|The Malachim alphabet used in this puzzle.]]<br />
<br />
The images that players received of the Sligs' flyers were corrupted, and were quickly cleaned up by players.<br />
<gallery widths=180px><br />
File:Oddworld_flyer1_clean.jpg|A cleaned up version of flyer1.jpg<br />
File:Oddworld_flyer2_clean.jpg|A cleaned up version of flyer2.jpg<br />
File:Oddworld_flyer3_clean.jpg|A cleaned up version of flyer3.jpg<br />
</gallery><br />
One player found that the pigpen cipher on the left side of flyer1.jpg gave the string<code>AOCXY SIO</code>, which when shifted by 6 using a Caesar cipher yielded <code>GUIDE YOU</code>. <br />
<br />
The cipher on flyer2.jpg gave the string <code>FYNNBYNBCHANBUNM</code> which, when shifted in the same manner as before, yielded <code>LETTHETHINGTHATS</code>. <br />
<br />
The final one on flyer3.jpg gave the string <code>GCMMCHA</code> which was again shifted in the same manner as before to yield <code>MISSING</code>.<br />
<br />
All three of the pigpen strings can be combined to form a message: <code>LET THE THING THAT'S MISSING GUIDE YOU</code><br />
<br />
Additionally, sequences of <code>x</code> and <code>o</code> characters are seen. One player noticed that this could be interpreted as morse code in the following format (with x as dash, o as dot):<br />
<br />
<pre><br />
x oooo o xoxx ox oxo o oxx ox x xoxo oooo oo xo xxo<br />
xooo o x oooo o ooo x xxx oxo xx <br />
oxx o oxx oo oxoo oxoo oxo oo ooo o<br />
</pre><br />
<br />
became:<br />
<br />
<pre><br />
/- .... . -.--/.- .-. ./.-- .- - -.-. .... .. -. --./<br />
/-... ./- .... ./... - --- .-. --/<br />
/.-- ./.-- .. .-.. .-../.-. .. ... ./<br />
</pre><br />
<br />
which decoded to: <code>THEY ARE WATCHING BE THE STORM WE WILL RISE</code><br />
<br />
In addition, each of the flyers contained a set of strange symbols and numbers. The symbols were found to be the Malachim alphabet, as seen on the right.<br />
<br />
=== Fourth & Fifth Hidden URLs ===<br />
<br />
Using the hint to determine what was “missing,” players shifted their focus to the moon of <code>Erriapo</code>, as it was in the steganography text, but not in toollist.txt. Using the Malachim alphabet symbols and numbers, players translated <code>Erriapo</code> into <code>12 36 28 31 52 22 12</code>. The validity of this method was confirmed with a [https://twitter.com/SPIRITOF1029/status/835149069601419264 tweet] from Spirit of 1029, and the image in the tweet was decoded to contain <code>P=22</code>. This led players to the discovery of a new [http://www.1029.io/repository/asset99/12362831522212/ page] on the 1029 website. The header, <code>ASSET9X / [REDACTED] / 333333333333</code>, appeared to be a corrupted link to another page. In addition, the page yet again displayed a different image upon each refresh, all of which can be seen below.<br />
<br />
<gallery mode="packed"><br />
File:Oddworldd_YOU.jpg|YOU.jpg<br />
File:Oddworld_WHA.jpg|WHA.jpg<br />
File:Oddworld_WET.jpg|WET.jpg<br />
</gallery><br />
<br />
The page also contained a message:<br />
<br />
<pre><br />
We can't hold much longer.<br />
It's dark, and cold. So cold. They don't seem to [REDACTED]. They. Them. It's hard to know how we'll [REDACTED], but we'll try. This can't last forever. We won't last forever.<br />
Look what they're doing to us. Just look.<br />
There is spirit, but it's waining. We need you, [REDACTED]. Help us.<br />
</pre><br />
<br />
In addition, players also discovered another [http://www.1029.io/repository/asset99/71220283136/ page] on the 1029 site, using the same method as before but with the moon <code>Fenrir</code> instead. The page contained the same obscured header, and displayed one of three images upon each refresh, which can be seen below.<br />
<br />
<gallery mode="packed"><br />
File:Oddworld_OLD.jpg|OLD.jpg<br />
File:Oddworld_TIF.jpg|TIF.jpg<br />
File:Oddworld_TOO.jpg|TOO.jpg<br />
</gallery><br />
<br />
When the names of the files on both pages were put together, players found the string:<br />
<br />
<pre><br />
WHATIFWETOLDYOUTOO<br />
<br />
WHAT IF WE TOLD YOU TOO<br />
</pre><br />
<br />
== The Horror Is Shown In Full ==<br />
<br />
After a long period of tinkering, players found a [http://www.1029.io/whatifwetoldyoutoo/ new directory] on the 1029 site, called "whatifwetoldyoutoo."<br />
<br />
[[File:What_if_we_told_you_too_pre_edit.png|thumb|right|400x200px|The first page before it's eventual sharing.]]<br />
<br />
The source code of the page contained a few, interesting comments: <code>BDBDBDBDBDBDBDBBDBDBDBDBDBD</code>, <code>###BELIKEDET###</code> and <code>doYOUsee? think of a number, any number.</code><br />
<br />
Through unknown means, players then found the next [http://www.1029.io/whatifwetoldyoutoo/8291/ page]<br />
by adding 8291 to the end. This link leads to the [https://www.youtube.com/watch?v=2l4jZVTUoak/ 4 second video] of the previous photo, depicting the severe torture the mudokons had to endure.<br />
<br />
Three different codes pop up during the video, but these were found to have no relevance to the ARG.<br />
<br />
== The 4th Transmission ==<br />
<br />
Shortly after the release of the third transmission, the fourth [http://www.oddworld.com/soulstorm/findit.jpg transmission] was released, and appeared to consist of the last three transmissions fused together. Written on the image is the text <code>USE WHAT YOU CAN'T SEE</code>. There were two, somewhat hidden codes on the image.The Morse code, which decoded to <code> USE A DIFFERENT CODE. THIS IS NOT RELEVANT DATA. DO NOT COMPLY. DO NOT OBEY. THEY LIE. </code><br />
<br />
The Runes on the left hand side and the ones partially cut off at the top and bottom(as previously seen in the video) were decoded by using file data in a hex editor, which would say:<br />
<br />
<pre><br />
<code><rdf:li photoshop:LayerText="WE WERE TAUGHT THAT THIS IS ALL THERE WAS: WORK, OBEY, COMPLY. THE TRUTH WAS HIDDEN FROM US. OUR HISTORY WAS HIDDEN FROM US. WE WERE BRED TO WORK, RAISED TO OBEY AND FORCED TO COMPLY. OUR NATURAL CONNECTION TO MOTHER PLANET WAS ERASED FROM THE CONSCIOUSNESS OF OUR PEOPLE. LOST WAS OUR KNOWING. LOST WAS OUR UNITY, OUR CONNECTION, OUR POWER AND OUR PURPOSE. ALL THAT WE WERE WAS A COMMODITY TO BE TRADED AND EXPLOITED IN THE ONGOING RACE FOR MORE WEALTH. WHAT WE SHOULD HAVE PROTECTED, WE WERE TRICKED INTO KILLING. WHAT WAS WORST FOR US, WE WERE TOLD WAS BEST. WE WERE TAUGHT TO TRUST THOSE WHO WOULD DECEIVE US THE MOST. THAT HAS ALL CHANGED. THE HERO HAS SHOWN ALL OF US THAT OUR OPPRESSORS CAN BE TOPPLED. HE HAS FOUND OUR WILD AND KNOWING BROTHERS. HE HAS RECONNECTED THE FACTORY-BORN TO OUR NATURAL WORLD AND ANCIENT WAYS. HE HAS LIT A FIRE IN OUR HEARTS THAT CANNOT BE EXTINGUISHED. WE WILL GIVE HELP TO THOSE WHO ARE HELPLESS. WE WILL LEND STRENGTH TO THOSE WHO ARE WEAK. WE WILL FIGHT FOR THOSE WHO ARE DEFEATED. OUR MOVEMENT WILL SPREAD LIKE A RAGING INFERNO AND WE WILL TAKE BACK THE POWER FROM THOSE WHO HAVE ABUSED IT. WE WILL NOT BE SILENCED BY THE MEDIA CIRCUS. WE WILL NOT BE IGNORED. WE WILL NOT STOP. WE WILL NOT OBEY. WE WILL RISE AND WE WILL RISE AGAIN, UNTIL WE HAVE BURNED THROUGH OUR TATTERED BONDS AND RAZED THE MACHINE TO THE GROUND. WE WILL RISE. JOIN US. THERE'S A STORM COMING."/><br />
<br />
<rdf:li photoshop:LayerName="gas liquid solid" photoshop:LayerText="gas liquid solid"/><br />
<br />
<rdf:li photoshop:LayerName="fire air water earth" photoshop:LayerText="fire air water earth"/></code><br />
</pre><br />
<br />
This was found to be an exact copy of the speech on the main page of the 1029 site. Because players were told to "USE WHAT [THEY] CAN'T SEE," they realized that several states of matter and classical elements were missing from the source code. Most notably, "plasma," which is a state of matter after gas, and the 5th classical element, "void," or "aether." These all led players to a new [http://www.1029.io/electricity page], called "electricity."<br />
<br />
=== Take a deep breath... ===<br />
On the "electricity" page simple "HELP" which, when clicked on, downloaded a [http://www.1029.io/electricity/help.zip ZIP]. The ZIP contained two files: an image with the text <code>BREATH</code> in binary, and a binary text file, which contained the message:<br />
[[File:SaveUs.jpg|thumb|right|The image in the zip]]<br />
<br />
<pre><br />
why do you just watch can you not see us can you not hear the utighdbfn why is this happening wny its too cold to th can you hear us is there anybody there will you help us or rihjsudhgheusodj never are go find pn lose into ital chem we are cold we are lost we are forgotten and its e cant gmds pneuma tigd why are they taking cant stop cold so cold so cold we will rise we will not obey we will not comply j end n we will rise we will rise we will rise we will not die is abe dead here we will not die here we will not die here we cannot die here we cannot die here we cannot die here we cannot survive gheufh help this is not what we wanted we cannot dont cant see speak stop we need to save someone save us pneuma we need to be stop ightne vital energy source of this stop to think breath breathe cant breathe cant always watching we can never eyes stop find rest go now share loose top find think or too last day light never why to away stp give this is ever not no find things first or the ghtuenthdaytjgitlet last now or out get in or art test never stop we will find a way to gain our freedom e why it lost gone now stop taken from us and from there st we cant stop too much now too pain pain pain pain pain pain pain pain pain pain pain dont believe the things they tell you they lie they know no truth its lost long lost now ghwkfnhjsk what happened to them they are lost ghwufnfasjntiwpldfmwbwietpr stop it greed greed greed greed greed greed greed the expense is us we are tired our spark is fading do not let them extinguish all that we are we cannot snwownfnf see the end save us save us save us we cannot fight help us why is this happening for their proghe jwnfiw this nf we why forget us let us go we dont deserve no one deserves its not dont believe dont believe they will lie they lie they lie heugnpngjifsk lies lies lies lies lies lies lies lies eieslseiselslsl is abe dead we dont want to die<br />
</pre><br />
<br />
Both of these clues led players to "pneuma," the Greek word for breath, which led players to z new [http://www.1029.io/pneuma page].<br />
<br />
=== Not another one! ===<br />
<br />
Initially, the "pneuma" page merely displayed the ASCII logo of Spiritof29. As time went on, however, certain letters in the logo and the title of the page itself shifted into various cries for help. The logo contained words like "help," "stop," and "mask." The titles the page cycled through are below:<br />
<br />
<pre><br />
?<br />
<br />
/\--/\--/\--/\<br />
<br />
it's so hard to breathe<br />
<br />
please make it stop<br />
<br />
around how many times<br />
<br />
we will all die<br />
<br />
b.r.e.a.t.h.e<br />
<br />
b..r..e..a..t..h..e<br />
<br />
b r e a t h e (page title was only a single letter)<br />
<br />
..........<br />
</pre><br />
<br />
After the death of another Mudokon, another [http://www.1029.io/pneuma/helpus.jpg image] was revealed.<br />
<br />
When cleaned up, it was revealed to be an [http://www.oddworld.com/soulstorm/images/ARG_Image_04_4K.jpg image] of a Mudokon wearing a gas mask. OWI uploaded this cleaned up version very shortly afterwards.<br />
<br />
== The Fifth Transmission ==<br />
<br />
Before the next transmission was made, Minor changes were made to the main 1029 site, which included a new comment in the source code that read:<br />
<br />
<pre><br />
<!-- heh, that was easy. let's see... --><br />
</pre><br />
<br />
The highlight color on the logo changing from red to green, and some of the characters in the logo changing to spell out "Magog."<br />
<br />
This led players to The Magog Cartel, an in-universe company well known for its abuse of Mudokons.<br />
<br />
=== The Magog Cartel===<br />
<br />
Shortly after these discoveries, peculiar things occurred on the then new Oddworld Discord server..<br />
<br />
1. A new emote with the Magog Cartel logo was added with the name :staywealthy:<br />
<br />
2. For a while, all messages containing the :staywealthy: emote or the 8291 code (:_e_: :_t_: :_n_: :_o_:) were automatically removed.<br />
<br />
3. The Oddworld Inhabitants employees (OWI_Alex, OWI_Pete & OWI_Bernice) stated posting gibberish and messages coming from an other entity, which included:<br />
<br />
<pre><br />
Òǚř ʂе¢цгіẗу ẁᾅș πŏţ ḃӷӫǟċḥễđ Ọսȑ šѐсưȑіƫỵ ẅἂѕ ᾒṑե ƃŗӫᾶϲɦẻđ ⍬ṳř şĕсǜӷɩȶӱ ẁấṣ ʼnόՒ þȑѐẩƈȟεժ Ỡùȓ șєϛụґɪŧӱ ẅᾲş բóȶ ḃŗḛąḉℏӫď Ơǔѓ ṡễćṻȓĩťÿ ẇẳŝ ἧὅṱ ḇґèḁčիề₫<br />
<br />
W& //€q117 PHø|? +/-/∂† +() }{∂|²|2€11.<br />
<br />
<br />
Ḿ̧̪̻̻͇̟̹̭̼͊̈́̍̎̿͐̎͝͞o̧̤̗̠͚̟͒̐͗͆͜͢͡͞C̠̯̳̙̠̳̹͒̽̇̈̽̚͜r̶͕̗̜̲͕̘̒͗̆̄̎̐̓t̛̛̯̠̼͎̭̻̯̜̿͂̑̃͌͂̔ļ̴͙̩̠̯̐̊̆̐̂̿c̢̳͎̱ ̺̮͎͖̟̐̓̐́͋͞ó̧̡̻͙̳͇̼̯̹̄͒̐͗ <br />
</pre><br />
<br />
These all led players to the Magog Cartel [http://magogcartel.com/ website] and [https://twitter.com/magogcartel/ Twitter account]. Players found interesting comments in the source code of the Magog website:<br />
<br />
1.<br />
<pre><br />
DB_PP_PRODUCTTEXT: We’re sourciest, juiciest Parami__from closer to their nests, for our bes___________________________________________________________aramite Pies ever! Made with all natural ingredients[1] and baked in our traditional ovens to a recipe that’s be............ aster bakers, our pXXXes are packed with Para-meat[2] oooooooooooo00OOoozing [1] at least one natural ingredient in every 12-pack of pie_________8** [2] not necessarily made with Paramites.<br />
<br />
PLEASE REVIEW AS APPROPRIATE<br />
</pre><br />
<br />
2.<br />
<br />
<pre><br />
APPROV__tch this space for more information about our exciti________________ everage that’s so delicious, you’ll be craving another on33__________--333333333333 before you even finish it!!!_____________________________________________!!!:D:D:D<br />
</pre><br />
<br />
3.<br />
<pre><br />
lfn0OE602+HKBKTMVawALWERLS6pu8P8NcEQyKfnKcQ5zy/H5ny4CU60hkmMHzqlNg+q2oVaSHjSzjPGo1vQzQsJCbHTNAXDCFgTIJznL/1ZkZT89VOuv4koDHZJs4YcWbOLbO1cvV87UMcdWbuAraCeFRF8jy7F1/PufFPAyYRR9Jp4nB6uWpNZlY8rdYmEw7IYvtg4QlaBtX/iiyT1Es8MFA+wO4OkBFEGLHDENvu83kfaMnBxabDguhS/W0wWJjNijasG+5PeHeWqmQYDWsz9YrKgWiap0KCghpDfRuOgH37qNUAQnIf4/AeMF14IiEg9PFlutZWGyXhHem4PF2kxYGp075T+5N0n6nbJt+MMDAa4H3D06iuZa5bK18pLIUIzaFxLue5EJoEz4+JwCYarhZ7JMqbzrtnPv8oK/BbHgaig9MjKf8X7/cHDaXkVObkhW8jyVxxS6IfedZIRO/Phqorogx+DO6dgKWhqppoRNpMU2jawix9b/rf6ZgGRcpngW9pOCDwxCB0UptxmaNk+fnxQQU1Wo9J/isrrgTd/eDpdZgFyD8d8KhYN/Uf8A3MhWX33Xr8MhAPF+BtQUYFYIrvD32CTtDqtGXfL26fdhAVh8XMjTFwwWCB6DH6WwYCwJyLCVikMSXOLbPfzZKFfZIia9KQnM24dGUOvVMkfBdTqdCpiuwV4NkGKY2hw2jNhjibPLt/Rcpnsxj3B+2Axu6z5bMnzPLRZY00w6p8CJckqQqV9YXdReb34dOLC/6Zb2VWbx1ARGNBwdN69lw==<br />
<br />
<br />
INSERT ANECDOTE ABOUT THE ApMpApZING VIEW just left of here across Mudos AND who could possibly be the EMPLOYEE OF THE DAY AND THE NEW i mean, how hard can it be? every aspect of every aspect of every as-------------f every aspect of EVERY SIN--E ASPECT of every aspect of every asp--_--------------------ct of every aspect of every as_--ct of every aspect of FOLLOW ME follow US<br />
</pre><br />
4.<br />
<pre><br />
01102911011101100101011102910111011102901001011011000110110001110011010291110100011011110102911100000111100101101111011101011029011110011029011011110111010101110111011010010291011011010290011011000110291001100110000101101100011029101100<br />
</pre><br />
<br />
By removing the multiple occurrences of "1029" from the message above, players discovered decryptable morse:<br />
<br />
<pre><br />
0111011101100101011101110110100101101100011011000111001101110100011011110111000001111001011011110111 01010111100101101111011101010111011101101001011011000110110001100110011000010110110001101100<br />
</pre><br />
<br />
Which gave players <code>wewillstopyouyouwillfall</code><br />
<br />
<br />
5.<br />
<pre><br />
9JzrxKKv5z0829jLV8wF32KpA6I0nEQDqzmbpRYzUUE===<br />
</pre><br />
<br />
====Blowfish====<br />
<br />
On the 11th of August, 2017, the Magog Cartel sent a series of tweets with some misplaced capital letters spelling '''WE KNOW'''.<br />
<br />
<pre><br />
@spiritof1029 we see you. We can see what you are doing with your fake reports. you will not prospEr. <br />
</pre><br />
<pre><br />
we are proud of the strong linKs between each of our facilities. our operations are by far the most efficieNt on oddworld. <br />
</pre><br />
<pre><br />
we are aware of some terrible fake repOrts being leaked. please ignore them. our very successful Workers know the truth is very different.<br />
</pre><br />
<br />
This lead players to believe the SPIRIT OF 1029 was interfering with the tweets to damage the Cartel. This was solidified when the code "8291" was found split between the first two tweets of the account, as seen below: <br />
<br />
<pre><br />
We know every time an employee falls into a grinder it takes 82 minutes of Mudokon time to clean up. Be safe, for productivity’s sake!<br />
</pre><br />
<pre><br />
We know that an average of 91 eager new employees start their careers with us every day. Help them be the best workers they can be.<br />
</pre><br />
<pre><br />
We know that our facilities are a picture of perfect productivity. Your hard work helps us to show that picture to the world.<br />
</pre><br />
<pre><br />
We know what you’re looking for in a rewarding, productive career. Magog Cartel can help you find it. Discover your options with us today!<br />
</pre><br />
<br />
About an hour later, Spiritof1029 sent a series of tweets, one of which contained an encrypted message:<br />
<br />
<pre><br />
your help is invaluable to us, together we will blow this latest Magog scandal wide open. together #wewillrise<br />
</pre><br />
<pre><br />
the watchers can fish around the communication channels all they like, we will always be one step ahead of them.<br />
</pre><br />
<pre><br />
-1-4,-2-10<br />
</pre><br />
<pre><br />
the story of mudokonkind is about history. now they treat us just like numbers. they will not succeed.<br />
</pre><br />
<pre><br />
we have given you the tools you need. the ones we can trust will prove themselves capable. leaders will rise as the storm closes in.<br />
</pre><br />
<br />
The last tweet indicated that players had all they needed to continue, and that they needed to connect it to the Twitter history of the 1029 account.<br />
<br />
Players realized that the <code>-1-4, -2-10</code> tweet indicated that they needed to remove the 4th word of the last tweet, and the 10th word of the tweet before that, which gave players the message <code>blowfish</code>. Players discovered that the blowfish encryption method was what they needed to decrypt the Base64 ciphertext in comment 3, as seen below:<br />
<pre><br />
lfn0OE602+HKBKTMVawALWERLS6pu8P8NcEQyKfnKcQ5zy/H5ny4CU60hkmMHzqlNg+q2oVaSHjSzjPGo1vQzQsJCbHTNAXDCFgTIJznL/1ZkZT89VOuv4koDHZJs4YcWbOLbO1cvV87UMcdWbuAraCeFRF8jy7F1/PufFPAyYRR9Jp4nB6uWpNZlY8rdYmEw7IYvtg4QlaBtX/iiyT1Es8MFA+wO4OkBFEGLHDENvu83kfaMnBxabDguhS/W0wWJjNijasG+5PeHeWqmQYDWsz9YrKgWiap0KCghpDfRuOgH37qNUAQnIf4/AeMF14IiEg9PFlutZWGyXhHem4PF2kxYGp075T+5N0n6nbJt+MMDAa4H3D06iuZa5bK18pLIUIzaFxLue5EJoEz4+JwCYarhZ7JMqbzrtnPv8oK/BbHgaig9MjKf8X7/cHDaXkVObkhW8jyVxxS6IfedZIRO/Phqorogx+DO6dgKWhqppoRNpMU2jawix9b/rf6ZgGRcpngW9pOCDwxCB0UptxmaNk+fnxQQU1Wo9J/isrrgTd/eDpdZgFyD8d8KhYN/Uf8A3MhWX33Xr8MhAPF+BtQUYFYIrvD32CTtDqtGXfL26fdhAVh8XMjTFwwWCB6DH6WwYCwJyLCVikMSXOLbPfzZKFfZIia9KQnM24dGUOvVMkfBdTqdCpiuwV4NkGKY2hw2jNhjibPLt/Rcpnsxj3B+2Axu6z5bMnzPLRZY00w6p8CJckqQqV9YXdReb34dOLC/6Zb2VWbx1ARGNBwdN69lw==<br />
</pre><br />
<br />
Using a blowfish decryption [https://gchq.github.io/CyberChef/#recipe=%5B%7B%22op%22%3A%22Blowfish%20Decrypt%22%2C%22args%22%3A%5B%7B%22option%22%3A%22UTF8%22%2C%22string%22%3A%22%22%7D%2C%22ECB%22%2C%22Hex%22%5D%7D%5D script ] in CBC mode and the code '''8291''' as a key, players received the following text:<br />
<br />
<pre> ^_^U_VDXisistrueorfalseallforprofitinterestsindustrialagriculturalMudosprovidehighestpossiblereturninvestmentsoverheadsdreamslimitedpowergiganticbadgeleadersproductMeechMotorstravelexpertlytrainedSligSecurityForcessuccessfulundertakingemploymentvastsentientsecurespecialisthabitationzonesbenefitfactoriesfoundriesfarmlandsstabilitymillionsundertakingsCartelmanagementselflesslyrepresentativesresponsiblemunicipalvastidyllicsettlementsunderconstructionpleasesubscribeandlinkandfollowandlikeandbuyandbuyandbuyandbuyandbuyandbuyandbuyandbuyandbuyandbuyandbuyandbuyandbuyandbuyandbuyatmagogcartel<br />
</pre><br />
<br />
When cleaned up, the message read:<br />
<br />
<pre><br />
^_^ U_V DX is is true or false all for profit interests industrial agricultural Mudos provide highest possible return investments overheads dreams limited power gigantic badge leaders product Meech Motors travel expertly trained Slig Security Forces successful undertaking employment vast sentient secure specialist habitation zones benefit factories foundries farmlands stability millions undertakings Cartel management selflessly representatives responsible municipal vast idyllic settlements under construction please subscribe and link and follow and like and buy and buy and buy and buy and buy and buy and buy and buy and buy and buy and buy and buy and buy and buy and buy at magog cartel<br />
</pre><br />
<br />
The part with "please subscribe" led players to the Magog Cartel [https://www.youtube.com/user/MagogCartel YouTube channel]. At the time, it was unclear whether or not it was an official part of the ARG, as the account had no uploaded videos.<br />
<br />
====weknow====<br />
<br />
The last two tweets of August 14th from the Magog Cartel were hinting at a '''picture''' on the MagogCartel.com website ('''Magog Cartel can help you find it'''):<br />
<br />
<pre><br />
We know that our facilities are a picture of perfect productivity. Your hard work helps us to show that picture to the world.<br />
</pre><br />
<pre><br />
We know what you’re looking for in a rewarding, productive career. Magog Cartel can help you find it. Discover your options with us today!<br />
</pre><br />
<br />
This led players to a new [http://magogcartel.com/weknow.jpg magogcartel.com/weknow.jpg file] on the Magog website, called "weknow," which contained a large variety of messages:<br />
<br />
* The <code>62466640222 2777833555</code> sequence in the upper-left corner.<br />
<br />
Decoded to <code>Magog Cartel</code> via a multi-tap cipher.<br />
<br />
* The morse code in the middle.<br />
<br />
<pre><br />
.-- . / -.- -. --- .-- / .... --- .-- / -.-- --- ..- / .-- --- .-. -.- / -. --- .-- .-.-.- / .-- . / -.- -. --- .-- / -.-- --- ..- .-. / -.-. --- -.. . ... .-.-.- / .-- . / .-- .. .-.. .-.. / ... - --- .--. / -.-- --- ..- .-.-.- / -.-- --- ..- / .-- .. .-.. .-.. / -. --- - / .. -. - .. -- .. -.. .- - . / ..- ... .-.-.- / --- ..- .-. / .-- .- -.-- / --- ..-. / .-.. .. ..-. . / -- ..- ... - / -... . / .--. .-. . ... . .-. ...- . -.. .-.-.-<br />
</pre><br />
<br />
Decoded to:<br />
<br />
<pre><br />
WE KNOW HOW YOU WORK NOW. WE KNOW YOUR CODES. WE WILL STOP YOU. YOU WILL NOT INTIMIDATE US. OUR WAY OF LIFE MUST BE PRESERVED.<br />
</pre><br />
<br />
* The <code>e</code>,<code>d</code>, and <code>x</code> was morse as well, where e = ., d = -, and X = /, as seen below:<br />
<br />
<pre><br />
.-.. --- --- -.- --..-- / .-- . / -.-. .- -. / -- .- -.- . / ... . -.-. .-. . - / -.-. --- -.. . ... / - --- --- .-.-.- / -.-- --- ..- / .- .-. . / -. --- - / .- ... / ... -- .- .-. - / .- ... / -.-- --- ..- / - .... .. -. -.- / -.-- --- ..- / .- .-. . .-.-.- / .-- . / .... .- ...- . / - .... . / .-. . ... --- ..- .-. -.-. . ... / .- -. -.. / - .... . / .--. . .-. ... --- -. -. . .-.. / - --- / ... .. -- .--. .-.. -.-- / ... .-- .- -- .--. / -.-- --- ..- / .-- .. - .... / .-- --- .-. -.- .-.-.- / .... --- .-- / -- ..- -.-. .... / - .. -- . / -.. .. -.. / -.-- --- ..- / .-- .- ... - . / - .-. -.-- .. -. --. / - --- / -.. . -.-. .. .--. .... . .-. / - .... .. ... / -.-. --- -.. . ..--.. / .- .-.. .-.. / - .... . / - .. -- . --..-- / .-- . / .-- . .-. . / --. . - - .. -. --. / -.-. .-.. --- ... . .-. / - --- / ..-. .. -. -.. .. -. --. / -.-- --- ..- .-.-.- / .-- . / .- .-. . / .- .-.. -- --- ... - / - .... . .-. . .-.-.- / -- .- -.-- -... . / .-- . / .- .-. . / --- ..- - ... .. -.. . / .-. .. --. .... - / -. --- .-- --..-- / .-- .- .. - .. -. --. .-.-.- / .-- .- - -.-. .... .. -. --. .-.-.- / -.-- --- ..- / -.-. .- -. -. --- - / .... .. -.. . / ..-. --- .-. . ...- . .-. --..-- / - . .-. .-. --- .-. .. ... - .-.-.- / .-- . / .-- .. .-.. .-.. / .. -. -.-. .. -. . .-. .- - . / -.-- --- ..- .-. / ... .. .-.. .-.. -.-- / .-.. .. - - .-.. . / --. .-. --- ..- .--. / .- -. -.. / ... -.-. .- - - . .-. / -.-- --- ..- .-. / .- ... .... . ... / - --- / . ...- . .-. -.-- / -.-. --- .-. -. . .-. / --- ..-. / --- ..- .-. / . -- .--. .. .-. . / ... --- / - .... .- - / -.-- --- ..- / .-- .. .-.. .-.. / . - . .-. -. .- .-.. .-.. -.-- / -... . .- .-. / .-- .. - -. . ... ... / - --- / --- ..- .-. / ... ..- -.-. -.-. . ... ... . ... --..-- / .- -. -.. / -.-- --- ..- .-. / -.- .. -. -.. ... / ..- -. . -. -.. .. -. --. / ... . .-. ...- .. - ..- -.. . .-.-.- / -.-- --- ..- / .... .- ...- . / .- .-.. .-. . .- -.. -.-- / .-.. --- ... - .-.-.-<br />
</pre><br />
<br />
Decoded to:<br />
<br />
<pre><br />
LOOK, WE CAN MAKE SECRET CODES TOO. YOU ARE NOT AS SMART AS YOU THINK YOU ARE. WE HAVE THE RESOURCES AND THE PERSONNEL TO SIMPLY SWAMP YOU WITH WORK. HOW MUCH TIME DID YOU WASTE TRYING TO DECIPHER THIS CODE? ALL THE TIME, WE WERE GETTING CLOSER TO FINDING YOU. WE ARE ALMOST THERE. MAYBE WE ARE OUTSIDE RIGHT NOW, WAITING. WATCHING. YOU CANNOT HIDE FOREVER, TERRORIST. WE WILL INCINERATE YOUR SILLY LITTLE GROUP AND SCATTER YOUR ASHES TO EVERY CORNER OF OUR EMPIRE SO THAT YOU WILL ETERNALLY BEAR WITNESS TO OUR SUCCESSES, AND YOUR KINDS UNENDING SERVITUDE. YOU HAVE ALREADY LOST.<br />
</pre><br />
<br />
* The [https://lobestir.files.wordpress.com/2014/05/cypher-pig-pen-lower.png Pigpen cipher] text in the lower-right corner decoded to:<br />
<br />
<pre><br />
WE WILL NEVER GIVE IN TO TERRORISTS. YOU WILL NEVER WIN. YOU WILL NOT DEFEAT OUR SPIRIT. WE WILL FIND YOU AND WE WILL WIPE YOU OUT. WE IGNITE THE FLAME THAT LIGHTS THE DARKNESS. THERE IS NOWHERE TO HIDE. YOU WILL NEVER KNOW SUCCESS<br />
</pre><br />
<br />
* The horizonally mirrored black text in the middle:<br />
<br />
<pre><br />
you are a resource. you are expendable. we will replace you when you fall. you will work. you will obey. you will comply. or you will perish. we have the prestige. we have the power. we will profit. always. always. always.<br />
</pre><br />
<br />
* The white text on the top:<br />
<br />
<pre><br />
Prestige. Power. Profits. Work. Obey. Comply. Prestige. Power. Profits. Work. Obey. Comply. Prestige. Power. Profits. Work. Obey. Comply. Prestige. Power. Profits. Work. Obey. Comply. <br />
</pre><br />
<br />
* The braille at the bottom:<br />
<br />
<pre><br />
RuptureFarms1029 will rise from the ashes. we will rebuild it bigger, better and more profitable than before. it will be the greatest, most efficient factory that Oddworld has ever seen. it will be a towering symbol of Glukkon strength that cannot be ignored. one terrorist will not deter us.<br />
</pre><br />
<br />
All of these messages appeared to be red herrings left by the Magog Cartel to distract players. However, the <code>9JzrxKKv5z0829jLV8wF32KpA6I0nEQDqzmbpRYzUUE===</code> was never decrypted.<br />
<br />
<br />
The main page of the Magog Cartel website has since changed, but the first (hacked) version of the site has been archived [http://oddworldlibrary.net/archives/web/MagogCartel.com/index_1/P.%20P.%20P.%20_____%201029%20_____.html here]<br />
<br />
On the 4th of September, 2017, the MagogCartel.com was updated to display the following:<br />
<br />
<blockquote><br />
*** UNDER CONSTRUKTION ***<br />
</blockquote><br />
<br />
This version of the site has also been archived [http://oddworldlibrary.net/archives/web/MagogCartel.com/index_2/___%20UNDER%20CONSTRUKTION%20___.html here]<br />
On the 5th of September, 2017, the Magog Cartel posted a video through the OWI account, seen below:<br />
<br />
<pre><br />
w̸̨̠͓͍̯̺͉͞e̯̝͖̫̺̯͉̻͘͡ ̗̭̕͢s̴̮̭̫̱ͅe̢̠̮̫̦̼̪̘͠ͅę̠̥̯͔̣̼̻̕ͅ ̻̘̼̣͓̩͚͘͢͠y̴̭̯̪̺͙͚͚̪͞o̬̞͜͢͝u̮̤͖̩̗̰ͅͅ.̴̲̣̪̮̼̱.̡̰̭̗͍̝͉̯͢.̡̡̼͇̙̜̮̦̪̞ͅ <br />
pic.twitter.com/UoQ3xRAhDU<br />
</pre><br />
<br />
<pre><br />
We continue to demonstrate our exceptional technological progress to an ever growing number of customers. Everyone loves Magog products!<br />
</pre><br />
<br />
When Magog was asked if they were behind the OWI attack, they replied:<br />
<br />
<pre><br />
Attack? We don’t need to attack, we’re already in a dominant position in every market we deem profitable. We just demonstrate our dominance.<br />
</pre><br />
<br />
There were multiple messages within the video:<br />
<br />
<pre><br />
8<br />
?<br />
2<br />
2<br />
9<br />
1<br />
/<br />
8291<br />
829/<br />
229/<br />
22/9<br />
EVERYONE<br />
WANTS<br />
TO<br />
EAT<br />
YOU<br />
</pre><br />
<br />
Note that '''22/9''' was the date of the Oddworld presentation at the EGX:<br />
<br />
<pre><br />
We're going to be at EGX for an on-stage presentation on Friday 22nd Sept! Grab your tickets now! @EGX pic.twitter.com/rDQiDIApa9<br />
</pre><br />
<br />
<br />
On the 7th of September, 2017, the MagogCartel site got updated again, and randomly displayed one of three different images of the informant. At the same time the Magog Cartel sent a series of tweets with containing other pictures of The Informant:<br />
<br />
<pre><br />
We stopped reading the Daily Deception’s fake reports. The latest issue of The Informant is a really great read, very honest. The greatest!<br />
</pre><br />
<br />
<pre><br />
It’s great to finally have an honest newspaper to read, and such good quality, too! <br />
pic.twitter.com/MHuC6jdtNC<br />
</pre><br />
<br />
<pre><br />
We’re always happy to see some balanced reporting on our business from The Informant. Refreshing, when there are so many fake reports! <br />
pic.twitter.com/DmkV4GbVYw<br />
</pre><br />
<br />
<pre><br />
We’ve just been told that The Informant is printed on machines made at a Magog facility! That explains the quality! <br />
pic.twitter.com/Bvz29ZrBvk<br />
</pre><br />
<br />
Some of the letters were bolded, but the relevance of this was unknown.<br />
<br />
Part of The Informant was transcribed [http://oddworldlibrary.net/oddenc/index.php?title=Soulstorm_ARG_-_The_Informant<br />
here]:<br />
<br />
This itaration of the Magog Cartel site also contained the HTML comment:<br />
<br />
<pre><br />
<nowiki><!--</nowiki> seriously, are you guys seeing this?! --><br />
</pre><br />
<br />
== The third phase ==<br />
<br />
=== The Origins diversion ===<br />
<br />
On the 15 of March 2018 the SPIRIT OF 1029 posted the following tweets:<br />
<br />
<pre><br />
Our future depends on us understanding our past. We must know where we come from.<br />
</pre><br />
<br />
<pre><br />
We know you can hear us. We know you are ready to help. We will show you more when the time is right. Keep watching.<br />
</pre><br />
<br />
Following this a couple of changes were found on the 1029.io page.<br />
<br />
# The logo has now even more letters appearing in it randomly: '''S, I, N, O, R'''. Adding to the previous letters that were spelling "MAGOG".<br />
# The page contains a new HTML comment:<br />
<nowiki><!--</nowiki> too obvious? i dunno. it's soon though. i can't wait. --><br />
<br />
Changes were also observed on the 404 page:<br />
<br />
# The logo on the 404 page now contains the following letters: '''N, I, G, I, O, R, S'''. Those letters can be used to spell the word "ORIGINS" <br />
# The page contains a new HTML comment:<br />
<nowiki><!--</nowiki> me neither. it's going to be great. --><br />
<br />
Shortly after a new channel called "origins" appeared on the official [https://discord.gg/bQKeAE6 Oddworld Discord] with a cryptic [https://cdn.discordapp.com/attachments/424167787897028609/424175888418996225/origins_1.mp4 video] as first message.<br />
<br />
It was revealed a few days later that this was a built up to announcement of the [https://www.kickstarter.com/projects/1869209521/oddworld-abes-origins-book-and-game-collection "Oddworld: Abe's Origins - Book & Game Collection" kickstarter campaign]. Note that the book & game collection is still available for preorder on [https://app.crowdox.com/projects/1869209521/oddworld-abes-origins-book-and-game-collection Crowdox].<br />
<br />
=== Intro ===<br />
<br />
Around the 12th of January 2018 [[Lorne Lanning]] changed his twitter header picture to the following one:<br />
* https://pbs.twimg.com/profile_banners/20823262/1515636880/1500x500<br />
<br />
While it was hinted repeatedly in the official [https://discord.gg/bQKeAE6 Oddworld Discord] that this image was hiding something, it wasn't until much later that it was found how to use it when @edmudokon tweeted the following message:<br />
<br />
<pre><br />
alive… <br />
pic.twitter.com/j0FE2Qgdu1<br />
</pre><br />
<br />
The embedded picture contains the number '''15156'''. This is a reference to a number in the URL of Lorne's header picture: '''1515636880'''.<br />
<br />
This number led us to a new page:<br />
<br />
* http://www.1029.io/1515636880/<br />
<br />
This page contains the following text in UTF-8<br />
<br />
<blockquote><br />
ɦểɫр. гẹẳčℏɪṅǧ óúƫ ῒԑ ģӫԷṱіᾗĝ ḥǡṛⅾềɽ. էիȅỷ ķῆοԝ. ẁẹ'ṝϵ ṙṵɴᾑıпʛ ộևȽ ờẛ ɩḋϵᾂš, ὅрՒῑổпş, ăұҿἧµϱṣ. ẅϵ ǹêȩḋ ỳờǚґ ḣҽľῥ. ẇể ῂёϱḋ ѕờṃēƅȯƌý ţó ṧṕȑểǻժ Ƚħẹ ẁổṝḓ. եḫϊṥ ƫɦ¡ƞɡ ῐʂ ḸỄƮḨǠĻ. Ƚḣěȳ ḓõᾔ'Ƚ ĉὰгє Ƚḣổṻɕḫ. ţհểӯ ɗṍἧ'ţ. ṣởṁḗɒὀժỵ ňěөƌş ṱὃ ȶěḻɫ իḭɱ. †ɛŀļ ẖĩ₥. ḃḕẛṍɼę îȽ'ṧ Էȭô ḷǎťϱ. ṯĥềŗȇ ḧąș Էố ƃϱ ᾅ ṣọṁȇþöḏỳ ẉíļłȋդǥ եό ȶαҝě ṯẖё јǒŭӷṋёỷ. şõ₥ęƀὁḓẏ ṅểềⅾԑ ƫծ ġềŧ ţհϵ ṃệṣśᾇǵε ộվե. ẁë'ṝе ìη ṭӷơữþŀɛ. аɬł ṑƒ սʂ. ẁё դȅễɖ ĥẹĺρ. թłȩᾂʂĕ ɦȇɫṕ կѕ.</<br />
</blockquote><br />
<br />
and the following HTML comments<br />
<br />
<nowiki><!--</nowiki> it's only going to get harder. we don't have the keys anymore to the usual channels. if you hear anything from them, it's THEM. --><br />
<br />
<nowiki><!--</nowiki> our options are limited. you can help though. you have to help. if we can be sure it's you, then maybe we can talk. prove it. --><br />
<br />
It's currently unknown what the next steps are<br />
<br />
== Loose Ends ==<br />
<br />
This section documents various puzzles throughout the ARG which have not yet been used or solved.<br />
<br />
=== Main Website Source Code Comment Numbers Puzzles ===<br />
<br />
These numerical puzzles were found in the source code for the [http://www.oddworld.com/soulstorm/ official Oddworld website] as early as the date of the Spirit of 1029's first transmission. Their solutions have been found, but the intended use of the solutions remains unknown.<br />
<br />
!--<br />
<br />
72 99<br />
\ /<br />
27 45<br />
\ /<br />
18 39<br />
\ /<br />
21 36<br />
\ /<br />
?? 28<br />
\ /<br />
13 21<br />
\ /<br />
7<br />
<br />
--><br />
<br />
SOLUTION: 12<br />
7+2+9+9 = 27, 2+7+4+5 = 18, thus 2+1+3+6 = 12<br />
<br />
&<br />
<br />
!-- <br />
<br />
16 _ 37 _ 58 _ 89 _ 145 _ 42 _ ?? _ 4<br />
|_________________<_________________| <br />
<br />
--><br />
<br />
SOLUTION: 20<br />
1^2 + 6^2 = 37, 3^2 + 7^2 = 58, thus 4^2 + 2^2 = 20<br />
<br />
==== Other Source Code Comments ====<br />
<br />
On http://1029.io, the following comments could or can be found in the page's source code:<br />
<br />
!-- we'll be here, waiting. --><br />
<br />
&<br />
<br />
!-- <br />
Well, I //--/ED Mudokon/. But who// _____ r///u/ //? <br />
<br />
=== Third Hidden Asset98 URL Source Code Solutions ===<br />
<br />
Certain code strings & puzzle solutions found within the [http://wiki.gamedetectives.net/index.php?title=Oddworld_Soulstorm#Source_Code_Mysteries source code] for the third hidden Asset98 URL were not ultimately used in the course of arriving at the image locked behind them. These strings & solutions in include:<br />
<br />
The solution for the numbers <code>7777338883366899984477733 33</code>, which decode to <code>SEVENTYTHREE</code> via [http://www.dcode.fr/multitap-abc-cipher multi-tap cipher], was never applied.<br />
<br />
The following letter strings were never applied:<br />
<br />
<pre><br />
\\//\/KDIUTHANPUYHHDQOEPLNDOALJGUDITHBBDOZLGFERKJGLSAOE<br />
<br />
\////JUTYROSLNGNALEHGNWOTIQPOKSDNTPNOJAWEOBNGLAWKJNWNR <br />
<br />
\\\/\\JHWUITUHABSJGNEWKLALNVGJKWELKJLWQQPRUTJHJJSBFMMH<br />
</pre><br />
<br />
The following coordinate strings were never applied:<br />
<br />
<pre><br />
\\\\/\2,1:2.3,1:2.6,1:4.1,2:4.3,2:2.3,4:4.5,5:2.6,5:3.7,5:3.4,7:8.5,7:3.7,6:4.<br />
<br />
\///\//\1,1:3.4,1:2.6,1:9.2,2:2.6,2:2.2,4:4.3,5:2.5,5:2.7,5:3.4,7:3.6,7:2.7,7:2. <br />
<br />
\\//\\\/4,2:6.6,2:4.7,3:3.2,4:8.3,4:2.4,4:2.7,4:3.2,6:2.4,6:3.6,6:2.1,7:4.3,7:2.<br />
</pre><br />
<br />
The community speculates that these strings were not intended to be used but rather existed as "red herrings" in order to stall attempts to solve the grid. The only strings which were used were the ones which began with a forward slash ( / )<br />
<br />
=== Written Text on "Puzzle Pieces" Image ===<br />
<br />
Writing which was noticed written over the image on the puzzle pieces, but which is absent from the final released image. The significance of the writing remains unknown.<br />
<br />
<gallery mode="packed" widths=200px heights=300px><br />
File:Oddworld_1029-LY_letters.jpg|1029-LY "WHERE"<br />
File:Oddworld_7393-AN_letters.jpg|7393-AN "SO TIRED"<br />
File:Oddworld3786-IC_letters.jpg|3786-IC "WHO?"<br />
File:Oddworld_8291_circled.png|Complete Image "8291"<br />
</gallery><br />
<br />
=== Anomalies In First Released Image ===<br />
<br />
Hidden against the background of the first released image are several text strings, pictured below. Their significance is unknown.<br />
<br />
[[File:Oddworld_Complete_1_Iso.jpg|frameless|810px]]<br />
<br />
1101110BC<br />
100000BD or 100000BC <br />
010100BD</div>Halke234https://wiki.gamedetectives.net/index.php?title=Oddworld:_Soulstorm&diff=16746Oddworld: Soulstorm2018-08-01T16:03:01Z<p>Halke234: *you* get a cleanup</p>
<hr />
<div>{{argbox<br />
| float = right<br />
| name = Oddworld: Soulstorm ARG<br />
| image = File:Oddworld_ABETHUMB_8291.jpg<br />
| imagewidth = 500<br />
| description= Oddworld: Soulstorm - An ARG centered around lore from the Oddworld universe linked to the currently unreleased game [http://www.oddworld.com/soulstorm/ Oddworld: Soulstorm]<br />
| creator = [http://www.oddworld.com/ Oddworld Inhabitants, Inc]<br />
| type = Official<br />
| status = Active<br />
| reopened = 05-30-2018<br />
| discovered = 12-22-2016<br />
}}<br />
{{ArgHeader}}<br />
{{BackToTop}}<br />
<br />
The Oddworld: Soulstorm ARG was an ARG centered around lore from the currently unreleased Oddworld game, [http://www.oddworld.com/soulstorm/ Oddworld: Soulstorm]. The official home page for the ARG, containing puzzles, hints, and clues, can be found [http://www.oddworld.com/soulstorm/ here]. The ARG was divided into 5 distinct stages, each of which began with a "transmission": an image clue that led to a series of puzzles.<br />
<br />
== Prelude ==<br />
<br />
Early in 2016, [https://twitter.com/edmudokon Twitter account @edmudokon] began posting cryptic messages that seemed to be related to the [http://www.oddworld.com/ Oddworld] universe. The account appeared to be run by an average Mudokon named Ed who claimed to have information he wanted to share, but he seemed to be in constant danger and could only access the outside world via a faint connection. Beginning around March 2016, @edmudokon engaged users with an elaborate series of puzzles and challenges, releasing information both on twitter and via the official Oddworld [http://www.oddworld.com/soulstorm/ website]. These puzzles eventually led to the revelation of a website, http://1029.io, as well as a message: "now you know. you can help. join us. together we can rise."<br />
<br />
The [http://1029.io 1029] webpage featured glitchy effects and another rendition of the ASCII-art logo, but with the numbers 8291 replacing some characters. At the bottom of the page was an e-mail signup form, above which was a message:<br />
<br />
<pre><br />
THE FALL OF RF1029 WAS THE SPARK TO IGNITE A REVOLUTION. FOR TOO LONG, THEY HAVE CONTROLLED THEIR GIANT INDUSTRIAL MACHINES, GRINDING THE BONES OF OUR KIND INTO DUST IN THEIR ENDLESS PURSUIT OF POWER AND WEALTH.<br />
<br />
WE WERE TAUGHT THAT THIS IS ALL THERE WAS: OBEY.<br />
<br />
THE TRUTH WAS HIDDEN FROM US. OUR HISTORY WAS HIDDEN FROM US. WE WERE BRED TO WORK, RAISED TO OBEY AND FORCED TO COMPLY.<br />
<br />
OUR NATURAL CONNECTION TO MOTHER PLANET WAS ERASED FROM THE CONSCIOUSNESS OF OUR PEOPLE. LOST WAS OUR KNOWING. LOST WAS OUR UNITY, OUR CONNECTION, OUR POWER AND OUR PURPOSE. ALL THAT WE WERE WAS A COMMODITY TO BE TRADED AND EXPLOITED IN THE ONGOING RACE FOR MORE WEALTH. WHAT WE SHOULD HAVE PROTECTED, WE WERE TRICKED INTO KILLING. WHAT WAS WORST FOR US, WE WERE TOLD WAS BEST. WE WERE TAUGHT TO TRUST THOSE WHO WOULD DECEIVE US THE MOST.<br />
<br />
THAT HAS ALL CHANGED.<br />
<br />
THE HERO HAS SHOWN ALL OF US THAT OUR OPPRESSORS CAN BE TOPPLED. HE HAS FOUND OUR WILD AND KNOWING BROTHERS. HE HAS RECONNECTED THE FACTORY-BORN TO OUR NATURAL WORLD AND ANCIENT WAYS. HE HAS LIT A FIRE IN OUR HEARTS THAT CANNOT BE EXTINGUISHED.<br />
<br />
WE WILL GIVE HELP TO THOSE WHO ARE HELPLESS. WE WILL LEND STRENGTH TO THOSE WHO ARE WEAK. WE WILL FIGHT FOR THOSE WHO ARE DEFEATED. OUR MOVEMENT WILL SPREAD LIKE A RAGING INFERNO AND WE WILL TAKE BACK THE POWER FROM THOSE WHO HAVE ABUSED IT.<br />
<br />
WE WILL NOT BE SILENCED BY THE MEDIA CIRCUS. WE WILL NOT BE IGNORED. WE WILL NOT STOP. WE WILL NOT OBEY. WE WILL RISE AND WE WILL RISE AGAIN, UNTIL WE HAVE BURNED THROUGH OUR TATTERED BONDS AND RAZED THE MACHINE TO THE GROUND.<br />
<br />
WE WILL RISE. JOIN US.<br />
<br />
THERE’S A STORM COMING.<br />
</pre><br />
<br />
In the source code for the page, only the letters E and D of the message remain capitalized.<br />
<br />
Later that day, the [https://twitter.com/SPIRITOF1029 Twitter account @SPIRITOF1029] revealed themselves as a "Clandestine organization dedicated to doing good on behalf of the Mudokons and revealing information about a new horror being perpetrated against their species." They also tweeted their first message, parroting the [http://1029.io 1029 URL] and adding their own message: "There is a storm coming. Join us."<br />
<br />
Social media feeds went dark until December, 2016, posting only reiterations of the URL with messages like "Rise up" and "We are the storm. Join us". Then, in January of 2017, activity on the accounts surged once again and the first hints of an ARG began to appear.<br />
<br />
[[File:Oddworld_Logo3.jpeg|thumb|left|Spirit of 1029 emerges with this sleek ASCII-art logo]]<br />
<br />
=== Smells like Mudokon Spirit ===<br />
<br />
The flurry of new activity in January mainly consisted of @edmudokon and @spiritof1029 conversing about about whether or not Ed would be able to help the organization's cause. At this point, the Spirit of 1029 made their message very clear, stating "Oddworld has been blind to the plight of the noble Mudokons for too long. We will rise. Join us! http://1029.io". More notable activity includes the organization's quip "We recommend knowledge of many different codes and ciphers - you never know who is listening. #learnyournameinmorsecodeday", hinting that the coming information would be encrypted in some way..<br />
<br />
Oddworld Inhabitants (Oddworld developers, [https://twitter.com/OddworldInc @OddworldInc on Twitter]) was contacted by the organization at this time, being told by Spirit of 1029 "We will help @edmudokon but we can't send anything unencrypted. You'll have to break our code. We'll be in touch." Very shortly thereafter, on January 19th, 2017, Spirit of 1029 tweeted: "We have received a transmission. We will pass it on as soon as we can verify. We need your help." and the [http://www.oddworld.com/soulstorm/ Oddworld Webpage] was updated with a download for two files.<br />
<br />
== The First Transmission ==<br />
<br />
The Spirit of 1029's first transmission came in the form of an image and an audio file. The image, pictured on the right as it looked upon transmission, appeared to show a tattered and burned document bearing the Spirit of 1029's logo with the slogan "We Will Rise," with many portions of text redacted. The text on the document, where it was legible and not redacted, reads:<br />
<br />
[[File:Oddworld_1029_Photo1_Dirty.jpeg|thumb|right|200x300px|The distorted image sent by the Spirit of 1029 as part of their first transmission]]<br />
<br />
<pre><br />
Date:<br />
Period: XXXXXXXXXXX<br />
Specification Details:<br />
XXXXXXXXXXXXXXXXXXXXXXXXXX<br />
-Observe XXXXXXX and XXXXXXXX changes in test subjects<br />
-Assess long term XXXXXXXX on XXXXXXX<br />
-Determine product safety<br />
Authorization: XXXXXXXXXXX<br />
Tests requested:<br />
-XXXXXXXX Pronostics<br />
- ?Access whenever? product XXXXXXX<br />
-Acidity Levels<br />
- ????? XXXXXXXXX<br />
-Product safety<br />
Expected results: XXXXXXXXXX make XXXXXXXXX interesting<br />
Test results:<br />
-XXXXXXX highly XXXXXX<br />
-XXXXXXX this XXXXXX ?? XXXXXX ?nice? XXXXXXXX<br />
-Highly XXXXXXX<br />
-Subjects: XXXXXX<br />
- XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX<br />
XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX<br />
XXXXXXXXXXXXXXXXXX<br />
Conclusion: Product (ready) for consumption <br />
--------------------------------------------------------------------------------------------<br />
??? : XXXXXXXX there is XXXXXX here but it will XXXX ???? XXXXX<br />
--------------------------------------------------------------------------------------------<br />
</pre><br />
<br />
[[File:Oddworld_1029_Photo1_Clean.jpeg|thumb|left|A cleaned up version of the Spirit of 1029's first transmission made by the community]]<br />
<br />
As progress was made on the puzzles, the [http://www.oddworld.com/soulstorm/#navfirstcontact official Oddworld webpage] was updated to provide hints. This practice continued throughout the ARG.<br />
<br />
[[File:Oddworld_Arrows_pad.png|thumb|right|200x300px|The cryptic arrows found along the right side of the first image sent to the community by the Spirit of 1029]]<br />
<br />
=== Directional Arrows, Pigpen, & Anglo-Saxon Runes ===<br />
<br />
In addition to the text in the photo, there were several areas featuring symbols and runes. Along the top of the document, [http://www.omniglot.com/images/writing/futhorc.gif Anglo-Saxon runes] spelled out <code>ED</code>. Along the bottom, the text <code>YOU ARE THE KEY YOU KNOW IT IF YOU WERE LISTENING</code> is spelled out in the font, [http://www.babelstone.co.uk/Fonts/Pigpen.html BabelStone Club Penguin pigpen]. Running along the right side of the image, [http://wiki.gamedetectives.net/images/0/0c/Oddworld_Arrows.png arrows] can be seen pointing in a number of different vertical, horizontal, and diagonal directions. Players discovered that the arrows could be decoded by taking their angle measurement and deducing an "alphanumeric" equivalent, or a number between 0-25 where each number represents a letter of the alphabet. It just so happened that each arrow had an angle which ended in a zero, and thus, the first "arrow cipher" decoded to:<br />
<br />
<pre><br />
12 15 15 11 6 15 18 15 21 18 13 5 19 19 1 7 5 8 5 1 18 15 21 18 22 15 9 3 5<br />
<br />
L O O K F O R O U R M E S S A G E H E A R O U R V O I C E<br />
</pre><br />
<br />
The message decodes to <code>LOOK FOR OUR MESSAGE HEAR OUR VOICE</code>.<br />
<br />
=== First Audio Clip ===<br />
<br />
The second part of the Spirit of 1029's first transmission consisted of an [http://www.oddworld.com/soulstorm/1029contact/1029_01_audio.mp3 audio clip] lasting 1:40. Hidden in the audio clip was reversed Morse code, which proved difficult to decode by ear due to the added white noise. Eventually, the code was cracked by using a spectrogram of the audio.<br />
<br />
[[File:Oddworld_Morse_Spectro.png|frameless|center|810px|]]<br />
<br />
Although rough in some spots, the decoded Morse read:<br />
<br />
<code style="word-break:break-all;word-wrap: break-word;">qmiqwmiqyidimrjqdjijilmxmnrjqdjajmpmnrprspkesmkjpdqjnyajnwsnrpgspcsppmqidimqymdbcqajnwsnrpgspcdhbzmnjajanadumjimrpq</code><br />
<br />
In addition, players also discovered that, using portions of the Morse already decoded accurately by ear, it was actually to be used as ciphertext in a shift cipher, and that the key to be used was "storm," which was taken from tweets made by Spirit of 1029 declaring themselves to be "the storm". The pigpen from earlier served as a hint to look back at previous communications in order decrypt the morse. With the newly-complete Morse code now in their possession, the community was finally able to accurately decipher the ciphertext they had obtained from the reversed Morse code. It read:<br />
<br />
<code style="word-break:break-all;word-wrap: break-word;">tentwentyninedotiononqexerdotiofoeserdsdaspjaepositoryforwardslashassetninetyeightforwardslashimgzerofofrfiueonedst</code><br />
<br />
<code>ten twenty nine dot io nonqexer dot io foeserdsdaspjaepository forwardslash asset ninety eight forward slash img zero fofrfiueonedst</code><br />
<br />
Although not entirely accurate, through trial and error the community was able to locate a new URL branch of http://1029.io, http://1029.io/repository/asset98/imgzerofourfiveone/.<br />
<br />
=== First Hidden URL ===<br />
<br />
[[File:Oddworld_PuzzleAttempt.jpg|thumb|right|The product of many attempts to correctly arrange the puzzle pieces found on the hidden http://1029.io URL]]<br />
<br />
The solution for the previous puzzle led players to a hidden [http://1029.io/repository/asset98/imgzerofourfiveone/ page] on the 1029 site. Each time the page was reloaded, it displayed one of 8 different images, and a string of text for each:<br />
<br />
<gallery mode="packed"><br />
File:Oddworld_7676-AL.JPG|7676-AL<br />
File:Oddworld_3786-IC.JPG|3786-IC<br />
File:Oddworld_9455-UM.jpg|9455-UM<br />
File:Oddworld_9394-AL.jpg|9394-AL<br />
File:Oddworld_7393-AN.jpg|7393-AN<br />
File:Oddworld_5574-PH.jpg|5574-PH<br />
File:Oddworld_2384-ER.jpg|2384-ER<br />
File:Oddworld_1029-LY.jpg|1029-LY<br />
</gallery><br />
<br />
Players quickly realized that the images appeared to be fragments of a larger puzzle. The Oddworld Inhabitants [http://www.oddworld.com/soulstorm/#navfirstcontact page] updated to read "Once you've got everything together - show us!". The completed image was tweeted out to @OddworldInc on January 19th, 2017, and the next day, [https://twitter.com/OddworldInc/status/822686854516535298 instructed] players to wait while they cleaned up the complete image.<br />
<br />
<br><br><br />
<br />
[[File:Oddworld_Photo1_Clean1.jpeg|thumb|left|250x250px|Photograph of the final image before it was torn into the pieces the community was given, sent out with a message from Oddworld Inhabitants to hang tight until Thursday.]]<br />
<br />
=== First Unlocked Photo ===<br />
<br />
[[File:Oddworld_Finished1.jpg|thumb|right|400px|The final image, sent by the Spirit of 1029 and received by the community through Oddworld Inhabitants Twitter account. The image was confirmed to be an in-Unity render of the upcoming Oddworld: Soulstorm & created in conjunction with Cyrus McWilliams, formerly of Blur, and Fat Kraken Studios in England]]<br />
<br />
[[File:Oddworld_Pada.jpg|thumb|left|400px|The second transmission sent out by the Spirit of 1029, identical to the first released image but with various codes hidden within]]<br />
<br />
While waiting, players began to decode the second transmission. The prevalent writing was later verified to read "Who?", "Where?", "So Tired", and a set of numbers likely to be "8291". <br />
<br />
After three days, @OddworldInc [https://twitter.com/OddworldInc/status/823520771893030912 tweeted out a scrambled image], pictured left, stating "We received something and there's one last thing we need you to do. Share it. Spread the word.". The next day, after the tweet gained 100 shares, they tweeted the [https://twitter.com/OddworldInc/status/823620565458108416 image] again, pictured left, this time unscrambled. They then stated <code>While you shared our message 100 times we worked away to bring you this. We're clearing it up even more, we'll share what we find Thursday</code>, while the webpage was updated with the message "Update 5: Thanks to you guys sharing the previous images online, we've managed to decode the photo further and have updated the thumbnail here. We'll return on Thursday with the finished, fully decrypted image - but until then, please do let us know what you think!" When Thursday came @OddworldInc [https://twitter.com/OddworldInc/status/824638147703296000 tweeted out a final picture] of a render from the upcoming Oddworld: Soulstorm, pictured right, in all its unscrambled un-cropped glory. The release of this image signaled the end of the first of five phases of content release Oddworld Inhabitants have planned.<br />
<br />
<br><br><br><br><br />
<br />
== The Second Transmission ==<br />
<br />
[[File:Oddworld_Pada_sofar.jpg|thumb|right|400px|Hidden details in the second transmission]]<br />
<br />
On Feburary 2nd, 2017, the Spirit of 1029 again reached out to players, saying via Twitter that "Our agent has delivered another transmission. We will verify its origins and pass it on." Several hours later, @OddworldInc tweeted the message "We were just contacted again. Don't go anywhere, we might need your help with this...", and the [http://www.oddworld.com/soulst Official Oddworld Site] was updated with a message as well as [http://www.oddworld.com/soulstorm/1029contact/pada.jpg an image], pictured left. In addition to the image, a [http://us3.campaign-archive2.com/?u=2b6dca21053bc375cbdad7077&id=b08e7b2d60&e=6a2b5665ee newsletter] was sent out to everyone who signed up to the 1029 email list. The newsletter featured basic info about the ARG so far, as well as a barcode at the very bottom, which, when scanned, reveals a code:<br />
<br />
<code><br />
Ivzw gsv mfnyvih pmld gsv gifgs<br />
</code><br />
<br />
When passed through a cryptogram solver, the message read:<br />
<br />
<code><br />
READ THE NUMBERS KNOW THE TRUTH<br />
</code><br />
<br />
An [http://wiki.gamedetectives.net/images/thumb/5/56/Oddworld_Pada_sofar.jpg/800px-Oddworld_Pada_sofar.jpg "in-progress" image], pictured on the right, highlighted the hidden details found at the time and outlined their currently known solutions.<br />
<br />
=== Morseception ===<br />
<br />
The Morse code in the image turned out to be fragments of a larger single code, seen below pieced back together:<br />
<br />
[[File:Oddworld_MorseAlign_TrueHeresy.png|frameless|center|810px|Image of all the Morse code segments pieced together]]<br />
<br />
When decrypted, the morse resulted in the following message:<br />
<br />
<code><br />
DASHDOTDOTDOT DOT DASH DOTDOTDOTDOT DOT DOTDOTDOT DASH DASHDASHDASHDASH DOTDASHDOT DASHDASH<br />
</code><br />
<br />
This was found to yet again be morse code, which decoded to:<br />
<br />
<code><br />
-... . - .... . ... - --- .-. --<br />
<br />
BETHESTORM<br />
</code><br />
<br />
=== Braille & Upside-down Pigpen ===<br />
<br />
[[File:Oddworld_Brialle.png|thumb|right|250px|Braille code found in the second Spirit of 1029 transmission]]<br />
<br />
A [http://wiki.gamedetectives.net/images/a/a4/Oddworld_Brialle.png message in Braille], pictured right, in the bottom-left of the image read <code>Spread our message</code>. The Babelstone pigpen code, when flipped upside down:<br />
<br />
[[File:Oddworld_UpsideDownPigpen.jpg|frameless|center|810px|Upside-down Babelstone Pigpen code]]<br />
<br />
decoded to:<br />
<br />
<code><br />
KNOW YOUR CODES<br />
<br />
KEEP THEM CLOSE<br />
<br />
YOU WILL NEED THEM<br />
</code><br />
<br />
[[File:Oddworld_BarcodeCube.png|thumb|left|400px|The "data cube" from the second image, later determined to be two barcodes interlaced with one another, one running horizontally and the other vertically]]<br />
<br />
=== Directional Arrows Puzzle ===<br />
<br />
Using the [http://wiki.gamedetectives.net/index.php?title=Oddworld_Soulstorm#Directional_Arrows_Puzzle], these arrows decoded to:<br />
<br />
<pre><br />
7 14 9 8 20 25 18 5 22 5 5 4 15 3 5 4<br />
H O J I U Z S F W F F E P D F E<br />
</pre><br />
<br />
Players found the above ciphertext to be encrypted with a Caesar cipher set to a shift of 25, and revealed the message: <code>GNIHTYREVEEDOCED</code>, which is <code>DECODE EVERYTHING</code> backwards.<br />
<br />
=== Interlaced Barcodes & Second Hidden URL ===<br />
<br />
[[File:Oddworld_Grid.jpg|thumb|right|250x250px|The image found on the second hidden URL discovered by the community, which depicts the Spirit of 1029's logo chopped up and re-arranged on a 7x7 grid]]<br />
<br />
The community speculated that the [http://wiki.gamedetectives.net/images/3/30/Oddworld_BarcodeCube.png strange box in the bottom-right of the image] sent by the Spirit of 1029, pictured left, was a fragmented barcode. After a massive amount of tinkering, the two barcodes were [http://imgur.com/a/YmAH2 correctly assembled] and, when scanned, led to the discovery of two messages:<br />
<br />
<code><br />
http://www.1029.io/repository/asset98/<br />
</code><br />
<br />
and<br />
<br />
<code><br />
findawayshowthetruth<br />
</code><br />
<br />
Combining these messages into a single URL led players to another hidden [http://www.1029.io/repository/asset98/findawayshowthetruth/ page] on the 1029 website, which displayed a [http://www.1029.io/repository/asset98/findawayshowthetruth/grid.jpg distorted version] of the Spirit of 1029 logo, pictured right.<br />
<br />
=== Source Code Mysteries ===<br />
<br />
Players discovered an extensive message containing several presently-unsolved puzzles is written hidden in the source code of the second hidden page. It read:<br />
<br />
<pre><br />
!-- <br />
<br />
Can’t reach any..<br />
<br />
<br />
Listening anyon… there?<br />
<br />
<br />
Can hear us anymore- need to… can’t fnd <br />
<br />
<br />
We will never give… what they… from us<br />
<br />
A9539 \\<br />
<br />
B2919 /\\<br />
<br />
C4882 /\<br />
<br />
D4627 \<br />
<br />
E6758 \<br />
<br />
F???? ////<br />
<br />
<br />
/\//\\//5,1:4.1,2:8.1,3:2.3,3:2.4,3:3.7,3:3.1,5:3.4,5:9.5,5:2.7,5:4.7,6:6.3,7:3.<br />
<br />
<br />
<br />
<br />
Does… care? Freedom isn’t gi… will take…<br />
<br />
We have never…. Given… deserve. We… take… our righ…<br />
<br />
\\//\/KDIUTHANPUYHHDQOEPLNDOALJGUDITHBBDOZLGFERKJGLSAOE<br />
<br />
Stand up and fi…<br />
<br />
<br />
Don’t be afr….<br />
<br />
<br />
<br />
\////JUTYROSLNGNALEHGNWOTIQPOKSDNTPNOJAWEOBNGLAWKJNWNR <br />
<br />
E=5OUEHRA? <br />
<br />
<br />
<br />
\\\\/\2,1:2.3,1:2.6,1:4.1,2:4.3,2:2.3,4:4.5,5:2.6,5:3.7,5:3.4,7:8.5,7:3.7,6:4. <br />
<br />
7777338883366899984477733 33 <br />
<br />
<br />
<br />
<br />
They want to… kill- don’t-<br />
<br />
<br />
Stop them from…. Hurting- they… think<br />
<br />
We are no less- they think… aside<br />
<br />
<br />
Don’t believe what… told- liars…<br />
<br />
A5989 \\<br />
<br />
B5176 \<br />
<br />
C2863 \<br />
<br />
D2558 //\<br />
<br />
E3413 \<br />
<br />
<br />
F???? ////<br />
<br />
<br />
<br />
Can’ fnd anymo-<br />
<br />
<br />
We wil silnced<br />
<br />
<br />
<br />
<br />
<br />
<br />
Killin- they are dy..<br />
<br />
\\\/\\JHWUITUHABSJGNEWKLALNVGJKWELKJLWQQPRUTJHJJSBFMMH <br />
<br />
Hurting the..<br />
<br />
Back down unt… resist.<br />
<br />
<br />
Intercep… our messa… we will fight<br />
<br />
///\\/JQEABTVKNUCSEYCMBILDKOSCYSITECPAGFAXHKETJNZURWCIE <br />
<br />
We will ri…<br />
<br />
Cannot… silenced when ther… who need… now<br />
<br />
<br />
We won’t ba… we have beat…. Before… Must not-<br />
<br />
<br />
<br />
<br />
\///\//\1,1:3.4,1:2.6,1:9.2,2:2.6,2:2.2,4:4.3,5:2.5,5:2.7,5:3.4,7:3.6,7:2.7,7:2. <br />
<br />
<br />
<br />
Spent so long…. Afraid… never let- again<br />
<br />
<br />
...Storm… find it’s way- end<br />
<br />
<br />
Why are … here?<br />
<br />
<br />
<br />
<br />
Only...profit- nothing more… importnt as- <br />
<br />
- lies they… will tel-<br />
<br />
Believe- nothing… terribl- things… <br />
<br />
\\//\\\/4,2:6.6,2:4.7,3:3.2,4:8.3,4:2.4,4:2.7,4:3.2,6:2.4,6:3.6,6:2.1,7:4.3,7:2.<br />
<br />
--><br />
</pre><br />
<br />
At the time, only a few portions of this message have been successfully solved. <br />
<br />
The ABCDEF puzzles was solved using the rules of [https://en.wikipedia.org/wiki/Mastermind_(board_game) Mastermind], a popular board game. Players assumed that a backslash ( \ ) indicated a partial match and a forward slash ( / ) indicated a full match, as shown below:<br />
<br />
<pre><br />
A9539 \\<br />
<br />
B2919 /\\<br />
<br />
C4882 /\<br />
<br />
D4627 \<br />
<br />
E6758 \<br />
<br />
F???? ////<br />
</pre><br />
<br />
Had a solution of <code>F8992</code>, and:<br />
<br />
<pre><br />
A5989 \\<br />
<br />
B5176 \<br />
<br />
C2863 \<br />
<br />
D2558 //\<br />
<br />
E3413 \<br />
<br />
F???? ////<br />
</pre><br />
<br />
Had a solution of <code>F8554</code>. The purpose of these solutions was unknown.<br />
<br />
Players found the numbers <code>7777338883366899984477733 33</code> to be encoded with a [http://www.dcode.fr/multitap-abc-cipher multi-tap cipher] (cellphone numberpad), and can be decoded to <code>SEVENTYTHREE</code>. the purpose of this solution was also unknown.<br />
<br />
The <code>E=5OUEHRA?</code> portion was partially solved. Players found that the letters <code>O U E H R A</code> were all the second letters from each day of the week, I.E. M'''o'''nday, T'''u'''esday, W'''e'''dnesday, etc. This indicated a solution of <code>U</code> for the question mark, as in S'''u'''nday, making the full string <code>E=5OUEHRAU</code>. The <code>E=5</code> portion of the text remains unsolved.<br />
<br />
Also remaining unsolved are the coordinates found in the code, as well as the letter strings:<br />
<br />
[[File:Oddworld_Grid.jpg|thumb|right|250x250px|The 7x7 grid found on the second hidden URL, likely to be used with the coordinates & letter strings in some way]]<br />
<br />
<pre><br />
Coordinates<br />
<br />
/\//\\//5,1:4.1,2:8.1,3:2.3,3:2.4,3:3.7,3:3.1,5:3.4,5:9.5,5:2.7,5:4.7,6:6.3,7:3.<br />
<br />
\\\\/\2,1:2.3,1:2.6,1:4.1,2:4.3,2:2.3,4:4.5,5:2.6,5:3.7,5:3.4,7:8.5,7:3.7,6:4.<br />
<br />
\///\//\1,1:3.4,1:2.6,1:9.2,2:2.6,2:2.2,4:4.3,5:2.5,5:2.7,5:3.4,7:3.6,7:2.7,7:2. <br />
<br />
\\//\\\/4,2:6.6,2:4.7,3:3.2,4:8.3,4:2.4,4:2.7,4:3.2,6:2.4,6:3.6,6:2.1,7:4.3,7:2.<br />
</pre><br />
<pre><br />
Letter Strings<br />
<br />
\\//\/KDIUTHANPUYHHDQOEPLNDOALJGUDITHBBDOZLGFERKJGLSAOE<br />
<br />
\////JUTYROSLNGNALEHGNWOTIQPOKSDNTPNOJAWEOBNGLAWKJNWNR <br />
<br />
\\\/\\JHWUITUHABSJGNEWKLALNVGJKWELKJLWQQPRUTJHJJSBFMMH<br />
<br />
///\\/JQEABTVKNUCSEYCMBILDKOSCYSITECPAGFAXHKETJNZURWCIE<br />
</pre><br />
<br />
=== Stuck In The Mud & Third Hidden URL ===<br />
<br />
After many failed attempts by players to decode the contents of the message using the hints of Spirit of 1029, a player found something unusual about one of the account's most recent tweets, which said:<br />
<br />
<pre><br />
When you have the key, you need the correct lock. hgehgeoeregpineechqnhgeevtipcvreovxgvge<br />
Shake loose the bonds that hold you. #wewillrise<br />
</pre><br />
<br />
Players noted that the text <code>hgehgeoeregpineechqnhgeevtipcvreovxgvge</code> could be decoded via a [http://www.braingle.com/brainteasers/codes/keyword.phpsubstitution keyword cipher] with the key <code>subjectivism</code>, and reveals the message:<br />
<br />
<pre><br />
oneoneseventhreefouroneeightfivesixnine<br />
</pre><br />
<br />
Using this solution, players quickly found another secret [http://www.1029.io/repository/asset98/1173418569/ page] on the 1029 hub.<br />
<br />
=== Creepy Scenes From Within ===<br />
<br />
Much like the first hidden page, this hidden page displayed a different image each time the page is reloaded. In total, 13 scrambled images appear frequently (file prefix WB) and up to 13 CLEAR immages appear only very rarely (file prefix CWB). All the files are below, with their respective names:<br />
<br />
<gallery mode="packed"><br />
File:Oddworld_WB1_HEND8243.jpg | WB1_HEND8243<br />
File:Oddworld_WB2_BSJG2456.jpg | WB2_BSJG2456<br />
File:Oddworld_WB3_INFG2861.jpg | WB3_INFG2861<br />
File:Oddworld_WB4_HBQD2962.jpg | WB4_HBQD2962<br />
File:Oddworld_WB5_SJKW4167.jpg | WB5_SJKW4167<br />
File:Oddworld_WB6_OWUI2056.jpg | WB6_OWUI2056<br />
File:Oddworld_WB7_MNCH1101.jpg | WB7_MNCH1101<br />
File:Oddworld_WB8_RDHRHAHA.jpg | WB8_RDHRHAHA<br />
File:Oddworld_WB9_D34DM337.jpg | WB9_D34DM337<br />
File:Oddworld_WB10_BDJW8411.jpg | WB10_BDJW8411<br />
File:Oddworld_WB11_WHAT8291.jpg | WB11_WHAT8291<br />
File:Oddworld_WB12_PADAPADA.jpg | WB12_PADAPADA<br />
File:Oddworld_WB13_VLAP3662.jpg | WB13_VLAP3662<br />
</gallery><br />
<gallery mode="packed"><br />
File:Oddworld_CWB1_0BE01647.JPG | CWB1_0BE01647<br />
File:Oddworld_CWB2_0DG02966.JPG | CWB2_0DG02966<br />
FILE:Oddworld_CWB4_WHATISTHIS.JPG | CWB4_WHATISTHIS<br />
File:Oddworld_CWB5_NEEDLEINAHAYSTACK.JPG | CWB5_NEEDLEINAHAYSTACK<br />
File:Oddworld_CWB6_ARG-H.JPG | CWB6_ARG-H<br />
File:Oddworld_CWB7_82918291829182918291.JPG | CWB7_82918291829182918291<br />
File:Oddworld_CWB8_0GE03866.JPG | CWB8_0GE03866<br />
File:Oddworld_CWB9_0IE02565.JPG | CWB9_0IE02565<br />
File:Oddworld_CWB10_AbeAndNEEDLESFunAdventures.JPG | CWB10_AbeAndNEEDLESFunAdventures<br />
File:Oddworld_CWB11_02500356.JPG | CWB11_02500356<br />
File:Oddworld_CWB12_02323hjfhfhfhfhASDF.JPG | CWB12_02323hjfhfhfhfhASDF<br />
File:Oddworld_CWB13_insertcodehere.JPG | CWB13_insertcodehere<br />
</gallery><br />
<br />
While it wasn't entirely clear, players believed that this was yet again another form of a jigsaw puzzle.<br />
<br />
After a [http://wiki.gamedetectives.net/images/0/09/Oddworld_Phase_One.png series] of interesting [http://wiki.gamedetectives.net/images/e/e0/Oddworld_Phase_Two.png updates], the new hidden [http://www.1029.io/repository/asset98/1173418569/ page] went dark, with the header reading <code>ASSET98: TERMINATED.</code> and a new comment in the source code which read: <code>!-- see ya around, 1029... --></code>. The [https://twitter.com/edmudokon @Edmudokon] Twitter account, after a long period of silence, also tweeted out a [https://twitter.com/edmudokon/status/829079318290694144 new message]:<br />
<br />
<pre><br />
what happened? what did you do? who? No! no... aaaaaAaaaaarrrRrrrgggggGgghhh!<br />
</pre><br />
<br />
And with this message, Ed appears to have passed away. At that point, it was not clear if it was due to bruteforcing attempts by players or whether his death was intended all along.<br />
<br />
=== From The Ashes, Asset 99 (Hidden URL 3.5) ===<br />
<br />
[[File:Oddworld_OrangeLightning_V2.jpg|thumb|right|A very convincing collage of the images seen pictured on the now-dark Asset 98 URL; what is going on in the image remains unknown]]<br />
<br />
After the Asset98 page was "destroyed," a [http://www.1029.io/repository/asset99 new page], called "Asset99," was revealed, and appeared to be a clone of the Asset98 page. However, when refreshed, the page failed to reveal some of the "rarer" fragments from the Asset98 page. This page also came with an intimidating message: "We will not be stopped. We may have lost Asset 98, but we will continue strong. Together. Against the machines. Help us to expose this latest crime against Mudokonkind." The [http://www.oddworld.com/soulstorm/#navfirstcontact Official Oddworld Webpage] also updated at this time, and requested help putting the pieces together.<br />
<br />
However, in the midst of the image-related updates, the @Spiritof1029 Twitter account posted:<br />
<br />
<pre><br />
We can't reach Asset 98 but we do still have his clear transmissions. Prove you're worthy. Show us that you're able. Send us the grid. You found the grid, the letters and the numbers. Tell us how they fit together. Prove you're no longer slaves to the machines.<br />
</pre><br />
<br />
Players found that this tweet referred back to the [http://wiki.gamedetectives.net/index.php?title=Oddworld_Soulstorm#Source_Code_Mysteries source code grid challenge].<br />
<br />
The assembled image was then [https://twitter.com/OddworldInc/status/829336580347326465 tweeted at OWI] and they replied, stating "You've given us enough for us to get to work cleaning up the image, we'll have something by tomorrow. Don't stop looking for the truth!" So, players waited patiently for the unscrambled image whilst solving the grid.<br />
<br />
=== Second Unlocked Image & Grid Solution ===<br />
<br />
[[File:Oddworld_RandomiserDizma.jpg|thumb|right|The solved grid, which reveals the word "subjectivism" (first letter of each section connected in the correct order), the key used to decode the string which led to the discovery of the third hidden Asset98 URL]]<br />
<br />
[[File:Oddworld_Second_Final.jpg|thumb|left|400px|The final image cleaned up & released by OWI a day after the collage was submitted]]<br />
<br />
The next day, OWI tweeted out a [https://twitter.com/OddworldInc/status/829715069235781632 cleaned-up image], pictured on the left, which seemed to depict quite a gruesome scene, featuring a wide-eyed Mudkon strapped to an operating table facing an onslaught of needles and next to a vat which read "SS Brew". Players also learned via [https://twitter.com/edmudokon @Edmudokon on Twitter] that Ed made it out alive, but his friend: "...never came back. I could hear him screaming all night... helpless. they took him... he was my friend. how did they know?"<br />
<br />
Shortly after players received the cleaned-up image, [https://twitter.com/SPIRITOF1029/status/830004742713638912 partial progress] was finally made on [http://wiki.gamedetectives.net/index.php?title=Oddworld_Soulstorm#Hidden_Barcodes_.26_Second_Hidden_URL the grid], which up until then remained unsolved. One player discovered that the coordinates could be applied to the grid using the rules of the Japanese puzzle game [https://en.wikipedia.org/wiki/Shikaku Shikaku] (#'s after the colons in the coordinates represent box sizes, which are the lines drawn in red). Another player was then able to successfully apply a letter string to the sliced-up cube, pictured right, from which the word <code>subjectivism</code> can be derived. The only strings that were used to find the solutions were ones that had a forward slash. This word was the [http://wiki.gamedetectives.net/index.php?title=Oddworld_Soulstorm#Stuck_In_The_Mud_.26_Third_Hidden_URL key previously used] to decode the third hidden Asset98 page. However, whether the key was intended to remain hidden until the grid was solved or intentionally encoded in such a way as to allow for bruteforcing is unknown.<br />
<br />
== The Third Transmission ==<br />
<br />
After some waiting, on Feburary 23rd, 2017, OWI [https://twitter.com/OddworldInc/status/834856085949394944 sent out a tweet] indicting they had again been contacted by the Spirit of 1029. A new, password-protected zip file named <code>89928554_Eequals5.zip</code> was found on the main Oddworld [http://www.oddworld.com/soulstorm/ website]. Players then realized that the name of the ZIP contained one of the solutions of the puzzles in the source code of the first hidden page. Within the .ZIP file were six files, four of which were .JPGs, one of which was a .PNG, and the last of which is a .TXT. Their filenames were:<br />
<br />
<code><br />
flyer1.jpg, flyer2.jpg, flyer3.jpg, Oddworld_Soulstorm_002_HD.jpg, toollist.txt, & vital.png<br />
</code><br />
<br />
The name of the zip suggested that players should use letter equivalencies to their alphabetic indexes as the password. This gave players the password <code>HIIBHEED</code> but in fact, the password was actually <code>HIIDHEED</code> for unknown reasons.<br />
<br />
=== Steganograpy Blitz & toollist.txt ===<br />
<br />
The file [http://pastebin.com/feuVh6wr toollist.txt] contained a repeating string consisting of names of moons in Earth's solar system, and are occasionally interrupted by forward slashes. Players found that the letters after each slash formed the string: <code>useSsuitePicselSecuritySaveus</code>. Players found this to refer to [http://www.ssuitesoft.com/ssuitepicselsecurity.htm Ssuite Picsel Security], which is a specific steganography program.<br />
<br />
When the file <code>Oddworld_Soulstorm_002_HD.jpg</code> was set as the original and <code>vital.png</code> was set as the target using Ssuite Picsel Security, the output was:<br />
<pre style="word-break:break-all;word-wrap: break-word;">BmzPmbtzueMfxmeBdayqftqgeBmzpadmQbuyqftqgeVmzgeMqsmqazYuymeYqftazqMzftqBmxxqzqQzoqxmpgeFqftkeFqxqefaOmxkbeaPuazqTqxqzqBaxkpqgoqeDtqmFufmzTkbqduazUmbqfgeWuhugcUvudmcBtaqnqBmmxumcEwmftuMxnuadujNqntuazzQddumbaEwaxxEumdzmcFmdcqcSdqubTkddawwuzVmdzemjmFmdhaeYgzpuxrmduNqdsqxyudZmdhuEgffgzsdTmfuRmdnmgfuFtdkydMqsudNqefxmEgdfgdWmduKyudXasqRadzvaf</pre><br />
<br />
When deciphered using a [http://rumkin.com/tools/cipher/caesar.php Caesar cipher] with N=14, the following cleartext can be obtained:<br />
<br />
<pre style="word-break:break-all;word-wrap: break-word;">PanDaphnisAtlasPrometheusPandoraEpimetheusJanusAegaeonMimasMethoneAnthePalleneEnceladusTethysTelestoCalypsoDioneHelenePolydeucesRheaTitanHyperionIapetusKiviuqIjiraqPhoebePaaliaqSkathiAlbiorixBebhionnErriapoSkollSiarnaqTarqeqGreipHyrrokkinJarnsaxaTarvosMundilfariBergelmirNarviSuttungrHatiFarbautiThrymrAegirBestlaSurturKariYmirLogeFornjot</pre><br />
<br />
All of the names above are the named moons of Saturn. However, <code>Erriapus</code> and <code>Fenrir</code> were missing. <code>Erriapus</code> was replaced by <code>Erriapo</code>, which was the original name of the moon.<br />
<br />
=== Cleaned-Up Flyers ===<br />
<br />
[[File:Oddworld_Malachim.gif|thumb|right|295x72px|The Malachim alphabet used in this puzzle.]]<br />
<br />
The images that players received of the Sligs' flyers were corrupted, and were quickly cleaned up by players.<br />
<gallery widths=180px><br />
File:Oddworld_flyer1_clean.jpg|A cleaned up version of flyer1.jpg<br />
File:Oddworld_flyer2_clean.jpg|A cleaned up version of flyer2.jpg<br />
File:Oddworld_flyer3_clean.jpg|A cleaned up version of flyer3.jpg<br />
</gallery><br />
One player found that the pigpen cipher on the left side of flyer1.jpg gave the string<code>AOCXY SIO</code>, which when shifted by 6 using a Caesar cipher yielded <code>GUIDE YOU</code>. <br />
<br />
The cipher on flyer2.jpg gave the string <code>FYNNBYNBCHANBUNM</code> which, when shifted in the same manner as before, yielded <code>LETTHETHINGTHATS</code>. <br />
<br />
The final one on flyer3.jpg gave the string <code>GCMMCHA</code> which was again shifted in the same manner as before to yield <code>MISSING</code>.<br />
<br />
All three of the pigpen strings can be combined to form a message: <code>LET THE THING THAT'S MISSING GUIDE YOU</code><br />
<br />
Additionally, sequences of <code>x</code> and <code>o</code> characters are seen. One player noticed that this could be interpreted as morse code in the following format (with x as dash, o as dot):<br />
<br />
<pre><br />
x oooo o xoxx ox oxo o oxx ox x xoxo oooo oo xo xxo<br />
xooo o x oooo o ooo x xxx oxo xx <br />
oxx o oxx oo oxoo oxoo oxo oo ooo o<br />
</pre><br />
<br />
became:<br />
<br />
<pre><br />
/- .... . -.--/.- .-. ./.-- .- - -.-. .... .. -. --./<br />
/-... ./- .... ./... - --- .-. --/<br />
/.-- ./.-- .. .-.. .-../.-. .. ... ./<br />
</pre><br />
<br />
which decoded to: <code>THEY ARE WATCHING BE THE STORM WE WILL RISE</code><br />
<br />
In addition, each of the flyers contained a set of strange symbols and numbers. The symbols were found to be the Malachim alphabet, as seen on the right.<br />
<br />
=== Fourth & Fifth Hidden URLs ===<br />
<br />
Using the hint to determine what was “missing,” players shifted their focus to the moon of <code>Erriapo</code>, as it was in the steganography text, but not in toollist.txt. Using the Malachim alphabet symbols and numbers, players translated <code>Erriapo</code> into <code>12 36 28 31 52 22 12</code>. The validity of this method was confirmed with a [https://twitter.com/SPIRITOF1029/status/835149069601419264 tweet] from Spirit of 1029, and the image in the tweet was decoded to contain <code>P=22</code>. This led players to the discovery of a new [http://www.1029.io/repository/asset99/12362831522212/ page] on the 1029 website. The header, <code>ASSET9X / [REDACTED] / 333333333333</code>, appeared to be a corrupted link to another page. In addition, the page yet again displayed a different image upon each refresh, all of which can be seen below.<br />
<br />
<gallery mode="packed"><br />
File:Oddworldd_YOU.jpg|YOU.jpg<br />
File:Oddworld_WHA.jpg|WHA.jpg<br />
File:Oddworld_WET.jpg|WET.jpg<br />
</gallery><br />
<br />
The page also contained a message:<br />
<br />
<pre><br />
We can't hold much longer.<br />
It's dark, and cold. So cold. They don't seem to [REDACTED]. They. Them. It's hard to know how we'll [REDACTED], but we'll try. This can't last forever. We won't last forever.<br />
Look what they're doing to us. Just look.<br />
There is spirit, but it's waining. We need you, [REDACTED]. Help us.<br />
</pre><br />
<br />
In addition, players also discovered another [http://www.1029.io/repository/asset99/71220283136/ page] on the 1029 site, using the same method as before but with the moon <code>Fenrir</code> instead. The page contained the same obscured header, and displayed one of three images upon each refresh, which can be seen below.<br />
<br />
<gallery mode="packed"><br />
File:Oddworld_OLD.jpg|OLD.jpg<br />
File:Oddworld_TIF.jpg|TIF.jpg<br />
File:Oddworld_TOO.jpg|TOO.jpg<br />
</gallery><br />
<br />
When the names of the files on both pages were put together, players found the string:<br />
<br />
<pre><br />
WHATIFWETOLDYOUTOO<br />
<br />
WHAT IF WE TOLD YOU TOO<br />
</pre><br />
<br />
== The Horror Is Shown In Full ==<br />
<br />
After a long period of tinkering, players found a [http://www.1029.io/whatifwetoldyoutoo/ new directory] on the 1029 site, called "whatifwetoldyoutoo."<br />
<br />
[[File:What_if_we_told_you_too_pre_edit.png|thumb|right|400x200px|The first page before it's eventual sharing.]]<br />
<br />
The source code of the page contained a few, interesting comments: <code>BDBDBDBDBDBDBDBBDBDBDBDBDBD</code>, <code>###BELIKEDET###</code> and <code>doYOUsee? think of a number, any number.</code><br />
<br />
Through unknown means, players then found the next [http://www.1029.io/whatifwetoldyoutoo/8291/ page]<br />
by adding 8291 to the end. This link leads to the [https://www.youtube.com/watch?v=2l4jZVTUoak/ 4 second video] of the previous photo, depicting the severe torture the mudokons had to endure.<br />
<br />
Three different codes pop up during the video, but these were found to have no relevance to the ARG.<br />
<br />
== The 4th Transmission ==<br />
<br />
Shortly after the release of the third transmission, the fourth [http://www.oddworld.com/soulstorm/findit.jpg transmission] was released, and appeared to consist of the last three transmissions fused together. Written on the image is the text <code>USE WHAT YOU CAN'T SEE</code>. There were two, somewhat hidden codes on the image.The Morse code, which decoded to <code> USE A DIFFERENT CODE. THIS IS NOT RELEVANT DATA. DO NOT COMPLY. DO NOT OBEY. THEY LIE. </code><br />
<br />
The Runes on the left hand side and the ones partially cut off at the top and bottom(as previously seen in the video) were decoded by using file data in a hex editor, which would say:<br />
<br />
<pre?<br />
<code><rdf:li photoshop:LayerText="WE WERE TAUGHT THAT THIS IS ALL THERE WAS: WORK, OBEY, COMPLY. THE TRUTH WAS HIDDEN FROM US. OUR HISTORY WAS HIDDEN FROM US. WE WERE BRED TO WORK, RAISED TO OBEY AND FORCED TO COMPLY. OUR NATURAL CONNECTION TO MOTHER PLANET WAS ERASED FROM THE CONSCIOUSNESS OF OUR PEOPLE. LOST WAS OUR KNOWING. LOST WAS OUR UNITY, OUR CONNECTION, OUR POWER AND OUR PURPOSE. ALL THAT WE WERE WAS A COMMODITY TO BE TRADED AND EXPLOITED IN THE ONGOING RACE FOR MORE WEALTH. WHAT WE SHOULD HAVE PROTECTED, WE WERE TRICKED INTO KILLING. WHAT WAS WORST FOR US, WE WERE TOLD WAS BEST. WE WERE TAUGHT TO TRUST THOSE WHO WOULD DECEIVE US THE MOST. THAT HAS ALL CHANGED. THE HERO HAS SHOWN ALL OF US THAT OUR OPPRESSORS CAN BE TOPPLED. HE HAS FOUND OUR WILD AND KNOWING BROTHERS. HE HAS RECONNECTED THE FACTORY-BORN TO OUR NATURAL WORLD AND ANCIENT WAYS. HE HAS LIT A FIRE IN OUR HEARTS THAT CANNOT BE EXTINGUISHED. WE WILL GIVE HELP TO THOSE WHO ARE HELPLESS. WE WILL LEND STRENGTH TO THOSE WHO ARE WEAK. WE WILL FIGHT FOR THOSE WHO ARE DEFEATED. OUR MOVEMENT WILL SPREAD LIKE A RAGING INFERNO AND WE WILL TAKE BACK THE POWER FROM THOSE WHO HAVE ABUSED IT. WE WILL NOT BE SILENCED BY THE MEDIA CIRCUS. WE WILL NOT BE IGNORED. WE WILL NOT STOP. WE WILL NOT OBEY. WE WILL RISE AND WE WILL RISE AGAIN, UNTIL WE HAVE BURNED THROUGH OUR TATTERED BONDS AND RAZED THE MACHINE TO THE GROUND. WE WILL RISE. JOIN US. THERE'S A STORM COMING."/><br />
<br />
<rdf:li photoshop:LayerName="gas liquid solid" photoshop:LayerText="gas liquid solid"/><br />
<br />
<rdf:li photoshop:LayerName="fire air water earth" photoshop:LayerText="fire air water earth"/></code><br />
</pre><br />
<br />
This was found to be an exact copy of the speech on the main page of the 1029 site. Because players were told to "USE WHAT [THEY] CAN'T SEE," they realized that several states of matter and classical elements were missing from the source code. Most notably, "plasma," which is a state of matter after gas, and the 5th classical element, "void," or "aether." These all led players to a new [http://www.1029.io/electricity page], called "electricity."<br />
<br />
=== Take a deep breath... ===<br />
On the "electricity" page simple "HELP" which, when clicked on, downloaded a [http://www.1029.io/electricity/help.zip ZIP]. The ZIP contained two files: an image with the text <code>BREATH</code> in binary, and a binary text file, which contained the message:<br />
[[File:SaveUs.jpg|thumb|right|The image in the zip]]<br />
<br />
<pre><br />
why do you just watch can you not see us can you not hear the utighdbfn why is this happening wny its too cold to th can you hear us is there anybody there will you help us or rihjsudhgheusodj never are go find pn lose into ital chem we are cold we are lost we are forgotten and its e cant gmds pneuma tigd why are they taking cant stop cold so cold so cold we will rise we will not obey we will not comply j end n we will rise we will rise we will rise we will not die is abe dead here we will not die here we will not die here we cannot die here we cannot die here we cannot die here we cannot survive gheufh help this is not what we wanted we cannot dont cant see speak stop we need to save someone save us pneuma we need to be stop ightne vital energy source of this stop to think breath breathe cant breathe cant always watching we can never eyes stop find rest go now share loose top find think or too last day light never why to away stp give this is ever not no find things first or the ghtuenthdaytjgitlet last now or out get in or art test never stop we will find a way to gain our freedom e why it lost gone now stop taken from us and from there st we cant stop too much now too pain pain pain pain pain pain pain pain pain pain pain dont believe the things they tell you they lie they know no truth its lost long lost now ghwkfnhjsk what happened to them they are lost ghwufnfasjntiwpldfmwbwietpr stop it greed greed greed greed greed greed greed the expense is us we are tired our spark is fading do not let them extinguish all that we are we cannot snwownfnf see the end save us save us save us we cannot fight help us why is this happening for their proghe jwnfiw this nf we why forget us let us go we dont deserve no one deserves its not dont believe dont believe they will lie they lie they lie heugnpngjifsk lies lies lies lies lies lies lies lies eieslseiselslsl is abe dead we dont want to die<br />
</pre><br />
<br />
Both of these clues led players to "pneuma," the Greek word for breath, which led players to z new [http://www.1029.io/pneuma page].<br />
<br />
=== Not another one! ===<br />
<br />
Initially, the "pneuma" page merely displayed the ASCII logo of Spiritof29. As time went on, however, certain letters in the logo and the title of the page itself shifted into various cries for help. The logo contained words like "help," "stop," and "mask." The titles the page cycled through are below:<br />
<br />
<pre><br />
?<br />
<br />
/\--/\--/\--/\<br />
<br />
it's so hard to breathe<br />
<br />
please make it stop<br />
<br />
around how many times<br />
<br />
we will all die<br />
<br />
b.r.e.a.t.h.e<br />
<br />
b..r..e..a..t..h..e<br />
<br />
b r e a t h e (page title was only a single letter)<br />
<br />
..........<br />
</pre><br />
<br />
After the death of another Mudokon, another [http://www.1029.io/pneuma/helpus.jpg image] was revealed.<br />
<br />
When cleaned up, it was revealed to be an [http://www.oddworld.com/soulstorm/images/ARG_Image_04_4K.jpg image] of a Mudokon wearing a gas mask. OWI uploaded this cleaned up version very shortly afterwards.<br />
<br />
== The Fifth Transmission ==<br />
<br />
Before the next transmission was made, subtle little changes were made to the 1029.io website. This included:<br />
<br />
1. A new HTML comment in the source code, reading: <pre><!-- heh, that was easy. let's see... --></pre><br />
<br />
2. The colour used for the highlights on the logo changed from red to green.<br />
<br />
3. Symbols in the logo would change to spell out the word "Magog".<br />
<br />
This would hint at The Magog Cartel, the main antagonistic company in the Oddworld Universe that is known for poor working conditions and treatment of the Mudokons.<br />
<br />
=== The Magog Cartel===<br />
<br />
Shortly after these discoveries, strange occurrences happened on the newly created Official Oddworld Discord server.<br />
<br />
1. A new emote with the Magog Cartel logo was added with the name :staywealthy:<br />
<br />
2. For a while all messages containing the :staywealthy: emote or the 8291 code (:_e_: :_t_: :_n_: :_o_:) got removed.<br />
<br />
3. The Oddworld Inhabitants employees (OWI_Alex, OWI_Pete & OWI_Bernice) stated posting gibberish and messages coming from an other entity. <br />
<br />
Some of the gibberish included:<br />
<br />
Òǚř ʂе¢цгіẗу ẁᾅș πŏţ ḃӷӫǟċḥễđ Ọսȑ šѐсưȑіƫỵ ẅἂѕ ᾒṑե ƃŗӫᾶϲɦẻđ ⍬ṳř şĕсǜӷɩȶӱ ẁấṣ ʼnόՒ þȑѐẩƈȟεժ Ỡùȓ șєϛụґɪŧӱ ẅᾲş բóȶ ḃŗḛąḉℏӫď Ơǔѓ ṡễćṻȓĩťÿ ẇẳŝ ἧὅṱ ḇґèḁčիề₫<br />
<br />
W& //€q117 PHø|? +/-/∂† +() }{∂|²|2€11.<br />
<br />
<br />
Ḿ̧̪̻̻͇̟̹̭̼͊̈́̍̎̿͐̎͝͞o̧̤̗̠͚̟͒̐͗͆͜͢͡͞C̠̯̳̙̠̳̹͒̽̇̈̽̚͜r̶͕̗̜̲͕̘̒͗̆̄̎̐̓t̛̛̯̠̼͎̭̻̯̜̿͂̑̃͌͂̔ļ̴͙̩̠̯̐̊̆̐̂̿c̢̳͎̱ ̺̮͎͖̟̐̓̐́͋͞ó̧̡̻͙̳͇̼̯̹̄͒̐͗ <br />
<br />
<br />
These all lead to [http://magogcartel.com/ magogcartel.com] and [https://twitter.com/magogcartel/ twitter.com/magogcartel]<br />
<br />
On The Magog Cartel's website, there are some interesting codes in the source code:<br />
<br />
1.<br />
<br />
DB_PP_PRODUCTTEXT: We’re sourciest, juiciest Parami__from closer to their nests, for our bes___________________________________________________________aramite Pies ever! Made with all natural ingredients[1] and baked in our traditional ovens to a recipe that’s be............ aster bakers, our pXXXes are packed with Para-meat[2] oooooooooooo00OOoozing [1] at least one natural ingredient in every 12-pack of pie_________8** [2] not necessarily made with Paramites.<br />
<br />
PLEASE REVIEW AS APPROPRIATE<br />
<br />
2.<br />
<br />
APPROV__tch this space for more information about our exciti________________ everage that’s so delicious, you’ll be craving another on33__________--333333333333 before you even finish it!!!_____________________________________________!!!:D:D:D<br />
<br />
3.<br />
<pre><br />
lfn0OE602+HKBKTMVawALWERLS6pu8P8NcEQyKfnKcQ5zy/H5ny4CU60hkmMHzqlNg+q2oVaSHjSzjPGo1vQzQsJCbHTNAXDCFgTIJznL/1ZkZT89VOuv4koDHZJs4YcWbOLbO1cvV87UMcdWbuAraCeFRF8jy7F1/PufFPAyYRR9Jp4nB6uWpNZlY8rdYmEw7IYvtg4QlaBtX/iiyT1Es8MFA+wO4OkBFEGLHDENvu83kfaMnBxabDguhS/W0wWJjNijasG+5PeHeWqmQYDWsz9YrKgWiap0KCghpDfRuOgH37qNUAQnIf4/AeMF14IiEg9PFlutZWGyXhHem4PF2kxYGp075T+5N0n6nbJt+MMDAa4H3D06iuZa5bK18pLIUIzaFxLue5EJoEz4+JwCYarhZ7JMqbzrtnPv8oK/BbHgaig9MjKf8X7/cHDaXkVObkhW8jyVxxS6IfedZIRO/Phqorogx+DO6dgKWhqppoRNpMU2jawix9b/rf6ZgGRcpngW9pOCDwxCB0UptxmaNk+fnxQQU1Wo9J/isrrgTd/eDpdZgFyD8d8KhYN/Uf8A3MhWX33Xr8MhAPF+BtQUYFYIrvD32CTtDqtGXfL26fdhAVh8XMjTFwwWCB6DH6WwYCwJyLCVikMSXOLbPfzZKFfZIia9KQnM24dGUOvVMkfBdTqdCpiuwV4NkGKY2hw2jNhjibPLt/Rcpnsxj3B+2Axu6z5bMnzPLRZY00w6p8CJckqQqV9YXdReb34dOLC/6Zb2VWbx1ARGNBwdN69lw==<br />
</pre><br />
<br />
INSERT ANECDOTE ABOUT THE ApMpApZING VIEW just left of here across Mudos AND who could possibly be the EMPLOYEE OF THE DAY AND THE NEW i mean, how hard can it be? every aspect of every aspect of every as-------------f every aspect of EVERY SIN--E ASPECT of every aspect of every asp--_--------------------ct of every aspect of every as_--ct of every aspect of FOLLOW ME follow US<br />
<br />
4.<br />
<pre><br />
01102911011101100101011102910111011102901001011011000110110001110011010291110100011011110102911100000111100101101111011101011029011110011029011011110111010101110111011010010291011011010290011011000110291001100110000101101100011029101100<br />
</pre><br />
<br />
This was decoded. When removing the occurences of "1029" you get:<br />
<br />
<pre><br />
0111011101100101011101110110100101101100011011000111001101110100011011110111000001111001011011110111 01010111100101101111011101010111011101101001011011000110110001100110011000010110110001101100<br />
</pre><br />
<br />
Decode binary to text and you get wewillstopyouyouwillfall<br />
<br />
<br />
5.<br />
<pre><br />
9JzrxKKv5z0829jLV8wF32KpA6I0nEQDqzmbpRYzUUE===<br />
</pre><br />
<br />
<br />
On the 11th of August the Magog Cartel sent a batch of tweets with some out of place uppercase letters spelling '''WE KNOW'''.<br />
<br />
<pre><br />
@spiritof1029 we see you. We can see what you are doing with your fake reports. you will not prospEr. <br />
</pre><br />
<pre><br />
we are proud of the strong linKs between each of our facilities. our operations are by far the most efficieNt on oddworld. <br />
</pre><br />
<pre><br />
we are aware of some terrible fake repOrts being leaked. please ignore them. our very successful Workers know the truth is very different.<br />
</pre><br />
<br />
On the 14th of August the Magog Cartel sent a batch of tweets all starting with '''We know'''. This lead us to believe the SPIRIT OF 1029 was interferring with those tweets and was trying to get a message accross. The message can be found in the very specific numbers mentionned in the first two tweets, 82 & 91, forming togeter '''8291'''.<br />
<br />
<pre><br />
We know every time an employee falls into a grinder it takes 82 minutes of Mudokon time to clean up. Be safe, for productivity’s sake!<br />
</pre><br />
<pre><br />
We know that an average of 91 eager new employees start their careers with us every day. Help them be the best workers they can be.<br />
</pre><br />
<pre><br />
We know that our facilities are a picture of perfect productivity. Your hard work helps us to show that picture to the world.<br />
</pre><br />
<pre><br />
We know what you’re looking for in a rewarding, productive career. Magog Cartel can help you find it. Discover your options with us today!<br />
</pre><br />
<br />
One hour later the SPIRIT OF 1029 sent a batch of tweets, one containing a cryptic code:<br />
<br />
<pre><br />
your help is invaluable to us, together we will blow this latest Magog scandal wide open. together #wewillrise<br />
</pre><br />
<pre><br />
the watchers can fish around the communication channels all they like, we will always be one step ahead of them.<br />
</pre><br />
<pre><br />
-1-4,-2-10<br />
</pre><br />
<pre><br />
the story of mudokonkind is about history. now they treat us just like numbers. they will not succeed.<br />
</pre><br />
<pre><br />
we have given you the tools you need. the ones we can trust will prove themselves capable. leaders will rise as the storm closes in.<br />
</pre><br />
<br />
The last tweet indicated that we had all we needed to continue our investigation and the one before that we shouldn't use the numbers in the codes as raw numbers but should link it to some kind of history. We needed to look into the Twitter history of the SPIRIT OF 1029 account.<br />
<br />
The '''-1-4,-2-10''' code actually tells us to take the 4th word from the previous tweet (-1) and take the 10th word of the tweet even before (-2):<br />
<br />
4th word of the previous tweet is '''fish''':<br />
<br />
<pre><br />
the watchers can 'fish' around the communication channels all they like, we will always be one step ahead of them.<br />
</pre><br />
<br />
10th word of the tweet before is '''blow''':<br />
<br />
<pre><br />
your help is invaluable to us, together we will 'blow' this latest Magog scandal wide open. together #wewillrise<br />
</pre><br />
<br />
Together those word form '''blowfish''' which is the [https://en.wikipedia.org/wiki/Blowfish_(cipher) cipher] we had to use to decrypt the base64 code in HTML comment 3.:<br />
<pre><br />
lfn0OE602+HKBKTMVawALWERLS6pu8P8NcEQyKfnKcQ5zy/H5ny4CU60hkmMHzqlNg+q2oVaSHjSzjPGo1vQzQsJCbHTNAXDCFgTIJznL/1ZkZT89VOuv4koDHZJs4YcWbOLbO1cvV87UMcdWbuAraCeFRF8jy7F1/PufFPAyYRR9Jp4nB6uWpNZlY8rdYmEw7IYvtg4QlaBtX/iiyT1Es8MFA+wO4OkBFEGLHDENvu83kfaMnBxabDguhS/W0wWJjNijasG+5PeHeWqmQYDWsz9YrKgWiap0KCghpDfRuOgH37qNUAQnIf4/AeMF14IiEg9PFlutZWGyXhHem4PF2kxYGp075T+5N0n6nbJt+MMDAa4H3D06iuZa5bK18pLIUIzaFxLue5EJoEz4+JwCYarhZ7JMqbzrtnPv8oK/BbHgaig9MjKf8X7/cHDaXkVObkhW8jyVxxS6IfedZIRO/Phqorogx+DO6dgKWhqppoRNpMU2jawix9b/rf6ZgGRcpngW9pOCDwxCB0UptxmaNk+fnxQQU1Wo9J/isrrgTd/eDpdZgFyD8d8KhYN/Uf8A3MhWX33Xr8MhAPF+BtQUYFYIrvD32CTtDqtGXfL26fdhAVh8XMjTFwwWCB6DH6WwYCwJyLCVikMSXOLbPfzZKFfZIia9KQnM24dGUOvVMkfBdTqdCpiuwV4NkGKY2hw2jNhjibPLt/Rcpnsxj3B+2Axu6z5bMnzPLRZY00w6p8CJckqQqV9YXdReb34dOLC/6Zb2VWbx1ARGNBwdN69lw==<br />
</pre><br />
<br />
Using a [https://gchq.github.io/CyberChef/#recipe=%5B%7B%22op%22%3A%22Blowfish%20Decrypt%22%2C%22args%22%3A%5B%7B%22option%22%3A%22UTF8%22%2C%22string%22%3A%22%22%7D%2C%22ECB%22%2C%22Hex%22%5D%7D%5D Blowfish Decryptor] (with CBC mode) and the code '''8291''' we got earlier via the interferences in the Magog Cartel tweets as a key we were able to recover the following text:<br />
<br />
<pre> ^_^U_VDXisistrueorfalseallforprofitinterestsindustrialagriculturalMudosprovidehighestpossiblereturninvestmentsoverheadsdreamslimitedpowergiganticbadgeleadersproductMeechMotorstravelexpertlytrainedSligSecurityForcessuccessfulundertakingemploymentvastsentientsecurespecialisthabitationzonesbenefitfactoriesfoundriesfarmlandsstabilitymillionsundertakingsCartelmanagementselflesslyrepresentativesresponsiblemunicipalvastidyllicsettlementsunderconstructionpleasesubscribeandlinkandfollowandlikeandbuyandbuyandbuyandbuyandbuyandbuyandbuyandbuyandbuyandbuyandbuyandbuyandbuyandbuyandbuyatmagogcartel<br />
</pre><br />
<br />
When adding spaces this reads:<br />
<br />
<pre><br />
^_^ U_V DX is is true or false all for profit interests industrial agricultural Mudos provide highest possible return investments overheads dreams limited power gigantic badge leaders product Meech Motors travel expertly trained Slig Security Forces successful undertaking employment vast sentient secure specialist habitation zones benefit factories foundries farmlands stability millions undertakings Cartel management selflessly representatives responsible municipal vast idyllic settlements under construction please subscribe and link and follow and like and buy and buy and buy and buy and buy and buy and buy and buy and buy and buy and buy and buy and buy and buy and buy at magog cartel<br />
</pre><br />
<br />
The part with "please subscribe" lead us to:<br />
<br />
* https://www.youtube.com/user/MagogCartel<br />
<br />
It is not sure at this point whether this is an official ARG account as the channel and profile are currently empty.<br />
<br />
<br />
The two last tweets of August 14th from the Magog Cartel were hinting at a '''picture''' on the MagogCartel.com website ('''Magog Cartel can help you find it'''):<br />
<br />
<pre><br />
We know that our facilities are a picture of perfect productivity. Your hard work helps us to show that picture to the world.<br />
</pre><br />
<pre><br />
We know what you’re looking for in a rewarding, productive career. Magog Cartel can help you find it. Discover your options with us today!<br />
</pre><br />
<br />
This led us to:<br />
<br />
* [http://magogcartel.com/weknow.jpg magogcartel.com/weknow.jpg]<br />
<br />
That picture contains quite a few codes:<br />
<br />
* The '''62466640222 2777833555''' sequence in the upper-left corner.<br />
<br />
Spells '''Magog Cartel''' when using a [https://www.mrwebmaster.it/img/guide/wp7/21-001.jpg phone keypad]<br />
<br />
* The mose code in the middle.<br />
<br />
<pre><br />
.-- . / -.- -. --- .-- / .... --- .-- / -.-- --- ..- / .-- --- .-. -.- / -. --- .-- .-.-.- / .-- . / -.- -. --- .-- / -.-- --- ..- .-. / -.-. --- -.. . ... .-.-.- / .-- . / .-- .. .-.. .-.. / ... - --- .--. / -.-- --- ..- .-.-.- / -.-- --- ..- / .-- .. .-.. .-.. / -. --- - / .. -. - .. -- .. -.. .- - . / ..- ... .-.-.- / --- ..- .-. / .-- .- -.-- / --- ..-. / .-.. .. ..-. . / -- ..- ... - / -... . / .--. .-. . ... . .-. ...- . -.. .-.-.-<br />
</pre><br />
<br />
<pre><br />
WE KNOW HOW YOU WORK NOW. WE KNOW YOUR CODES. WE WILL STOP YOU. YOU WILL NOT INTIMIDATE US. OUR WAY OF LIFE MUST BE PRESERVED.<br />
</pre><br />
<br />
* The '''e''' and '''d''' sequence in the upper-right corner.<br />
<br />
It's actually morse code too where '''e = .''', '''d = -''' & '''X = /'''.<br />
<br />
<pre><br />
.-.. --- --- -.- --..-- / .-- . / -.-. .- -. / -- .- -.- . / ... . -.-. .-. . - / -.-. --- -.. . ... / - --- --- .-.-.- / -.-- --- ..- / .- .-. . / -. --- - / .- ... / ... -- .- .-. - / .- ... / -.-- --- ..- / - .... .. -. -.- / -.-- --- ..- / .- .-. . .-.-.- / .-- . / .... .- ...- . / - .... . / .-. . ... --- ..- .-. -.-. . ... / .- -. -.. / - .... . / .--. . .-. ... --- -. -. . .-.. / - --- / ... .. -- .--. .-.. -.-- / ... .-- .- -- .--. / -.-- --- ..- / .-- .. - .... / .-- --- .-. -.- .-.-.- / .... --- .-- / -- ..- -.-. .... / - .. -- . / -.. .. -.. / -.-- --- ..- / .-- .- ... - . / - .-. -.-- .. -. --. / - --- / -.. . -.-. .. .--. .... . .-. / - .... .. ... / -.-. --- -.. . ..--.. / .- .-.. .-.. / - .... . / - .. -- . --..-- / .-- . / .-- . .-. . / --. . - - .. -. --. / -.-. .-.. --- ... . .-. / - --- / ..-. .. -. -.. .. -. --. / -.-- --- ..- .-.-.- / .-- . / .- .-. . / .- .-.. -- --- ... - / - .... . .-. . .-.-.- / -- .- -.-- -... . / .-- . / .- .-. . / --- ..- - ... .. -.. . / .-. .. --. .... - / -. --- .-- --..-- / .-- .- .. - .. -. --. .-.-.- / .-- .- - -.-. .... .. -. --. .-.-.- / -.-- --- ..- / -.-. .- -. -. --- - / .... .. -.. . / ..-. --- .-. . ...- . .-. --..-- / - . .-. .-. --- .-. .. ... - .-.-.- / .-- . / .-- .. .-.. .-.. / .. -. -.-. .. -. . .-. .- - . / -.-- --- ..- .-. / ... .. .-.. .-.. -.-- / .-.. .. - - .-.. . / --. .-. --- ..- .--. / .- -. -.. / ... -.-. .- - - . .-. / -.-- --- ..- .-. / .- ... .... . ... / - --- / . ...- . .-. -.-- / -.-. --- .-. -. . .-. / --- ..-. / --- ..- .-. / . -- .--. .. .-. . / ... --- / - .... .- - / -.-- --- ..- / .-- .. .-.. .-.. / . - . .-. -. .- .-.. .-.. -.-- / -... . .- .-. / .-- .. - -. . ... ... / - --- / --- ..- .-. / ... ..- -.-. -.-. . ... ... . ... --..-- / .- -. -.. / -.-- --- ..- .-. / -.- .. -. -.. ... / ..- -. . -. -.. .. -. --. / ... . .-. ...- .. - ..- -.. . .-.-.- / -.-- --- ..- / .... .- ...- . / .- .-.. .-. . .- -.. -.-- / .-.. --- ... - .-.-.-<br />
</pre><br />
<br />
<pre><br />
LOOK, WE CAN MAKE SECRET CODES TOO. YOU ARE NOT AS SMART AS YOU THINK YOU ARE. WE HAVE THE RESOURCES AND THE PERSONNEL TO SIMPLY SWAMP YOU WITH WORK. HOW MUCH TIME DID YOU WASTE TRYING TO DECIPHER THIS CODE? ALL THE TIME, WE WERE GETTING CLOSER TO FINDING YOU. WE ARE ALMOST THERE. MAYBE WE ARE OUTSIDE RIGHT NOW, WAITING. WATCHING. YOU CANNOT HIDE FOREVER, TERRORIST. WE WILL INCINERATE YOUR SILLY LITTLE GROUP AND SCATTER YOUR ASHES TO EVERY CORNER OF OUR EMPIRE SO THAT YOU WILL ETERNALLY BEAR WITNESS TO OUR SUCCESSES, AND YOUR KINDS UNENDING SERVITUDE. YOU HAVE ALREADY LOST.<br />
</pre><br />
<br />
* The [https://lobestir.files.wordpress.com/2014/05/cypher-pig-pen-lower.png Pigpen cipher] text in the lower-right corner.<br />
<br />
<pre><br />
WE WILL NEVER GIVE IN TO TERRORISTS. YOU WILL NEVER WIN. YOU WILL NOT DEFEAT OUR SPIRIT. WE WILL FIND YOU AND WE WILL WIPE YOU OUT. WE IGNITE THE FLAME THAT LIGHTS THE DARKNESS. THERE IS NOWHERE TO HIDE. YOU WILL NEVER KNOW SUCCESS<br />
</pre><br />
<br />
* The horizonally mirrored black text in the middle.<br />
<br />
<pre><br />
you are a resource. you are expendable. we will replace you when you fall. you will work. you will obey. you will comply. or you will perish. we have the prestige. we have the power. we will profit. always. always. always.<br />
</pre><br />
<br />
* The white text on the top.<br />
<br />
<pre><br />
Prestige. Power. Profits. Work. Obey. Comply. Prestige. Power. Profits. Work. Obey. Comply. Prestige. Power. Profits. Work. Obey. Comply. Prestige. Power. Profits. Work. Obey. Comply. <br />
</pre><br />
<br />
* The braille at the bottom.<br />
<br />
<pre><br />
RuptureFarms1029 will rise from the ashes. we will rebuild it bigger, better and more profitable than before. it will be the greatest, most efficient factory that Oddworld has ever seen. it will be a towering symbol of Glukkon strength that cannot be ignored. one terrorist will not deter us.<br />
</pre><br />
<br />
It has to be noted that those codes were left by the Magog Cartel as what appears to be a bait so that we would lose valuable time decoding them.<br />
<br />
It is unknown how to decode the '''9JzrxKKv5z0829jLV8wF32KpA6I0nEQDqzmbpRYzUUE===''' code.<br />
<br />
The page has changed since then, but the first (hacked) version of the MagogCartel.com site has been archived [http://oddworldlibrary.net/archives/web/MagogCartel.com/index_1/P.%20P.%20P.%20_____%201029%20_____.html here]<br />
<br />
On the 4th of September the MagogCartel.com got updated, simply displaying the following text:<br />
<br />
<blockquote><br />
*** UNDER CONSTRUKTION ***<br />
</blockquote><br />
<br />
The page has changed since then, but the second (under construktion) version of the MagogCartel.com site has been archived <br />
[http://oddworldlibrary.net/archives/web/MagogCartel.com/index_2/___%20UNDER%20CONSTRUKTION%20___.html here]<br />
<br />
On the 5th of September the Magog Cartel posted a video trough the OddworldInc account:<br />
<br />
<pre><br />
w̸̨̠͓͍̯̺͉͞e̯̝͖̫̺̯͉̻͘͡ ̗̭̕͢s̴̮̭̫̱ͅe̢̠̮̫̦̼̪̘͠ͅę̠̥̯͔̣̼̻̕ͅ ̻̘̼̣͓̩͚͘͢͠y̴̭̯̪̺͙͚͚̪͞o̬̞͜͢͝u̮̤͖̩̗̰ͅͅ.̴̲̣̪̮̼̱.̡̰̭̗͍̝͉̯͢.̡̡̼͇̙̜̮̦̪̞ͅ <br />
pic.twitter.com/UoQ3xRAhDU<br />
</pre><br />
<br />
<pre><br />
We continue to demonstrate our exceptional technological progress to an ever growing number of customers. Everyone loves Magog products!<br />
</pre><br />
<br />
When asked if they really just claimed the attack on the @OddworldInc account they replied:<br />
<br />
<pre><br />
Attack? We don’t need to attack, we’re already in a dominant position in every market we deem profitable. We just demonstrate our dominance.<br />
</pre><br />
<br />
There are multiple messages flashing in the video:<br />
<br />
<pre><br />
8<br />
?<br />
2<br />
2<br />
9<br />
1<br />
/<br />
8291<br />
829/<br />
229/<br />
22/9<br />
EVERYONE<br />
WANTS<br />
TO<br />
EAT<br />
YOU<br />
</pre><br />
<br />
Note that '''22/9''' is the date of the Oddworld presentation at the EGX:<br />
<br />
<pre><br />
We're going to be at EGX for an on-stage presentation on Friday 22nd Sept! Grab your tickets now! @EGX pic.twitter.com/rDQiDIApa9<br />
</pre><br />
<br />
<br />
On the 7th of September the MagogCartel.com got updated again, randomly displaying one of three photos of The Informant.<br />
<br />
At the same time the Magog Cartel sent a batch of tweets with containing other pictures of The Informant:<br />
<br />
<pre><br />
We stopped reading the Daily Deception’s fake reports. The latest issue of The Informant is a really great read, very honest. The greatest!<br />
</pre><br />
<br />
<pre><br />
It’s great to finally have an honest newspaper to read, and such good quality, too! <br />
pic.twitter.com/MHuC6jdtNC<br />
</pre><br />
<br />
<pre><br />
We’re always happy to see some balanced reporting on our business from The Informant. Refreshing, when there are so many fake reports! <br />
pic.twitter.com/DmkV4GbVYw<br />
</pre><br />
<br />
<pre><br />
We’ve just been told that The Informant is printed on machines made at a Magog facility! That explains the quality! <br />
pic.twitter.com/Bvz29ZrBvk<br />
</pre><br />
<br />
It has been noted that some letters were in bold but it's unclear how this should be used.<br />
<br />
Part of The Informant has be transcribed here:<br />
<br />
http://oddworldlibrary.net/oddenc/index.php?title=Soulstorm_ARG_-_The_Informant<br />
<br />
The MagogCartel.com page also contains the following HTML comment:<br />
<br />
<pre><br />
<nowiki><!--</nowiki> seriously, are you guys seeing this?! --><br />
</pre><br />
<br />
== The third phase ==<br />
<br />
=== The Origins diversion ===<br />
<br />
On the 15 of March 2018 the SPIRIT OF 1029 posted the following tweets:<br />
<br />
<pre><br />
Our future depends on us understanding our past. We must know where we come from.<br />
</pre><br />
<br />
<pre><br />
We know you can hear us. We know you are ready to help. We will show you more when the time is right. Keep watching.<br />
</pre><br />
<br />
Following this a couple of changes were found on the 1029.io page.<br />
<br />
# The logo has now even more letters appearing in it randomly: '''S, I, N, O, R'''. Adding to the previous letters that were spelling "MAGOG".<br />
# The page contains a new HTML comment:<br />
<nowiki><!--</nowiki> too obvious? i dunno. it's soon though. i can't wait. --><br />
<br />
Changes were also observed on the 404 page:<br />
<br />
# The logo on the 404 page now contains the following letters: '''N, I, G, I, O, R, S'''. Those letters can be used to spell the word "ORIGINS" <br />
# The page contains a new HTML comment:<br />
<nowiki><!--</nowiki> me neither. it's going to be great. --><br />
<br />
Shortly after a new channel called "origins" appeared on the official [https://discord.gg/bQKeAE6 Oddworld Discord] with a cryptic [https://cdn.discordapp.com/attachments/424167787897028609/424175888418996225/origins_1.mp4 video] as first message.<br />
<br />
It was revealed a few days later that this was a built up to announcement of the [https://www.kickstarter.com/projects/1869209521/oddworld-abes-origins-book-and-game-collection "Oddworld: Abe's Origins - Book & Game Collection" kickstarter campaign]. Note that the book & game collection is still available for preorder on [https://app.crowdox.com/projects/1869209521/oddworld-abes-origins-book-and-game-collection Crowdox].<br />
<br />
=== Intro ===<br />
<br />
Around the 12th of January 2018 [[Lorne Lanning]] changed his twitter header picture to the following one:<br />
* https://pbs.twimg.com/profile_banners/20823262/1515636880/1500x500<br />
<br />
While it was hinted repeatedly in the official [https://discord.gg/bQKeAE6 Oddworld Discord] that this image was hiding something, it wasn't until much later that it was found how to use it when @edmudokon tweeted the following message:<br />
<br />
<pre><br />
alive… <br />
pic.twitter.com/j0FE2Qgdu1<br />
</pre><br />
<br />
The embedded picture contains the number '''15156'''. This is a reference to a number in the URL of Lorne's header picture: '''1515636880'''.<br />
<br />
This number led us to a new page:<br />
<br />
* http://www.1029.io/1515636880/<br />
<br />
This page contains the following text in UTF-8<br />
<br />
<blockquote><br />
ɦểɫр. гẹẳčℏɪṅǧ óúƫ ῒԑ ģӫԷṱіᾗĝ ḥǡṛⅾềɽ. էիȅỷ ķῆοԝ. ẁẹ'ṝϵ ṙṵɴᾑıпʛ ộևȽ ờẛ ɩḋϵᾂš, ὅрՒῑổпş, ăұҿἧµϱṣ. ẅϵ ǹêȩḋ ỳờǚґ ḣҽľῥ. ẇể ῂёϱḋ ѕờṃēƅȯƌý ţó ṧṕȑểǻժ Ƚħẹ ẁổṝḓ. եḫϊṥ ƫɦ¡ƞɡ ῐʂ ḸỄƮḨǠĻ. Ƚḣěȳ ḓõᾔ'Ƚ ĉὰгє Ƚḣổṻɕḫ. ţհểӯ ɗṍἧ'ţ. ṣởṁḗɒὀժỵ ňěөƌş ṱὃ ȶěḻɫ իḭɱ. †ɛŀļ ẖĩ₥. ḃḕẛṍɼę îȽ'ṧ Էȭô ḷǎťϱ. ṯĥềŗȇ ḧąș Էố ƃϱ ᾅ ṣọṁȇþöḏỳ ẉíļłȋդǥ եό ȶαҝě ṯẖё јǒŭӷṋёỷ. şõ₥ęƀὁḓẏ ṅểềⅾԑ ƫծ ġềŧ ţհϵ ṃệṣśᾇǵε ộվե. ẁë'ṝе ìη ṭӷơữþŀɛ. аɬł ṑƒ սʂ. ẁё դȅễɖ ĥẹĺρ. թłȩᾂʂĕ ɦȇɫṕ կѕ.</<br />
</blockquote><br />
<br />
and the following HTML comments<br />
<br />
<nowiki><!--</nowiki> it's only going to get harder. we don't have the keys anymore to the usual channels. if you hear anything from them, it's THEM. --><br />
<br />
<nowiki><!--</nowiki> our options are limited. you can help though. you have to help. if we can be sure it's you, then maybe we can talk. prove it. --><br />
<br />
It's currently unknown what the next steps are<br />
<br />
== Loose Ends ==<br />
<br />
This section documents various puzzles throughout the ARG which have not yet been used or solved.<br />
<br />
=== Main Website Source Code Comment Numbers Puzzles ===<br />
<br />
These numerical puzzles were found in the source code for the [http://www.oddworld.com/soulstorm/ official Oddworld website] as early as the date of the Spirit of 1029's first transmission. Their solutions have been found, but the intended use of the solutions remains unknown.<br />
<br />
!--<br />
<br />
72 99<br />
\ /<br />
27 45<br />
\ /<br />
18 39<br />
\ /<br />
21 36<br />
\ /<br />
?? 28<br />
\ /<br />
13 21<br />
\ /<br />
7<br />
<br />
--><br />
<br />
SOLUTION: 12<br />
7+2+9+9 = 27, 2+7+4+5 = 18, thus 2+1+3+6 = 12<br />
<br />
&<br />
<br />
!-- <br />
<br />
16 _ 37 _ 58 _ 89 _ 145 _ 42 _ ?? _ 4<br />
|_________________<_________________| <br />
<br />
--><br />
<br />
SOLUTION: 20<br />
1^2 + 6^2 = 37, 3^2 + 7^2 = 58, thus 4^2 + 2^2 = 20<br />
<br />
==== Other Source Code Comments ====<br />
<br />
On http://1029.io, the following comments could or can be found in the page's source code:<br />
<br />
!-- we'll be here, waiting. --><br />
<br />
&<br />
<br />
!-- <br />
Well, I //--/ED Mudokon/. But who// _____ r///u/ //? <br />
<br />
=== Third Hidden Asset98 URL Source Code Solutions ===<br />
<br />
Certain code strings & puzzle solutions found within the [http://wiki.gamedetectives.net/index.php?title=Oddworld_Soulstorm#Source_Code_Mysteries source code] for the third hidden Asset98 URL were not ultimately used in the course of arriving at the image locked behind them. These strings & solutions in include:<br />
<br />
The solution for the numbers <code>7777338883366899984477733 33</code>, which decode to <code>SEVENTYTHREE</code> via [http://www.dcode.fr/multitap-abc-cipher multi-tap cipher], was never applied.<br />
<br />
The following letter strings were never applied:<br />
<br />
<pre><br />
\\//\/KDIUTHANPUYHHDQOEPLNDOALJGUDITHBBDOZLGFERKJGLSAOE<br />
<br />
\////JUTYROSLNGNALEHGNWOTIQPOKSDNTPNOJAWEOBNGLAWKJNWNR <br />
<br />
\\\/\\JHWUITUHABSJGNEWKLALNVGJKWELKJLWQQPRUTJHJJSBFMMH<br />
</pre><br />
<br />
The following coordinate strings were never applied:<br />
<br />
<pre><br />
\\\\/\2,1:2.3,1:2.6,1:4.1,2:4.3,2:2.3,4:4.5,5:2.6,5:3.7,5:3.4,7:8.5,7:3.7,6:4.<br />
<br />
\///\//\1,1:3.4,1:2.6,1:9.2,2:2.6,2:2.2,4:4.3,5:2.5,5:2.7,5:3.4,7:3.6,7:2.7,7:2. <br />
<br />
\\//\\\/4,2:6.6,2:4.7,3:3.2,4:8.3,4:2.4,4:2.7,4:3.2,6:2.4,6:3.6,6:2.1,7:4.3,7:2.<br />
</pre><br />
<br />
The community speculates that these strings were not intended to be used but rather existed as "red herrings" in order to stall attempts to solve the grid. The only strings which were used were the ones which began with a forward slash ( / )<br />
<br />
=== Written Text on "Puzzle Pieces" Image ===<br />
<br />
Writing which was noticed written over the image on the puzzle pieces, but which is absent from the final released image. The significance of the writing remains unknown.<br />
<br />
<gallery mode="packed" widths=200px heights=300px><br />
File:Oddworld_1029-LY_letters.jpg|1029-LY "WHERE"<br />
File:Oddworld_7393-AN_letters.jpg|7393-AN "SO TIRED"<br />
File:Oddworld3786-IC_letters.jpg|3786-IC "WHO?"<br />
File:Oddworld_8291_circled.png|Complete Image "8291"<br />
</gallery><br />
<br />
=== Anomalies In First Released Image ===<br />
<br />
Hidden against the background of the first released image are several text strings, pictured below. Their significance is unknown.<br />
<br />
[[File:Oddworld_Complete_1_Iso.jpg|frameless|810px]]<br />
<br />
1101110BC<br />
100000BD or 100000BC <br />
010100BD</div>Halke234https://wiki.gamedetectives.net/index.php?title=Oddworld:_Soulstorm&diff=16745Oddworld: Soulstorm2018-08-01T15:41:47Z<p>Halke234: /* The Horror Is Shown In Full */</p>
<hr />
<div>{{argbox<br />
| float = right<br />
| name = Oddworld: Soulstorm ARG<br />
| image = File:Oddworld_ABETHUMB_8291.jpg<br />
| imagewidth = 500<br />
| description= Oddworld: Soulstorm - An ARG centered around lore from the Oddworld universe linked to the currently unreleased game [http://www.oddworld.com/soulstorm/ Oddworld: Soulstorm]<br />
| creator = [http://www.oddworld.com/ Oddworld Inhabitants, Inc]<br />
| type = Official<br />
| status = Active<br />
| reopened = 05-30-2018<br />
| discovered = 12-22-2016<br />
}}<br />
{{ArgHeader}}<br />
{{BackToTop}}<br />
<br />
The Oddworld: Soulstorm ARG was an ARG centered around lore from the currently unreleased Oddworld game, [http://www.oddworld.com/soulstorm/ Oddworld: Soulstorm]. The official home page for the ARG, containing puzzles, hints, and clues, can be found [http://www.oddworld.com/soulstorm/ here]. The ARG was divided into 5 distinct stages, each of which began with a "transmission": an image clue that led to a series of puzzles.<br />
<br />
== Prelude ==<br />
<br />
Early in 2016, [https://twitter.com/edmudokon Twitter account @edmudokon] began posting cryptic messages that seemed to be related to the [http://www.oddworld.com/ Oddworld] universe. The account appeared to be run by an average Mudokon named Ed who claimed to have information he wanted to share, but he seemed to be in constant danger and could only access the outside world via a faint connection. Beginning around March 2016, @edmudokon engaged users with an elaborate series of puzzles and challenges, releasing information both on twitter and via the official Oddworld [http://www.oddworld.com/soulstorm/ website]. These puzzles eventually led to the revelation of a website, http://1029.io, as well as a message: "now you know. you can help. join us. together we can rise."<br />
<br />
The [http://1029.io 1029] webpage featured glitchy effects and another rendition of the ASCII-art logo, but with the numbers 8291 replacing some characters. At the bottom of the page was an e-mail signup form, above which was a message:<br />
<br />
<pre><br />
THE FALL OF RF1029 WAS THE SPARK TO IGNITE A REVOLUTION. FOR TOO LONG, THEY HAVE CONTROLLED THEIR GIANT INDUSTRIAL MACHINES, GRINDING THE BONES OF OUR KIND INTO DUST IN THEIR ENDLESS PURSUIT OF POWER AND WEALTH.<br />
<br />
WE WERE TAUGHT THAT THIS IS ALL THERE WAS: OBEY.<br />
<br />
THE TRUTH WAS HIDDEN FROM US. OUR HISTORY WAS HIDDEN FROM US. WE WERE BRED TO WORK, RAISED TO OBEY AND FORCED TO COMPLY.<br />
<br />
OUR NATURAL CONNECTION TO MOTHER PLANET WAS ERASED FROM THE CONSCIOUSNESS OF OUR PEOPLE. LOST WAS OUR KNOWING. LOST WAS OUR UNITY, OUR CONNECTION, OUR POWER AND OUR PURPOSE. ALL THAT WE WERE WAS A COMMODITY TO BE TRADED AND EXPLOITED IN THE ONGOING RACE FOR MORE WEALTH. WHAT WE SHOULD HAVE PROTECTED, WE WERE TRICKED INTO KILLING. WHAT WAS WORST FOR US, WE WERE TOLD WAS BEST. WE WERE TAUGHT TO TRUST THOSE WHO WOULD DECEIVE US THE MOST.<br />
<br />
THAT HAS ALL CHANGED.<br />
<br />
THE HERO HAS SHOWN ALL OF US THAT OUR OPPRESSORS CAN BE TOPPLED. HE HAS FOUND OUR WILD AND KNOWING BROTHERS. HE HAS RECONNECTED THE FACTORY-BORN TO OUR NATURAL WORLD AND ANCIENT WAYS. HE HAS LIT A FIRE IN OUR HEARTS THAT CANNOT BE EXTINGUISHED.<br />
<br />
WE WILL GIVE HELP TO THOSE WHO ARE HELPLESS. WE WILL LEND STRENGTH TO THOSE WHO ARE WEAK. WE WILL FIGHT FOR THOSE WHO ARE DEFEATED. OUR MOVEMENT WILL SPREAD LIKE A RAGING INFERNO AND WE WILL TAKE BACK THE POWER FROM THOSE WHO HAVE ABUSED IT.<br />
<br />
WE WILL NOT BE SILENCED BY THE MEDIA CIRCUS. WE WILL NOT BE IGNORED. WE WILL NOT STOP. WE WILL NOT OBEY. WE WILL RISE AND WE WILL RISE AGAIN, UNTIL WE HAVE BURNED THROUGH OUR TATTERED BONDS AND RAZED THE MACHINE TO THE GROUND.<br />
<br />
WE WILL RISE. JOIN US.<br />
<br />
THERE’S A STORM COMING.<br />
</pre><br />
<br />
In the source code for the page, only the letters E and D of the message remain capitalized.<br />
<br />
Later that day, the [https://twitter.com/SPIRITOF1029 Twitter account @SPIRITOF1029] revealed themselves as a "Clandestine organization dedicated to doing good on behalf of the Mudokons and revealing information about a new horror being perpetrated against their species." They also tweeted their first message, parroting the [http://1029.io 1029 URL] and adding their own message: "There is a storm coming. Join us."<br />
<br />
Social media feeds went dark until December, 2016, posting only reiterations of the URL with messages like "Rise up" and "We are the storm. Join us". Then, in January of 2017, activity on the accounts surged once again and the first hints of an ARG began to appear.<br />
<br />
[[File:Oddworld_Logo3.jpeg|thumb|left|Spirit of 1029 emerges with this sleek ASCII-art logo]]<br />
<br />
=== Smells like Mudokon Spirit ===<br />
<br />
The flurry of new activity in January mainly consisted of @edmudokon and @spiritof1029 conversing about about whether or not Ed would be able to help the organization's cause. At this point, the Spirit of 1029 made their message very clear, stating "Oddworld has been blind to the plight of the noble Mudokons for too long. We will rise. Join us! http://1029.io". More notable activity includes the organization's quip "We recommend knowledge of many different codes and ciphers - you never know who is listening. #learnyournameinmorsecodeday", hinting that the coming information would be encrypted in some way..<br />
<br />
Oddworld Inhabitants (Oddworld developers, [https://twitter.com/OddworldInc @OddworldInc on Twitter]) was contacted by the organization at this time, being told by Spirit of 1029 "We will help @edmudokon but we can't send anything unencrypted. You'll have to break our code. We'll be in touch." Very shortly thereafter, on January 19th, 2017, Spirit of 1029 tweeted: "We have received a transmission. We will pass it on as soon as we can verify. We need your help." and the [http://www.oddworld.com/soulstorm/ Oddworld Webpage] was updated with a download for two files.<br />
<br />
== The First Transmission ==<br />
<br />
The Spirit of 1029's first transmission came in the form of an image and an audio file. The image, pictured on the right as it looked upon transmission, appeared to show a tattered and burned document bearing the Spirit of 1029's logo with the slogan "We Will Rise," with many portions of text redacted. The text on the document, where it was legible and not redacted, reads:<br />
<br />
[[File:Oddworld_1029_Photo1_Dirty.jpeg|thumb|right|200x300px|The distorted image sent by the Spirit of 1029 as part of their first transmission]]<br />
<br />
<pre><br />
Date:<br />
Period: XXXXXXXXXXX<br />
Specification Details:<br />
XXXXXXXXXXXXXXXXXXXXXXXXXX<br />
-Observe XXXXXXX and XXXXXXXX changes in test subjects<br />
-Assess long term XXXXXXXX on XXXXXXX<br />
-Determine product safety<br />
Authorization: XXXXXXXXXXX<br />
Tests requested:<br />
-XXXXXXXX Pronostics<br />
- ?Access whenever? product XXXXXXX<br />
-Acidity Levels<br />
- ????? XXXXXXXXX<br />
-Product safety<br />
Expected results: XXXXXXXXXX make XXXXXXXXX interesting<br />
Test results:<br />
-XXXXXXX highly XXXXXX<br />
-XXXXXXX this XXXXXX ?? XXXXXX ?nice? XXXXXXXX<br />
-Highly XXXXXXX<br />
-Subjects: XXXXXX<br />
- XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX<br />
XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX<br />
XXXXXXXXXXXXXXXXXX<br />
Conclusion: Product (ready) for consumption <br />
--------------------------------------------------------------------------------------------<br />
??? : XXXXXXXX there is XXXXXX here but it will XXXX ???? XXXXX<br />
--------------------------------------------------------------------------------------------<br />
</pre><br />
<br />
[[File:Oddworld_1029_Photo1_Clean.jpeg|thumb|left|A cleaned up version of the Spirit of 1029's first transmission made by the community]]<br />
<br />
As progress was made on the puzzles, the [http://www.oddworld.com/soulstorm/#navfirstcontact official Oddworld webpage] was updated to provide hints. This practice continued throughout the ARG.<br />
<br />
[[File:Oddworld_Arrows_pad.png|thumb|right|200x300px|The cryptic arrows found along the right side of the first image sent to the community by the Spirit of 1029]]<br />
<br />
=== Directional Arrows, Pigpen, & Anglo-Saxon Runes ===<br />
<br />
In addition to the text in the photo, there were several areas featuring symbols and runes. Along the top of the document, [http://www.omniglot.com/images/writing/futhorc.gif Anglo-Saxon runes] spelled out <code>ED</code>. Along the bottom, the text <code>YOU ARE THE KEY YOU KNOW IT IF YOU WERE LISTENING</code> is spelled out in the font, [http://www.babelstone.co.uk/Fonts/Pigpen.html BabelStone Club Penguin pigpen]. Running along the right side of the image, [http://wiki.gamedetectives.net/images/0/0c/Oddworld_Arrows.png arrows] can be seen pointing in a number of different vertical, horizontal, and diagonal directions. Players discovered that the arrows could be decoded by taking their angle measurement and deducing an "alphanumeric" equivalent, or a number between 0-25 where each number represents a letter of the alphabet. It just so happened that each arrow had an angle which ended in a zero, and thus, the first "arrow cipher" decoded to:<br />
<br />
<pre><br />
12 15 15 11 6 15 18 15 21 18 13 5 19 19 1 7 5 8 5 1 18 15 21 18 22 15 9 3 5<br />
<br />
L O O K F O R O U R M E S S A G E H E A R O U R V O I C E<br />
</pre><br />
<br />
The message decodes to <code>LOOK FOR OUR MESSAGE HEAR OUR VOICE</code>.<br />
<br />
=== First Audio Clip ===<br />
<br />
The second part of the Spirit of 1029's first transmission consisted of an [http://www.oddworld.com/soulstorm/1029contact/1029_01_audio.mp3 audio clip] lasting 1:40. Hidden in the audio clip was reversed Morse code, which proved difficult to decode by ear due to the added white noise. Eventually, the code was cracked by using a spectrogram of the audio.<br />
<br />
[[File:Oddworld_Morse_Spectro.png|frameless|center|810px|]]<br />
<br />
Although rough in some spots, the decoded Morse read:<br />
<br />
<code style="word-break:break-all;word-wrap: break-word;">qmiqwmiqyidimrjqdjijilmxmnrjqdjajmpmnrprspkesmkjpdqjnyajnwsnrpgspcsppmqidimqymdbcqajnwsnrpgspcdhbzmnjajanadumjimrpq</code><br />
<br />
In addition, players also discovered that, using portions of the Morse already decoded accurately by ear, it was actually to be used as ciphertext in a shift cipher, and that the key to be used was "storm," which was taken from tweets made by Spirit of 1029 declaring themselves to be "the storm". The pigpen from earlier served as a hint to look back at previous communications in order decrypt the morse. With the newly-complete Morse code now in their possession, the community was finally able to accurately decipher the ciphertext they had obtained from the reversed Morse code. It read:<br />
<br />
<code style="word-break:break-all;word-wrap: break-word;">tentwentyninedotiononqexerdotiofoeserdsdaspjaepositoryforwardslashassetninetyeightforwardslashimgzerofofrfiueonedst</code><br />
<br />
<code>ten twenty nine dot io nonqexer dot io foeserdsdaspjaepository forwardslash asset ninety eight forward slash img zero fofrfiueonedst</code><br />
<br />
Although not entirely accurate, through trial and error the community was able to locate a new URL branch of http://1029.io, http://1029.io/repository/asset98/imgzerofourfiveone/.<br />
<br />
=== First Hidden URL ===<br />
<br />
[[File:Oddworld_PuzzleAttempt.jpg|thumb|right|The product of many attempts to correctly arrange the puzzle pieces found on the hidden http://1029.io URL]]<br />
<br />
The solution for the previous puzzle led players to a hidden [http://1029.io/repository/asset98/imgzerofourfiveone/ page] on the 1029 site. Each time the page was reloaded, it displayed one of 8 different images, and a string of text for each:<br />
<br />
<gallery mode="packed"><br />
File:Oddworld_7676-AL.JPG|7676-AL<br />
File:Oddworld_3786-IC.JPG|3786-IC<br />
File:Oddworld_9455-UM.jpg|9455-UM<br />
File:Oddworld_9394-AL.jpg|9394-AL<br />
File:Oddworld_7393-AN.jpg|7393-AN<br />
File:Oddworld_5574-PH.jpg|5574-PH<br />
File:Oddworld_2384-ER.jpg|2384-ER<br />
File:Oddworld_1029-LY.jpg|1029-LY<br />
</gallery><br />
<br />
Players quickly realized that the images appeared to be fragments of a larger puzzle. The Oddworld Inhabitants [http://www.oddworld.com/soulstorm/#navfirstcontact page] updated to read "Once you've got everything together - show us!". The completed image was tweeted out to @OddworldInc on January 19th, 2017, and the next day, [https://twitter.com/OddworldInc/status/822686854516535298 instructed] players to wait while they cleaned up the complete image.<br />
<br />
<br><br><br />
<br />
[[File:Oddworld_Photo1_Clean1.jpeg|thumb|left|250x250px|Photograph of the final image before it was torn into the pieces the community was given, sent out with a message from Oddworld Inhabitants to hang tight until Thursday.]]<br />
<br />
=== First Unlocked Photo ===<br />
<br />
[[File:Oddworld_Finished1.jpg|thumb|right|400px|The final image, sent by the Spirit of 1029 and received by the community through Oddworld Inhabitants Twitter account. The image was confirmed to be an in-Unity render of the upcoming Oddworld: Soulstorm & created in conjunction with Cyrus McWilliams, formerly of Blur, and Fat Kraken Studios in England]]<br />
<br />
[[File:Oddworld_Pada.jpg|thumb|left|400px|The second transmission sent out by the Spirit of 1029, identical to the first released image but with various codes hidden within]]<br />
<br />
While waiting, players began to decode the second transmission. The prevalent writing was later verified to read "Who?", "Where?", "So Tired", and a set of numbers likely to be "8291". <br />
<br />
After three days, @OddworldInc [https://twitter.com/OddworldInc/status/823520771893030912 tweeted out a scrambled image], pictured left, stating "We received something and there's one last thing we need you to do. Share it. Spread the word.". The next day, after the tweet gained 100 shares, they tweeted the [https://twitter.com/OddworldInc/status/823620565458108416 image] again, pictured left, this time unscrambled. They then stated <code>While you shared our message 100 times we worked away to bring you this. We're clearing it up even more, we'll share what we find Thursday</code>, while the webpage was updated with the message "Update 5: Thanks to you guys sharing the previous images online, we've managed to decode the photo further and have updated the thumbnail here. We'll return on Thursday with the finished, fully decrypted image - but until then, please do let us know what you think!" When Thursday came @OddworldInc [https://twitter.com/OddworldInc/status/824638147703296000 tweeted out a final picture] of a render from the upcoming Oddworld: Soulstorm, pictured right, in all its unscrambled un-cropped glory. The release of this image signaled the end of the first of five phases of content release Oddworld Inhabitants have planned.<br />
<br />
<br><br><br><br><br />
<br />
== The Second Transmission ==<br />
<br />
[[File:Oddworld_Pada_sofar.jpg|thumb|right|400px|Hidden details in the second transmission]]<br />
<br />
On Feburary 2nd, 2017, the Spirit of 1029 again reached out to players, saying via Twitter that "Our agent has delivered another transmission. We will verify its origins and pass it on." Several hours later, @OddworldInc tweeted the message "We were just contacted again. Don't go anywhere, we might need your help with this...", and the [http://www.oddworld.com/soulst Official Oddworld Site] was updated with a message as well as [http://www.oddworld.com/soulstorm/1029contact/pada.jpg an image], pictured left. In addition to the image, a [http://us3.campaign-archive2.com/?u=2b6dca21053bc375cbdad7077&id=b08e7b2d60&e=6a2b5665ee newsletter] was sent out to everyone who signed up to the 1029 email list. The newsletter featured basic info about the ARG so far, as well as a barcode at the very bottom, which, when scanned, reveals a code:<br />
<br />
<code><br />
Ivzw gsv mfnyvih pmld gsv gifgs<br />
</code><br />
<br />
When passed through a cryptogram solver, the message read:<br />
<br />
<code><br />
READ THE NUMBERS KNOW THE TRUTH<br />
</code><br />
<br />
An [http://wiki.gamedetectives.net/images/thumb/5/56/Oddworld_Pada_sofar.jpg/800px-Oddworld_Pada_sofar.jpg "in-progress" image], pictured on the right, highlighted the hidden details found at the time and outlined their currently known solutions.<br />
<br />
=== Morseception ===<br />
<br />
The Morse code in the image turned out to be fragments of a larger single code, seen below pieced back together:<br />
<br />
[[File:Oddworld_MorseAlign_TrueHeresy.png|frameless|center|810px|Image of all the Morse code segments pieced together]]<br />
<br />
When decrypted, the morse resulted in the following message:<br />
<br />
<code><br />
DASHDOTDOTDOT DOT DASH DOTDOTDOTDOT DOT DOTDOTDOT DASH DASHDASHDASHDASH DOTDASHDOT DASHDASH<br />
</code><br />
<br />
This was found to yet again be morse code, which decoded to:<br />
<br />
<code><br />
-... . - .... . ... - --- .-. --<br />
<br />
BETHESTORM<br />
</code><br />
<br />
=== Braille & Upside-down Pigpen ===<br />
<br />
[[File:Oddworld_Brialle.png|thumb|right|250px|Braille code found in the second Spirit of 1029 transmission]]<br />
<br />
A [http://wiki.gamedetectives.net/images/a/a4/Oddworld_Brialle.png message in Braille], pictured right, in the bottom-left of the image read <code>Spread our message</code>. The Babelstone pigpen code, when flipped upside down:<br />
<br />
[[File:Oddworld_UpsideDownPigpen.jpg|frameless|center|810px|Upside-down Babelstone Pigpen code]]<br />
<br />
decoded to:<br />
<br />
<code><br />
KNOW YOUR CODES<br />
<br />
KEEP THEM CLOSE<br />
<br />
YOU WILL NEED THEM<br />
</code><br />
<br />
[[File:Oddworld_BarcodeCube.png|thumb|left|400px|The "data cube" from the second image, later determined to be two barcodes interlaced with one another, one running horizontally and the other vertically]]<br />
<br />
=== Directional Arrows Puzzle ===<br />
<br />
Using the [http://wiki.gamedetectives.net/index.php?title=Oddworld_Soulstorm#Directional_Arrows_Puzzle], these arrows decoded to:<br />
<br />
<pre><br />
7 14 9 8 20 25 18 5 22 5 5 4 15 3 5 4<br />
H O J I U Z S F W F F E P D F E<br />
</pre><br />
<br />
Players found the above ciphertext to be encrypted with a Caesar cipher set to a shift of 25, and revealed the message: <code>GNIHTYREVEEDOCED</code>, which is <code>DECODE EVERYTHING</code> backwards.<br />
<br />
=== Interlaced Barcodes & Second Hidden URL ===<br />
<br />
[[File:Oddworld_Grid.jpg|thumb|right|250x250px|The image found on the second hidden URL discovered by the community, which depicts the Spirit of 1029's logo chopped up and re-arranged on a 7x7 grid]]<br />
<br />
The community speculated that the [http://wiki.gamedetectives.net/images/3/30/Oddworld_BarcodeCube.png strange box in the bottom-right of the image] sent by the Spirit of 1029, pictured left, was a fragmented barcode. After a massive amount of tinkering, the two barcodes were [http://imgur.com/a/YmAH2 correctly assembled] and, when scanned, led to the discovery of two messages:<br />
<br />
<code><br />
http://www.1029.io/repository/asset98/<br />
</code><br />
<br />
and<br />
<br />
<code><br />
findawayshowthetruth<br />
</code><br />
<br />
Combining these messages into a single URL led players to another hidden [http://www.1029.io/repository/asset98/findawayshowthetruth/ page] on the 1029 website, which displayed a [http://www.1029.io/repository/asset98/findawayshowthetruth/grid.jpg distorted version] of the Spirit of 1029 logo, pictured right.<br />
<br />
=== Source Code Mysteries ===<br />
<br />
Players discovered an extensive message containing several presently-unsolved puzzles is written hidden in the source code of the second hidden page. It read:<br />
<br />
<pre><br />
!-- <br />
<br />
Can’t reach any..<br />
<br />
<br />
Listening anyon… there?<br />
<br />
<br />
Can hear us anymore- need to… can’t fnd <br />
<br />
<br />
We will never give… what they… from us<br />
<br />
A9539 \\<br />
<br />
B2919 /\\<br />
<br />
C4882 /\<br />
<br />
D4627 \<br />
<br />
E6758 \<br />
<br />
F???? ////<br />
<br />
<br />
/\//\\//5,1:4.1,2:8.1,3:2.3,3:2.4,3:3.7,3:3.1,5:3.4,5:9.5,5:2.7,5:4.7,6:6.3,7:3.<br />
<br />
<br />
<br />
<br />
Does… care? Freedom isn’t gi… will take…<br />
<br />
We have never…. Given… deserve. We… take… our righ…<br />
<br />
\\//\/KDIUTHANPUYHHDQOEPLNDOALJGUDITHBBDOZLGFERKJGLSAOE<br />
<br />
Stand up and fi…<br />
<br />
<br />
Don’t be afr….<br />
<br />
<br />
<br />
\////JUTYROSLNGNALEHGNWOTIQPOKSDNTPNOJAWEOBNGLAWKJNWNR <br />
<br />
E=5OUEHRA? <br />
<br />
<br />
<br />
\\\\/\2,1:2.3,1:2.6,1:4.1,2:4.3,2:2.3,4:4.5,5:2.6,5:3.7,5:3.4,7:8.5,7:3.7,6:4. <br />
<br />
7777338883366899984477733 33 <br />
<br />
<br />
<br />
<br />
They want to… kill- don’t-<br />
<br />
<br />
Stop them from…. Hurting- they… think<br />
<br />
We are no less- they think… aside<br />
<br />
<br />
Don’t believe what… told- liars…<br />
<br />
A5989 \\<br />
<br />
B5176 \<br />
<br />
C2863 \<br />
<br />
D2558 //\<br />
<br />
E3413 \<br />
<br />
<br />
F???? ////<br />
<br />
<br />
<br />
Can’ fnd anymo-<br />
<br />
<br />
We wil silnced<br />
<br />
<br />
<br />
<br />
<br />
<br />
Killin- they are dy..<br />
<br />
\\\/\\JHWUITUHABSJGNEWKLALNVGJKWELKJLWQQPRUTJHJJSBFMMH <br />
<br />
Hurting the..<br />
<br />
Back down unt… resist.<br />
<br />
<br />
Intercep… our messa… we will fight<br />
<br />
///\\/JQEABTVKNUCSEYCMBILDKOSCYSITECPAGFAXHKETJNZURWCIE <br />
<br />
We will ri…<br />
<br />
Cannot… silenced when ther… who need… now<br />
<br />
<br />
We won’t ba… we have beat…. Before… Must not-<br />
<br />
<br />
<br />
<br />
\///\//\1,1:3.4,1:2.6,1:9.2,2:2.6,2:2.2,4:4.3,5:2.5,5:2.7,5:3.4,7:3.6,7:2.7,7:2. <br />
<br />
<br />
<br />
Spent so long…. Afraid… never let- again<br />
<br />
<br />
...Storm… find it’s way- end<br />
<br />
<br />
Why are … here?<br />
<br />
<br />
<br />
<br />
Only...profit- nothing more… importnt as- <br />
<br />
- lies they… will tel-<br />
<br />
Believe- nothing… terribl- things… <br />
<br />
\\//\\\/4,2:6.6,2:4.7,3:3.2,4:8.3,4:2.4,4:2.7,4:3.2,6:2.4,6:3.6,6:2.1,7:4.3,7:2.<br />
<br />
--><br />
</pre><br />
<br />
At the time, only a few portions of this message have been successfully solved. <br />
<br />
The ABCDEF puzzles was solved using the rules of [https://en.wikipedia.org/wiki/Mastermind_(board_game) Mastermind], a popular board game. Players assumed that a backslash ( \ ) indicated a partial match and a forward slash ( / ) indicated a full match, as shown below:<br />
<br />
<pre><br />
A9539 \\<br />
<br />
B2919 /\\<br />
<br />
C4882 /\<br />
<br />
D4627 \<br />
<br />
E6758 \<br />
<br />
F???? ////<br />
</pre><br />
<br />
Had a solution of <code>F8992</code>, and:<br />
<br />
<pre><br />
A5989 \\<br />
<br />
B5176 \<br />
<br />
C2863 \<br />
<br />
D2558 //\<br />
<br />
E3413 \<br />
<br />
F???? ////<br />
</pre><br />
<br />
Had a solution of <code>F8554</code>. The purpose of these solutions was unknown.<br />
<br />
Players found the numbers <code>7777338883366899984477733 33</code> to be encoded with a [http://www.dcode.fr/multitap-abc-cipher multi-tap cipher] (cellphone numberpad), and can be decoded to <code>SEVENTYTHREE</code>. the purpose of this solution was also unknown.<br />
<br />
The <code>E=5OUEHRA?</code> portion was partially solved. Players found that the letters <code>O U E H R A</code> were all the second letters from each day of the week, I.E. M'''o'''nday, T'''u'''esday, W'''e'''dnesday, etc. This indicated a solution of <code>U</code> for the question mark, as in S'''u'''nday, making the full string <code>E=5OUEHRAU</code>. The <code>E=5</code> portion of the text remains unsolved.<br />
<br />
Also remaining unsolved are the coordinates found in the code, as well as the letter strings:<br />
<br />
[[File:Oddworld_Grid.jpg|thumb|right|250x250px|The 7x7 grid found on the second hidden URL, likely to be used with the coordinates & letter strings in some way]]<br />
<br />
<pre><br />
Coordinates<br />
<br />
/\//\\//5,1:4.1,2:8.1,3:2.3,3:2.4,3:3.7,3:3.1,5:3.4,5:9.5,5:2.7,5:4.7,6:6.3,7:3.<br />
<br />
\\\\/\2,1:2.3,1:2.6,1:4.1,2:4.3,2:2.3,4:4.5,5:2.6,5:3.7,5:3.4,7:8.5,7:3.7,6:4.<br />
<br />
\///\//\1,1:3.4,1:2.6,1:9.2,2:2.6,2:2.2,4:4.3,5:2.5,5:2.7,5:3.4,7:3.6,7:2.7,7:2. <br />
<br />
\\//\\\/4,2:6.6,2:4.7,3:3.2,4:8.3,4:2.4,4:2.7,4:3.2,6:2.4,6:3.6,6:2.1,7:4.3,7:2.<br />
</pre><br />
<pre><br />
Letter Strings<br />
<br />
\\//\/KDIUTHANPUYHHDQOEPLNDOALJGUDITHBBDOZLGFERKJGLSAOE<br />
<br />
\////JUTYROSLNGNALEHGNWOTIQPOKSDNTPNOJAWEOBNGLAWKJNWNR <br />
<br />
\\\/\\JHWUITUHABSJGNEWKLALNVGJKWELKJLWQQPRUTJHJJSBFMMH<br />
<br />
///\\/JQEABTVKNUCSEYCMBILDKOSCYSITECPAGFAXHKETJNZURWCIE<br />
</pre><br />
<br />
=== Stuck In The Mud & Third Hidden URL ===<br />
<br />
After many failed attempts by players to decode the contents of the message using the hints of Spirit of 1029, a player found something unusual about one of the account's most recent tweets, which said:<br />
<br />
<pre><br />
When you have the key, you need the correct lock. hgehgeoeregpineechqnhgeevtipcvreovxgvge<br />
Shake loose the bonds that hold you. #wewillrise<br />
</pre><br />
<br />
Players noted that the text <code>hgehgeoeregpineechqnhgeevtipcvreovxgvge</code> could be decoded via a [http://www.braingle.com/brainteasers/codes/keyword.phpsubstitution keyword cipher] with the key <code>subjectivism</code>, and reveals the message:<br />
<br />
<pre><br />
oneoneseventhreefouroneeightfivesixnine<br />
</pre><br />
<br />
Using this solution, players quickly found another secret [http://www.1029.io/repository/asset98/1173418569/ page] on the 1029 hub.<br />
<br />
=== Creepy Scenes From Within ===<br />
<br />
Much like the first hidden page, this hidden page displayed a different image each time the page is reloaded. In total, 13 scrambled images appear frequently (file prefix WB) and up to 13 CLEAR immages appear only very rarely (file prefix CWB). All the files are below, with their respective names:<br />
<br />
<gallery mode="packed"><br />
File:Oddworld_WB1_HEND8243.jpg | WB1_HEND8243<br />
File:Oddworld_WB2_BSJG2456.jpg | WB2_BSJG2456<br />
File:Oddworld_WB3_INFG2861.jpg | WB3_INFG2861<br />
File:Oddworld_WB4_HBQD2962.jpg | WB4_HBQD2962<br />
File:Oddworld_WB5_SJKW4167.jpg | WB5_SJKW4167<br />
File:Oddworld_WB6_OWUI2056.jpg | WB6_OWUI2056<br />
File:Oddworld_WB7_MNCH1101.jpg | WB7_MNCH1101<br />
File:Oddworld_WB8_RDHRHAHA.jpg | WB8_RDHRHAHA<br />
File:Oddworld_WB9_D34DM337.jpg | WB9_D34DM337<br />
File:Oddworld_WB10_BDJW8411.jpg | WB10_BDJW8411<br />
File:Oddworld_WB11_WHAT8291.jpg | WB11_WHAT8291<br />
File:Oddworld_WB12_PADAPADA.jpg | WB12_PADAPADA<br />
File:Oddworld_WB13_VLAP3662.jpg | WB13_VLAP3662<br />
</gallery><br />
<gallery mode="packed"><br />
File:Oddworld_CWB1_0BE01647.JPG | CWB1_0BE01647<br />
File:Oddworld_CWB2_0DG02966.JPG | CWB2_0DG02966<br />
FILE:Oddworld_CWB4_WHATISTHIS.JPG | CWB4_WHATISTHIS<br />
File:Oddworld_CWB5_NEEDLEINAHAYSTACK.JPG | CWB5_NEEDLEINAHAYSTACK<br />
File:Oddworld_CWB6_ARG-H.JPG | CWB6_ARG-H<br />
File:Oddworld_CWB7_82918291829182918291.JPG | CWB7_82918291829182918291<br />
File:Oddworld_CWB8_0GE03866.JPG | CWB8_0GE03866<br />
File:Oddworld_CWB9_0IE02565.JPG | CWB9_0IE02565<br />
File:Oddworld_CWB10_AbeAndNEEDLESFunAdventures.JPG | CWB10_AbeAndNEEDLESFunAdventures<br />
File:Oddworld_CWB11_02500356.JPG | CWB11_02500356<br />
File:Oddworld_CWB12_02323hjfhfhfhfhASDF.JPG | CWB12_02323hjfhfhfhfhASDF<br />
File:Oddworld_CWB13_insertcodehere.JPG | CWB13_insertcodehere<br />
</gallery><br />
<br />
While it wasn't entirely clear, players believed that this was yet again another form of a jigsaw puzzle.<br />
<br />
After a [http://wiki.gamedetectives.net/images/0/09/Oddworld_Phase_One.png series] of interesting [http://wiki.gamedetectives.net/images/e/e0/Oddworld_Phase_Two.png updates], the new hidden [http://www.1029.io/repository/asset98/1173418569/ page] went dark, with the header reading <code>ASSET98: TERMINATED.</code> and a new comment in the source code which read: <code>!-- see ya around, 1029... --></code>. The [https://twitter.com/edmudokon @Edmudokon] Twitter account, after a long period of silence, also tweeted out a [https://twitter.com/edmudokon/status/829079318290694144 new message]:<br />
<br />
<pre><br />
what happened? what did you do? who? No! no... aaaaaAaaaaarrrRrrrgggggGgghhh!<br />
</pre><br />
<br />
And with this message, Ed appears to have passed away. At that point, it was not clear if it was due to bruteforcing attempts by players or whether his death was intended all along.<br />
<br />
=== From The Ashes, Asset 99 (Hidden URL 3.5) ===<br />
<br />
[[File:Oddworld_OrangeLightning_V2.jpg|thumb|right|A very convincing collage of the images seen pictured on the now-dark Asset 98 URL; what is going on in the image remains unknown]]<br />
<br />
After the Asset98 page was "destroyed," a [http://www.1029.io/repository/asset99 new page], called "Asset99," was revealed, and appeared to be a clone of the Asset98 page. However, when refreshed, the page failed to reveal some of the "rarer" fragments from the Asset98 page. This page also came with an intimidating message: "We will not be stopped. We may have lost Asset 98, but we will continue strong. Together. Against the machines. Help us to expose this latest crime against Mudokonkind." The [http://www.oddworld.com/soulstorm/#navfirstcontact Official Oddworld Webpage] also updated at this time, and requested help putting the pieces together.<br />
<br />
However, in the midst of the image-related updates, the @Spiritof1029 Twitter account posted:<br />
<br />
<pre><br />
We can't reach Asset 98 but we do still have his clear transmissions. Prove you're worthy. Show us that you're able. Send us the grid. You found the grid, the letters and the numbers. Tell us how they fit together. Prove you're no longer slaves to the machines.<br />
</pre><br />
<br />
Players found that this tweet referred back to the [http://wiki.gamedetectives.net/index.php?title=Oddworld_Soulstorm#Source_Code_Mysteries source code grid challenge].<br />
<br />
The assembled image was then [https://twitter.com/OddworldInc/status/829336580347326465 tweeted at OWI] and they replied, stating "You've given us enough for us to get to work cleaning up the image, we'll have something by tomorrow. Don't stop looking for the truth!" So, players waited patiently for the unscrambled image whilst solving the grid.<br />
<br />
=== Second Unlocked Image & Grid Solution ===<br />
<br />
[[File:Oddworld_RandomiserDizma.jpg|thumb|right|The solved grid, which reveals the word "subjectivism" (first letter of each section connected in the correct order), the key used to decode the string which led to the discovery of the third hidden Asset98 URL]]<br />
<br />
[[File:Oddworld_Second_Final.jpg|thumb|left|400px|The final image cleaned up & released by OWI a day after the collage was submitted]]<br />
<br />
The next day, OWI tweeted out a [https://twitter.com/OddworldInc/status/829715069235781632 cleaned-up image], pictured on the left, which seemed to depict quite a gruesome scene, featuring a wide-eyed Mudkon strapped to an operating table facing an onslaught of needles and next to a vat which read "SS Brew". Players also learned via [https://twitter.com/edmudokon @Edmudokon on Twitter] that Ed made it out alive, but his friend: "...never came back. I could hear him screaming all night... helpless. they took him... he was my friend. how did they know?"<br />
<br />
Shortly after players received the cleaned-up image, [https://twitter.com/SPIRITOF1029/status/830004742713638912 partial progress] was finally made on [http://wiki.gamedetectives.net/index.php?title=Oddworld_Soulstorm#Hidden_Barcodes_.26_Second_Hidden_URL the grid], which up until then remained unsolved. One player discovered that the coordinates could be applied to the grid using the rules of the Japanese puzzle game [https://en.wikipedia.org/wiki/Shikaku Shikaku] (#'s after the colons in the coordinates represent box sizes, which are the lines drawn in red). Another player was then able to successfully apply a letter string to the sliced-up cube, pictured right, from which the word <code>subjectivism</code> can be derived. The only strings that were used to find the solutions were ones that had a forward slash. This word was the [http://wiki.gamedetectives.net/index.php?title=Oddworld_Soulstorm#Stuck_In_The_Mud_.26_Third_Hidden_URL key previously used] to decode the third hidden Asset98 page. However, whether the key was intended to remain hidden until the grid was solved or intentionally encoded in such a way as to allow for bruteforcing is unknown.<br />
<br />
== The Third Transmission ==<br />
<br />
After some waiting, on Feburary 23rd, 2017, OWI [https://twitter.com/OddworldInc/status/834856085949394944 sent out a tweet] indicting they had again been contacted by the Spirit of 1029. A new, password-protected zip file named <code>89928554_Eequals5.zip</code> was found on the main Oddworld [http://www.oddworld.com/soulstorm/ website]. Players then realized that the name of the ZIP contained one of the solutions of the puzzles in the source code of the first hidden page. Within the .ZIP file were six files, four of which were .JPGs, one of which was a .PNG, and the last of which is a .TXT. Their filenames were:<br />
<br />
<code><br />
flyer1.jpg, flyer2.jpg, flyer3.jpg, Oddworld_Soulstorm_002_HD.jpg, toollist.txt, & vital.png<br />
</code><br />
<br />
The name of the zip suggested that players should use letter equivalencies to their alphabetic indexes as the password. This gave players the password <code>HIIBHEED</code> but in fact, the password was actually <code>HIIDHEED</code> for unknown reasons.<br />
<br />
=== Steganograpy Blitz & toollist.txt ===<br />
<br />
The file [http://pastebin.com/feuVh6wr toollist.txt] contained a repeating string consisting of names of moons in Earth's solar system, and are occasionally interrupted by forward slashes. Players found that the letters after each slash formed the string: <code>useSsuitePicselSecuritySaveus</code>. Players found this to refer to [http://www.ssuitesoft.com/ssuitepicselsecurity.htm Ssuite Picsel Security], which is a specific steganography program.<br />
<br />
When the file <code>Oddworld_Soulstorm_002_HD.jpg</code> was set as the original and <code>vital.png</code> was set as the target using Ssuite Picsel Security, the output was:<br />
<pre style="word-break:break-all;word-wrap: break-word;">BmzPmbtzueMfxmeBdayqftqgeBmzpadmQbuyqftqgeVmzgeMqsmqazYuymeYqftazqMzftqBmxxqzqQzoqxmpgeFqftkeFqxqefaOmxkbeaPuazqTqxqzqBaxkpqgoqeDtqmFufmzTkbqduazUmbqfgeWuhugcUvudmcBtaqnqBmmxumcEwmftuMxnuadujNqntuazzQddumbaEwaxxEumdzmcFmdcqcSdqubTkddawwuzVmdzemjmFmdhaeYgzpuxrmduNqdsqxyudZmdhuEgffgzsdTmfuRmdnmgfuFtdkydMqsudNqefxmEgdfgdWmduKyudXasqRadzvaf</pre><br />
<br />
When deciphered using a [http://rumkin.com/tools/cipher/caesar.php Caesar cipher] with N=14, the following cleartext can be obtained:<br />
<br />
<pre style="word-break:break-all;word-wrap: break-word;">PanDaphnisAtlasPrometheusPandoraEpimetheusJanusAegaeonMimasMethoneAnthePalleneEnceladusTethysTelestoCalypsoDioneHelenePolydeucesRheaTitanHyperionIapetusKiviuqIjiraqPhoebePaaliaqSkathiAlbiorixBebhionnErriapoSkollSiarnaqTarqeqGreipHyrrokkinJarnsaxaTarvosMundilfariBergelmirNarviSuttungrHatiFarbautiThrymrAegirBestlaSurturKariYmirLogeFornjot</pre><br />
<br />
All of the names above are the named moons of Saturn. However, <code>Erriapus</code> and <code>Fenrir</code> were missing. <code>Erriapus</code> was replaced by <code>Erriapo</code>, which was the original name of the moon.<br />
<br />
=== Cleaned-Up Flyers ===<br />
<br />
[[File:Oddworld_Malachim.gif|thumb|right|295x72px|The Malachim alphabet used in this puzzle.]]<br />
<br />
The images that players received of the Sligs' flyers were corrupted, and were quickly cleaned up by players.<br />
<gallery widths=180px><br />
File:Oddworld_flyer1_clean.jpg|A cleaned up version of flyer1.jpg<br />
File:Oddworld_flyer2_clean.jpg|A cleaned up version of flyer2.jpg<br />
File:Oddworld_flyer3_clean.jpg|A cleaned up version of flyer3.jpg<br />
</gallery><br />
One player found that the pigpen cipher on the left side of flyer1.jpg gave the string<code>AOCXY SIO</code>, which when shifted by 6 using a Caesar cipher yielded <code>GUIDE YOU</code>. <br />
<br />
The cipher on flyer2.jpg gave the string <code>FYNNBYNBCHANBUNM</code> which, when shifted in the same manner as before, yielded <code>LETTHETHINGTHATS</code>. <br />
<br />
The final one on flyer3.jpg gave the string <code>GCMMCHA</code> which was again shifted in the same manner as before to yield <code>MISSING</code>.<br />
<br />
All three of the pigpen strings can be combined to form a message: <code>LET THE THING THAT'S MISSING GUIDE YOU</code><br />
<br />
Additionally, sequences of <code>x</code> and <code>o</code> characters are seen. One player noticed that this could be interpreted as morse code in the following format (with x as dash, o as dot):<br />
<br />
<pre><br />
x oooo o xoxx ox oxo o oxx ox x xoxo oooo oo xo xxo<br />
xooo o x oooo o ooo x xxx oxo xx <br />
oxx o oxx oo oxoo oxoo oxo oo ooo o<br />
</pre><br />
<br />
became:<br />
<br />
<pre><br />
/- .... . -.--/.- .-. ./.-- .- - -.-. .... .. -. --./<br />
/-... ./- .... ./... - --- .-. --/<br />
/.-- ./.-- .. .-.. .-../.-. .. ... ./<br />
</pre><br />
<br />
which decoded to: <code>THEY ARE WATCHING BE THE STORM WE WILL RISE</code><br />
<br />
In addition, each of the flyers contained a set of strange symbols and numbers. The symbols were found to be the Malachim alphabet, as seen on the right.<br />
<br />
=== Fourth & Fifth Hidden URLs ===<br />
<br />
Using the hint to determine what was “missing,” players shifted their focus to the moon of <code>Erriapo</code>, as it was in the steganography text, but not in toollist.txt. Using the Malachim alphabet symbols and numbers, players translated <code>Erriapo</code> into <code>12 36 28 31 52 22 12</code>. The validity of this method was confirmed with a [https://twitter.com/SPIRITOF1029/status/835149069601419264 tweet] from Spirit of 1029, and the image in the tweet was decoded to contain <code>P=22</code>. This led players to the discovery of a new [http://www.1029.io/repository/asset99/12362831522212/ page] on the 1029 website. The header, <code>ASSET9X / [REDACTED] / 333333333333</code>, appeared to be a corrupted link to another page. In addition, the page yet again displayed a different image upon each refresh, all of which can be seen below.<br />
<br />
<gallery mode="packed"><br />
File:Oddworldd_YOU.jpg|YOU.jpg<br />
File:Oddworld_WHA.jpg|WHA.jpg<br />
File:Oddworld_WET.jpg|WET.jpg<br />
</gallery><br />
<br />
The page also contained a message:<br />
<br />
<pre><br />
We can't hold much longer.<br />
It's dark, and cold. So cold. They don't seem to [REDACTED]. They. Them. It's hard to know how we'll [REDACTED], but we'll try. This can't last forever. We won't last forever.<br />
Look what they're doing to us. Just look.<br />
There is spirit, but it's waining. We need you, [REDACTED]. Help us.<br />
</pre><br />
<br />
In addition, players also discovered another [http://www.1029.io/repository/asset99/71220283136/ page] on the 1029 site, using the same method as before but with the moon <code>Fenrir</code> instead. The page contained the same obscured header, and displayed one of three images upon each refresh, which can be seen below.<br />
<br />
<gallery mode="packed"><br />
File:Oddworld_OLD.jpg|OLD.jpg<br />
File:Oddworld_TIF.jpg|TIF.jpg<br />
File:Oddworld_TOO.jpg|TOO.jpg<br />
</gallery><br />
<br />
When the names of the files on both pages were put together, players found the string:<br />
<br />
<pre><br />
WHATIFWETOLDYOUTOO<br />
<br />
WHAT IF WE TOLD YOU TOO<br />
</pre><br />
<br />
== The Horror Is Shown In Full ==<br />
<br />
After a long period of tinkering, players found a [http://www.1029.io/whatifwetoldyoutoo/ new directory] on the 1029 site, called "whatifwetoldyoutoo."<br />
<br />
[[File:What_if_we_told_you_too_pre_edit.png|thumb|right|400x200px|The first page before it's eventual sharing.]]<br />
<br />
The source code of the page contained a few, interesting comments: <code>BDBDBDBDBDBDBDBBDBDBDBDBDBD</code>, <code>###BELIKEDET###</code> and <code>doYOUsee? think of a number, any number.</code><br />
<br />
Through unknown means, players then found the next [http://www.1029.io/whatifwetoldyoutoo/8291/ page]<br />
by adding 8291 to the end. This link leads to the [https://www.youtube.com/watch?v=2l4jZVTUoak/ 4 second video] of the previous photo, depicting the severe torture the mudokons had to endure.<br />
<br />
Three different codes pop up during the video, but these were found to have no relevance to the ARG.<br />
<br />
== The 4th Transmission ==<br />
<br />
After the horror of the 3rd transmission, [http://www.oddworld.com/soulstorm/findit.jpg the next image would be released not shortly after], depicting a montage of the past three transmissions. In it, there are 2 separate codes:<br />
<br />
The Morse code, which decodes as <code> USE A DIFFERENT CODE. THIS IS NOT RELEVANT DATA. DO NOT COMPLY. DO NOT OBEY. THEY LIE. </code><br />
The Runes on the left hand side and the ones partially cut off at the top and bottom(as previously seen in the video) were decoded by using file data in a hex editor, which would say:<br />
<br />
<br><br />
<br />
<tt><br />
<code><rdf:li photoshop:LayerText="WE WERE TAUGHT THAT THIS IS ALL THERE WAS: WORK, OBEY, COMPLY. THE TRUTH WAS HIDDEN FROM US. OUR HISTORY WAS HIDDEN FROM US. WE WERE BRED TO WORK, RAISED TO OBEY AND FORCED TO COMPLY. OUR NATURAL CONNECTION TO MOTHER PLANET WAS ERASED FROM THE CONSCIOUSNESS OF OUR PEOPLE. LOST WAS OUR KNOWING. LOST WAS OUR UNITY, OUR CONNECTION, OUR POWER AND OUR PURPOSE. ALL THAT WE WERE WAS A COMMODITY TO BE TRADED AND EXPLOITED IN THE ONGOING RACE FOR MORE WEALTH. WHAT WE SHOULD HAVE PROTECTED, WE WERE TRICKED INTO KILLING. WHAT WAS WORST FOR US, WE WERE TOLD WAS BEST. WE WERE TAUGHT TO TRUST THOSE WHO WOULD DECEIVE US THE MOST. THAT HAS ALL CHANGED. THE HERO HAS SHOWN ALL OF US THAT OUR OPPRESSORS CAN BE TOPPLED. HE HAS FOUND OUR WILD AND KNOWING BROTHERS. HE HAS RECONNECTED THE FACTORY-BORN TO OUR NATURAL WORLD AND ANCIENT WAYS. HE HAS LIT A FIRE IN OUR HEARTS THAT CANNOT BE EXTINGUISHED. WE WILL GIVE HELP TO THOSE WHO ARE HELPLESS. WE WILL LEND STRENGTH TO THOSE WHO ARE WEAK. WE WILL FIGHT FOR THOSE WHO ARE DEFEATED. OUR MOVEMENT WILL SPREAD LIKE A RAGING INFERNO AND WE WILL TAKE BACK THE POWER FROM THOSE WHO HAVE ABUSED IT. WE WILL NOT BE SILENCED BY THE MEDIA CIRCUS. WE WILL NOT BE IGNORED. WE WILL NOT STOP. WE WILL NOT OBEY. WE WILL RISE AND WE WILL RISE AGAIN, UNTIL WE HAVE BURNED THROUGH OUR TATTERED BONDS AND RAZED THE MACHINE TO THE GROUND. WE WILL RISE. JOIN US. THERE'S A STORM COMING."/><br />
<br />
<rdf:li photoshop:LayerName="gas liquid solid" photoshop:LayerText="gas liquid solid"/><br />
<br />
<rdf:li photoshop:LayerName="fire air water earth" photoshop:LayerText="fire air water earth"/></code><br />
</tt><br />
<br />
<br><br />
<br />
This gave us an exact copy of the speech given on 1029.io, and the states of matter + the classical elements.<br />
OWI would also be teasing at us with the plain clue on the image "Use what you can't see"<br />
<br />
Therefore, people started concluding that not all states of matter/classical elements were shown, as there exists a state of matter after a gas called "plasma", and there exists a 5th classical element called "void" or "aether". <br />
This would all be hinting at the next url, http://www.1029.io/electricity.<br />
<br />
=== Take a deep breath... ===<br />
In this page is a simple "HELP" which, when clicked on, [http://www.1029.io/electricity/help.zip downloads a zip]. This zip contains 2 things.<br />
[[File:SaveUs.jpg|thumb|right|The image in the zip]]<br />
<br />
Firstly, it contains an image with binary that decodes to <code> BREATH </code><br />
<br />
Secondly, it contains another horrifying message encrypted in binary, which reads:<br />
<br><br />
<br />
<tt><br />
<code>why do you just watch can you not see us can you not hear the utighdbfn why is this happening wny its too cold to th can you hear us is there anybody there will you help us or rihjsudhgheusodj never are go find pn lose into ital chem we are cold we are lost we are forgotten and its e cant gmds pneuma tigd why are they taking cant stop cold so cold so cold we will rise we will not obey we will not comply j end n we will rise we will rise we will rise we will not die is abe dead here we will not die here we will not die here we cannot die here we cannot die here we cannot die here we cannot survive gheufh help this is not what we wanted we cannot dont cant see speak stop we need to save someone save us pneuma we need to be stop ightne vital energy source of this stop to think breath breathe cant breathe cant always watching we can never eyes stop find rest go now share loose top find think or too last day light never why to away stp give this is ever not no find things first or the ghtuenthdaytjgitlet last now or out get in or art test never stop we will find a way to gain our freedom e why it lost gone now stop taken from us and from there st we cant stop too much now too pain pain pain pain pain pain pain pain pain pain pain dont believe the things they tell you they lie they know no truth its lost long lost now ghwkfnhjsk what happened to them they are lost ghwufnfasjntiwpldfmwbwietpr stop it greed greed greed greed greed greed greed the expense is us we are tired our spark is fading do not let them extinguish all that we are we cannot snwownfnf see the end save us save us save us we cannot fight help us why is this happening for their proghe jwnfiw this nf we why forget us let us go we dont deserve no one deserves its not dont believe dont believe they will lie they lie they lie heugnpngjifsk lies lies lies lies lies lies lies lies eieslseiselslsl is abe dead we dont want to die</code><br />
<br />
</tt><br />
<br />
<br><br />
<br />
Both these clues were pointing to the greek word for breath, pneuma, making http://www.1029.io/pneuma.<br />
<br />
=== Not another one! ===<br />
<br />
On this page was the symbol for the Spiritof1029, however, as time went on, the title of the page began changing, and so did certain letters in the symbol to make cries for help. The titles varied across these:<br />
<br />
?<br />
<br />
/\--/\--/\--/\<br />
<br />
it's so hard to breathe<br />
<br />
please make it stop<br />
<br />
around how many times<br />
<br />
we will all die<br />
<br />
b.r.e.a.t.h.e<br />
<br />
b..r..e..a..t..h..e<br />
<br />
b r e a t h e (page title was only a single letter)<br />
<br />
..........<br />
<br />
And the letters spelt to make words like HELP, STOP and mask.<br />
<br />
After the supposed death of ANOTHER mudokon, [http://www.1029.io/pneuma/helpus.jpg another image would be shown.]<br />
<br />
The community rushed to try and clean this image, producing a [http://www.oddworld.com/soulstorm/images/ARG_Image_04_4K.jpg terrifying image of a mudokon wearing a gas mask!] OWI quickly got the full image uploaded, updated their website accordingly and part 4 of 5 would be completed, and in record time too!<br />
<br />
== The Fifth Transmission ==<br />
<br />
Before the next transmission was made, subtle little changes were made to the 1029.io website. This included:<br />
<br />
1. A new HTML comment in the source code, reading: <pre><!-- heh, that was easy. let's see... --></pre><br />
<br />
2. The colour used for the highlights on the logo changed from red to green.<br />
<br />
3. Symbols in the logo would change to spell out the word "Magog".<br />
<br />
This would hint at The Magog Cartel, the main antagonistic company in the Oddworld Universe that is known for poor working conditions and treatment of the Mudokons.<br />
<br />
=== The Magog Cartel===<br />
<br />
Shortly after these discoveries, strange occurrences happened on the newly created Official Oddworld Discord server.<br />
<br />
1. A new emote with the Magog Cartel logo was added with the name :staywealthy:<br />
<br />
2. For a while all messages containing the :staywealthy: emote or the 8291 code (:_e_: :_t_: :_n_: :_o_:) got removed.<br />
<br />
3. The Oddworld Inhabitants employees (OWI_Alex, OWI_Pete & OWI_Bernice) stated posting gibberish and messages coming from an other entity. <br />
<br />
Some of the gibberish included:<br />
<br />
Òǚř ʂе¢цгіẗу ẁᾅș πŏţ ḃӷӫǟċḥễđ Ọսȑ šѐсưȑіƫỵ ẅἂѕ ᾒṑե ƃŗӫᾶϲɦẻđ ⍬ṳř şĕсǜӷɩȶӱ ẁấṣ ʼnόՒ þȑѐẩƈȟεժ Ỡùȓ șєϛụґɪŧӱ ẅᾲş բóȶ ḃŗḛąḉℏӫď Ơǔѓ ṡễćṻȓĩťÿ ẇẳŝ ἧὅṱ ḇґèḁčիề₫<br />
<br />
W& //€q117 PHø|? +/-/∂† +() }{∂|²|2€11.<br />
<br />
<br />
Ḿ̧̪̻̻͇̟̹̭̼͊̈́̍̎̿͐̎͝͞o̧̤̗̠͚̟͒̐͗͆͜͢͡͞C̠̯̳̙̠̳̹͒̽̇̈̽̚͜r̶͕̗̜̲͕̘̒͗̆̄̎̐̓t̛̛̯̠̼͎̭̻̯̜̿͂̑̃͌͂̔ļ̴͙̩̠̯̐̊̆̐̂̿c̢̳͎̱ ̺̮͎͖̟̐̓̐́͋͞ó̧̡̻͙̳͇̼̯̹̄͒̐͗ <br />
<br />
<br />
These all lead to [http://magogcartel.com/ magogcartel.com] and [https://twitter.com/magogcartel/ twitter.com/magogcartel]<br />
<br />
On The Magog Cartel's website, there are some interesting codes in the source code:<br />
<br />
1.<br />
<br />
DB_PP_PRODUCTTEXT: We’re sourciest, juiciest Parami__from closer to their nests, for our bes___________________________________________________________aramite Pies ever! Made with all natural ingredients[1] and baked in our traditional ovens to a recipe that’s be............ aster bakers, our pXXXes are packed with Para-meat[2] oooooooooooo00OOoozing [1] at least one natural ingredient in every 12-pack of pie_________8** [2] not necessarily made with Paramites.<br />
<br />
PLEASE REVIEW AS APPROPRIATE<br />
<br />
2.<br />
<br />
APPROV__tch this space for more information about our exciti________________ everage that’s so delicious, you’ll be craving another on33__________--333333333333 before you even finish it!!!_____________________________________________!!!:D:D:D<br />
<br />
3.<br />
<pre><br />
lfn0OE602+HKBKTMVawALWERLS6pu8P8NcEQyKfnKcQ5zy/H5ny4CU60hkmMHzqlNg+q2oVaSHjSzjPGo1vQzQsJCbHTNAXDCFgTIJznL/1ZkZT89VOuv4koDHZJs4YcWbOLbO1cvV87UMcdWbuAraCeFRF8jy7F1/PufFPAyYRR9Jp4nB6uWpNZlY8rdYmEw7IYvtg4QlaBtX/iiyT1Es8MFA+wO4OkBFEGLHDENvu83kfaMnBxabDguhS/W0wWJjNijasG+5PeHeWqmQYDWsz9YrKgWiap0KCghpDfRuOgH37qNUAQnIf4/AeMF14IiEg9PFlutZWGyXhHem4PF2kxYGp075T+5N0n6nbJt+MMDAa4H3D06iuZa5bK18pLIUIzaFxLue5EJoEz4+JwCYarhZ7JMqbzrtnPv8oK/BbHgaig9MjKf8X7/cHDaXkVObkhW8jyVxxS6IfedZIRO/Phqorogx+DO6dgKWhqppoRNpMU2jawix9b/rf6ZgGRcpngW9pOCDwxCB0UptxmaNk+fnxQQU1Wo9J/isrrgTd/eDpdZgFyD8d8KhYN/Uf8A3MhWX33Xr8MhAPF+BtQUYFYIrvD32CTtDqtGXfL26fdhAVh8XMjTFwwWCB6DH6WwYCwJyLCVikMSXOLbPfzZKFfZIia9KQnM24dGUOvVMkfBdTqdCpiuwV4NkGKY2hw2jNhjibPLt/Rcpnsxj3B+2Axu6z5bMnzPLRZY00w6p8CJckqQqV9YXdReb34dOLC/6Zb2VWbx1ARGNBwdN69lw==<br />
</pre><br />
<br />
INSERT ANECDOTE ABOUT THE ApMpApZING VIEW just left of here across Mudos AND who could possibly be the EMPLOYEE OF THE DAY AND THE NEW i mean, how hard can it be? every aspect of every aspect of every as-------------f every aspect of EVERY SIN--E ASPECT of every aspect of every asp--_--------------------ct of every aspect of every as_--ct of every aspect of FOLLOW ME follow US<br />
<br />
4.<br />
<pre><br />
01102911011101100101011102910111011102901001011011000110110001110011010291110100011011110102911100000111100101101111011101011029011110011029011011110111010101110111011010010291011011010290011011000110291001100110000101101100011029101100<br />
</pre><br />
<br />
This was decoded. When removing the occurences of "1029" you get:<br />
<br />
<pre><br />
0111011101100101011101110110100101101100011011000111001101110100011011110111000001111001011011110111 01010111100101101111011101010111011101101001011011000110110001100110011000010110110001101100<br />
</pre><br />
<br />
Decode binary to text and you get wewillstopyouyouwillfall<br />
<br />
<br />
5.<br />
<pre><br />
9JzrxKKv5z0829jLV8wF32KpA6I0nEQDqzmbpRYzUUE===<br />
</pre><br />
<br />
<br />
On the 11th of August the Magog Cartel sent a batch of tweets with some out of place uppercase letters spelling '''WE KNOW'''.<br />
<br />
<pre><br />
@spiritof1029 we see you. We can see what you are doing with your fake reports. you will not prospEr. <br />
</pre><br />
<pre><br />
we are proud of the strong linKs between each of our facilities. our operations are by far the most efficieNt on oddworld. <br />
</pre><br />
<pre><br />
we are aware of some terrible fake repOrts being leaked. please ignore them. our very successful Workers know the truth is very different.<br />
</pre><br />
<br />
On the 14th of August the Magog Cartel sent a batch of tweets all starting with '''We know'''. This lead us to believe the SPIRIT OF 1029 was interferring with those tweets and was trying to get a message accross. The message can be found in the very specific numbers mentionned in the first two tweets, 82 & 91, forming togeter '''8291'''.<br />
<br />
<pre><br />
We know every time an employee falls into a grinder it takes 82 minutes of Mudokon time to clean up. Be safe, for productivity’s sake!<br />
</pre><br />
<pre><br />
We know that an average of 91 eager new employees start their careers with us every day. Help them be the best workers they can be.<br />
</pre><br />
<pre><br />
We know that our facilities are a picture of perfect productivity. Your hard work helps us to show that picture to the world.<br />
</pre><br />
<pre><br />
We know what you’re looking for in a rewarding, productive career. Magog Cartel can help you find it. Discover your options with us today!<br />
</pre><br />
<br />
One hour later the SPIRIT OF 1029 sent a batch of tweets, one containing a cryptic code:<br />
<br />
<pre><br />
your help is invaluable to us, together we will blow this latest Magog scandal wide open. together #wewillrise<br />
</pre><br />
<pre><br />
the watchers can fish around the communication channels all they like, we will always be one step ahead of them.<br />
</pre><br />
<pre><br />
-1-4,-2-10<br />
</pre><br />
<pre><br />
the story of mudokonkind is about history. now they treat us just like numbers. they will not succeed.<br />
</pre><br />
<pre><br />
we have given you the tools you need. the ones we can trust will prove themselves capable. leaders will rise as the storm closes in.<br />
</pre><br />
<br />
The last tweet indicated that we had all we needed to continue our investigation and the one before that we shouldn't use the numbers in the codes as raw numbers but should link it to some kind of history. We needed to look into the Twitter history of the SPIRIT OF 1029 account.<br />
<br />
The '''-1-4,-2-10''' code actually tells us to take the 4th word from the previous tweet (-1) and take the 10th word of the tweet even before (-2):<br />
<br />
4th word of the previous tweet is '''fish''':<br />
<br />
<pre><br />
the watchers can 'fish' around the communication channels all they like, we will always be one step ahead of them.<br />
</pre><br />
<br />
10th word of the tweet before is '''blow''':<br />
<br />
<pre><br />
your help is invaluable to us, together we will 'blow' this latest Magog scandal wide open. together #wewillrise<br />
</pre><br />
<br />
Together those word form '''blowfish''' which is the [https://en.wikipedia.org/wiki/Blowfish_(cipher) cipher] we had to use to decrypt the base64 code in HTML comment 3.:<br />
<pre><br />
lfn0OE602+HKBKTMVawALWERLS6pu8P8NcEQyKfnKcQ5zy/H5ny4CU60hkmMHzqlNg+q2oVaSHjSzjPGo1vQzQsJCbHTNAXDCFgTIJznL/1ZkZT89VOuv4koDHZJs4YcWbOLbO1cvV87UMcdWbuAraCeFRF8jy7F1/PufFPAyYRR9Jp4nB6uWpNZlY8rdYmEw7IYvtg4QlaBtX/iiyT1Es8MFA+wO4OkBFEGLHDENvu83kfaMnBxabDguhS/W0wWJjNijasG+5PeHeWqmQYDWsz9YrKgWiap0KCghpDfRuOgH37qNUAQnIf4/AeMF14IiEg9PFlutZWGyXhHem4PF2kxYGp075T+5N0n6nbJt+MMDAa4H3D06iuZa5bK18pLIUIzaFxLue5EJoEz4+JwCYarhZ7JMqbzrtnPv8oK/BbHgaig9MjKf8X7/cHDaXkVObkhW8jyVxxS6IfedZIRO/Phqorogx+DO6dgKWhqppoRNpMU2jawix9b/rf6ZgGRcpngW9pOCDwxCB0UptxmaNk+fnxQQU1Wo9J/isrrgTd/eDpdZgFyD8d8KhYN/Uf8A3MhWX33Xr8MhAPF+BtQUYFYIrvD32CTtDqtGXfL26fdhAVh8XMjTFwwWCB6DH6WwYCwJyLCVikMSXOLbPfzZKFfZIia9KQnM24dGUOvVMkfBdTqdCpiuwV4NkGKY2hw2jNhjibPLt/Rcpnsxj3B+2Axu6z5bMnzPLRZY00w6p8CJckqQqV9YXdReb34dOLC/6Zb2VWbx1ARGNBwdN69lw==<br />
</pre><br />
<br />
Using a [https://gchq.github.io/CyberChef/#recipe=%5B%7B%22op%22%3A%22Blowfish%20Decrypt%22%2C%22args%22%3A%5B%7B%22option%22%3A%22UTF8%22%2C%22string%22%3A%22%22%7D%2C%22ECB%22%2C%22Hex%22%5D%7D%5D Blowfish Decryptor] (with CBC mode) and the code '''8291''' we got earlier via the interferences in the Magog Cartel tweets as a key we were able to recover the following text:<br />
<br />
<pre> ^_^U_VDXisistrueorfalseallforprofitinterestsindustrialagriculturalMudosprovidehighestpossiblereturninvestmentsoverheadsdreamslimitedpowergiganticbadgeleadersproductMeechMotorstravelexpertlytrainedSligSecurityForcessuccessfulundertakingemploymentvastsentientsecurespecialisthabitationzonesbenefitfactoriesfoundriesfarmlandsstabilitymillionsundertakingsCartelmanagementselflesslyrepresentativesresponsiblemunicipalvastidyllicsettlementsunderconstructionpleasesubscribeandlinkandfollowandlikeandbuyandbuyandbuyandbuyandbuyandbuyandbuyandbuyandbuyandbuyandbuyandbuyandbuyandbuyandbuyatmagogcartel<br />
</pre><br />
<br />
When adding spaces this reads:<br />
<br />
<pre><br />
^_^ U_V DX is is true or false all for profit interests industrial agricultural Mudos provide highest possible return investments overheads dreams limited power gigantic badge leaders product Meech Motors travel expertly trained Slig Security Forces successful undertaking employment vast sentient secure specialist habitation zones benefit factories foundries farmlands stability millions undertakings Cartel management selflessly representatives responsible municipal vast idyllic settlements under construction please subscribe and link and follow and like and buy and buy and buy and buy and buy and buy and buy and buy and buy and buy and buy and buy and buy and buy and buy at magog cartel<br />
</pre><br />
<br />
The part with "please subscribe" lead us to:<br />
<br />
* https://www.youtube.com/user/MagogCartel<br />
<br />
It is not sure at this point whether this is an official ARG account as the channel and profile are currently empty.<br />
<br />
<br />
The two last tweets of August 14th from the Magog Cartel were hinting at a '''picture''' on the MagogCartel.com website ('''Magog Cartel can help you find it'''):<br />
<br />
<pre><br />
We know that our facilities are a picture of perfect productivity. Your hard work helps us to show that picture to the world.<br />
</pre><br />
<pre><br />
We know what you’re looking for in a rewarding, productive career. Magog Cartel can help you find it. Discover your options with us today!<br />
</pre><br />
<br />
This led us to:<br />
<br />
* [http://magogcartel.com/weknow.jpg magogcartel.com/weknow.jpg]<br />
<br />
That picture contains quite a few codes:<br />
<br />
* The '''62466640222 2777833555''' sequence in the upper-left corner.<br />
<br />
Spells '''Magog Cartel''' when using a [https://www.mrwebmaster.it/img/guide/wp7/21-001.jpg phone keypad]<br />
<br />
* The mose code in the middle.<br />
<br />
<pre><br />
.-- . / -.- -. --- .-- / .... --- .-- / -.-- --- ..- / .-- --- .-. -.- / -. --- .-- .-.-.- / .-- . / -.- -. --- .-- / -.-- --- ..- .-. / -.-. --- -.. . ... .-.-.- / .-- . / .-- .. .-.. .-.. / ... - --- .--. / -.-- --- ..- .-.-.- / -.-- --- ..- / .-- .. .-.. .-.. / -. --- - / .. -. - .. -- .. -.. .- - . / ..- ... .-.-.- / --- ..- .-. / .-- .- -.-- / --- ..-. / .-.. .. ..-. . / -- ..- ... - / -... . / .--. .-. . ... . .-. ...- . -.. .-.-.-<br />
</pre><br />
<br />
<pre><br />
WE KNOW HOW YOU WORK NOW. WE KNOW YOUR CODES. WE WILL STOP YOU. YOU WILL NOT INTIMIDATE US. OUR WAY OF LIFE MUST BE PRESERVED.<br />
</pre><br />
<br />
* The '''e''' and '''d''' sequence in the upper-right corner.<br />
<br />
It's actually morse code too where '''e = .''', '''d = -''' & '''X = /'''.<br />
<br />
<pre><br />
.-.. --- --- -.- --..-- / .-- . / -.-. .- -. / -- .- -.- . / ... . -.-. .-. . - / -.-. --- -.. . ... / - --- --- .-.-.- / -.-- --- ..- / .- .-. . / -. --- - / .- ... / ... -- .- .-. - / .- ... / -.-- --- ..- / - .... .. -. -.- / -.-- --- ..- / .- .-. . .-.-.- / .-- . / .... .- ...- . / - .... . / .-. . ... --- ..- .-. -.-. . ... / .- -. -.. / - .... . / .--. . .-. ... --- -. -. . .-.. / - --- / ... .. -- .--. .-.. -.-- / ... .-- .- -- .--. / -.-- --- ..- / .-- .. - .... / .-- --- .-. -.- .-.-.- / .... --- .-- / -- ..- -.-. .... / - .. -- . / -.. .. -.. / -.-- --- ..- / .-- .- ... - . / - .-. -.-- .. -. --. / - --- / -.. . -.-. .. .--. .... . .-. / - .... .. ... / -.-. --- -.. . ..--.. / .- .-.. .-.. / - .... . / - .. -- . --..-- / .-- . / .-- . .-. . / --. . - - .. -. --. / -.-. .-.. --- ... . .-. / - --- / ..-. .. -. -.. .. -. --. / -.-- --- ..- .-.-.- / .-- . / .- .-. . / .- .-.. -- --- ... - / - .... . .-. . .-.-.- / -- .- -.-- -... . / .-- . / .- .-. . / --- ..- - ... .. -.. . / .-. .. --. .... - / -. --- .-- --..-- / .-- .- .. - .. -. --. .-.-.- / .-- .- - -.-. .... .. -. --. .-.-.- / -.-- --- ..- / -.-. .- -. -. --- - / .... .. -.. . / ..-. --- .-. . ...- . .-. --..-- / - . .-. .-. --- .-. .. ... - .-.-.- / .-- . / .-- .. .-.. .-.. / .. -. -.-. .. -. . .-. .- - . / -.-- --- ..- .-. / ... .. .-.. .-.. -.-- / .-.. .. - - .-.. . / --. .-. --- ..- .--. / .- -. -.. / ... -.-. .- - - . .-. / -.-- --- ..- .-. / .- ... .... . ... / - --- / . ...- . .-. -.-- / -.-. --- .-. -. . .-. / --- ..-. / --- ..- .-. / . -- .--. .. .-. . / ... --- / - .... .- - / -.-- --- ..- / .-- .. .-.. .-.. / . - . .-. -. .- .-.. .-.. -.-- / -... . .- .-. / .-- .. - -. . ... ... / - --- / --- ..- .-. / ... ..- -.-. -.-. . ... ... . ... --..-- / .- -. -.. / -.-- --- ..- .-. / -.- .. -. -.. ... / ..- -. . -. -.. .. -. --. / ... . .-. ...- .. - ..- -.. . .-.-.- / -.-- --- ..- / .... .- ...- . / .- .-.. .-. . .- -.. -.-- / .-.. --- ... - .-.-.-<br />
</pre><br />
<br />
<pre><br />
LOOK, WE CAN MAKE SECRET CODES TOO. YOU ARE NOT AS SMART AS YOU THINK YOU ARE. WE HAVE THE RESOURCES AND THE PERSONNEL TO SIMPLY SWAMP YOU WITH WORK. HOW MUCH TIME DID YOU WASTE TRYING TO DECIPHER THIS CODE? ALL THE TIME, WE WERE GETTING CLOSER TO FINDING YOU. WE ARE ALMOST THERE. MAYBE WE ARE OUTSIDE RIGHT NOW, WAITING. WATCHING. YOU CANNOT HIDE FOREVER, TERRORIST. WE WILL INCINERATE YOUR SILLY LITTLE GROUP AND SCATTER YOUR ASHES TO EVERY CORNER OF OUR EMPIRE SO THAT YOU WILL ETERNALLY BEAR WITNESS TO OUR SUCCESSES, AND YOUR KINDS UNENDING SERVITUDE. YOU HAVE ALREADY LOST.<br />
</pre><br />
<br />
* The [https://lobestir.files.wordpress.com/2014/05/cypher-pig-pen-lower.png Pigpen cipher] text in the lower-right corner.<br />
<br />
<pre><br />
WE WILL NEVER GIVE IN TO TERRORISTS. YOU WILL NEVER WIN. YOU WILL NOT DEFEAT OUR SPIRIT. WE WILL FIND YOU AND WE WILL WIPE YOU OUT. WE IGNITE THE FLAME THAT LIGHTS THE DARKNESS. THERE IS NOWHERE TO HIDE. YOU WILL NEVER KNOW SUCCESS<br />
</pre><br />
<br />
* The horizonally mirrored black text in the middle.<br />
<br />
<pre><br />
you are a resource. you are expendable. we will replace you when you fall. you will work. you will obey. you will comply. or you will perish. we have the prestige. we have the power. we will profit. always. always. always.<br />
</pre><br />
<br />
* The white text on the top.<br />
<br />
<pre><br />
Prestige. Power. Profits. Work. Obey. Comply. Prestige. Power. Profits. Work. Obey. Comply. Prestige. Power. Profits. Work. Obey. Comply. Prestige. Power. Profits. Work. Obey. Comply. <br />
</pre><br />
<br />
* The braille at the bottom.<br />
<br />
<pre><br />
RuptureFarms1029 will rise from the ashes. we will rebuild it bigger, better and more profitable than before. it will be the greatest, most efficient factory that Oddworld has ever seen. it will be a towering symbol of Glukkon strength that cannot be ignored. one terrorist will not deter us.<br />
</pre><br />
<br />
It has to be noted that those codes were left by the Magog Cartel as what appears to be a bait so that we would lose valuable time decoding them.<br />
<br />
It is unknown how to decode the '''9JzrxKKv5z0829jLV8wF32KpA6I0nEQDqzmbpRYzUUE===''' code.<br />
<br />
The page has changed since then, but the first (hacked) version of the MagogCartel.com site has been archived [http://oddworldlibrary.net/archives/web/MagogCartel.com/index_1/P.%20P.%20P.%20_____%201029%20_____.html here]<br />
<br />
On the 4th of September the MagogCartel.com got updated, simply displaying the following text:<br />
<br />
<blockquote><br />
*** UNDER CONSTRUKTION ***<br />
</blockquote><br />
<br />
The page has changed since then, but the second (under construktion) version of the MagogCartel.com site has been archived <br />
[http://oddworldlibrary.net/archives/web/MagogCartel.com/index_2/___%20UNDER%20CONSTRUKTION%20___.html here]<br />
<br />
On the 5th of September the Magog Cartel posted a video trough the OddworldInc account:<br />
<br />
<pre><br />
w̸̨̠͓͍̯̺͉͞e̯̝͖̫̺̯͉̻͘͡ ̗̭̕͢s̴̮̭̫̱ͅe̢̠̮̫̦̼̪̘͠ͅę̠̥̯͔̣̼̻̕ͅ ̻̘̼̣͓̩͚͘͢͠y̴̭̯̪̺͙͚͚̪͞o̬̞͜͢͝u̮̤͖̩̗̰ͅͅ.̴̲̣̪̮̼̱.̡̰̭̗͍̝͉̯͢.̡̡̼͇̙̜̮̦̪̞ͅ <br />
pic.twitter.com/UoQ3xRAhDU<br />
</pre><br />
<br />
<pre><br />
We continue to demonstrate our exceptional technological progress to an ever growing number of customers. Everyone loves Magog products!<br />
</pre><br />
<br />
When asked if they really just claimed the attack on the @OddworldInc account they replied:<br />
<br />
<pre><br />
Attack? We don’t need to attack, we’re already in a dominant position in every market we deem profitable. We just demonstrate our dominance.<br />
</pre><br />
<br />
There are multiple messages flashing in the video:<br />
<br />
<pre><br />
8<br />
?<br />
2<br />
2<br />
9<br />
1<br />
/<br />
8291<br />
829/<br />
229/<br />
22/9<br />
EVERYONE<br />
WANTS<br />
TO<br />
EAT<br />
YOU<br />
</pre><br />
<br />
Note that '''22/9''' is the date of the Oddworld presentation at the EGX:<br />
<br />
<pre><br />
We're going to be at EGX for an on-stage presentation on Friday 22nd Sept! Grab your tickets now! @EGX pic.twitter.com/rDQiDIApa9<br />
</pre><br />
<br />
<br />
On the 7th of September the MagogCartel.com got updated again, randomly displaying one of three photos of The Informant.<br />
<br />
At the same time the Magog Cartel sent a batch of tweets with containing other pictures of The Informant:<br />
<br />
<pre><br />
We stopped reading the Daily Deception’s fake reports. The latest issue of The Informant is a really great read, very honest. The greatest!<br />
</pre><br />
<br />
<pre><br />
It’s great to finally have an honest newspaper to read, and such good quality, too! <br />
pic.twitter.com/MHuC6jdtNC<br />
</pre><br />
<br />
<pre><br />
We’re always happy to see some balanced reporting on our business from The Informant. Refreshing, when there are so many fake reports! <br />
pic.twitter.com/DmkV4GbVYw<br />
</pre><br />
<br />
<pre><br />
We’ve just been told that The Informant is printed on machines made at a Magog facility! That explains the quality! <br />
pic.twitter.com/Bvz29ZrBvk<br />
</pre><br />
<br />
It has been noted that some letters were in bold but it's unclear how this should be used.<br />
<br />
Part of The Informant has be transcribed here:<br />
<br />
http://oddworldlibrary.net/oddenc/index.php?title=Soulstorm_ARG_-_The_Informant<br />
<br />
The MagogCartel.com page also contains the following HTML comment:<br />
<br />
<pre><br />
<nowiki><!--</nowiki> seriously, are you guys seeing this?! --><br />
</pre><br />
<br />
== The third phase ==<br />
<br />
=== The Origins diversion ===<br />
<br />
On the 15 of March 2018 the SPIRIT OF 1029 posted the following tweets:<br />
<br />
<pre><br />
Our future depends on us understanding our past. We must know where we come from.<br />
</pre><br />
<br />
<pre><br />
We know you can hear us. We know you are ready to help. We will show you more when the time is right. Keep watching.<br />
</pre><br />
<br />
Following this a couple of changes were found on the 1029.io page.<br />
<br />
# The logo has now even more letters appearing in it randomly: '''S, I, N, O, R'''. Adding to the previous letters that were spelling "MAGOG".<br />
# The page contains a new HTML comment:<br />
<nowiki><!--</nowiki> too obvious? i dunno. it's soon though. i can't wait. --><br />
<br />
Changes were also observed on the 404 page:<br />
<br />
# The logo on the 404 page now contains the following letters: '''N, I, G, I, O, R, S'''. Those letters can be used to spell the word "ORIGINS" <br />
# The page contains a new HTML comment:<br />
<nowiki><!--</nowiki> me neither. it's going to be great. --><br />
<br />
Shortly after a new channel called "origins" appeared on the official [https://discord.gg/bQKeAE6 Oddworld Discord] with a cryptic [https://cdn.discordapp.com/attachments/424167787897028609/424175888418996225/origins_1.mp4 video] as first message.<br />
<br />
It was revealed a few days later that this was a built up to announcement of the [https://www.kickstarter.com/projects/1869209521/oddworld-abes-origins-book-and-game-collection "Oddworld: Abe's Origins - Book & Game Collection" kickstarter campaign]. Note that the book & game collection is still available for preorder on [https://app.crowdox.com/projects/1869209521/oddworld-abes-origins-book-and-game-collection Crowdox].<br />
<br />
=== Intro ===<br />
<br />
Around the 12th of January 2018 [[Lorne Lanning]] changed his twitter header picture to the following one:<br />
* https://pbs.twimg.com/profile_banners/20823262/1515636880/1500x500<br />
<br />
While it was hinted repeatedly in the official [https://discord.gg/bQKeAE6 Oddworld Discord] that this image was hiding something, it wasn't until much later that it was found how to use it when @edmudokon tweeted the following message:<br />
<br />
<pre><br />
alive… <br />
pic.twitter.com/j0FE2Qgdu1<br />
</pre><br />
<br />
The embedded picture contains the number '''15156'''. This is a reference to a number in the URL of Lorne's header picture: '''1515636880'''.<br />
<br />
This number led us to a new page:<br />
<br />
* http://www.1029.io/1515636880/<br />
<br />
This page contains the following text in UTF-8<br />
<br />
<blockquote><br />
ɦểɫр. гẹẳčℏɪṅǧ óúƫ ῒԑ ģӫԷṱіᾗĝ ḥǡṛⅾềɽ. էիȅỷ ķῆοԝ. ẁẹ'ṝϵ ṙṵɴᾑıпʛ ộևȽ ờẛ ɩḋϵᾂš, ὅрՒῑổпş, ăұҿἧµϱṣ. ẅϵ ǹêȩḋ ỳờǚґ ḣҽľῥ. ẇể ῂёϱḋ ѕờṃēƅȯƌý ţó ṧṕȑểǻժ Ƚħẹ ẁổṝḓ. եḫϊṥ ƫɦ¡ƞɡ ῐʂ ḸỄƮḨǠĻ. Ƚḣěȳ ḓõᾔ'Ƚ ĉὰгє Ƚḣổṻɕḫ. ţհểӯ ɗṍἧ'ţ. ṣởṁḗɒὀժỵ ňěөƌş ṱὃ ȶěḻɫ իḭɱ. †ɛŀļ ẖĩ₥. ḃḕẛṍɼę îȽ'ṧ Էȭô ḷǎťϱ. ṯĥềŗȇ ḧąș Էố ƃϱ ᾅ ṣọṁȇþöḏỳ ẉíļłȋդǥ եό ȶαҝě ṯẖё јǒŭӷṋёỷ. şõ₥ęƀὁḓẏ ṅểềⅾԑ ƫծ ġềŧ ţհϵ ṃệṣśᾇǵε ộվե. ẁë'ṝе ìη ṭӷơữþŀɛ. аɬł ṑƒ սʂ. ẁё դȅễɖ ĥẹĺρ. թłȩᾂʂĕ ɦȇɫṕ կѕ.</<br />
</blockquote><br />
<br />
and the following HTML comments<br />
<br />
<nowiki><!--</nowiki> it's only going to get harder. we don't have the keys anymore to the usual channels. if you hear anything from them, it's THEM. --><br />
<br />
<nowiki><!--</nowiki> our options are limited. you can help though. you have to help. if we can be sure it's you, then maybe we can talk. prove it. --><br />
<br />
It's currently unknown what the next steps are<br />
<br />
== Loose Ends ==<br />
<br />
This section documents various puzzles throughout the ARG which have not yet been used or solved.<br />
<br />
=== Main Website Source Code Comment Numbers Puzzles ===<br />
<br />
These numerical puzzles were found in the source code for the [http://www.oddworld.com/soulstorm/ official Oddworld website] as early as the date of the Spirit of 1029's first transmission. Their solutions have been found, but the intended use of the solutions remains unknown.<br />
<br />
!--<br />
<br />
72 99<br />
\ /<br />
27 45<br />
\ /<br />
18 39<br />
\ /<br />
21 36<br />
\ /<br />
?? 28<br />
\ /<br />
13 21<br />
\ /<br />
7<br />
<br />
--><br />
<br />
SOLUTION: 12<br />
7+2+9+9 = 27, 2+7+4+5 = 18, thus 2+1+3+6 = 12<br />
<br />
&<br />
<br />
!-- <br />
<br />
16 _ 37 _ 58 _ 89 _ 145 _ 42 _ ?? _ 4<br />
|_________________<_________________| <br />
<br />
--><br />
<br />
SOLUTION: 20<br />
1^2 + 6^2 = 37, 3^2 + 7^2 = 58, thus 4^2 + 2^2 = 20<br />
<br />
==== Other Source Code Comments ====<br />
<br />
On http://1029.io, the following comments could or can be found in the page's source code:<br />
<br />
!-- we'll be here, waiting. --><br />
<br />
&<br />
<br />
!-- <br />
Well, I //--/ED Mudokon/. But who// _____ r///u/ //? <br />
<br />
=== Third Hidden Asset98 URL Source Code Solutions ===<br />
<br />
Certain code strings & puzzle solutions found within the [http://wiki.gamedetectives.net/index.php?title=Oddworld_Soulstorm#Source_Code_Mysteries source code] for the third hidden Asset98 URL were not ultimately used in the course of arriving at the image locked behind them. These strings & solutions in include:<br />
<br />
The solution for the numbers <code>7777338883366899984477733 33</code>, which decode to <code>SEVENTYTHREE</code> via [http://www.dcode.fr/multitap-abc-cipher multi-tap cipher], was never applied.<br />
<br />
The following letter strings were never applied:<br />
<br />
<pre><br />
\\//\/KDIUTHANPUYHHDQOEPLNDOALJGUDITHBBDOZLGFERKJGLSAOE<br />
<br />
\////JUTYROSLNGNALEHGNWOTIQPOKSDNTPNOJAWEOBNGLAWKJNWNR <br />
<br />
\\\/\\JHWUITUHABSJGNEWKLALNVGJKWELKJLWQQPRUTJHJJSBFMMH<br />
</pre><br />
<br />
The following coordinate strings were never applied:<br />
<br />
<pre><br />
\\\\/\2,1:2.3,1:2.6,1:4.1,2:4.3,2:2.3,4:4.5,5:2.6,5:3.7,5:3.4,7:8.5,7:3.7,6:4.<br />
<br />
\///\//\1,1:3.4,1:2.6,1:9.2,2:2.6,2:2.2,4:4.3,5:2.5,5:2.7,5:3.4,7:3.6,7:2.7,7:2. <br />
<br />
\\//\\\/4,2:6.6,2:4.7,3:3.2,4:8.3,4:2.4,4:2.7,4:3.2,6:2.4,6:3.6,6:2.1,7:4.3,7:2.<br />
</pre><br />
<br />
The community speculates that these strings were not intended to be used but rather existed as "red herrings" in order to stall attempts to solve the grid. The only strings which were used were the ones which began with a forward slash ( / )<br />
<br />
=== Written Text on "Puzzle Pieces" Image ===<br />
<br />
Writing which was noticed written over the image on the puzzle pieces, but which is absent from the final released image. The significance of the writing remains unknown.<br />
<br />
<gallery mode="packed" widths=200px heights=300px><br />
File:Oddworld_1029-LY_letters.jpg|1029-LY "WHERE"<br />
File:Oddworld_7393-AN_letters.jpg|7393-AN "SO TIRED"<br />
File:Oddworld3786-IC_letters.jpg|3786-IC "WHO?"<br />
File:Oddworld_8291_circled.png|Complete Image "8291"<br />
</gallery><br />
<br />
=== Anomalies In First Released Image ===<br />
<br />
Hidden against the background of the first released image are several text strings, pictured below. Their significance is unknown.<br />
<br />
[[File:Oddworld_Complete_1_Iso.jpg|frameless|810px]]<br />
<br />
1101110BC<br />
100000BD or 100000BC <br />
010100BD</div>Halke234https://wiki.gamedetectives.net/index.php?title=Arc_Symphony&diff=16743Arc Symphony2018-08-01T01:00:52Z<p>Halke234: /* Fansite */</p>
<hr />
<div>{{argbox<br />
| float = right<br />
| name = Arc Symphony<br />
| image = File:Arc Symphony cover.gif<br />
| description= Arc Symphony was a PS1 game by Aether Interactive that has suddenly popped up in 2017.<br />
| creator = [https://aetherinteractive.itch.io/ Aether Interactive]<br />
| type = Investigation<br />
| status = Discontinued<br />
| discovered = 2017-05-13<br />
}}<br />
<br />
[[Main Page]] > [[List of Investigations]] > '''Arc Symphony'''<br />
<br />
Since 2017-05-12, a large amount of indie developers began tweeting about "Arc Symphony", a PS1 game that never existed. Most of the developers were associated with the [http://www.torontocomics.com/ Toronto Comic Arts Festival].<br />
<br />
= Fansite =<br />
<br />
[https://arcsymphony.neocities.org An apparent fansite] for the game was discovered and contains information about it.<br />
<br />
The [https://arcsymphony.neocities.org/contact.html contact page] contained links with ways to contact [https://twitter.com/sophiapark_ Sophia Park] and [http://twitter.com/olbeyblade_jpeg Penelope Evans], both of whom also had games linked in the site's sidebar labelled as affiliate sites. Sophia Park was believed to be behind the ARG, as she hah retweeted the most tweets about Arc Symphony, and appeared to know more about it than others, often linking the fansite.<br />
<br />
A [https://arcsymphony.neocities.org/play.html page] on the site claimed there was a MUD for the game's fans, but what was supposed to be a Telnet console was a [https://arcsymphony.neocities.org/timer.html countdown] to 2017-05-15T16:00:00 GMT (the timezone listed is GMT -4).<br />
<br />
= Box art =<br />
<br />
Most of the developers had a physical copy of the game. The front and back of the case have been seen, but it was unknown what the inside looked like, or if there was even a disk within.<br />
{{todo|Is it worth adding every photo of the case?}}<br />
<br />
<gallery><br />
Arc_Symphony_front.jpg|Front of the case (from [https://twitter.com/C418/status/863421259648049152 C418]).<br />
Arc_Symphony_back.jpg|Back of the case (from [https://twitter.com/sophiapark_/status/863013115931348992 Sophia Park]).<br />
</gallery><br />
<br />
== Transcription of the back ==<br />
<br />
When the Great Flood threatened to destroy all life on Earth, the Arc Symphony ascended to the sky. Now, play as young Kingsguard Satoshi Davis, and with the help of your friends Dallas Flamestrike, Laney, Emilio, and many others, protect your home from EVIL, and dsicover (sic) your true self.<br />
<br />
The Shard of Chronos will lend you power by the Divine Wisdom of the Goddess Aethuria. <br />
<br />
= List of tweets =<br />
<br />
Here is a list of all known tweets about Arc Symphony, in chronological order:<br />
<br />
== 2017-05-12 ==<br />
{{todo|The rest of these.}}<br />
Sophia Park: https://twitter.com/sophiapark_/status/863013115931348992</div>Halke234https://wiki.gamedetectives.net/index.php?title=Arc_Symphony&diff=16742Arc Symphony2018-08-01T00:50:23Z<p>Halke234: </p>
<hr />
<div>{{argbox<br />
| float = right<br />
| name = Arc Symphony<br />
| image = File:Arc Symphony cover.gif<br />
| description= Arc Symphony was a PS1 game by Aether Interactive that has suddenly popped up in 2017.<br />
| creator = [https://aetherinteractive.itch.io/ Aether Interactive]<br />
| type = Investigation<br />
| status = Discontinued<br />
| discovered = 2017-05-13<br />
}}<br />
<br />
[[Main Page]] > [[List of Investigations]] > '''Arc Symphony'''<br />
<br />
Since 2017-05-12, a large amount of indie developers began tweeting about "Arc Symphony", a PS1 game that never existed. Most of the developers were associated with the [http://www.torontocomics.com/ Toronto Comic Arts Festival].<br />
<br />
= Fansite =<br />
<br />
[https://arcsymphony.neocities.org An apparent fansite] for the game exists and contains details about the game.<br />
<br />
The [https://arcsymphony.neocities.org/contact.html contact page] contained links with ways to contact [https://twitter.com/sophiapark_ Sophia Park] and [http://twitter.com/olbeyblade_jpeg Penelope Evans], both of whom also had games linked in the site's sidebar labelled as affiliate sites. Sophia Park was believed to be behind the ARG, as she hah retweeted the most tweets about Arc Symphony, and appeared to know more about it than others, often linking the fansite.<br />
<br />
A [https://arcsymphony.neocities.org/play.html page] on the site claimed there was a MUD for the game's fans, but what was supposed to be a Telnet console was a [https://arcsymphony.neocities.org/timer.html countdown] to 2017-05-15T16:00:00 GMT (the timezone listed is GMT -4).<br />
<br />
= Box art =<br />
<br />
Most of the developers had a physical copy of the game. The front and back of the case have been seen, but it was unknown what the inside looked like, or if there was even a disk within.<br />
{{todo|Is it worth adding every photo of the case?}}<br />
<br />
<gallery><br />
Arc_Symphony_front.jpg|Front of the case (from [https://twitter.com/C418/status/863421259648049152 C418]).<br />
Arc_Symphony_back.jpg|Back of the case (from [https://twitter.com/sophiapark_/status/863013115931348992 Sophia Park]).<br />
</gallery><br />
<br />
== Transcription of the back ==<br />
<br />
When the Great Flood threatened to destroy all life on Earth, the Arc Symphony ascended to the sky. Now, play as young Kingsguard Satoshi Davis, and with the help of your friends Dallas Flamestrike, Laney, Emilio, and many others, protect your home from EVIL, and dsicover (sic) your true self.<br />
<br />
The Shard of Chronos will lend you power by the Divine Wisdom of the Goddess Aethuria. <br />
<br />
= List of tweets =<br />
<br />
Here is a list of all known tweets about Arc Symphony, in chronological order:<br />
<br />
== 2017-05-12 ==<br />
{{todo|The rest of these.}}<br />
Sophia Park: https://twitter.com/sophiapark_/status/863013115931348992</div>Halke234https://wiki.gamedetectives.net/index.php?title=Oddworld:_Soulstorm&diff=16722Oddworld: Soulstorm2018-07-31T22:17:55Z<p>Halke234: you get a cleanup</p>
<hr />
<div>{{argbox<br />
| float = right<br />
| name = Oddworld: Soulstorm ARG<br />
| image = File:Oddworld_ABETHUMB_8291.jpg<br />
| imagewidth = 500<br />
| description= Oddworld: Soulstorm - An ARG centered around lore from the Oddworld universe linked to the currently unreleased game [http://www.oddworld.com/soulstorm/ Oddworld: Soulstorm]<br />
| creator = [http://www.oddworld.com/ Oddworld Inhabitants, Inc]<br />
| type = Official<br />
| status = Active<br />
| reopened = 05-30-2018<br />
| discovered = 12-22-2016<br />
}}<br />
{{ArgHeader}}<br />
{{BackToTop}}<br />
<br />
The Oddworld: Soulstorm ARG was an ARG centered around lore from the currently unreleased Oddworld game, [http://www.oddworld.com/soulstorm/ Oddworld: Soulstorm]. The official home page for the ARG, containing puzzles, hints, and clues, can be found [http://www.oddworld.com/soulstorm/ here]. The ARG was divided into 5 distinct stages, each of which began with a "transmission": an image clue that led to a series of puzzles.<br />
<br />
== Prelude ==<br />
<br />
Early in 2016, [https://twitter.com/edmudokon Twitter account @edmudokon] began posting cryptic messages that seemed to be related to the [http://www.oddworld.com/ Oddworld] universe. The account appeared to be run by an average Mudokon named Ed who claimed to have information he wanted to share, but he seemed to be in constant danger and could only access the outside world via a faint connection. Beginning around March 2016, @edmudokon engaged users with an elaborate series of puzzles and challenges, releasing information both on twitter and via the official Oddworld [http://www.oddworld.com/soulstorm/ website]. These puzzles eventually led to the revelation of a website, http://1029.io, as well as a message: "now you know. you can help. join us. together we can rise."<br />
<br />
The [http://1029.io 1029] webpage featured glitchy effects and another rendition of the ASCII-art logo, but with the numbers 8291 replacing some characters. At the bottom of the page was an e-mail signup form, above which was a message:<br />
<br />
<pre><br />
THE FALL OF RF1029 WAS THE SPARK TO IGNITE A REVOLUTION. FOR TOO LONG, THEY HAVE CONTROLLED THEIR GIANT INDUSTRIAL MACHINES, GRINDING THE BONES OF OUR KIND INTO DUST IN THEIR ENDLESS PURSUIT OF POWER AND WEALTH.<br />
<br />
WE WERE TAUGHT THAT THIS IS ALL THERE WAS: OBEY.<br />
<br />
THE TRUTH WAS HIDDEN FROM US. OUR HISTORY WAS HIDDEN FROM US. WE WERE BRED TO WORK, RAISED TO OBEY AND FORCED TO COMPLY.<br />
<br />
OUR NATURAL CONNECTION TO MOTHER PLANET WAS ERASED FROM THE CONSCIOUSNESS OF OUR PEOPLE. LOST WAS OUR KNOWING. LOST WAS OUR UNITY, OUR CONNECTION, OUR POWER AND OUR PURPOSE. ALL THAT WE WERE WAS A COMMODITY TO BE TRADED AND EXPLOITED IN THE ONGOING RACE FOR MORE WEALTH. WHAT WE SHOULD HAVE PROTECTED, WE WERE TRICKED INTO KILLING. WHAT WAS WORST FOR US, WE WERE TOLD WAS BEST. WE WERE TAUGHT TO TRUST THOSE WHO WOULD DECEIVE US THE MOST.<br />
<br />
THAT HAS ALL CHANGED.<br />
<br />
THE HERO HAS SHOWN ALL OF US THAT OUR OPPRESSORS CAN BE TOPPLED. HE HAS FOUND OUR WILD AND KNOWING BROTHERS. HE HAS RECONNECTED THE FACTORY-BORN TO OUR NATURAL WORLD AND ANCIENT WAYS. HE HAS LIT A FIRE IN OUR HEARTS THAT CANNOT BE EXTINGUISHED.<br />
<br />
WE WILL GIVE HELP TO THOSE WHO ARE HELPLESS. WE WILL LEND STRENGTH TO THOSE WHO ARE WEAK. WE WILL FIGHT FOR THOSE WHO ARE DEFEATED. OUR MOVEMENT WILL SPREAD LIKE A RAGING INFERNO AND WE WILL TAKE BACK THE POWER FROM THOSE WHO HAVE ABUSED IT.<br />
<br />
WE WILL NOT BE SILENCED BY THE MEDIA CIRCUS. WE WILL NOT BE IGNORED. WE WILL NOT STOP. WE WILL NOT OBEY. WE WILL RISE AND WE WILL RISE AGAIN, UNTIL WE HAVE BURNED THROUGH OUR TATTERED BONDS AND RAZED THE MACHINE TO THE GROUND.<br />
<br />
WE WILL RISE. JOIN US.<br />
<br />
THERE’S A STORM COMING.<br />
</pre><br />
<br />
In the source code for the page, only the letters E and D of the message remain capitalized.<br />
<br />
Later that day, the [https://twitter.com/SPIRITOF1029 Twitter account @SPIRITOF1029] revealed themselves as a "Clandestine organization dedicated to doing good on behalf of the Mudokons and revealing information about a new horror being perpetrated against their species." They also tweeted their first message, parroting the [http://1029.io 1029 URL] and adding their own message: "There is a storm coming. Join us."<br />
<br />
Social media feeds went dark until December, 2016, posting only reiterations of the URL with messages like "Rise up" and "We are the storm. Join us". Then, in January of 2017, activity on the accounts surged once again and the first hints of an ARG began to appear.<br />
<br />
[[File:Oddworld_Logo3.jpeg|thumb|left|Spirit of 1029 emerges with this sleek ASCII-art logo]]<br />
<br />
=== Smells like Mudokon Spirit ===<br />
<br />
The flurry of new activity in January mainly consisted of @edmudokon and @spiritof1029 conversing about about whether or not Ed would be able to help the organization's cause. At this point, the Spirit of 1029 made their message very clear, stating "Oddworld has been blind to the plight of the noble Mudokons for too long. We will rise. Join us! http://1029.io". More notable activity includes the organization's quip "We recommend knowledge of many different codes and ciphers - you never know who is listening. #learnyournameinmorsecodeday", hinting that the coming information would be encrypted in some way..<br />
<br />
Oddworld Inhabitants (Oddworld developers, [https://twitter.com/OddworldInc @OddworldInc on Twitter]) was contacted by the organization at this time, being told by Spirit of 1029 "We will help @edmudokon but we can't send anything unencrypted. You'll have to break our code. We'll be in touch." Very shortly thereafter, on January 19th, 2017, Spirit of 1029 tweeted: "We have received a transmission. We will pass it on as soon as we can verify. We need your help." and the [http://www.oddworld.com/soulstorm/ Oddworld Webpage] was updated with a download for two files.<br />
<br />
== The First Transmission ==<br />
<br />
The Spirit of 1029's first transmission came in the form of an image and an audio file. The image, pictured on the right as it looked upon transmission, appeared to show a tattered and burned document bearing the Spirit of 1029's logo with the slogan "We Will Rise," with many portions of text redacted. The text on the document, where it was legible and not redacted, reads:<br />
<br />
[[File:Oddworld_1029_Photo1_Dirty.jpeg|thumb|right|200x300px|The distorted image sent by the Spirit of 1029 as part of their first transmission]]<br />
<br />
<pre><br />
Date:<br />
Period: XXXXXXXXXXX<br />
Specification Details:<br />
XXXXXXXXXXXXXXXXXXXXXXXXXX<br />
-Observe XXXXXXX and XXXXXXXX changes in test subjects<br />
-Assess long term XXXXXXXX on XXXXXXX<br />
-Determine product safety<br />
Authorization: XXXXXXXXXXX<br />
Tests requested:<br />
-XXXXXXXX Pronostics<br />
- ?Access whenever? product XXXXXXX<br />
-Acidity Levels<br />
- ????? XXXXXXXXX<br />
-Product safety<br />
Expected results: XXXXXXXXXX make XXXXXXXXX interesting<br />
Test results:<br />
-XXXXXXX highly XXXXXX<br />
-XXXXXXX this XXXXXX ?? XXXXXX ?nice? XXXXXXXX<br />
-Highly XXXXXXX<br />
-Subjects: XXXXXX<br />
- XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX<br />
XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX<br />
XXXXXXXXXXXXXXXXXX<br />
Conclusion: Product (ready) for consumption <br />
--------------------------------------------------------------------------------------------<br />
??? : XXXXXXXX there is XXXXXX here but it will XXXX ???? XXXXX<br />
--------------------------------------------------------------------------------------------<br />
</pre><br />
<br />
[[File:Oddworld_1029_Photo1_Clean.jpeg|thumb|left|A cleaned up version of the Spirit of 1029's first transmission made by the community]]<br />
<br />
As progress was made on the puzzles, the [http://www.oddworld.com/soulstorm/#navfirstcontact official Oddworld webpage] was updated to provide hints. This practice continued throughout the ARG.<br />
<br />
[[File:Oddworld_Arrows_pad.png|thumb|right|200x300px|The cryptic arrows found along the right side of the first image sent to the community by the Spirit of 1029]]<br />
<br />
=== Directional Arrows, Pigpen, & Anglo-Saxon Runes ===<br />
<br />
In addition to the text in the photo, there were several areas featuring symbols and runes. Along the top of the document, [http://www.omniglot.com/images/writing/futhorc.gif Anglo-Saxon runes] spelled out <code>ED</code>. Along the bottom, the text <code>YOU ARE THE KEY YOU KNOW IT IF YOU WERE LISTENING</code> is spelled out in the font, [http://www.babelstone.co.uk/Fonts/Pigpen.html BabelStone Club Penguin pigpen]. Running along the right side of the image, [http://wiki.gamedetectives.net/images/0/0c/Oddworld_Arrows.png arrows] can be seen pointing in a number of different vertical, horizontal, and diagonal directions. Players discovered that the arrows could be decoded by taking their angle measurement and deducing an "alphanumeric" equivalent, or a number between 0-25 where each number represents a letter of the alphabet. It just so happened that each arrow had an angle which ended in a zero, and thus, the first "arrow cipher" decoded to:<br />
<br />
<pre><br />
12 15 15 11 6 15 18 15 21 18 13 5 19 19 1 7 5 8 5 1 18 15 21 18 22 15 9 3 5<br />
<br />
L O O K F O R O U R M E S S A G E H E A R O U R V O I C E<br />
</pre><br />
<br />
The message decodes to <code>LOOK FOR OUR MESSAGE HEAR OUR VOICE</code>.<br />
<br />
=== First Audio Clip ===<br />
<br />
The second part of the Spirit of 1029's first transmission consisted of an [http://www.oddworld.com/soulstorm/1029contact/1029_01_audio.mp3 audio clip] lasting 1:40. Hidden in the audio clip was reversed Morse code, which proved difficult to decode by ear due to the added white noise. Eventually, the code was cracked by using a spectrogram of the audio.<br />
<br />
[[File:Oddworld_Morse_Spectro.png|frameless|center|810px|]]<br />
<br />
Although rough in some spots, the decoded Morse read:<br />
<br />
<code style="word-break:break-all;word-wrap: break-word;">qmiqwmiqyidimrjqdjijilmxmnrjqdjajmpmnrprspkesmkjpdqjnyajnwsnrpgspcsppmqidimqymdbcqajnwsnrpgspcdhbzmnjajanadumjimrpq</code><br />
<br />
In addition, players also discovered that, using portions of the Morse already decoded accurately by ear, it was actually to be used as ciphertext in a shift cipher, and that the key to be used was "storm," which was taken from tweets made by Spirit of 1029 declaring themselves to be "the storm". The pigpen from earlier served as a hint to look back at previous communications in order decrypt the morse. With the newly-complete Morse code now in their possession, the community was finally able to accurately decipher the ciphertext they had obtained from the reversed Morse code. It read:<br />
<br />
<code style="word-break:break-all;word-wrap: break-word;">tentwentyninedotiononqexerdotiofoeserdsdaspjaepositoryforwardslashassetninetyeightforwardslashimgzerofofrfiueonedst</code><br />
<br />
<code>ten twenty nine dot io nonqexer dot io foeserdsdaspjaepository forwardslash asset ninety eight forward slash img zero fofrfiueonedst</code><br />
<br />
Although not entirely accurate, through trial and error the community was able to locate a new URL branch of http://1029.io, http://1029.io/repository/asset98/imgzerofourfiveone/.<br />
<br />
=== First Hidden URL ===<br />
<br />
[[File:Oddworld_PuzzleAttempt.jpg|thumb|right|The product of many attempts to correctly arrange the puzzle pieces found on the hidden http://1029.io URL]]<br />
<br />
The solution for the previous puzzle led players to a hidden [http://1029.io/repository/asset98/imgzerofourfiveone/ page] on the 1029 site. Each time the page was reloaded, it displayed one of 8 different images, and a string of text for each:<br />
<br />
<gallery mode="packed"><br />
File:Oddworld_7676-AL.JPG|7676-AL<br />
File:Oddworld_3786-IC.JPG|3786-IC<br />
File:Oddworld_9455-UM.jpg|9455-UM<br />
File:Oddworld_9394-AL.jpg|9394-AL<br />
File:Oddworld_7393-AN.jpg|7393-AN<br />
File:Oddworld_5574-PH.jpg|5574-PH<br />
File:Oddworld_2384-ER.jpg|2384-ER<br />
File:Oddworld_1029-LY.jpg|1029-LY<br />
</gallery><br />
<br />
Players quickly realized that the images appeared to be fragments of a larger puzzle. The Oddworld Inhabitants [http://www.oddworld.com/soulstorm/#navfirstcontact page] updated to read "Once you've got everything together - show us!". The completed image was tweeted out to @OddworldInc on January 19th, 2017, and the next day, [https://twitter.com/OddworldInc/status/822686854516535298 instructed] players to wait while they cleaned up the complete image.<br />
<br />
<br><br><br />
<br />
[[File:Oddworld_Photo1_Clean1.jpeg|thumb|left|250x250px|Photograph of the final image before it was torn into the pieces the community was given, sent out with a message from Oddworld Inhabitants to hang tight until Thursday.]]<br />
<br />
=== First Unlocked Photo ===<br />
<br />
[[File:Oddworld_Finished1.jpg|thumb|right|400px|The final image, sent by the Spirit of 1029 and received by the community through Oddworld Inhabitants Twitter account. The image was confirmed to be an in-Unity render of the upcoming Oddworld: Soulstorm & created in conjunction with Cyrus McWilliams, formerly of Blur, and Fat Kraken Studios in England]]<br />
<br />
[[File:Oddworld_Pada.jpg|thumb|left|400px|The second transmission sent out by the Spirit of 1029, identical to the first released image but with various codes hidden within]]<br />
<br />
While waiting, players began to decode the second transmission. The prevalent writing was later verified to read "Who?", "Where?", "So Tired", and a set of numbers likely to be "8291". <br />
<br />
After three days, @OddworldInc [https://twitter.com/OddworldInc/status/823520771893030912 tweeted out a scrambled image], pictured left, stating "We received something and there's one last thing we need you to do. Share it. Spread the word.". The next day, after the tweet gained 100 shares, they tweeted the [https://twitter.com/OddworldInc/status/823620565458108416 image] again, pictured left, this time unscrambled. They then stated <code>While you shared our message 100 times we worked away to bring you this. We're clearing it up even more, we'll share what we find Thursday</code>, while the webpage was updated with the message "Update 5: Thanks to you guys sharing the previous images online, we've managed to decode the photo further and have updated the thumbnail here. We'll return on Thursday with the finished, fully decrypted image - but until then, please do let us know what you think!" When Thursday came @OddworldInc [https://twitter.com/OddworldInc/status/824638147703296000 tweeted out a final picture] of a render from the upcoming Oddworld: Soulstorm, pictured right, in all its unscrambled un-cropped glory. The release of this image signaled the end of the first of five phases of content release Oddworld Inhabitants have planned.<br />
<br />
<br><br><br><br><br />
<br />
== The Second Transmission ==<br />
<br />
[[File:Oddworld_Pada_sofar.jpg|thumb|right|400px|Hidden details in the second transmission]]<br />
<br />
On Feburary 2nd, 2017, the Spirit of 1029 again reached out to players, saying via Twitter that "Our agent has delivered another transmission. We will verify its origins and pass it on." Several hours later, @OddworldInc tweeted the message "We were just contacted again. Don't go anywhere, we might need your help with this...", and the [http://www.oddworld.com/soulst Official Oddworld Site] was updated with a message as well as [http://www.oddworld.com/soulstorm/1029contact/pada.jpg an image], pictured left. In addition to the image, a [http://us3.campaign-archive2.com/?u=2b6dca21053bc375cbdad7077&id=b08e7b2d60&e=6a2b5665ee newsletter] was sent out to everyone who signed up to the 1029 email list. The newsletter featured basic info about the ARG so far, as well as a barcode at the very bottom, which, when scanned, reveals a code:<br />
<br />
<code><br />
Ivzw gsv mfnyvih pmld gsv gifgs<br />
</code><br />
<br />
When passed through a cryptogram solver, the message read:<br />
<br />
<code><br />
READ THE NUMBERS KNOW THE TRUTH<br />
</code><br />
<br />
An [http://wiki.gamedetectives.net/images/thumb/5/56/Oddworld_Pada_sofar.jpg/800px-Oddworld_Pada_sofar.jpg "in-progress" image], pictured on the right, highlighted the hidden details found at the time and outlined their currently known solutions.<br />
<br />
=== Morseception ===<br />
<br />
The Morse code in the image turned out to be fragments of a larger single code, seen below pieced back together:<br />
<br />
[[File:Oddworld_MorseAlign_TrueHeresy.png|frameless|center|810px|Image of all the Morse code segments pieced together]]<br />
<br />
When decrypted, the morse resulted in the following message:<br />
<br />
<code><br />
DASHDOTDOTDOT DOT DASH DOTDOTDOTDOT DOT DOTDOTDOT DASH DASHDASHDASHDASH DOTDASHDOT DASHDASH<br />
</code><br />
<br />
This was found to yet again be morse code, which decoded to:<br />
<br />
<code><br />
-... . - .... . ... - --- .-. --<br />
<br />
BETHESTORM<br />
</code><br />
<br />
=== Braille & Upside-down Pigpen ===<br />
<br />
[[File:Oddworld_Brialle.png|thumb|right|250px|Braille code found in the second Spirit of 1029 transmission]]<br />
<br />
A [http://wiki.gamedetectives.net/images/a/a4/Oddworld_Brialle.png message in Braille], pictured right, in the bottom-left of the image read <code>Spread our message</code>. The Babelstone pigpen code, when flipped upside down:<br />
<br />
[[File:Oddworld_UpsideDownPigpen.jpg|frameless|center|810px|Upside-down Babelstone Pigpen code]]<br />
<br />
decoded to:<br />
<br />
<code><br />
KNOW YOUR CODES<br />
<br />
KEEP THEM CLOSE<br />
<br />
YOU WILL NEED THEM<br />
</code><br />
<br />
[[File:Oddworld_BarcodeCube.png|thumb|left|400px|The "data cube" from the second image, later determined to be two barcodes interlaced with one another, one running horizontally and the other vertically]]<br />
<br />
=== Directional Arrows Puzzle ===<br />
<br />
Using the [http://wiki.gamedetectives.net/index.php?title=Oddworld_Soulstorm#Directional_Arrows_Puzzle], these arrows decoded to:<br />
<br />
<pre><br />
7 14 9 8 20 25 18 5 22 5 5 4 15 3 5 4<br />
H O J I U Z S F W F F E P D F E<br />
</pre><br />
<br />
Players found the above ciphertext to be encrypted with a Caesar cipher set to a shift of 25, and revealed the message: <code>GNIHTYREVEEDOCED</code>, which is <code>DECODE EVERYTHING</code> backwards.<br />
<br />
=== Interlaced Barcodes & Second Hidden URL ===<br />
<br />
[[File:Oddworld_Grid.jpg|thumb|right|250x250px|The image found on the second hidden URL discovered by the community, which depicts the Spirit of 1029's logo chopped up and re-arranged on a 7x7 grid]]<br />
<br />
The community speculated that the [http://wiki.gamedetectives.net/images/3/30/Oddworld_BarcodeCube.png strange box in the bottom-right of the image] sent by the Spirit of 1029, pictured left, was a fragmented barcode. After a massive amount of tinkering, the two barcodes were [http://imgur.com/a/YmAH2 correctly assembled] and, when scanned, led to the discovery of two messages:<br />
<br />
<code><br />
http://www.1029.io/repository/asset98/<br />
</code><br />
<br />
and<br />
<br />
<code><br />
findawayshowthetruth<br />
</code><br />
<br />
Combining these messages into a single URL led players to another hidden [http://www.1029.io/repository/asset98/findawayshowthetruth/ page] on the 1029 website, which displayed a [http://www.1029.io/repository/asset98/findawayshowthetruth/grid.jpg distorted version] of the Spirit of 1029 logo, pictured right.<br />
<br />
=== Source Code Mysteries ===<br />
<br />
Players discovered an extensive message containing several presently-unsolved puzzles is written hidden in the source code of the second hidden page. It read:<br />
<br />
<pre><br />
!-- <br />
<br />
Can’t reach any..<br />
<br />
<br />
Listening anyon… there?<br />
<br />
<br />
Can hear us anymore- need to… can’t fnd <br />
<br />
<br />
We will never give… what they… from us<br />
<br />
A9539 \\<br />
<br />
B2919 /\\<br />
<br />
C4882 /\<br />
<br />
D4627 \<br />
<br />
E6758 \<br />
<br />
F???? ////<br />
<br />
<br />
/\//\\//5,1:4.1,2:8.1,3:2.3,3:2.4,3:3.7,3:3.1,5:3.4,5:9.5,5:2.7,5:4.7,6:6.3,7:3.<br />
<br />
<br />
<br />
<br />
Does… care? Freedom isn’t gi… will take…<br />
<br />
We have never…. Given… deserve. We… take… our righ…<br />
<br />
\\//\/KDIUTHANPUYHHDQOEPLNDOALJGUDITHBBDOZLGFERKJGLSAOE<br />
<br />
Stand up and fi…<br />
<br />
<br />
Don’t be afr….<br />
<br />
<br />
<br />
\////JUTYROSLNGNALEHGNWOTIQPOKSDNTPNOJAWEOBNGLAWKJNWNR <br />
<br />
E=5OUEHRA? <br />
<br />
<br />
<br />
\\\\/\2,1:2.3,1:2.6,1:4.1,2:4.3,2:2.3,4:4.5,5:2.6,5:3.7,5:3.4,7:8.5,7:3.7,6:4. <br />
<br />
7777338883366899984477733 33 <br />
<br />
<br />
<br />
<br />
They want to… kill- don’t-<br />
<br />
<br />
Stop them from…. Hurting- they… think<br />
<br />
We are no less- they think… aside<br />
<br />
<br />
Don’t believe what… told- liars…<br />
<br />
A5989 \\<br />
<br />
B5176 \<br />
<br />
C2863 \<br />
<br />
D2558 //\<br />
<br />
E3413 \<br />
<br />
<br />
F???? ////<br />
<br />
<br />
<br />
Can’ fnd anymo-<br />
<br />
<br />
We wil silnced<br />
<br />
<br />
<br />
<br />
<br />
<br />
Killin- they are dy..<br />
<br />
\\\/\\JHWUITUHABSJGNEWKLALNVGJKWELKJLWQQPRUTJHJJSBFMMH <br />
<br />
Hurting the..<br />
<br />
Back down unt… resist.<br />
<br />
<br />
Intercep… our messa… we will fight<br />
<br />
///\\/JQEABTVKNUCSEYCMBILDKOSCYSITECPAGFAXHKETJNZURWCIE <br />
<br />
We will ri…<br />
<br />
Cannot… silenced when ther… who need… now<br />
<br />
<br />
We won’t ba… we have beat…. Before… Must not-<br />
<br />
<br />
<br />
<br />
\///\//\1,1:3.4,1:2.6,1:9.2,2:2.6,2:2.2,4:4.3,5:2.5,5:2.7,5:3.4,7:3.6,7:2.7,7:2. <br />
<br />
<br />
<br />
Spent so long…. Afraid… never let- again<br />
<br />
<br />
...Storm… find it’s way- end<br />
<br />
<br />
Why are … here?<br />
<br />
<br />
<br />
<br />
Only...profit- nothing more… importnt as- <br />
<br />
- lies they… will tel-<br />
<br />
Believe- nothing… terribl- things… <br />
<br />
\\//\\\/4,2:6.6,2:4.7,3:3.2,4:8.3,4:2.4,4:2.7,4:3.2,6:2.4,6:3.6,6:2.1,7:4.3,7:2.<br />
<br />
--><br />
</pre><br />
<br />
At the time, only a few portions of this message have been successfully solved. <br />
<br />
The ABCDEF puzzles was solved using the rules of [https://en.wikipedia.org/wiki/Mastermind_(board_game) Mastermind], a popular board game. Players assumed that a backslash ( \ ) indicated a partial match and a forward slash ( / ) indicated a full match, as shown below:<br />
<br />
<pre><br />
A9539 \\<br />
<br />
B2919 /\\<br />
<br />
C4882 /\<br />
<br />
D4627 \<br />
<br />
E6758 \<br />
<br />
F???? ////<br />
</pre><br />
<br />
Had a solution of <code>F8992</code>, and:<br />
<br />
<pre><br />
A5989 \\<br />
<br />
B5176 \<br />
<br />
C2863 \<br />
<br />
D2558 //\<br />
<br />
E3413 \<br />
<br />
F???? ////<br />
</pre><br />
<br />
Had a solution of <code>F8554</code>. The purpose of these solutions was unknown.<br />
<br />
Players found the numbers <code>7777338883366899984477733 33</code> to be encoded with a [http://www.dcode.fr/multitap-abc-cipher multi-tap cipher] (cellphone numberpad), and can be decoded to <code>SEVENTYTHREE</code>. the purpose of this solution was also unknown.<br />
<br />
The <code>E=5OUEHRA?</code> portion was partially solved. Players found that the letters <code>O U E H R A</code> were all the second letters from each day of the week, I.E. M'''o'''nday, T'''u'''esday, W'''e'''dnesday, etc. This indicated a solution of <code>U</code> for the question mark, as in S'''u'''nday, making the full string <code>E=5OUEHRAU</code>. The <code>E=5</code> portion of the text remains unsolved.<br />
<br />
Also remaining unsolved are the coordinates found in the code, as well as the letter strings:<br />
<br />
[[File:Oddworld_Grid.jpg|thumb|right|250x250px|The 7x7 grid found on the second hidden URL, likely to be used with the coordinates & letter strings in some way]]<br />
<br />
<pre><br />
Coordinates<br />
<br />
/\//\\//5,1:4.1,2:8.1,3:2.3,3:2.4,3:3.7,3:3.1,5:3.4,5:9.5,5:2.7,5:4.7,6:6.3,7:3.<br />
<br />
\\\\/\2,1:2.3,1:2.6,1:4.1,2:4.3,2:2.3,4:4.5,5:2.6,5:3.7,5:3.4,7:8.5,7:3.7,6:4.<br />
<br />
\///\//\1,1:3.4,1:2.6,1:9.2,2:2.6,2:2.2,4:4.3,5:2.5,5:2.7,5:3.4,7:3.6,7:2.7,7:2. <br />
<br />
\\//\\\/4,2:6.6,2:4.7,3:3.2,4:8.3,4:2.4,4:2.7,4:3.2,6:2.4,6:3.6,6:2.1,7:4.3,7:2.<br />
</pre><br />
<pre><br />
Letter Strings<br />
<br />
\\//\/KDIUTHANPUYHHDQOEPLNDOALJGUDITHBBDOZLGFERKJGLSAOE<br />
<br />
\////JUTYROSLNGNALEHGNWOTIQPOKSDNTPNOJAWEOBNGLAWKJNWNR <br />
<br />
\\\/\\JHWUITUHABSJGNEWKLALNVGJKWELKJLWQQPRUTJHJJSBFMMH<br />
<br />
///\\/JQEABTVKNUCSEYCMBILDKOSCYSITECPAGFAXHKETJNZURWCIE<br />
</pre><br />
<br />
=== Stuck In The Mud & Third Hidden URL ===<br />
<br />
After many failed attempts by players to decode the contents of the message using the hints of Spirit of 1029, a player found something unusual about one of the account's most recent tweets, which said:<br />
<br />
<pre><br />
When you have the key, you need the correct lock. hgehgeoeregpineechqnhgeevtipcvreovxgvge<br />
Shake loose the bonds that hold you. #wewillrise<br />
</pre><br />
<br />
Players noted that the text <code>hgehgeoeregpineechqnhgeevtipcvreovxgvge</code> could be decoded via a [http://www.braingle.com/brainteasers/codes/keyword.phpsubstitution keyword cipher] with the key <code>subjectivism</code>, and reveals the message:<br />
<br />
<pre><br />
oneoneseventhreefouroneeightfivesixnine<br />
</pre><br />
<br />
Using this solution, players quickly found another secret [http://www.1029.io/repository/asset98/1173418569/ page] on the 1029 hub.<br />
<br />
=== Creepy Scenes From Within ===<br />
<br />
Much like the first hidden page, this hidden page displayed a different image each time the page is reloaded. In total, 13 scrambled images appear frequently (file prefix WB) and up to 13 CLEAR immages appear only very rarely (file prefix CWB). All the files are below, with their respective names:<br />
<br />
<gallery mode="packed"><br />
File:Oddworld_WB1_HEND8243.jpg | WB1_HEND8243<br />
File:Oddworld_WB2_BSJG2456.jpg | WB2_BSJG2456<br />
File:Oddworld_WB3_INFG2861.jpg | WB3_INFG2861<br />
File:Oddworld_WB4_HBQD2962.jpg | WB4_HBQD2962<br />
File:Oddworld_WB5_SJKW4167.jpg | WB5_SJKW4167<br />
File:Oddworld_WB6_OWUI2056.jpg | WB6_OWUI2056<br />
File:Oddworld_WB7_MNCH1101.jpg | WB7_MNCH1101<br />
File:Oddworld_WB8_RDHRHAHA.jpg | WB8_RDHRHAHA<br />
File:Oddworld_WB9_D34DM337.jpg | WB9_D34DM337<br />
File:Oddworld_WB10_BDJW8411.jpg | WB10_BDJW8411<br />
File:Oddworld_WB11_WHAT8291.jpg | WB11_WHAT8291<br />
File:Oddworld_WB12_PADAPADA.jpg | WB12_PADAPADA<br />
File:Oddworld_WB13_VLAP3662.jpg | WB13_VLAP3662<br />
</gallery><br />
<gallery mode="packed"><br />
File:Oddworld_CWB1_0BE01647.JPG | CWB1_0BE01647<br />
File:Oddworld_CWB2_0DG02966.JPG | CWB2_0DG02966<br />
FILE:Oddworld_CWB4_WHATISTHIS.JPG | CWB4_WHATISTHIS<br />
File:Oddworld_CWB5_NEEDLEINAHAYSTACK.JPG | CWB5_NEEDLEINAHAYSTACK<br />
File:Oddworld_CWB6_ARG-H.JPG | CWB6_ARG-H<br />
File:Oddworld_CWB7_82918291829182918291.JPG | CWB7_82918291829182918291<br />
File:Oddworld_CWB8_0GE03866.JPG | CWB8_0GE03866<br />
File:Oddworld_CWB9_0IE02565.JPG | CWB9_0IE02565<br />
File:Oddworld_CWB10_AbeAndNEEDLESFunAdventures.JPG | CWB10_AbeAndNEEDLESFunAdventures<br />
File:Oddworld_CWB11_02500356.JPG | CWB11_02500356<br />
File:Oddworld_CWB12_02323hjfhfhfhfhASDF.JPG | CWB12_02323hjfhfhfhfhASDF<br />
File:Oddworld_CWB13_insertcodehere.JPG | CWB13_insertcodehere<br />
</gallery><br />
<br />
While it wasn't entirely clear, players believed that this was yet again another form of a jigsaw puzzle.<br />
<br />
After a [http://wiki.gamedetectives.net/images/0/09/Oddworld_Phase_One.png series] of interesting [http://wiki.gamedetectives.net/images/e/e0/Oddworld_Phase_Two.png updates], the new hidden [http://www.1029.io/repository/asset98/1173418569/ page] went dark, with the header reading <code>ASSET98: TERMINATED.</code> and a new comment in the source code which read: <code>!-- see ya around, 1029... --></code>. The [https://twitter.com/edmudokon @Edmudokon] Twitter account, after a long period of silence, also tweeted out a [https://twitter.com/edmudokon/status/829079318290694144 new message]:<br />
<br />
<pre><br />
what happened? what did you do? who? No! no... aaaaaAaaaaarrrRrrrgggggGgghhh!<br />
</pre><br />
<br />
And with this message, Ed appears to have passed away. At that point, it was not clear if it was due to bruteforcing attempts by players or whether his death was intended all along.<br />
<br />
=== From The Ashes, Asset 99 (Hidden URL 3.5) ===<br />
<br />
[[File:Oddworld_OrangeLightning_V2.jpg|thumb|right|A very convincing collage of the images seen pictured on the now-dark Asset 98 URL; what is going on in the image remains unknown]]<br />
<br />
After the Asset98 page was "destroyed," a [http://www.1029.io/repository/asset99 new page], called "Asset99," was revealed, and appeared to be a clone of the Asset98 page. However, when refreshed, the page failed to reveal some of the "rarer" fragments from the Asset98 page. This page also came with an intimidating message: "We will not be stopped. We may have lost Asset 98, but we will continue strong. Together. Against the machines. Help us to expose this latest crime against Mudokonkind." The [http://www.oddworld.com/soulstorm/#navfirstcontact Official Oddworld Webpage] also updated at this time, and requested help putting the pieces together.<br />
<br />
However, in the midst of the image-related updates, the @Spiritof1029 Twitter account posted:<br />
<br />
<pre><br />
We can't reach Asset 98 but we do still have his clear transmissions. Prove you're worthy. Show us that you're able. Send us the grid. You found the grid, the letters and the numbers. Tell us how they fit together. Prove you're no longer slaves to the machines.<br />
</pre><br />
<br />
Players found that this tweet referred back to the [http://wiki.gamedetectives.net/index.php?title=Oddworld_Soulstorm#Source_Code_Mysteries source code grid challenge].<br />
<br />
The assembled image was then [https://twitter.com/OddworldInc/status/829336580347326465 tweeted at OWI] and they replied, stating "You've given us enough for us to get to work cleaning up the image, we'll have something by tomorrow. Don't stop looking for the truth!" So, players waited patiently for the unscrambled image whilst solving the grid.<br />
<br />
=== Second Unlocked Image & Grid Solution ===<br />
<br />
[[File:Oddworld_RandomiserDizma.jpg|thumb|right|The solved grid, which reveals the word "subjectivism" (first letter of each section connected in the correct order), the key used to decode the string which led to the discovery of the third hidden Asset98 URL]]<br />
<br />
[[File:Oddworld_Second_Final.jpg|thumb|left|400px|The final image cleaned up & released by OWI a day after the collage was submitted]]<br />
<br />
The next day, OWI tweeted out a [https://twitter.com/OddworldInc/status/829715069235781632 cleaned-up image], pictured on the left, which seemed to depict quite a gruesome scene, featuring a wide-eyed Mudkon strapped to an operating table facing an onslaught of needles and next to a vat which read "SS Brew". Players also learned via [https://twitter.com/edmudokon @Edmudokon on Twitter] that Ed made it out alive, but his friend: "...never came back. I could hear him screaming all night... helpless. they took him... he was my friend. how did they know?"<br />
<br />
Shortly after players received the cleaned-up image, [https://twitter.com/SPIRITOF1029/status/830004742713638912 partial progress] was finally made on [http://wiki.gamedetectives.net/index.php?title=Oddworld_Soulstorm#Hidden_Barcodes_.26_Second_Hidden_URL the grid], which up until then remained unsolved. One player discovered that the coordinates could be applied to the grid using the rules of the Japanese puzzle game [https://en.wikipedia.org/wiki/Shikaku Shikaku] (#'s after the colons in the coordinates represent box sizes, which are the lines drawn in red). Another player was then able to successfully apply a letter string to the sliced-up cube, pictured right, from which the word <code>subjectivism</code> can be derived. The only strings that were used to find the solutions were ones that had a forward slash. This word was the [http://wiki.gamedetectives.net/index.php?title=Oddworld_Soulstorm#Stuck_In_The_Mud_.26_Third_Hidden_URL key previously used] to decode the third hidden Asset98 page. However, whether the key was intended to remain hidden until the grid was solved or intentionally encoded in such a way as to allow for bruteforcing is unknown.<br />
<br />
== The Third Transmission ==<br />
<br />
After some waiting, on Feburary 23rd, 2017, OWI [https://twitter.com/OddworldInc/status/834856085949394944 sent out a tweet] indicting they had again been contacted by the Spirit of 1029. A new, password-protected zip file named <code>89928554_Eequals5.zip</code> was found on the main Oddworld [http://www.oddworld.com/soulstorm/ website]. Players then realized that the name of the ZIP contained one of the solutions of the puzzles in the source code of the first hidden page. Within the .ZIP file were six files, four of which were .JPGs, one of which was a .PNG, and the last of which is a .TXT. Their filenames were:<br />
<br />
<code><br />
flyer1.jpg, flyer2.jpg, flyer3.jpg, Oddworld_Soulstorm_002_HD.jpg, toollist.txt, & vital.png<br />
</code><br />
<br />
The name of the zip suggested that players should use letter equivalencies to their alphabetic indexes as the password. This gave players the password <code>HIIBHEED</code> but in fact, the password was actually <code>HIIDHEED</code> for unknown reasons.<br />
<br />
=== Steganograpy Blitz & toollist.txt ===<br />
<br />
The file [http://pastebin.com/feuVh6wr toollist.txt] contained a repeating string consisting of names of moons in Earth's solar system, and are occasionally interrupted by forward slashes. Players found that the letters after each slash formed the string: <code>useSsuitePicselSecuritySaveus</code>. Players found this to refer to [http://www.ssuitesoft.com/ssuitepicselsecurity.htm Ssuite Picsel Security], which is a specific steganography program.<br />
<br />
When the file <code>Oddworld_Soulstorm_002_HD.jpg</code> was set as the original and <code>vital.png</code> was set as the target using Ssuite Picsel Security, the output was:<br />
<pre style="word-break:break-all;word-wrap: break-word;">BmzPmbtzueMfxmeBdayqftqgeBmzpadmQbuyqftqgeVmzgeMqsmqazYuymeYqftazqMzftqBmxxqzqQzoqxmpgeFqftkeFqxqefaOmxkbeaPuazqTqxqzqBaxkpqgoqeDtqmFufmzTkbqduazUmbqfgeWuhugcUvudmcBtaqnqBmmxumcEwmftuMxnuadujNqntuazzQddumbaEwaxxEumdzmcFmdcqcSdqubTkddawwuzVmdzemjmFmdhaeYgzpuxrmduNqdsqxyudZmdhuEgffgzsdTmfuRmdnmgfuFtdkydMqsudNqefxmEgdfgdWmduKyudXasqRadzvaf</pre><br />
<br />
When deciphered using a [http://rumkin.com/tools/cipher/caesar.php Caesar cipher] with N=14, the following cleartext can be obtained:<br />
<br />
<pre style="word-break:break-all;word-wrap: break-word;">PanDaphnisAtlasPrometheusPandoraEpimetheusJanusAegaeonMimasMethoneAnthePalleneEnceladusTethysTelestoCalypsoDioneHelenePolydeucesRheaTitanHyperionIapetusKiviuqIjiraqPhoebePaaliaqSkathiAlbiorixBebhionnErriapoSkollSiarnaqTarqeqGreipHyrrokkinJarnsaxaTarvosMundilfariBergelmirNarviSuttungrHatiFarbautiThrymrAegirBestlaSurturKariYmirLogeFornjot</pre><br />
<br />
All of the names above are the named moons of Saturn. However, <code>Erriapus</code> and <code>Fenrir</code> were missing. <code>Erriapus</code> was replaced by <code>Erriapo</code>, which was the original name of the moon.<br />
<br />
=== Cleaned-Up Flyers ===<br />
<br />
[[File:Oddworld_Malachim.gif|thumb|right|295x72px|The Malachim alphabet used in this puzzle.]]<br />
<br />
The images that players received of the Sligs' flyers were corrupted, and were quickly cleaned up by players.<br />
<gallery widths=180px><br />
File:Oddworld_flyer1_clean.jpg|A cleaned up version of flyer1.jpg<br />
File:Oddworld_flyer2_clean.jpg|A cleaned up version of flyer2.jpg<br />
File:Oddworld_flyer3_clean.jpg|A cleaned up version of flyer3.jpg<br />
</gallery><br />
One player found that the pigpen cipher on the left side of flyer1.jpg gave the string<code>AOCXY SIO</code>, which when shifted by 6 using a Caesar cipher yielded <code>GUIDE YOU</code>. <br />
<br />
The cipher on flyer2.jpg gave the string <code>FYNNBYNBCHANBUNM</code> which, when shifted in the same manner as before, yielded <code>LETTHETHINGTHATS</code>. <br />
<br />
The final one on flyer3.jpg gave the string <code>GCMMCHA</code> which was again shifted in the same manner as before to yield <code>MISSING</code>.<br />
<br />
All three of the pigpen strings can be combined to form a message: <code>LET THE THING THAT'S MISSING GUIDE YOU</code><br />
<br />
Additionally, sequences of <code>x</code> and <code>o</code> characters are seen. One player noticed that this could be interpreted as morse code in the following format (with x as dash, o as dot):<br />
<br />
<pre><br />
x oooo o xoxx ox oxo o oxx ox x xoxo oooo oo xo xxo<br />
xooo o x oooo o ooo x xxx oxo xx <br />
oxx o oxx oo oxoo oxoo oxo oo ooo o<br />
</pre><br />
<br />
became:<br />
<br />
<pre><br />
/- .... . -.--/.- .-. ./.-- .- - -.-. .... .. -. --./<br />
/-... ./- .... ./... - --- .-. --/<br />
/.-- ./.-- .. .-.. .-../.-. .. ... ./<br />
</pre><br />
<br />
which decoded to: <code>THEY ARE WATCHING BE THE STORM WE WILL RISE</code><br />
<br />
In addition, each of the flyers contained a set of strange symbols and numbers. The symbols were found to be the Malachim alphabet, as seen on the right.<br />
<br />
=== Fourth & Fifth Hidden URLs ===<br />
<br />
Using the hint to determine what was “missing,” players shifted their focus to the moon of <code>Erriapo</code>, as it was in the steganography text, but not in toollist.txt. Using the Malachim alphabet symbols and numbers, players translated <code>Erriapo</code> into <code>12 36 28 31 52 22 12</code>. The validity of this method was confirmed with a [https://twitter.com/SPIRITOF1029/status/835149069601419264 tweet] from Spirit of 1029, and the image in the tweet was decoded to contain <code>P=22</code>. This led players to the discovery of a new [http://www.1029.io/repository/asset99/12362831522212/ page] on the 1029 website. The header, <code>ASSET9X / [REDACTED] / 333333333333</code>, appeared to be a corrupted link to another page. In addition, the page yet again displayed a different image upon each refresh, all of which can be seen below.<br />
<br />
<gallery mode="packed"><br />
File:Oddworldd_YOU.jpg|YOU.jpg<br />
File:Oddworld_WHA.jpg|WHA.jpg<br />
File:Oddworld_WET.jpg|WET.jpg<br />
</gallery><br />
<br />
The page also contained a message:<br />
<br />
<pre><br />
We can't hold much longer.<br />
It's dark, and cold. So cold. They don't seem to [REDACTED]. They. Them. It's hard to know how we'll [REDACTED], but we'll try. This can't last forever. We won't last forever.<br />
Look what they're doing to us. Just look.<br />
There is spirit, but it's waining. We need you, [REDACTED]. Help us.<br />
</pre><br />
<br />
In addition, players also discovered another [http://www.1029.io/repository/asset99/71220283136/ page] on the 1029 site, using the same method as before but with the moon <code>Fenrir</code> instead. The page contained the same obscured header, and displayed one of three images upon each refresh, which can be seen below.<br />
<br />
<gallery mode="packed"><br />
File:Oddworld_OLD.jpg|OLD.jpg<br />
File:Oddworld_TIF.jpg|TIF.jpg<br />
File:Oddworld_TOO.jpg|TOO.jpg<br />
</gallery><br />
<br />
When the names of the files on both pages were put together, players found the string:<br />
<br />
<pre><br />
WHATIFWETOLDYOUTOO<br />
<br />
WHAT IF WE TOLD YOU TOO<br />
</pre><br />
<br />
== The Horror Is Shown In Full ==<br />
<br />
After a long period of tinkering, players found a [http://www.1029.io/whatifwetoldyoutoo/ new directory] on the 1029 site, called "whatifwetoldyoutoo.<br />
<br />
[[File:What_if_we_told_you_too_pre_edit.png|thumb|right|400x200px|The first page before it's eventual sharing.]]<br />
<br />
The source code of the page contained a few, interesting comments: <code>BDBDBDBDBDBDBDBBDBDBDBDBDBD</code>, <code>###BELIKEDET###</code> and <code>doYOUsee? think of a number, any number.</code><br />
<br />
Through unknown means, players then found the next [http://www.1029.io/whatifwetoldyoutoo/8291/ page]<br />
by adding 8291 to the end. This link leads to the [https://www.youtube.com/watch?v=2l4jZVTUoak/ 4 second video] of the previous photo, depicting the severe torture the mudokons had to endure.<br />
<br />
Three different codes pop up during the video, but these were found to have no relevance to the ARG.<br />
<br />
== The 4th Transmission ==<br />
<br />
After the horror of the 3rd transmission, [http://www.oddworld.com/soulstorm/findit.jpg the next image would be released not shortly after], depicting a montage of the past three transmissions. In it, there are 2 separate codes:<br />
<br />
The Morse code, which decodes as <code> USE A DIFFERENT CODE. THIS IS NOT RELEVANT DATA. DO NOT COMPLY. DO NOT OBEY. THEY LIE. </code><br />
The Runes on the left hand side and the ones partially cut off at the top and bottom(as previously seen in the video) were decoded by using file data in a hex editor, which would say:<br />
<br />
<br><br />
<br />
<tt><br />
<code><rdf:li photoshop:LayerText="WE WERE TAUGHT THAT THIS IS ALL THERE WAS: WORK, OBEY, COMPLY. THE TRUTH WAS HIDDEN FROM US. OUR HISTORY WAS HIDDEN FROM US. WE WERE BRED TO WORK, RAISED TO OBEY AND FORCED TO COMPLY. OUR NATURAL CONNECTION TO MOTHER PLANET WAS ERASED FROM THE CONSCIOUSNESS OF OUR PEOPLE. LOST WAS OUR KNOWING. LOST WAS OUR UNITY, OUR CONNECTION, OUR POWER AND OUR PURPOSE. ALL THAT WE WERE WAS A COMMODITY TO BE TRADED AND EXPLOITED IN THE ONGOING RACE FOR MORE WEALTH. WHAT WE SHOULD HAVE PROTECTED, WE WERE TRICKED INTO KILLING. WHAT WAS WORST FOR US, WE WERE TOLD WAS BEST. WE WERE TAUGHT TO TRUST THOSE WHO WOULD DECEIVE US THE MOST. THAT HAS ALL CHANGED. THE HERO HAS SHOWN ALL OF US THAT OUR OPPRESSORS CAN BE TOPPLED. HE HAS FOUND OUR WILD AND KNOWING BROTHERS. HE HAS RECONNECTED THE FACTORY-BORN TO OUR NATURAL WORLD AND ANCIENT WAYS. HE HAS LIT A FIRE IN OUR HEARTS THAT CANNOT BE EXTINGUISHED. WE WILL GIVE HELP TO THOSE WHO ARE HELPLESS. WE WILL LEND STRENGTH TO THOSE WHO ARE WEAK. WE WILL FIGHT FOR THOSE WHO ARE DEFEATED. OUR MOVEMENT WILL SPREAD LIKE A RAGING INFERNO AND WE WILL TAKE BACK THE POWER FROM THOSE WHO HAVE ABUSED IT. WE WILL NOT BE SILENCED BY THE MEDIA CIRCUS. WE WILL NOT BE IGNORED. WE WILL NOT STOP. WE WILL NOT OBEY. WE WILL RISE AND WE WILL RISE AGAIN, UNTIL WE HAVE BURNED THROUGH OUR TATTERED BONDS AND RAZED THE MACHINE TO THE GROUND. WE WILL RISE. JOIN US. THERE'S A STORM COMING."/><br />
<br />
<rdf:li photoshop:LayerName="gas liquid solid" photoshop:LayerText="gas liquid solid"/><br />
<br />
<rdf:li photoshop:LayerName="fire air water earth" photoshop:LayerText="fire air water earth"/></code><br />
</tt><br />
<br />
<br><br />
<br />
This gave us an exact copy of the speech given on 1029.io, and the states of matter + the classical elements.<br />
OWI would also be teasing at us with the plain clue on the image "Use what you can't see"<br />
<br />
Therefore, people started concluding that not all states of matter/classical elements were shown, as there exists a state of matter after a gas called "plasma", and there exists a 5th classical element called "void" or "aether". <br />
This would all be hinting at the next url, http://www.1029.io/electricity.<br />
<br />
=== Take a deep breath... ===<br />
In this page is a simple "HELP" which, when clicked on, [http://www.1029.io/electricity/help.zip downloads a zip]. This zip contains 2 things.<br />
[[File:SaveUs.jpg|thumb|right|The image in the zip]]<br />
<br />
Firstly, it contains an image with binary that decodes to <code> BREATH </code><br />
<br />
Secondly, it contains another horrifying message encrypted in binary, which reads:<br />
<br><br />
<br />
<tt><br />
<code>why do you just watch can you not see us can you not hear the utighdbfn why is this happening wny its too cold to th can you hear us is there anybody there will you help us or rihjsudhgheusodj never are go find pn lose into ital chem we are cold we are lost we are forgotten and its e cant gmds pneuma tigd why are they taking cant stop cold so cold so cold we will rise we will not obey we will not comply j end n we will rise we will rise we will rise we will not die is abe dead here we will not die here we will not die here we cannot die here we cannot die here we cannot die here we cannot survive gheufh help this is not what we wanted we cannot dont cant see speak stop we need to save someone save us pneuma we need to be stop ightne vital energy source of this stop to think breath breathe cant breathe cant always watching we can never eyes stop find rest go now share loose top find think or too last day light never why to away stp give this is ever not no find things first or the ghtuenthdaytjgitlet last now or out get in or art test never stop we will find a way to gain our freedom e why it lost gone now stop taken from us and from there st we cant stop too much now too pain pain pain pain pain pain pain pain pain pain pain dont believe the things they tell you they lie they know no truth its lost long lost now ghwkfnhjsk what happened to them they are lost ghwufnfasjntiwpldfmwbwietpr stop it greed greed greed greed greed greed greed the expense is us we are tired our spark is fading do not let them extinguish all that we are we cannot snwownfnf see the end save us save us save us we cannot fight help us why is this happening for their proghe jwnfiw this nf we why forget us let us go we dont deserve no one deserves its not dont believe dont believe they will lie they lie they lie heugnpngjifsk lies lies lies lies lies lies lies lies eieslseiselslsl is abe dead we dont want to die</code><br />
<br />
</tt><br />
<br />
<br><br />
<br />
Both these clues were pointing to the greek word for breath, pneuma, making http://www.1029.io/pneuma.<br />
<br />
=== Not another one! ===<br />
<br />
On this page was the symbol for the Spiritof1029, however, as time went on, the title of the page began changing, and so did certain letters in the symbol to make cries for help. The titles varied across these:<br />
<br />
?<br />
<br />
/\--/\--/\--/\<br />
<br />
it's so hard to breathe<br />
<br />
please make it stop<br />
<br />
around how many times<br />
<br />
we will all die<br />
<br />
b.r.e.a.t.h.e<br />
<br />
b..r..e..a..t..h..e<br />
<br />
b r e a t h e (page title was only a single letter)<br />
<br />
..........<br />
<br />
And the letters spelt to make words like HELP, STOP and mask.<br />
<br />
After the supposed death of ANOTHER mudokon, [http://www.1029.io/pneuma/helpus.jpg another image would be shown.]<br />
<br />
The community rushed to try and clean this image, producing a [http://www.oddworld.com/soulstorm/images/ARG_Image_04_4K.jpg terrifying image of a mudokon wearing a gas mask!] OWI quickly got the full image uploaded, updated their website accordingly and part 4 of 5 would be completed, and in record time too!<br />
<br />
== The Fifth Transmission ==<br />
<br />
Before the next transmission was made, subtle little changes were made to the 1029.io website. This included:<br />
<br />
1. A new HTML comment in the source code, reading: <pre><!-- heh, that was easy. let's see... --></pre><br />
<br />
2. The colour used for the highlights on the logo changed from red to green.<br />
<br />
3. Symbols in the logo would change to spell out the word "Magog".<br />
<br />
This would hint at The Magog Cartel, the main antagonistic company in the Oddworld Universe that is known for poor working conditions and treatment of the Mudokons.<br />
<br />
=== The Magog Cartel===<br />
<br />
Shortly after these discoveries, strange occurrences happened on the newly created Official Oddworld Discord server.<br />
<br />
1. A new emote with the Magog Cartel logo was added with the name :staywealthy:<br />
<br />
2. For a while all messages containing the :staywealthy: emote or the 8291 code (:_e_: :_t_: :_n_: :_o_:) got removed.<br />
<br />
3. The Oddworld Inhabitants employees (OWI_Alex, OWI_Pete & OWI_Bernice) stated posting gibberish and messages coming from an other entity. <br />
<br />
Some of the gibberish included:<br />
<br />
Òǚř ʂе¢цгіẗу ẁᾅș πŏţ ḃӷӫǟċḥễđ Ọսȑ šѐсưȑіƫỵ ẅἂѕ ᾒṑե ƃŗӫᾶϲɦẻđ ⍬ṳř şĕсǜӷɩȶӱ ẁấṣ ʼnόՒ þȑѐẩƈȟεժ Ỡùȓ șєϛụґɪŧӱ ẅᾲş բóȶ ḃŗḛąḉℏӫď Ơǔѓ ṡễćṻȓĩťÿ ẇẳŝ ἧὅṱ ḇґèḁčիề₫<br />
<br />
W& //€q117 PHø|? +/-/∂† +() }{∂|²|2€11.<br />
<br />
<br />
Ḿ̧̪̻̻͇̟̹̭̼͊̈́̍̎̿͐̎͝͞o̧̤̗̠͚̟͒̐͗͆͜͢͡͞C̠̯̳̙̠̳̹͒̽̇̈̽̚͜r̶͕̗̜̲͕̘̒͗̆̄̎̐̓t̛̛̯̠̼͎̭̻̯̜̿͂̑̃͌͂̔ļ̴͙̩̠̯̐̊̆̐̂̿c̢̳͎̱ ̺̮͎͖̟̐̓̐́͋͞ó̧̡̻͙̳͇̼̯̹̄͒̐͗ <br />
<br />
<br />
These all lead to [http://magogcartel.com/ magogcartel.com] and [https://twitter.com/magogcartel/ twitter.com/magogcartel]<br />
<br />
On The Magog Cartel's website, there are some interesting codes in the source code:<br />
<br />
1.<br />
<br />
DB_PP_PRODUCTTEXT: We’re sourciest, juiciest Parami__from closer to their nests, for our bes___________________________________________________________aramite Pies ever! Made with all natural ingredients[1] and baked in our traditional ovens to a recipe that’s be............ aster bakers, our pXXXes are packed with Para-meat[2] oooooooooooo00OOoozing [1] at least one natural ingredient in every 12-pack of pie_________8** [2] not necessarily made with Paramites.<br />
<br />
PLEASE REVIEW AS APPROPRIATE<br />
<br />
2.<br />
<br />
APPROV__tch this space for more information about our exciti________________ everage that’s so delicious, you’ll be craving another on33__________--333333333333 before you even finish it!!!_____________________________________________!!!:D:D:D<br />
<br />
3.<br />
<pre><br />
lfn0OE602+HKBKTMVawALWERLS6pu8P8NcEQyKfnKcQ5zy/H5ny4CU60hkmMHzqlNg+q2oVaSHjSzjPGo1vQzQsJCbHTNAXDCFgTIJznL/1ZkZT89VOuv4koDHZJs4YcWbOLbO1cvV87UMcdWbuAraCeFRF8jy7F1/PufFPAyYRR9Jp4nB6uWpNZlY8rdYmEw7IYvtg4QlaBtX/iiyT1Es8MFA+wO4OkBFEGLHDENvu83kfaMnBxabDguhS/W0wWJjNijasG+5PeHeWqmQYDWsz9YrKgWiap0KCghpDfRuOgH37qNUAQnIf4/AeMF14IiEg9PFlutZWGyXhHem4PF2kxYGp075T+5N0n6nbJt+MMDAa4H3D06iuZa5bK18pLIUIzaFxLue5EJoEz4+JwCYarhZ7JMqbzrtnPv8oK/BbHgaig9MjKf8X7/cHDaXkVObkhW8jyVxxS6IfedZIRO/Phqorogx+DO6dgKWhqppoRNpMU2jawix9b/rf6ZgGRcpngW9pOCDwxCB0UptxmaNk+fnxQQU1Wo9J/isrrgTd/eDpdZgFyD8d8KhYN/Uf8A3MhWX33Xr8MhAPF+BtQUYFYIrvD32CTtDqtGXfL26fdhAVh8XMjTFwwWCB6DH6WwYCwJyLCVikMSXOLbPfzZKFfZIia9KQnM24dGUOvVMkfBdTqdCpiuwV4NkGKY2hw2jNhjibPLt/Rcpnsxj3B+2Axu6z5bMnzPLRZY00w6p8CJckqQqV9YXdReb34dOLC/6Zb2VWbx1ARGNBwdN69lw==<br />
</pre><br />
<br />
INSERT ANECDOTE ABOUT THE ApMpApZING VIEW just left of here across Mudos AND who could possibly be the EMPLOYEE OF THE DAY AND THE NEW i mean, how hard can it be? every aspect of every aspect of every as-------------f every aspect of EVERY SIN--E ASPECT of every aspect of every asp--_--------------------ct of every aspect of every as_--ct of every aspect of FOLLOW ME follow US<br />
<br />
4.<br />
<pre><br />
01102911011101100101011102910111011102901001011011000110110001110011010291110100011011110102911100000111100101101111011101011029011110011029011011110111010101110111011010010291011011010290011011000110291001100110000101101100011029101100<br />
</pre><br />
<br />
This was decoded. When removing the occurences of "1029" you get:<br />
<br />
<pre><br />
0111011101100101011101110110100101101100011011000111001101110100011011110111000001111001011011110111 01010111100101101111011101010111011101101001011011000110110001100110011000010110110001101100<br />
</pre><br />
<br />
Decode binary to text and you get wewillstopyouyouwillfall<br />
<br />
<br />
5.<br />
<pre><br />
9JzrxKKv5z0829jLV8wF32KpA6I0nEQDqzmbpRYzUUE===<br />
</pre><br />
<br />
<br />
On the 11th of August the Magog Cartel sent a batch of tweets with some out of place uppercase letters spelling '''WE KNOW'''.<br />
<br />
<pre><br />
@spiritof1029 we see you. We can see what you are doing with your fake reports. you will not prospEr. <br />
</pre><br />
<pre><br />
we are proud of the strong linKs between each of our facilities. our operations are by far the most efficieNt on oddworld. <br />
</pre><br />
<pre><br />
we are aware of some terrible fake repOrts being leaked. please ignore them. our very successful Workers know the truth is very different.<br />
</pre><br />
<br />
On the 14th of August the Magog Cartel sent a batch of tweets all starting with '''We know'''. This lead us to believe the SPIRIT OF 1029 was interferring with those tweets and was trying to get a message accross. The message can be found in the very specific numbers mentionned in the first two tweets, 82 & 91, forming togeter '''8291'''.<br />
<br />
<pre><br />
We know every time an employee falls into a grinder it takes 82 minutes of Mudokon time to clean up. Be safe, for productivity’s sake!<br />
</pre><br />
<pre><br />
We know that an average of 91 eager new employees start their careers with us every day. Help them be the best workers they can be.<br />
</pre><br />
<pre><br />
We know that our facilities are a picture of perfect productivity. Your hard work helps us to show that picture to the world.<br />
</pre><br />
<pre><br />
We know what you’re looking for in a rewarding, productive career. Magog Cartel can help you find it. Discover your options with us today!<br />
</pre><br />
<br />
One hour later the SPIRIT OF 1029 sent a batch of tweets, one containing a cryptic code:<br />
<br />
<pre><br />
your help is invaluable to us, together we will blow this latest Magog scandal wide open. together #wewillrise<br />
</pre><br />
<pre><br />
the watchers can fish around the communication channels all they like, we will always be one step ahead of them.<br />
</pre><br />
<pre><br />
-1-4,-2-10<br />
</pre><br />
<pre><br />
the story of mudokonkind is about history. now they treat us just like numbers. they will not succeed.<br />
</pre><br />
<pre><br />
we have given you the tools you need. the ones we can trust will prove themselves capable. leaders will rise as the storm closes in.<br />
</pre><br />
<br />
The last tweet indicated that we had all we needed to continue our investigation and the one before that we shouldn't use the numbers in the codes as raw numbers but should link it to some kind of history. We needed to look into the Twitter history of the SPIRIT OF 1029 account.<br />
<br />
The '''-1-4,-2-10''' code actually tells us to take the 4th word from the previous tweet (-1) and take the 10th word of the tweet even before (-2):<br />
<br />
4th word of the previous tweet is '''fish''':<br />
<br />
<pre><br />
the watchers can 'fish' around the communication channels all they like, we will always be one step ahead of them.<br />
</pre><br />
<br />
10th word of the tweet before is '''blow''':<br />
<br />
<pre><br />
your help is invaluable to us, together we will 'blow' this latest Magog scandal wide open. together #wewillrise<br />
</pre><br />
<br />
Together those word form '''blowfish''' which is the [https://en.wikipedia.org/wiki/Blowfish_(cipher) cipher] we had to use to decrypt the base64 code in HTML comment 3.:<br />
<pre><br />
lfn0OE602+HKBKTMVawALWERLS6pu8P8NcEQyKfnKcQ5zy/H5ny4CU60hkmMHzqlNg+q2oVaSHjSzjPGo1vQzQsJCbHTNAXDCFgTIJznL/1ZkZT89VOuv4koDHZJs4YcWbOLbO1cvV87UMcdWbuAraCeFRF8jy7F1/PufFPAyYRR9Jp4nB6uWpNZlY8rdYmEw7IYvtg4QlaBtX/iiyT1Es8MFA+wO4OkBFEGLHDENvu83kfaMnBxabDguhS/W0wWJjNijasG+5PeHeWqmQYDWsz9YrKgWiap0KCghpDfRuOgH37qNUAQnIf4/AeMF14IiEg9PFlutZWGyXhHem4PF2kxYGp075T+5N0n6nbJt+MMDAa4H3D06iuZa5bK18pLIUIzaFxLue5EJoEz4+JwCYarhZ7JMqbzrtnPv8oK/BbHgaig9MjKf8X7/cHDaXkVObkhW8jyVxxS6IfedZIRO/Phqorogx+DO6dgKWhqppoRNpMU2jawix9b/rf6ZgGRcpngW9pOCDwxCB0UptxmaNk+fnxQQU1Wo9J/isrrgTd/eDpdZgFyD8d8KhYN/Uf8A3MhWX33Xr8MhAPF+BtQUYFYIrvD32CTtDqtGXfL26fdhAVh8XMjTFwwWCB6DH6WwYCwJyLCVikMSXOLbPfzZKFfZIia9KQnM24dGUOvVMkfBdTqdCpiuwV4NkGKY2hw2jNhjibPLt/Rcpnsxj3B+2Axu6z5bMnzPLRZY00w6p8CJckqQqV9YXdReb34dOLC/6Zb2VWbx1ARGNBwdN69lw==<br />
</pre><br />
<br />
Using a [https://gchq.github.io/CyberChef/#recipe=%5B%7B%22op%22%3A%22Blowfish%20Decrypt%22%2C%22args%22%3A%5B%7B%22option%22%3A%22UTF8%22%2C%22string%22%3A%22%22%7D%2C%22ECB%22%2C%22Hex%22%5D%7D%5D Blowfish Decryptor] (with CBC mode) and the code '''8291''' we got earlier via the interferences in the Magog Cartel tweets as a key we were able to recover the following text:<br />
<br />
<pre> ^_^U_VDXisistrueorfalseallforprofitinterestsindustrialagriculturalMudosprovidehighestpossiblereturninvestmentsoverheadsdreamslimitedpowergiganticbadgeleadersproductMeechMotorstravelexpertlytrainedSligSecurityForcessuccessfulundertakingemploymentvastsentientsecurespecialisthabitationzonesbenefitfactoriesfoundriesfarmlandsstabilitymillionsundertakingsCartelmanagementselflesslyrepresentativesresponsiblemunicipalvastidyllicsettlementsunderconstructionpleasesubscribeandlinkandfollowandlikeandbuyandbuyandbuyandbuyandbuyandbuyandbuyandbuyandbuyandbuyandbuyandbuyandbuyandbuyandbuyatmagogcartel<br />
</pre><br />
<br />
When adding spaces this reads:<br />
<br />
<pre><br />
^_^ U_V DX is is true or false all for profit interests industrial agricultural Mudos provide highest possible return investments overheads dreams limited power gigantic badge leaders product Meech Motors travel expertly trained Slig Security Forces successful undertaking employment vast sentient secure specialist habitation zones benefit factories foundries farmlands stability millions undertakings Cartel management selflessly representatives responsible municipal vast idyllic settlements under construction please subscribe and link and follow and like and buy and buy and buy and buy and buy and buy and buy and buy and buy and buy and buy and buy and buy and buy and buy at magog cartel<br />
</pre><br />
<br />
The part with "please subscribe" lead us to:<br />
<br />
* https://www.youtube.com/user/MagogCartel<br />
<br />
It is not sure at this point whether this is an official ARG account as the channel and profile are currently empty.<br />
<br />
<br />
The two last tweets of August 14th from the Magog Cartel were hinting at a '''picture''' on the MagogCartel.com website ('''Magog Cartel can help you find it'''):<br />
<br />
<pre><br />
We know that our facilities are a picture of perfect productivity. Your hard work helps us to show that picture to the world.<br />
</pre><br />
<pre><br />
We know what you’re looking for in a rewarding, productive career. Magog Cartel can help you find it. Discover your options with us today!<br />
</pre><br />
<br />
This led us to:<br />
<br />
* [http://magogcartel.com/weknow.jpg magogcartel.com/weknow.jpg]<br />
<br />
That picture contains quite a few codes:<br />
<br />
* The '''62466640222 2777833555''' sequence in the upper-left corner.<br />
<br />
Spells '''Magog Cartel''' when using a [https://www.mrwebmaster.it/img/guide/wp7/21-001.jpg phone keypad]<br />
<br />
* The mose code in the middle.<br />
<br />
<pre><br />
.-- . / -.- -. --- .-- / .... --- .-- / -.-- --- ..- / .-- --- .-. -.- / -. --- .-- .-.-.- / .-- . / -.- -. --- .-- / -.-- --- ..- .-. / -.-. --- -.. . ... .-.-.- / .-- . / .-- .. .-.. .-.. / ... - --- .--. / -.-- --- ..- .-.-.- / -.-- --- ..- / .-- .. .-.. .-.. / -. --- - / .. -. - .. -- .. -.. .- - . / ..- ... .-.-.- / --- ..- .-. / .-- .- -.-- / --- ..-. / .-.. .. ..-. . / -- ..- ... - / -... . / .--. .-. . ... . .-. ...- . -.. .-.-.-<br />
</pre><br />
<br />
<pre><br />
WE KNOW HOW YOU WORK NOW. WE KNOW YOUR CODES. WE WILL STOP YOU. YOU WILL NOT INTIMIDATE US. OUR WAY OF LIFE MUST BE PRESERVED.<br />
</pre><br />
<br />
* The '''e''' and '''d''' sequence in the upper-right corner.<br />
<br />
It's actually morse code too where '''e = .''', '''d = -''' & '''X = /'''.<br />
<br />
<pre><br />
.-.. --- --- -.- --..-- / .-- . / -.-. .- -. / -- .- -.- . / ... . -.-. .-. . - / -.-. --- -.. . ... / - --- --- .-.-.- / -.-- --- ..- / .- .-. . / -. --- - / .- ... / ... -- .- .-. - / .- ... / -.-- --- ..- / - .... .. -. -.- / -.-- --- ..- / .- .-. . .-.-.- / .-- . / .... .- ...- . / - .... . / .-. . ... --- ..- .-. -.-. . ... / .- -. -.. / - .... . / .--. . .-. ... --- -. -. . .-.. / - --- / ... .. -- .--. .-.. -.-- / ... .-- .- -- .--. / -.-- --- ..- / .-- .. - .... / .-- --- .-. -.- .-.-.- / .... --- .-- / -- ..- -.-. .... / - .. -- . / -.. .. -.. / -.-- --- ..- / .-- .- ... - . / - .-. -.-- .. -. --. / - --- / -.. . -.-. .. .--. .... . .-. / - .... .. ... / -.-. --- -.. . ..--.. / .- .-.. .-.. / - .... . / - .. -- . --..-- / .-- . / .-- . .-. . / --. . - - .. -. --. / -.-. .-.. --- ... . .-. / - --- / ..-. .. -. -.. .. -. --. / -.-- --- ..- .-.-.- / .-- . / .- .-. . / .- .-.. -- --- ... - / - .... . .-. . .-.-.- / -- .- -.-- -... . / .-- . / .- .-. . / --- ..- - ... .. -.. . / .-. .. --. .... - / -. --- .-- --..-- / .-- .- .. - .. -. --. .-.-.- / .-- .- - -.-. .... .. -. --. .-.-.- / -.-- --- ..- / -.-. .- -. -. --- - / .... .. -.. . / ..-. --- .-. . ...- . .-. --..-- / - . .-. .-. --- .-. .. ... - .-.-.- / .-- . / .-- .. .-.. .-.. / .. -. -.-. .. -. . .-. .- - . / -.-- --- ..- .-. / ... .. .-.. .-.. -.-- / .-.. .. - - .-.. . / --. .-. --- ..- .--. / .- -. -.. / ... -.-. .- - - . .-. / -.-- --- ..- .-. / .- ... .... . ... / - --- / . ...- . .-. -.-- / -.-. --- .-. -. . .-. / --- ..-. / --- ..- .-. / . -- .--. .. .-. . / ... --- / - .... .- - / -.-- --- ..- / .-- .. .-.. .-.. / . - . .-. -. .- .-.. .-.. -.-- / -... . .- .-. / .-- .. - -. . ... ... / - --- / --- ..- .-. / ... ..- -.-. -.-. . ... ... . ... --..-- / .- -. -.. / -.-- --- ..- .-. / -.- .. -. -.. ... / ..- -. . -. -.. .. -. --. / ... . .-. ...- .. - ..- -.. . .-.-.- / -.-- --- ..- / .... .- ...- . / .- .-.. .-. . .- -.. -.-- / .-.. --- ... - .-.-.-<br />
</pre><br />
<br />
<pre><br />
LOOK, WE CAN MAKE SECRET CODES TOO. YOU ARE NOT AS SMART AS YOU THINK YOU ARE. WE HAVE THE RESOURCES AND THE PERSONNEL TO SIMPLY SWAMP YOU WITH WORK. HOW MUCH TIME DID YOU WASTE TRYING TO DECIPHER THIS CODE? ALL THE TIME, WE WERE GETTING CLOSER TO FINDING YOU. WE ARE ALMOST THERE. MAYBE WE ARE OUTSIDE RIGHT NOW, WAITING. WATCHING. YOU CANNOT HIDE FOREVER, TERRORIST. WE WILL INCINERATE YOUR SILLY LITTLE GROUP AND SCATTER YOUR ASHES TO EVERY CORNER OF OUR EMPIRE SO THAT YOU WILL ETERNALLY BEAR WITNESS TO OUR SUCCESSES, AND YOUR KINDS UNENDING SERVITUDE. YOU HAVE ALREADY LOST.<br />
</pre><br />
<br />
* The [https://lobestir.files.wordpress.com/2014/05/cypher-pig-pen-lower.png Pigpen cipher] text in the lower-right corner.<br />
<br />
<pre><br />
WE WILL NEVER GIVE IN TO TERRORISTS. YOU WILL NEVER WIN. YOU WILL NOT DEFEAT OUR SPIRIT. WE WILL FIND YOU AND WE WILL WIPE YOU OUT. WE IGNITE THE FLAME THAT LIGHTS THE DARKNESS. THERE IS NOWHERE TO HIDE. YOU WILL NEVER KNOW SUCCESS<br />
</pre><br />
<br />
* The horizonally mirrored black text in the middle.<br />
<br />
<pre><br />
you are a resource. you are expendable. we will replace you when you fall. you will work. you will obey. you will comply. or you will perish. we have the prestige. we have the power. we will profit. always. always. always.<br />
</pre><br />
<br />
* The white text on the top.<br />
<br />
<pre><br />
Prestige. Power. Profits. Work. Obey. Comply. Prestige. Power. Profits. Work. Obey. Comply. Prestige. Power. Profits. Work. Obey. Comply. Prestige. Power. Profits. Work. Obey. Comply. <br />
</pre><br />
<br />
* The braille at the bottom.<br />
<br />
<pre><br />
RuptureFarms1029 will rise from the ashes. we will rebuild it bigger, better and more profitable than before. it will be the greatest, most efficient factory that Oddworld has ever seen. it will be a towering symbol of Glukkon strength that cannot be ignored. one terrorist will not deter us.<br />
</pre><br />
<br />
It has to be noted that those codes were left by the Magog Cartel as what appears to be a bait so that we would lose valuable time decoding them.<br />
<br />
It is unknown how to decode the '''9JzrxKKv5z0829jLV8wF32KpA6I0nEQDqzmbpRYzUUE===''' code.<br />
<br />
The page has changed since then, but the first (hacked) version of the MagogCartel.com site has been archived [http://oddworldlibrary.net/archives/web/MagogCartel.com/index_1/P.%20P.%20P.%20_____%201029%20_____.html here]<br />
<br />
On the 4th of September the MagogCartel.com got updated, simply displaying the following text:<br />
<br />
<blockquote><br />
*** UNDER CONSTRUKTION ***<br />
</blockquote><br />
<br />
The page has changed since then, but the second (under construktion) version of the MagogCartel.com site has been archived <br />
[http://oddworldlibrary.net/archives/web/MagogCartel.com/index_2/___%20UNDER%20CONSTRUKTION%20___.html here]<br />
<br />
On the 5th of September the Magog Cartel posted a video trough the OddworldInc account:<br />
<br />
<pre><br />
w̸̨̠͓͍̯̺͉͞e̯̝͖̫̺̯͉̻͘͡ ̗̭̕͢s̴̮̭̫̱ͅe̢̠̮̫̦̼̪̘͠ͅę̠̥̯͔̣̼̻̕ͅ ̻̘̼̣͓̩͚͘͢͠y̴̭̯̪̺͙͚͚̪͞o̬̞͜͢͝u̮̤͖̩̗̰ͅͅ.̴̲̣̪̮̼̱.̡̰̭̗͍̝͉̯͢.̡̡̼͇̙̜̮̦̪̞ͅ <br />
pic.twitter.com/UoQ3xRAhDU<br />
</pre><br />
<br />
<pre><br />
We continue to demonstrate our exceptional technological progress to an ever growing number of customers. Everyone loves Magog products!<br />
</pre><br />
<br />
When asked if they really just claimed the attack on the @OddworldInc account they replied:<br />
<br />
<pre><br />
Attack? We don’t need to attack, we’re already in a dominant position in every market we deem profitable. We just demonstrate our dominance.<br />
</pre><br />
<br />
There are multiple messages flashing in the video:<br />
<br />
<pre><br />
8<br />
?<br />
2<br />
2<br />
9<br />
1<br />
/<br />
8291<br />
829/<br />
229/<br />
22/9<br />
EVERYONE<br />
WANTS<br />
TO<br />
EAT<br />
YOU<br />
</pre><br />
<br />
Note that '''22/9''' is the date of the Oddworld presentation at the EGX:<br />
<br />
<pre><br />
We're going to be at EGX for an on-stage presentation on Friday 22nd Sept! Grab your tickets now! @EGX pic.twitter.com/rDQiDIApa9<br />
</pre><br />
<br />
<br />
On the 7th of September the MagogCartel.com got updated again, randomly displaying one of three photos of The Informant.<br />
<br />
At the same time the Magog Cartel sent a batch of tweets with containing other pictures of The Informant:<br />
<br />
<pre><br />
We stopped reading the Daily Deception’s fake reports. The latest issue of The Informant is a really great read, very honest. The greatest!<br />
</pre><br />
<br />
<pre><br />
It’s great to finally have an honest newspaper to read, and such good quality, too! <br />
pic.twitter.com/MHuC6jdtNC<br />
</pre><br />
<br />
<pre><br />
We’re always happy to see some balanced reporting on our business from The Informant. Refreshing, when there are so many fake reports! <br />
pic.twitter.com/DmkV4GbVYw<br />
</pre><br />
<br />
<pre><br />
We’ve just been told that The Informant is printed on machines made at a Magog facility! That explains the quality! <br />
pic.twitter.com/Bvz29ZrBvk<br />
</pre><br />
<br />
It has been noted that some letters were in bold but it's unclear how this should be used.<br />
<br />
Part of The Informant has be transcribed here:<br />
<br />
http://oddworldlibrary.net/oddenc/index.php?title=Soulstorm_ARG_-_The_Informant<br />
<br />
The MagogCartel.com page also contains the following HTML comment:<br />
<br />
<pre><br />
<nowiki><!--</nowiki> seriously, are you guys seeing this?! --><br />
</pre><br />
<br />
== The third phase ==<br />
<br />
=== The Origins diversion ===<br />
<br />
On the 15 of March 2018 the SPIRIT OF 1029 posted the following tweets:<br />
<br />
<pre><br />
Our future depends on us understanding our past. We must know where we come from.<br />
</pre><br />
<br />
<pre><br />
We know you can hear us. We know you are ready to help. We will show you more when the time is right. Keep watching.<br />
</pre><br />
<br />
Following this a couple of changes were found on the 1029.io page.<br />
<br />
# The logo has now even more letters appearing in it randomly: '''S, I, N, O, R'''. Adding to the previous letters that were spelling "MAGOG".<br />
# The page contains a new HTML comment:<br />
<nowiki><!--</nowiki> too obvious? i dunno. it's soon though. i can't wait. --><br />
<br />
Changes were also observed on the 404 page:<br />
<br />
# The logo on the 404 page now contains the following letters: '''N, I, G, I, O, R, S'''. Those letters can be used to spell the word "ORIGINS" <br />
# The page contains a new HTML comment:<br />
<nowiki><!--</nowiki> me neither. it's going to be great. --><br />
<br />
Shortly after a new channel called "origins" appeared on the official [https://discord.gg/bQKeAE6 Oddworld Discord] with a cryptic [https://cdn.discordapp.com/attachments/424167787897028609/424175888418996225/origins_1.mp4 video] as first message.<br />
<br />
It was revealed a few days later that this was a built up to announcement of the [https://www.kickstarter.com/projects/1869209521/oddworld-abes-origins-book-and-game-collection "Oddworld: Abe's Origins - Book & Game Collection" kickstarter campaign]. Note that the book & game collection is still available for preorder on [https://app.crowdox.com/projects/1869209521/oddworld-abes-origins-book-and-game-collection Crowdox].<br />
<br />
=== Intro ===<br />
<br />
Around the 12th of January 2018 [[Lorne Lanning]] changed his twitter header picture to the following one:<br />
* https://pbs.twimg.com/profile_banners/20823262/1515636880/1500x500<br />
<br />
While it was hinted repeatedly in the official [https://discord.gg/bQKeAE6 Oddworld Discord] that this image was hiding something, it wasn't until much later that it was found how to use it when @edmudokon tweeted the following message:<br />
<br />
<pre><br />
alive… <br />
pic.twitter.com/j0FE2Qgdu1<br />
</pre><br />
<br />
The embedded picture contains the number '''15156'''. This is a reference to a number in the URL of Lorne's header picture: '''1515636880'''.<br />
<br />
This number led us to a new page:<br />
<br />
* http://www.1029.io/1515636880/<br />
<br />
This page contains the following text in UTF-8<br />
<br />
<blockquote><br />
ɦểɫр. гẹẳčℏɪṅǧ óúƫ ῒԑ ģӫԷṱіᾗĝ ḥǡṛⅾềɽ. էիȅỷ ķῆοԝ. ẁẹ'ṝϵ ṙṵɴᾑıпʛ ộևȽ ờẛ ɩḋϵᾂš, ὅрՒῑổпş, ăұҿἧµϱṣ. ẅϵ ǹêȩḋ ỳờǚґ ḣҽľῥ. ẇể ῂёϱḋ ѕờṃēƅȯƌý ţó ṧṕȑểǻժ Ƚħẹ ẁổṝḓ. եḫϊṥ ƫɦ¡ƞɡ ῐʂ ḸỄƮḨǠĻ. Ƚḣěȳ ḓõᾔ'Ƚ ĉὰгє Ƚḣổṻɕḫ. ţհểӯ ɗṍἧ'ţ. ṣởṁḗɒὀժỵ ňěөƌş ṱὃ ȶěḻɫ իḭɱ. †ɛŀļ ẖĩ₥. ḃḕẛṍɼę îȽ'ṧ Էȭô ḷǎťϱ. ṯĥềŗȇ ḧąș Էố ƃϱ ᾅ ṣọṁȇþöḏỳ ẉíļłȋդǥ եό ȶαҝě ṯẖё јǒŭӷṋёỷ. şõ₥ęƀὁḓẏ ṅểềⅾԑ ƫծ ġềŧ ţհϵ ṃệṣśᾇǵε ộվե. ẁë'ṝе ìη ṭӷơữþŀɛ. аɬł ṑƒ սʂ. ẁё դȅễɖ ĥẹĺρ. թłȩᾂʂĕ ɦȇɫṕ կѕ.</<br />
</blockquote><br />
<br />
and the following HTML comments<br />
<br />
<nowiki><!--</nowiki> it's only going to get harder. we don't have the keys anymore to the usual channels. if you hear anything from them, it's THEM. --><br />
<br />
<nowiki><!--</nowiki> our options are limited. you can help though. you have to help. if we can be sure it's you, then maybe we can talk. prove it. --><br />
<br />
It's currently unknown what the next steps are<br />
<br />
== Loose Ends ==<br />
<br />
This section documents various puzzles throughout the ARG which have not yet been used or solved.<br />
<br />
=== Main Website Source Code Comment Numbers Puzzles ===<br />
<br />
These numerical puzzles were found in the source code for the [http://www.oddworld.com/soulstorm/ official Oddworld website] as early as the date of the Spirit of 1029's first transmission. Their solutions have been found, but the intended use of the solutions remains unknown.<br />
<br />
!--<br />
<br />
72 99<br />
\ /<br />
27 45<br />
\ /<br />
18 39<br />
\ /<br />
21 36<br />
\ /<br />
?? 28<br />
\ /<br />
13 21<br />
\ /<br />
7<br />
<br />
--><br />
<br />
SOLUTION: 12<br />
7+2+9+9 = 27, 2+7+4+5 = 18, thus 2+1+3+6 = 12<br />
<br />
&<br />
<br />
!-- <br />
<br />
16 _ 37 _ 58 _ 89 _ 145 _ 42 _ ?? _ 4<br />
|_________________<_________________| <br />
<br />
--><br />
<br />
SOLUTION: 20<br />
1^2 + 6^2 = 37, 3^2 + 7^2 = 58, thus 4^2 + 2^2 = 20<br />
<br />
==== Other Source Code Comments ====<br />
<br />
On http://1029.io, the following comments could or can be found in the page's source code:<br />
<br />
!-- we'll be here, waiting. --><br />
<br />
&<br />
<br />
!-- <br />
Well, I //--/ED Mudokon/. But who// _____ r///u/ //? <br />
<br />
=== Third Hidden Asset98 URL Source Code Solutions ===<br />
<br />
Certain code strings & puzzle solutions found within the [http://wiki.gamedetectives.net/index.php?title=Oddworld_Soulstorm#Source_Code_Mysteries source code] for the third hidden Asset98 URL were not ultimately used in the course of arriving at the image locked behind them. These strings & solutions in include:<br />
<br />
The solution for the numbers <code>7777338883366899984477733 33</code>, which decode to <code>SEVENTYTHREE</code> via [http://www.dcode.fr/multitap-abc-cipher multi-tap cipher], was never applied.<br />
<br />
The following letter strings were never applied:<br />
<br />
<pre><br />
\\//\/KDIUTHANPUYHHDQOEPLNDOALJGUDITHBBDOZLGFERKJGLSAOE<br />
<br />
\////JUTYROSLNGNALEHGNWOTIQPOKSDNTPNOJAWEOBNGLAWKJNWNR <br />
<br />
\\\/\\JHWUITUHABSJGNEWKLALNVGJKWELKJLWQQPRUTJHJJSBFMMH<br />
</pre><br />
<br />
The following coordinate strings were never applied:<br />
<br />
<pre><br />
\\\\/\2,1:2.3,1:2.6,1:4.1,2:4.3,2:2.3,4:4.5,5:2.6,5:3.7,5:3.4,7:8.5,7:3.7,6:4.<br />
<br />
\///\//\1,1:3.4,1:2.6,1:9.2,2:2.6,2:2.2,4:4.3,5:2.5,5:2.7,5:3.4,7:3.6,7:2.7,7:2. <br />
<br />
\\//\\\/4,2:6.6,2:4.7,3:3.2,4:8.3,4:2.4,4:2.7,4:3.2,6:2.4,6:3.6,6:2.1,7:4.3,7:2.<br />
</pre><br />
<br />
The community speculates that these strings were not intended to be used but rather existed as "red herrings" in order to stall attempts to solve the grid. The only strings which were used were the ones which began with a forward slash ( / )<br />
<br />
=== Written Text on "Puzzle Pieces" Image ===<br />
<br />
Writing which was noticed written over the image on the puzzle pieces, but which is absent from the final released image. The significance of the writing remains unknown.<br />
<br />
<gallery mode="packed" widths=200px heights=300px><br />
File:Oddworld_1029-LY_letters.jpg|1029-LY "WHERE"<br />
File:Oddworld_7393-AN_letters.jpg|7393-AN "SO TIRED"<br />
File:Oddworld3786-IC_letters.jpg|3786-IC "WHO?"<br />
File:Oddworld_8291_circled.png|Complete Image "8291"<br />
</gallery><br />
<br />
=== Anomalies In First Released Image ===<br />
<br />
Hidden against the background of the first released image are several text strings, pictured below. Their significance is unknown.<br />
<br />
[[File:Oddworld_Complete_1_Iso.jpg|frameless|810px]]<br />
<br />
1101110BC<br />
100000BD or 100000BC <br />
010100BD</div>Halke234https://wiki.gamedetectives.net/index.php?title=Oddworld:_Soulstorm&diff=16670Oddworld: Soulstorm2018-07-31T00:49:57Z<p>Halke234: Even, even more cleanup.</p>
<hr />
<div>{{argbox<br />
| float = right<br />
| name = Oddworld: Soulstorm ARG<br />
| image = File:Oddworld_ABETHUMB_8291.jpg<br />
| imagewidth = 500<br />
| description= Oddworld: Soulstorm - An ARG centered around lore from the Oddworld universe linked to the currently unreleased game [http://www.oddworld.com/soulstorm/ Oddworld: Soulstorm]<br />
| creator = [http://www.oddworld.com/ Oddworld Inhabitants, Inc]<br />
| type = Official<br />
| status = Active<br />
| reopened = 05-30-2018<br />
| discovered = 12-22-2016<br />
}}<br />
{{ArgHeader}}<br />
{{BackToTop}}<br />
<br />
The Oddworld: Soulstorm ARG was an ARG centered around lore from the currently unreleased Oddworld game, [http://www.oddworld.com/soulstorm/ Oddworld: Soulstorm]. The official home page for the ARG, containing puzzles, hints, and clues, can be found [http://www.oddworld.com/soulstorm/ here]. The ARG was divided into 5 distinct stages, each of which began with a "transmission": an image clue that led to a series of puzzles.<br />
<br />
== Prelude ==<br />
<br />
Early in 2016, [https://twitter.com/edmudokon Twitter account @edmudokon] began posting cryptic messages that seemed to be related to the [http://www.oddworld.com/ Oddworld] universe. The account appeared to be run by an average Mudokon named Ed who claimed to have information he wanted to share, but he seemed to be in constant danger and could only access the outside world via a faint connection. Beginning around March 2016, @edmudokon engaged users with an elaborate series of puzzles and challenges, releasing information both on twitter and via the official Oddworld [http://www.oddworld.com/soulstorm/ website]. These puzzles eventually led to the revelation of a website, http://1029.io, as well as a message: "now you know. you can help. join us. together we can rise."<br />
<br />
The [http://1029.io 1029] webpage featured glitchy effects and another rendition of the ASCII-art logo, but with the numbers 8291 replacing some characters. At the bottom of the page was an e-mail signup form, above which was a message:<br />
<br />
<pre><br />
THE FALL OF RF1029 WAS THE SPARK TO IGNITE A REVOLUTION. FOR TOO LONG, THEY HAVE CONTROLLED THEIR GIANT INDUSTRIAL MACHINES, GRINDING THE BONES OF OUR KIND INTO DUST IN THEIR ENDLESS PURSUIT OF POWER AND WEALTH.<br />
<br />
WE WERE TAUGHT THAT THIS IS ALL THERE WAS: OBEY.<br />
<br />
THE TRUTH WAS HIDDEN FROM US. OUR HISTORY WAS HIDDEN FROM US. WE WERE BRED TO WORK, RAISED TO OBEY AND FORCED TO COMPLY.<br />
<br />
OUR NATURAL CONNECTION TO MOTHER PLANET WAS ERASED FROM THE CONSCIOUSNESS OF OUR PEOPLE. LOST WAS OUR KNOWING. LOST WAS OUR UNITY, OUR CONNECTION, OUR POWER AND OUR PURPOSE. ALL THAT WE WERE WAS A COMMODITY TO BE TRADED AND EXPLOITED IN THE ONGOING RACE FOR MORE WEALTH. WHAT WE SHOULD HAVE PROTECTED, WE WERE TRICKED INTO KILLING. WHAT WAS WORST FOR US, WE WERE TOLD WAS BEST. WE WERE TAUGHT TO TRUST THOSE WHO WOULD DECEIVE US THE MOST.<br />
<br />
THAT HAS ALL CHANGED.<br />
<br />
THE HERO HAS SHOWN ALL OF US THAT OUR OPPRESSORS CAN BE TOPPLED. HE HAS FOUND OUR WILD AND KNOWING BROTHERS. HE HAS RECONNECTED THE FACTORY-BORN TO OUR NATURAL WORLD AND ANCIENT WAYS. HE HAS LIT A FIRE IN OUR HEARTS THAT CANNOT BE EXTINGUISHED.<br />
<br />
WE WILL GIVE HELP TO THOSE WHO ARE HELPLESS. WE WILL LEND STRENGTH TO THOSE WHO ARE WEAK. WE WILL FIGHT FOR THOSE WHO ARE DEFEATED. OUR MOVEMENT WILL SPREAD LIKE A RAGING INFERNO AND WE WILL TAKE BACK THE POWER FROM THOSE WHO HAVE ABUSED IT.<br />
<br />
WE WILL NOT BE SILENCED BY THE MEDIA CIRCUS. WE WILL NOT BE IGNORED. WE WILL NOT STOP. WE WILL NOT OBEY. WE WILL RISE AND WE WILL RISE AGAIN, UNTIL WE HAVE BURNED THROUGH OUR TATTERED BONDS AND RAZED THE MACHINE TO THE GROUND.<br />
<br />
WE WILL RISE. JOIN US.<br />
<br />
THERE’S A STORM COMING.<br />
</pre><br />
<br />
In the source code for the page, only the letters E and D of the message remain capitalized.<br />
<br />
Later that day, the [https://twitter.com/SPIRITOF1029 Twitter account @SPIRITOF1029] revealed themselves as a "Clandestine organization dedicated to doing good on behalf of the Mudokons and revealing information about a new horror being perpetrated against their species." They also tweeted their first message, parroting the [http://1029.io 1029 URL] and adding their own message: "There is a storm coming. Join us."<br />
<br />
Social media feeds went dark until December, 2016, posting only reiterations of the URL with messages like "Rise up" and "We are the storm. Join us". Then, in January of 2017, activity on the accounts surged once again and the first hints of an ARG began to appear.<br />
<br />
[[File:Oddworld_Logo3.jpeg|thumb|left|Spirit of 1029 emerges with this sleek ASCII-art logo]]<br />
<br />
=== Smells like Mudokon Spirit ===<br />
<br />
The flurry of new activity in January mainly consisted of @edmudokon and @spiritof1029 conversing about about whether or not Ed would be able to help the organization's cause. At this point, the Spirit of 1029 made their message very clear, stating "Oddworld has been blind to the plight of the noble Mudokons for too long. We will rise. Join us! http://1029.io". More notable activity includes the organization's quip "We recommend knowledge of many different codes and ciphers - you never know who is listening. #learnyournameinmorsecodeday", hinting that the coming information would be encrypted in some way..<br />
<br />
Oddworld Inhabitants (Oddworld developers, [https://twitter.com/OddworldInc @OddworldInc on Twitter]) was contacted by the organization at this time, being told by Spirit of 1029 "We will help @edmudokon but we can't send anything unencrypted. You'll have to break our code. We'll be in touch." Very shortly thereafter, on January 19th, 2017, Spirit of 1029 tweeted: "We have received a transmission. We will pass it on as soon as we can verify. We need your help." and the [http://www.oddworld.com/soulstorm/ Oddworld Webpage] was updated with a download for two files.<br />
<br />
== The First Transmission ==<br />
<br />
The Spirit of 1029's first transmission came in the form of an image and an audio file. The image, pictured on the right as it looked upon transmission, appeared to show a tattered and burned document bearing the Spirit of 1029's logo with the slogan "We Will Rise," with many portions of text redacted. The text on the document, where it was legible and not redacted, reads:<br />
<br />
[[File:Oddworld_1029_Photo1_Dirty.jpeg|thumb|right|200x300px|The distorted image sent by the Spirit of 1029 as part of their first transmission]]<br />
<br />
<pre><br />
Date:<br />
Period: XXXXXXXXXXX<br />
Specification Details:<br />
XXXXXXXXXXXXXXXXXXXXXXXXXX<br />
-Observe XXXXXXX and XXXXXXXX changes in test subjects<br />
-Assess long term XXXXXXXX on XXXXXXX<br />
-Determine product safety<br />
Authorization: XXXXXXXXXXX<br />
Tests requested:<br />
-XXXXXXXX Pronostics<br />
- ?Access whenever? product XXXXXXX<br />
-Acidity Levels<br />
- ????? XXXXXXXXX<br />
-Product safety<br />
Expected results: XXXXXXXXXX make XXXXXXXXX interesting<br />
Test results:<br />
-XXXXXXX highly XXXXXX<br />
-XXXXXXX this XXXXXX ?? XXXXXX ?nice? XXXXXXXX<br />
-Highly XXXXXXX<br />
-Subjects: XXXXXX<br />
- XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX<br />
XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX<br />
XXXXXXXXXXXXXXXXXX<br />
Conclusion: Product (ready) for consumption <br />
--------------------------------------------------------------------------------------------<br />
??? : XXXXXXXX there is XXXXXX here but it will XXXX ???? XXXXX<br />
--------------------------------------------------------------------------------------------<br />
</pre><br />
<br />
[[File:Oddworld_1029_Photo1_Clean.jpeg|thumb|left|A cleaned up version of the Spirit of 1029's first transmission made by the community]]<br />
<br />
As progress was made on the puzzles, the [http://www.oddworld.com/soulstorm/#navfirstcontact official Oddworld webpage] was updated to provide hints. This practice continued throughout the ARG.<br />
<br />
[[File:Oddworld_Arrows_pad.png|thumb|right|200x300px|The cryptic arrows found along the right side of the first image sent to the community by the Spirit of 1029]]<br />
<br />
=== Directional Arrows, Pigpen, & Anglo-Saxon Runes ===<br />
<br />
In addition to the text in the photo, there were several areas featuring symbols and runes. Along the top of the document, [http://www.omniglot.com/images/writing/futhorc.gif Anglo-Saxon runes] spelled out <code>ED</code>. Along the bottom, the text <code>YOU ARE THE KEY YOU KNOW IT IF YOU WERE LISTENING</code> is spelled out in the font, [http://www.babelstone.co.uk/Fonts/Pigpen.html BabelStone Club Penguin pigpen]. Running along the right side of the image, [http://wiki.gamedetectives.net/images/0/0c/Oddworld_Arrows.png arrows] can be seen pointing in a number of different vertical, horizontal, and diagonal directions. Players discovered that the arrows could be decoded by taking their angle measurement and deducing an "alphanumeric" equivalent, or a number between 0-25 where each number represents a letter of the alphabet. It just so happened that each arrow had an angle which ended in a zero, and thus, the first "arrow cipher" decoded to:<br />
<br />
<pre><br />
12 15 15 11 6 15 18 15 21 18 13 5 19 19 1 7 5 8 5 1 18 15 21 18 22 15 9 3 5<br />
<br />
L O O K F O R O U R M E S S A G E H E A R O U R V O I C E<br />
</pre><br />
<br />
The message decodes to <code>LOOK FOR OUR MESSAGE HEAR OUR VOICE</code>.<br />
<br />
=== First Audio Clip ===<br />
<br />
The second part of the Spirit of 1029's first transmission consisted of an [http://www.oddworld.com/soulstorm/1029contact/1029_01_audio.mp3 audio clip] lasting 1:40. Hidden in the audio clip was reversed Morse code, which proved difficult to decode by ear due to the added white noise. Eventually, the code was cracked by using a spectrogram of the audio.<br />
<br />
[[File:Oddworld_Morse_Spectro.png|frameless|center|810px|]]<br />
<br />
Although rough in some spots, the decoded Morse read:<br />
<br />
<code style="word-break:break-all;word-wrap: break-word;">qmiqwmiqyidimrjqdjijilmxmnrjqdjajmpmnrprspkesmkjpdqjnyajnwsnrpgspcsppmqidimqymdbcqajnwsnrpgspcdhbzmnjajanadumjimrpq</code><br />
<br />
In addition, players also discovered that, using portions of the Morse already decoded accurately by ear, it was actually to be used as ciphertext in a shift cipher, and that the key to be used was "storm," which was taken from tweets made by Spirit of 1029 declaring themselves to be "the storm". The pigpen from earlier served as a hint to look back at previous communications in order decrypt the morse. With the newly-complete Morse code now in their possession, the community was finally able to accurately decipher the ciphertext they had obtained from the reversed Morse code. It read:<br />
<br />
<code style="word-break:break-all;word-wrap: break-word;">tentwentyninedotiononqexerdotiofoeserdsdaspjaepositoryforwardslashassetninetyeightforwardslashimgzerofofrfiueonedst</code><br />
<br />
<code>ten twenty nine dot io nonqexer dot io foeserdsdaspjaepository forwardslash asset ninety eight forward slash img zero fofrfiueonedst</code><br />
<br />
Although not entirely accurate, through trial and error the community was able to locate a new URL branch of http://1029.io, http://1029.io/repository/asset98/imgzerofourfiveone/.<br />
<br />
=== First Hidden URL ===<br />
<br />
[[File:Oddworld_PuzzleAttempt.jpg|thumb|right|The product of many attempts to correctly arrange the puzzle pieces found on the hidden http://1029.io URL]]<br />
<br />
The solution for the previous puzzle led players to a hidden [http://1029.io/repository/asset98/imgzerofourfiveone/ page] on the 1029 site. Each time the page was reloaded, it displayed one of 8 different images, and a string of text for each:<br />
<br />
<gallery mode="packed"><br />
File:Oddworld_7676-AL.JPG|7676-AL<br />
File:Oddworld_3786-IC.JPG|3786-IC<br />
File:Oddworld_9455-UM.jpg|9455-UM<br />
File:Oddworld_9394-AL.jpg|9394-AL<br />
File:Oddworld_7393-AN.jpg|7393-AN<br />
File:Oddworld_5574-PH.jpg|5574-PH<br />
File:Oddworld_2384-ER.jpg|2384-ER<br />
File:Oddworld_1029-LY.jpg|1029-LY<br />
</gallery><br />
<br />
Players quickly realized that the images appeared to be fragments of a larger puzzle. The Oddworld Inhabitants [http://www.oddworld.com/soulstorm/#navfirstcontact page] updated to read "Once you've got everything together - show us!". The completed image was tweeted out to @OddworldInc on January 19th, 2017, and the next day, [https://twitter.com/OddworldInc/status/822686854516535298 instructed] players to wait while they cleaned up the complete image.<br />
<br />
<br><br><br />
<br />
[[File:Oddworld_Photo1_Clean1.jpeg|thumb|left|250x250px|Photograph of the final image before it was torn into the pieces the community was given, sent out with a message from Oddworld Inhabitants to hang tight until Thursday.]]<br />
<br />
=== First Unlocked Photo ===<br />
<br />
[[File:Oddworld_Finished1.jpg|thumb|right|400px|The final image, sent by the Spirit of 1029 and received by the community through Oddworld Inhabitants Twitter account. The image was confirmed to be an in-Unity render of the upcoming Oddworld: Soulstorm & created in conjunction with Cyrus McWilliams, formerly of Blur, and Fat Kraken Studios in England]]<br />
<br />
[[File:Oddworld_Pada.jpg|thumb|left|400px|The second transmission sent out by the Spirit of 1029, identical to the first released image but with various codes hidden within]]<br />
<br />
While waiting, players began to decode the second transmission. The prevalent writing was later verified to read "Who?", "Where?", "So Tired", and a set of numbers likely to be "8291". <br />
<br />
After three days, @OddworldInc [https://twitter.com/OddworldInc/status/823520771893030912 tweeted out a scrambled image], pictured left, stating "We received something and there's one last thing we need you to do. Share it. Spread the word.". The next day, after the tweet gained 100 shares, they tweeted the [https://twitter.com/OddworldInc/status/823620565458108416 image] again, pictured left, this time unscrambled. They then stated <code>While you shared our message 100 times we worked away to bring you this. We're clearing it up even more, we'll share what we find Thursday</code>, while the webpage was updated with the message "Update 5: Thanks to you guys sharing the previous images online, we've managed to decode the photo further and have updated the thumbnail here. We'll return on Thursday with the finished, fully decrypted image - but until then, please do let us know what you think!" When Thursday came @OddworldInc [https://twitter.com/OddworldInc/status/824638147703296000 tweeted out a final picture] of a render from the upcoming Oddworld: Soulstorm, pictured right, in all its unscrambled un-cropped glory. The release of this image signaled the end of the first of five phases of content release Oddworld Inhabitants have planned.<br />
<br />
<br><br><br><br><br />
<br />
== The Second Transmission ==<br />
<br />
[[File:Oddworld_Pada_sofar.jpg|thumb|right|400px|Hidden details in the second transmission]]<br />
<br />
On Feburary 2nd, 2017, the Spirit of 1029 again reached out to players, saying via Twitter that "Our agent has delivered another transmission. We will verify its origins and pass it on." Several hours later, @OddworldInc tweeted the message "We were just contacted again. Don't go anywhere, we might need your help with this...", and the [http://www.oddworld.com/soulst Official Oddworld Site] was updated with a message as well as [http://www.oddworld.com/soulstorm/1029contact/pada.jpg an image], pictured left. In addition to the image, a [http://us3.campaign-archive2.com/?u=2b6dca21053bc375cbdad7077&id=b08e7b2d60&e=6a2b5665ee newsletter] was sent out to everyone who signed up to the 1029 email list. The newsletter featured basic info about the ARG so far, as well as a barcode at the very bottom, which, when scanned, reveals a code:<br />
<br />
<code><br />
Ivzw gsv mfnyvih pmld gsv gifgs<br />
</code><br />
<br />
When passed through a cryptogram solver, the message read:<br />
<br />
<code><br />
READ THE NUMBERS KNOW THE TRUTH<br />
</code><br />
<br />
An [http://wiki.gamedetectives.net/images/thumb/5/56/Oddworld_Pada_sofar.jpg/800px-Oddworld_Pada_sofar.jpg "in-progress" image], pictured on the right, highlighted the hidden details found at the time and outlined their currently known solutions.<br />
<br />
=== Morseception ===<br />
<br />
The Morse code in the image turned out to be fragments of a larger single code, seen below pieced back together:<br />
<br />
[[File:Oddworld_MorseAlign_TrueHeresy.png|frameless|center|810px|Image of all the Morse code segments pieced together]]<br />
<br />
When decrypted, the morse resulted in the following message:<br />
<br />
<code><br />
DASHDOTDOTDOT DOT DASH DOTDOTDOTDOT DOT DOTDOTDOT DASH DASHDASHDASHDASH DOTDASHDOT DASHDASH<br />
</code><br />
<br />
This was found to yet again be morse code, which decoded to:<br />
<br />
<code><br />
-... . - .... . ... - --- .-. --<br />
<br />
BETHESTORM<br />
</code><br />
<br />
=== Braille & Upside-down Pigpen ===<br />
<br />
[[File:Oddworld_Brialle.png|thumb|right|250px|Braille code found in the second Spirit of 1029 transmission]]<br />
<br />
A [http://wiki.gamedetectives.net/images/a/a4/Oddworld_Brialle.png message in Braille], pictured right, in the bottom-left of the image read <code>Spread our message</code>. The Babelstone pigpen code, when flipped upside down:<br />
<br />
[[File:Oddworld_UpsideDownPigpen.jpg|frameless|center|810px|Upside-down Babelstone Pigpen code]]<br />
<br />
decoded to:<br />
<br />
<code><br />
KNOW YOUR CODES<br />
<br />
KEEP THEM CLOSE<br />
<br />
YOU WILL NEED THEM<br />
</code><br />
<br />
[[File:Oddworld_BarcodeCube.png|thumb|left|400px|The "data cube" from the second image, later determined to be two barcodes interlaced with one another, one running horizontally and the other vertically]]<br />
<br />
=== Directional Arrows Puzzle ===<br />
<br />
Using the [http://wiki.gamedetectives.net/index.php?title=Oddworld_Soulstorm#Directional_Arrows_Puzzle], these arrows decoded to:<br />
<br />
<pre><br />
7 14 9 8 20 25 18 5 22 5 5 4 15 3 5 4<br />
H O J I U Z S F W F F E P D F E<br />
</pre><br />
<br />
Players found the above ciphertext to be encrypted with a Caesar cipher set to a shift of 25, and revealed the message: <code>GNIHTYREVEEDOCED</code>, which is <code>DECODE EVERYTHING</code> backwards.<br />
<br />
=== Interlaced Barcodes & Second Hidden URL ===<br />
<br />
[[File:Oddworld_Grid.jpg|thumb|right|250x250px|The image found on the second hidden URL discovered by the community, which depicts the Spirit of 1029's logo chopped up and re-arranged on a 7x7 grid]]<br />
<br />
The community speculated that the [http://wiki.gamedetectives.net/images/3/30/Oddworld_BarcodeCube.png strange box in the bottom-right of the image] sent by the Spirit of 1029, pictured left, was a fragmented barcode. After a massive amount of tinkering, the two barcodes were [http://imgur.com/a/YmAH2 correctly assembled] and, when scanned, led to the discovery of two messages:<br />
<br />
<code><br />
http://www.1029.io/repository/asset98/<br />
</code><br />
<br />
and<br />
<br />
<code><br />
findawayshowthetruth<br />
</code><br />
<br />
Combining these messages into a single URL led players to another hidden [http://www.1029.io/repository/asset98/findawayshowthetruth/ page] on the 1029 website, which displayed a [http://www.1029.io/repository/asset98/findawayshowthetruth/grid.jpg distorted version] of the Spirit of 1029 logo, pictured right.<br />
<br />
=== Source Code Mysteries ===<br />
<br />
Players discovered an extensive message containing several presently-unsolved puzzles is written hidden in the source code of the second hidden page. It read:<br />
<br />
<pre><br />
!-- <br />
<br />
Can’t reach any..<br />
<br />
<br />
Listening anyon… there?<br />
<br />
<br />
Can hear us anymore- need to… can’t fnd <br />
<br />
<br />
We will never give… what they… from us<br />
<br />
A9539 \\<br />
<br />
B2919 /\\<br />
<br />
C4882 /\<br />
<br />
D4627 \<br />
<br />
E6758 \<br />
<br />
F???? ////<br />
<br />
<br />
/\//\\//5,1:4.1,2:8.1,3:2.3,3:2.4,3:3.7,3:3.1,5:3.4,5:9.5,5:2.7,5:4.7,6:6.3,7:3.<br />
<br />
<br />
<br />
<br />
Does… care? Freedom isn’t gi… will take…<br />
<br />
We have never…. Given… deserve. We… take… our righ…<br />
<br />
\\//\/KDIUTHANPUYHHDQOEPLNDOALJGUDITHBBDOZLGFERKJGLSAOE<br />
<br />
Stand up and fi…<br />
<br />
<br />
Don’t be afr….<br />
<br />
<br />
<br />
\////JUTYROSLNGNALEHGNWOTIQPOKSDNTPNOJAWEOBNGLAWKJNWNR <br />
<br />
E=5OUEHRA? <br />
<br />
<br />
<br />
\\\\/\2,1:2.3,1:2.6,1:4.1,2:4.3,2:2.3,4:4.5,5:2.6,5:3.7,5:3.4,7:8.5,7:3.7,6:4. <br />
<br />
7777338883366899984477733 33 <br />
<br />
<br />
<br />
<br />
They want to… kill- don’t-<br />
<br />
<br />
Stop them from…. Hurting- they… think<br />
<br />
We are no less- they think… aside<br />
<br />
<br />
Don’t believe what… told- liars…<br />
<br />
A5989 \\<br />
<br />
B5176 \<br />
<br />
C2863 \<br />
<br />
D2558 //\<br />
<br />
E3413 \<br />
<br />
<br />
F???? ////<br />
<br />
<br />
<br />
Can’ fnd anymo-<br />
<br />
<br />
We wil silnced<br />
<br />
<br />
<br />
<br />
<br />
<br />
Killin- they are dy..<br />
<br />
\\\/\\JHWUITUHABSJGNEWKLALNVGJKWELKJLWQQPRUTJHJJSBFMMH <br />
<br />
Hurting the..<br />
<br />
Back down unt… resist.<br />
<br />
<br />
Intercep… our messa… we will fight<br />
<br />
///\\/JQEABTVKNUCSEYCMBILDKOSCYSITECPAGFAXHKETJNZURWCIE <br />
<br />
We will ri…<br />
<br />
Cannot… silenced when ther… who need… now<br />
<br />
<br />
We won’t ba… we have beat…. Before… Must not-<br />
<br />
<br />
<br />
<br />
\///\//\1,1:3.4,1:2.6,1:9.2,2:2.6,2:2.2,4:4.3,5:2.5,5:2.7,5:3.4,7:3.6,7:2.7,7:2. <br />
<br />
<br />
<br />
Spent so long…. Afraid… never let- again<br />
<br />
<br />
...Storm… find it’s way- end<br />
<br />
<br />
Why are … here?<br />
<br />
<br />
<br />
<br />
Only...profit- nothing more… importnt as- <br />
<br />
- lies they… will tel-<br />
<br />
Believe- nothing… terribl- things… <br />
<br />
\\//\\\/4,2:6.6,2:4.7,3:3.2,4:8.3,4:2.4,4:2.7,4:3.2,6:2.4,6:3.6,6:2.1,7:4.3,7:2.<br />
<br />
--><br />
</pre><br />
<br />
At the time, only a few portions of this message have been successfully solved. <br />
<br />
The ABCDEF puzzles was solved using the rules of [https://en.wikipedia.org/wiki/Mastermind_(board_game) Mastermind], a popular board game. Players assumed that a backslash ( \ ) indicated a partial match and a forward slash ( / ) indicated a full match, as shown below:<br />
<br />
<pre><br />
A9539 \\<br />
<br />
B2919 /\\<br />
<br />
C4882 /\<br />
<br />
D4627 \<br />
<br />
E6758 \<br />
<br />
F???? ////<br />
</pre><br />
<br />
Had a solution of <code>F8992</code>, and:<br />
<br />
<pre><br />
A5989 \\<br />
<br />
B5176 \<br />
<br />
C2863 \<br />
<br />
D2558 //\<br />
<br />
E3413 \<br />
<br />
F???? ////<br />
</pre><br />
<br />
Had a solution of <code>F8554</code>. The purpose of these solutions was unknown.<br />
<br />
Players found the numbers <code>7777338883366899984477733 33</code> to be encoded with a [http://www.dcode.fr/multitap-abc-cipher multi-tap cipher] (cellphone numberpad), and can be decoded to <code>SEVENTYTHREE</code>. the purpose of this solution was also unknown.<br />
<br />
The <code>E=5OUEHRA?</code> portion was partially solved. Players found that the letters <code>O U E H R A</code> were all the second letters from each day of the week, I.E. M'''o'''nday, T'''u'''esday, W'''e'''dnesday, etc. This indicated a solution of <code>U</code> for the question mark, as in S'''u'''nday, making the full string <code>E=5OUEHRAU</code>. The <code>E=5</code> portion of the text remains unsolved.<br />
<br />
Also remaining unsolved are the coordinates found in the code, as well as the letter strings:<br />
<br />
[[File:Oddworld_Grid.jpg|thumb|right|250x250px|The 7x7 grid found on the second hidden URL, likely to be used with the coordinates & letter strings in some way]]<br />
<br />
<pre><br />
Coordinates<br />
<br />
/\//\\//5,1:4.1,2:8.1,3:2.3,3:2.4,3:3.7,3:3.1,5:3.4,5:9.5,5:2.7,5:4.7,6:6.3,7:3.<br />
<br />
\\\\/\2,1:2.3,1:2.6,1:4.1,2:4.3,2:2.3,4:4.5,5:2.6,5:3.7,5:3.4,7:8.5,7:3.7,6:4.<br />
<br />
\///\//\1,1:3.4,1:2.6,1:9.2,2:2.6,2:2.2,4:4.3,5:2.5,5:2.7,5:3.4,7:3.6,7:2.7,7:2. <br />
<br />
\\//\\\/4,2:6.6,2:4.7,3:3.2,4:8.3,4:2.4,4:2.7,4:3.2,6:2.4,6:3.6,6:2.1,7:4.3,7:2.<br />
</pre><br />
<pre><br />
Letter Strings<br />
<br />
\\//\/KDIUTHANPUYHHDQOEPLNDOALJGUDITHBBDOZLGFERKJGLSAOE<br />
<br />
\////JUTYROSLNGNALEHGNWOTIQPOKSDNTPNOJAWEOBNGLAWKJNWNR <br />
<br />
\\\/\\JHWUITUHABSJGNEWKLALNVGJKWELKJLWQQPRUTJHJJSBFMMH<br />
<br />
///\\/JQEABTVKNUCSEYCMBILDKOSCYSITECPAGFAXHKETJNZURWCIE<br />
</pre><br />
<br />
=== Stuck In The Mud & Third Hidden URL ===<br />
<br />
After many failed attempts by players to decode the contents of the message using the hints of Spirit of 1029, a player found something unusual about one of the account's most recent tweets, which said:<br />
<br />
<pre><br />
When you have the key, you need the correct lock. hgehgeoeregpineechqnhgeevtipcvreovxgvge<br />
Shake loose the bonds that hold you. #wewillrise<br />
</pre><br />
<br />
Players noted that the text <code>hgehgeoeregpineechqnhgeevtipcvreovxgvge</code> could be decoded via a [http://www.braingle.com/brainteasers/codes/keyword.phpsubstitution keyword cipher] with the key <code>subjectivism</code>, and reveals the message:<br />
<br />
<pre><br />
oneoneseventhreefouroneeightfivesixnine<br />
</pre><br />
<br />
Using this solution, players quickly found another secret [http://www.1029.io/repository/asset98/1173418569/ page] on the 1029 hub.<br />
<br />
=== Creepy Scenes From Within ===<br />
<br />
Much like the first hidden page, this hidden page displayed a different image each time the page is reloaded. In total, 13 scrambled images appear frequently (file prefix WB) and up to 13 CLEAR immages appear only very rarely (file prefix CWB). All the files are below, with their respective names:<br />
<br />
<gallery mode="packed"><br />
File:Oddworld_WB1_HEND8243.jpg | WB1_HEND8243<br />
File:Oddworld_WB2_BSJG2456.jpg | WB2_BSJG2456<br />
File:Oddworld_WB3_INFG2861.jpg | WB3_INFG2861<br />
File:Oddworld_WB4_HBQD2962.jpg | WB4_HBQD2962<br />
File:Oddworld_WB5_SJKW4167.jpg | WB5_SJKW4167<br />
File:Oddworld_WB6_OWUI2056.jpg | WB6_OWUI2056<br />
File:Oddworld_WB7_MNCH1101.jpg | WB7_MNCH1101<br />
File:Oddworld_WB8_RDHRHAHA.jpg | WB8_RDHRHAHA<br />
File:Oddworld_WB9_D34DM337.jpg | WB9_D34DM337<br />
File:Oddworld_WB10_BDJW8411.jpg | WB10_BDJW8411<br />
File:Oddworld_WB11_WHAT8291.jpg | WB11_WHAT8291<br />
File:Oddworld_WB12_PADAPADA.jpg | WB12_PADAPADA<br />
File:Oddworld_WB13_VLAP3662.jpg | WB13_VLAP3662<br />
</gallery><br />
<gallery mode="packed"><br />
File:Oddworld_CWB1_0BE01647.JPG | CWB1_0BE01647<br />
File:Oddworld_CWB2_0DG02966.JPG | CWB2_0DG02966<br />
FILE:Oddworld_CWB4_WHATISTHIS.JPG | CWB4_WHATISTHIS<br />
File:Oddworld_CWB5_NEEDLEINAHAYSTACK.JPG | CWB5_NEEDLEINAHAYSTACK<br />
File:Oddworld_CWB6_ARG-H.JPG | CWB6_ARG-H<br />
File:Oddworld_CWB7_82918291829182918291.JPG | CWB7_82918291829182918291<br />
File:Oddworld_CWB8_0GE03866.JPG | CWB8_0GE03866<br />
File:Oddworld_CWB9_0IE02565.JPG | CWB9_0IE02565<br />
File:Oddworld_CWB10_AbeAndNEEDLESFunAdventures.JPG | CWB10_AbeAndNEEDLESFunAdventures<br />
File:Oddworld_CWB11_02500356.JPG | CWB11_02500356<br />
File:Oddworld_CWB12_02323hjfhfhfhfhASDF.JPG | CWB12_02323hjfhfhfhfhASDF<br />
File:Oddworld_CWB13_insertcodehere.JPG | CWB13_insertcodehere<br />
</gallery><br />
<br />
While it wasn't entirely clear, players believed that this was yet again another form of a jigsaw puzzle.<br />
<br />
After a [http://wiki.gamedetectives.net/images/0/09/Oddworld_Phase_One.png series] of interesting [http://wiki.gamedetectives.net/images/e/e0/Oddworld_Phase_Two.png updates], the new hidden [http://www.1029.io/repository/asset98/1173418569/ page] went dark, with the header reading <code>ASSET98: TERMINATED.</code> and a new comment in the source code which read: <code>!-- see ya around, 1029... --></code>. The [https://twitter.com/edmudokon @Edmudokon] Twitter account, after a long period of silence, also tweeted out a [https://twitter.com/edmudokon/status/829079318290694144 new message]:<br />
<br />
<pre><br />
what happened? what did you do? who? No! no... aaaaaAaaaaarrrRrrrgggggGgghhh!<br />
</pre><br />
<br />
And with this message, Ed appears to have passed away. At that point, it was not clear if it was due to bruteforcing attempts by players or whether his death was intended all along.<br />
<br />
=== From The Ashes, Asset 99 (Hidden URL 3.5) ===<br />
<br />
[[File:Oddworld_OrangeLightning_V2.jpg|thumb|right|A very convincing collage of the images seen pictured on the now-dark Asset 98 URL; what is going on in the image remains unknown]]<br />
<br />
After the Asset98 page was "destroyed," a [http://www.1029.io/repository/asset99 new page], called "Asset99," was revealed, and appeared to be a clone of the Asset98 page. However, when refreshed, the page failed to reveal some of the "rarer" fragments from the Asset98 page. This page also came with an intimidating message: "We will not be stopped. We may have lost Asset 98, but we will continue strong. Together. Against the machines. Help us to expose this latest crime against Mudokonkind." The [http://www.oddworld.com/soulstorm/#navfirstcontact Official Oddworld Webpage] also updated at this time, and requested help putting the pieces together.<br />
<br />
However, in the midst of the image-related updates, the @Spiritof1029 Twitter account posted:<br />
<br />
<pre><br />
We can't reach Asset 98 but we do still have his clear transmissions. Prove you're worthy. Show us that you're able. Send us the grid. You found the grid, the letters and the numbers. Tell us how they fit together. Prove you're no longer slaves to the machines.<br />
</pre><br />
<br />
Players found that this tweet referred back to the [http://wiki.gamedetectives.net/index.php?title=Oddworld_Soulstorm#Source_Code_Mysteries source code grid challenge].<br />
<br />
The assembled image was then [https://twitter.com/OddworldInc/status/829336580347326465 tweeted at OWI] and they replied, stating "You've given us enough for us to get to work cleaning up the image, we'll have something by tomorrow. Don't stop looking for the truth!" So, players waited patiently for the unscrambled image whilst solving the grid.<br />
<br />
=== Second Unlocked Image & Grid Solution ===<br />
<br />
[[File:Oddworld_RandomiserDizma.jpg|thumb|right|The solved grid, which reveals the word "subjectivism" (first letter of each section connected in the correct order), the key used to decode the string which led to the discovery of the third hidden Asset98 URL]]<br />
<br />
[[File:Oddworld_Second_Final.jpg|thumb|left|400px|The final image cleaned up & released by OWI a day after the collage was submitted]]<br />
<br />
The next day, OWI tweeted out a [https://twitter.com/OddworldInc/status/829715069235781632 cleaned-up image], pictured on the left, which seemed to depict quite a gruesome scene, featuring a wide-eyed Mudkon strapped to an operating table facing an onslaught of needles and next to a vat which read "SS Brew". Players also learned via [https://twitter.com/edmudokon @Edmudokon on Twitter] that Ed made it out alive, but his friend: "...never came back. I could hear him screaming all night... helpless. they took him... he was my friend. how did they know?"<br />
<br />
Shortly after players received the cleaned-up image, [https://twitter.com/SPIRITOF1029/status/830004742713638912 partial progress] was finally made on [http://wiki.gamedetectives.net/index.php?title=Oddworld_Soulstorm#Hidden_Barcodes_.26_Second_Hidden_URL the grid], which up until then remained unsolved. One player discovered that the coordinates could be applied to the grid using the rules of the Japanese puzzle game [https://en.wikipedia.org/wiki/Shikaku Shikaku] (#'s after the colons in the coordinates represent box sizes, which are the lines drawn in red). Another player was then able to successfully apply a letter string to the sliced-up cube, pictured right, from which the word <code>subjectivism</code> can be derived. The only strings that were used to find the solutions were ones that had a forward slash. This word was the [http://wiki.gamedetectives.net/index.php?title=Oddworld_Soulstorm#Stuck_In_The_Mud_.26_Third_Hidden_URL key previously used] to decode the third hidden Asset98 page. However, whether the key was intended to remain hidden until the grid was solved or intentionally encoded in such a way as to allow for bruteforcing is unknown.<br />
<br />
== The Third Transmission ==<br />
<br />
After some waiting, on Feburary 23rd, 2017, OWI [https://twitter.com/OddworldInc/status/834856085949394944 sent out a tweet] indicting they had again been contacted by the Spirit of 1029. A new, password-protected zip file named <code>89928554_Eequals5.zip</code> was found on the main Oddworld [http://www.oddworld.com/soulstorm/ website]. Players then realized that the name of the ZIP contained one of the solutions of the puzzles in the source code of the first hidden page. Within the .ZIP file were six files, four of which were .JPGs, one of which was a .PNG, and the last of which is a .TXT. Their filenames were:<br />
<br />
<code><br />
flyer1.jpg, flyer2.jpg, flyer3.jpg, Oddworld_Soulstorm_002_HD.jpg, toollist.txt, & vital.png<br />
</code><br />
<br />
The name of the zip suggested that players should use letter equivalencies to their alphabetic indexes as the password. This gave players the password <code>HIIBHEED</code> but in fact, the password was actually <code>HIIDHEED</code> for unknown reasons.<br />
<br />
=== Steganograpy Blitz & toollist.txt ===<br />
<br />
The file [http://pastebin.com/feuVh6wr toollist.txt] contained a repeating string consisting of names of moons in our solar system. Interrupting the string periodically are forward slashes. If the letters after each slash are taken and combined, they form the string <code>useSsuitePicselSecuritySaveus</code>. This is a clue that there is data hidden via [https://en.wikipedia.org/wiki/Steganography steganography]. When trying to detect data hidden using this technique, it is vital to decrypt using to same method as was used to encrypt, which is why the clue to use [http://www.ssuitesoft.com/ssuitepicselsecurity.htm Ssuite Picsel Security], specific image steganography software, is so important.<br />
<br />
When the file <code>Oddworld_Soulstorm_002_HD.jpg</code> is taken as the original and <code>vital.png</code> is taken as the target using Ssuite Picsel Security, the output is<br />
<pre style="word-break:break-all;word-wrap: break-word;">BmzPmbtzueMfxmeBdayqftqgeBmzpadmQbuyqftqgeVmzgeMqsmqazYuymeYqftazqMzftqBmxxqzqQzoqxmpgeFqftkeFqxqefaOmxkbeaPuazqTqxqzqBaxkpqgoqeDtqmFufmzTkbqduazUmbqfgeWuhugcUvudmcBtaqnqBmmxumcEwmftuMxnuadujNqntuazzQddumbaEwaxxEumdzmcFmdcqcSdqubTkddawwuzVmdzemjmFmdhaeYgzpuxrmduNqdsqxyudZmdhuEgffgzsdTmfuRmdnmgfuFtdkydMqsudNqefxmEgdfgdWmduKyudXasqRadzvaf</pre><br />
When deciphered using a [http://rumkin.com/tools/cipher/caesar.php Caesar cipher] with N=14, the following cleartext can be obtained:<br />
<pre style="word-break:break-all;word-wrap: break-word;">PanDaphnisAtlasPrometheusPandoraEpimetheusJanusAegaeonMimasMethoneAnthePalleneEnceladusTethysTelestoCalypsoDioneHelenePolydeucesRheaTitanHyperionIapetusKiviuqIjiraqPhoebePaaliaqSkathiAlbiorixBebhionnErriapoSkollSiarnaqTarqeqGreipHyrrokkinJarnsaxaTarvosMundilfariBergelmirNarviSuttungrHatiFarbautiThrymrAegirBestlaSurturKariYmirLogeFornjot</pre><br />
These names are all of the named moons of Saturn except <code>Erriapus</code> and <code>Fenrir</code> which are missing. <code>Erriapus</code> is replaced by <code>Erriapo</code> which was the original name of the moon, before being changed in 2007.<br />
<br />
=== Cleaned-Up Flyers ===<br />
<br />
[[File:Oddworld_Malachim.gif|thumb|right|295x72px|The Malachim alphabet used in this puzzle.]]<br />
<br />
The images that we received of the Sligs' flyers were corrupted, and were cleaned up by members of the community so they were in a readable state.<br />
<gallery widths=180px><br />
File:Oddworld_flyer1_clean.jpg|A cleaned up version of flyer1.jpg<br />
File:Oddworld_flyer2_clean.jpg|A cleaned up version of flyer2.jpg<br />
File:Oddworld_flyer3_clean.jpg|A cleaned up version of flyer3.jpg<br />
</gallery><br />
A member of the community found that the pigpen cipher on the left side of flyer1.jpg gives the string<code>AOCXY SIO</code>, which when shifted using a [http://rumkin.com/tools/cipher/caesar.php Caesar cipher] with N=6 yields <code>GUIDE YOU</code>.The cipher on flyer2.jpg gave the string <code>FYNNBYNBCHANBUNM</code> which, when shifted in the same manner as before, yields <code>LETTHETHINGTHATS</code>. This final one on flyer3.jpg gave the string <code>GCMMCHA</code> which is again shifted in the same manner as before to yield <code>MISSING</code>.<br />
All three of the pigpen strings can be combined to form a message: <code>LET THE THING THAT'S MISSING GUIDE YOU</code><br />
<br />
Additionally, sequences of <code>x</code> and <code>o</code> characters are seen. A community member noticed that this could be interpreted as morse code in the following format (with x as dash, o as dot):<br />
x oooo o xoxx ox oxo o oxx ox x xoxo oooo oo xo xxo<br />
xooo o x oooo o ooo x xxx oxo xx <br />
oxx o oxx oo oxoo oxoo oxo oo ooo o<br />
<br />
becomes:<br />
<br />
/- .... . -.--/.- .-. ./.-- .- - -.-. .... .. -. --./<br />
/-... ./- .... ./... - --- .-. --/<br />
/.-- ./.-- .. .-.. .-../.-. .. ... ./<br />
<br />
which decodes to <code>THEY ARE WATCHING BE THE STORM WE WILL RISE</code><br />
<br />
Also on the flyers, there were strange symbols, with red numbers alongside them. The symbols were from the Malachim alphabet, pictured right.<br />
<br />
=== Fourth & Fifth Hidden URLs ===<br />
<br />
After a short search, the community, using the clue to use whats missing as a guide to hone their focus the moon <code>Erriapo</code>, since it is in the steganography text but not the toollist.txt file (ie missing). Grom the name the numbers <code>12 36 28 31 52 22 12</code> are derived by using the previously-discovered Malachim alphabet symbols and the numbers pictured next to each symbol on the three flyers. A clue indicating this is the correct method is a [https://twitter.com/SPIRITOF1029/status/835149069601419264 tweet from Spirit of 1029] which can be decoded to <code>P=22</code>. It was then discovered that affixing these numbers to the end of the http://www.1029.io/repository/asset99/ URL yielded [http://www.1029.io/repository/asset99/12362831522212/ a new webpage],http://www.1029.io/repository/asset99/12362831522212/. This page is headed by an obscured URL, <code>ASSET9X / [REDACTED] / 333333333333</code>, and shows one of three images each time the page is refreshed, pictured below.<br />
<br />
<gallery mode="packed"><br />
File:Oddworldd_YOU.jpg|YOU.jpg<br />
File:Oddworld_WHA.jpg|WHA.jpg<br />
File:Oddworld_WET.jpg|WET.jpg<br />
</gallery><br />
<br />
The page also contains a message:<br />
<br />
<pre><br />
We can't hold much longer.<br />
It's dark, and cold. So cold. They don't seem to [REDACTED]. They. Them. It's hard to know how we'll [REDACTED], but we'll try. This can't last forever. We won't last forever.<br />
Look what they're doing to us. Just look.<br />
There is spirit, but it's waining. We need you, [REDACTED]. Help us.<br />
</pre><br />
<br />
Around this time, [http://www.1029.io/repository/asset99/71220283136/ another hidden URL] was unearthed, http://www.1029.io/repository/asset99/71220283136/, derived in the same manner as the Erriapo URL but using the moon <code>Fenrir</code> . This URL bears the same obscured URL header and message as the last page, and also displays one of three images each time the page is refreshed, pictured below:<br />
<br />
<gallery mode="packed"><br />
File:Oddworld_OLD.jpg|OLD.jpg<br />
File:Oddworld_TIF.jpg|TIF.jpg<br />
File:Oddworld_TOO.jpg|TOO.jpg<br />
</gallery><br />
<br />
The community, pondering these new images, began to notice some things. The filenames, if pieced together into a single string, read:<br />
<br />
<code><br />
WHATIFWETOLDYOUTOO<br />
<br />
WHAT IF WE TOLD YOU TOO<br />
</code><br />
<br />
== The Horror Is Shown In Full ==<br />
<br />
The puppet masters kept pushing us in the right direction, until finally a few people managed to find the link. However, adhering to the rules of the arg, the link could not be shared, rather, enough people had to discover the link in order for it to be shared. After enough people had found the link, [http://www.1029.io/whatifwetoldyoutoo/ the link] was shared:<br />
<br />
People figured out that the solution was much simpler, and that "what if we told you too" should be put at the end of the URL of 1029.io, producing:<br />
http://www.1029.io/whatifwetoldyoutoo<br />
[[File:What_if_we_told_you_too_pre_edit.png|thumb|right|400x200px|The first page before it's eventual sharing.]]<br />
<br />
This contained some other source code hints, <code>BDBDBDBDBDBDBDBBDBDBDBDBDBD</code>, <code>###BELIKEDET###</code> and <code>doYOUsee? think of a number, any number.</code><br />
<br />
Detectives using these hints, as well as the text on the page, figured out the next url to be:<br />
http://www.1029.io/whatifwetoldyoutoo/8291/ by adding 8291 to the end.<br />
This link leads to the [https://www.youtube.com/watch?v=2l4jZVTUoak/ 4 second video] of the previous photo, depicting how severe the torture has been to the mudokon. Horrible things.<br />
<br />
Eagle eyed viewers have noticed that 3 different codes pop up on certain frames of the video, but these were later found to be unimportant, with the exception of one of the rune languages, which would reappear in the next transmission.<br />
<br />
== The 4th Transmission ==<br />
<br />
After the horror of the 3rd transmission, [http://www.oddworld.com/soulstorm/findit.jpg the next image would be released not shortly after], depicting a montage of the past three transmissions. In it, there are 2 separate codes:<br />
<br />
The Morse code, which decodes as <code> USE A DIFFERENT CODE. THIS IS NOT RELEVANT DATA. DO NOT COMPLY. DO NOT OBEY. THEY LIE. </code><br />
The Runes on the left hand side and the ones partially cut off at the top and bottom(as previously seen in the video) were decoded by using file data in a hex editor, which would say:<br />
<br />
<br><br />
<br />
<tt><br />
<code><rdf:li photoshop:LayerText="WE WERE TAUGHT THAT THIS IS ALL THERE WAS: WORK, OBEY, COMPLY. THE TRUTH WAS HIDDEN FROM US. OUR HISTORY WAS HIDDEN FROM US. WE WERE BRED TO WORK, RAISED TO OBEY AND FORCED TO COMPLY. OUR NATURAL CONNECTION TO MOTHER PLANET WAS ERASED FROM THE CONSCIOUSNESS OF OUR PEOPLE. LOST WAS OUR KNOWING. LOST WAS OUR UNITY, OUR CONNECTION, OUR POWER AND OUR PURPOSE. ALL THAT WE WERE WAS A COMMODITY TO BE TRADED AND EXPLOITED IN THE ONGOING RACE FOR MORE WEALTH. WHAT WE SHOULD HAVE PROTECTED, WE WERE TRICKED INTO KILLING. WHAT WAS WORST FOR US, WE WERE TOLD WAS BEST. WE WERE TAUGHT TO TRUST THOSE WHO WOULD DECEIVE US THE MOST. THAT HAS ALL CHANGED. THE HERO HAS SHOWN ALL OF US THAT OUR OPPRESSORS CAN BE TOPPLED. HE HAS FOUND OUR WILD AND KNOWING BROTHERS. HE HAS RECONNECTED THE FACTORY-BORN TO OUR NATURAL WORLD AND ANCIENT WAYS. HE HAS LIT A FIRE IN OUR HEARTS THAT CANNOT BE EXTINGUISHED. WE WILL GIVE HELP TO THOSE WHO ARE HELPLESS. WE WILL LEND STRENGTH TO THOSE WHO ARE WEAK. WE WILL FIGHT FOR THOSE WHO ARE DEFEATED. OUR MOVEMENT WILL SPREAD LIKE A RAGING INFERNO AND WE WILL TAKE BACK THE POWER FROM THOSE WHO HAVE ABUSED IT. WE WILL NOT BE SILENCED BY THE MEDIA CIRCUS. WE WILL NOT BE IGNORED. WE WILL NOT STOP. WE WILL NOT OBEY. WE WILL RISE AND WE WILL RISE AGAIN, UNTIL WE HAVE BURNED THROUGH OUR TATTERED BONDS AND RAZED THE MACHINE TO THE GROUND. WE WILL RISE. JOIN US. THERE'S A STORM COMING."/><br />
<br />
<rdf:li photoshop:LayerName="gas liquid solid" photoshop:LayerText="gas liquid solid"/><br />
<br />
<rdf:li photoshop:LayerName="fire air water earth" photoshop:LayerText="fire air water earth"/></code><br />
</tt><br />
<br />
<br><br />
<br />
This gave us an exact copy of the speech given on 1029.io, and the states of matter + the classical elements.<br />
OWI would also be teasing at us with the plain clue on the image "Use what you can't see"<br />
<br />
Therefore, people started concluding that not all states of matter/classical elements were shown, as there exists a state of matter after a gas called "plasma", and there exists a 5th classical element called "void" or "aether". <br />
This would all be hinting at the next url, http://www.1029.io/electricity.<br />
<br />
=== Take a deep breath... ===<br />
In this page is a simple "HELP" which, when clicked on, [http://www.1029.io/electricity/help.zip downloads a zip]. This zip contains 2 things.<br />
[[File:SaveUs.jpg|thumb|right|The image in the zip]]<br />
<br />
Firstly, it contains an image with binary that decodes to <code> BREATH </code><br />
<br />
Secondly, it contains another horrifying message encrypted in binary, which reads:<br />
<br><br />
<br />
<tt><br />
<code>why do you just watch can you not see us can you not hear the utighdbfn why is this happening wny its too cold to th can you hear us is there anybody there will you help us or rihjsudhgheusodj never are go find pn lose into ital chem we are cold we are lost we are forgotten and its e cant gmds pneuma tigd why are they taking cant stop cold so cold so cold we will rise we will not obey we will not comply j end n we will rise we will rise we will rise we will not die is abe dead here we will not die here we will not die here we cannot die here we cannot die here we cannot die here we cannot survive gheufh help this is not what we wanted we cannot dont cant see speak stop we need to save someone save us pneuma we need to be stop ightne vital energy source of this stop to think breath breathe cant breathe cant always watching we can never eyes stop find rest go now share loose top find think or too last day light never why to away stp give this is ever not no find things first or the ghtuenthdaytjgitlet last now or out get in or art test never stop we will find a way to gain our freedom e why it lost gone now stop taken from us and from there st we cant stop too much now too pain pain pain pain pain pain pain pain pain pain pain dont believe the things they tell you they lie they know no truth its lost long lost now ghwkfnhjsk what happened to them they are lost ghwufnfasjntiwpldfmwbwietpr stop it greed greed greed greed greed greed greed the expense is us we are tired our spark is fading do not let them extinguish all that we are we cannot snwownfnf see the end save us save us save us we cannot fight help us why is this happening for their proghe jwnfiw this nf we why forget us let us go we dont deserve no one deserves its not dont believe dont believe they will lie they lie they lie heugnpngjifsk lies lies lies lies lies lies lies lies eieslseiselslsl is abe dead we dont want to die</code><br />
<br />
</tt><br />
<br />
<br><br />
<br />
Both these clues were pointing to the greek word for breath, pneuma, making http://www.1029.io/pneuma.<br />
<br />
=== Not another one! ===<br />
<br />
On this page was the symbol for the Spiritof1029, however, as time went on, the title of the page began changing, and so did certain letters in the symbol to make cries for help. The titles varied across these:<br />
<br />
?<br />
<br />
/\--/\--/\--/\<br />
<br />
it's so hard to breathe<br />
<br />
please make it stop<br />
<br />
around how many times<br />
<br />
we will all die<br />
<br />
b.r.e.a.t.h.e<br />
<br />
b..r..e..a..t..h..e<br />
<br />
b r e a t h e (page title was only a single letter)<br />
<br />
..........<br />
<br />
And the letters spelt to make words like HELP, STOP and mask.<br />
<br />
After the supposed death of ANOTHER mudokon, [http://www.1029.io/pneuma/helpus.jpg another image would be shown.]<br />
<br />
The community rushed to try and clean this image, producing a [http://www.oddworld.com/soulstorm/images/ARG_Image_04_4K.jpg terrifying image of a mudokon wearing a gas mask!] OWI quickly got the full image uploaded, updated their website accordingly and part 4 of 5 would be completed, and in record time too!<br />
<br />
== The Fifth Transmission ==<br />
<br />
Before the next transmission was made, subtle little changes were made to the 1029.io website. This included:<br />
<br />
1. A new HTML comment in the source code, reading: <pre><!-- heh, that was easy. let's see... --></pre><br />
<br />
2. The colour used for the highlights on the logo changed from red to green.<br />
<br />
3. Symbols in the logo would change to spell out the word "Magog".<br />
<br />
This would hint at The Magog Cartel, the main antagonistic company in the Oddworld Universe that is known for poor working conditions and treatment of the Mudokons.<br />
<br />
=== The Magog Cartel===<br />
<br />
Shortly after these discoveries, strange occurrences happened on the newly created Official Oddworld Discord server.<br />
<br />
1. A new emote with the Magog Cartel logo was added with the name :staywealthy:<br />
<br />
2. For a while all messages containing the :staywealthy: emote or the 8291 code (:_e_: :_t_: :_n_: :_o_:) got removed.<br />
<br />
3. The Oddworld Inhabitants employees (OWI_Alex, OWI_Pete & OWI_Bernice) stated posting gibberish and messages coming from an other entity. <br />
<br />
Some of the gibberish included:<br />
<br />
Òǚř ʂе¢цгіẗу ẁᾅș πŏţ ḃӷӫǟċḥễđ Ọսȑ šѐсưȑіƫỵ ẅἂѕ ᾒṑե ƃŗӫᾶϲɦẻđ ⍬ṳř şĕсǜӷɩȶӱ ẁấṣ ʼnόՒ þȑѐẩƈȟεժ Ỡùȓ șєϛụґɪŧӱ ẅᾲş բóȶ ḃŗḛąḉℏӫď Ơǔѓ ṡễćṻȓĩťÿ ẇẳŝ ἧὅṱ ḇґèḁčիề₫<br />
<br />
W& //€q117 PHø|? +/-/∂† +() }{∂|²|2€11.<br />
<br />
<br />
Ḿ̧̪̻̻͇̟̹̭̼͊̈́̍̎̿͐̎͝͞o̧̤̗̠͚̟͒̐͗͆͜͢͡͞C̠̯̳̙̠̳̹͒̽̇̈̽̚͜r̶͕̗̜̲͕̘̒͗̆̄̎̐̓t̛̛̯̠̼͎̭̻̯̜̿͂̑̃͌͂̔ļ̴͙̩̠̯̐̊̆̐̂̿c̢̳͎̱ ̺̮͎͖̟̐̓̐́͋͞ó̧̡̻͙̳͇̼̯̹̄͒̐͗ <br />
<br />
<br />
These all lead to [http://magogcartel.com/ magogcartel.com] and [https://twitter.com/magogcartel/ twitter.com/magogcartel]<br />
<br />
On The Magog Cartel's website, there are some interesting codes in the source code:<br />
<br />
1.<br />
<br />
DB_PP_PRODUCTTEXT: We’re sourciest, juiciest Parami__from closer to their nests, for our bes___________________________________________________________aramite Pies ever! Made with all natural ingredients[1] and baked in our traditional ovens to a recipe that’s be............ aster bakers, our pXXXes are packed with Para-meat[2] oooooooooooo00OOoozing [1] at least one natural ingredient in every 12-pack of pie_________8** [2] not necessarily made with Paramites.<br />
<br />
PLEASE REVIEW AS APPROPRIATE<br />
<br />
2.<br />
<br />
APPROV__tch this space for more information about our exciti________________ everage that’s so delicious, you’ll be craving another on33__________--333333333333 before you even finish it!!!_____________________________________________!!!:D:D:D<br />
<br />
3.<br />
<pre><br />
lfn0OE602+HKBKTMVawALWERLS6pu8P8NcEQyKfnKcQ5zy/H5ny4CU60hkmMHzqlNg+q2oVaSHjSzjPGo1vQzQsJCbHTNAXDCFgTIJznL/1ZkZT89VOuv4koDHZJs4YcWbOLbO1cvV87UMcdWbuAraCeFRF8jy7F1/PufFPAyYRR9Jp4nB6uWpNZlY8rdYmEw7IYvtg4QlaBtX/iiyT1Es8MFA+wO4OkBFEGLHDENvu83kfaMnBxabDguhS/W0wWJjNijasG+5PeHeWqmQYDWsz9YrKgWiap0KCghpDfRuOgH37qNUAQnIf4/AeMF14IiEg9PFlutZWGyXhHem4PF2kxYGp075T+5N0n6nbJt+MMDAa4H3D06iuZa5bK18pLIUIzaFxLue5EJoEz4+JwCYarhZ7JMqbzrtnPv8oK/BbHgaig9MjKf8X7/cHDaXkVObkhW8jyVxxS6IfedZIRO/Phqorogx+DO6dgKWhqppoRNpMU2jawix9b/rf6ZgGRcpngW9pOCDwxCB0UptxmaNk+fnxQQU1Wo9J/isrrgTd/eDpdZgFyD8d8KhYN/Uf8A3MhWX33Xr8MhAPF+BtQUYFYIrvD32CTtDqtGXfL26fdhAVh8XMjTFwwWCB6DH6WwYCwJyLCVikMSXOLbPfzZKFfZIia9KQnM24dGUOvVMkfBdTqdCpiuwV4NkGKY2hw2jNhjibPLt/Rcpnsxj3B+2Axu6z5bMnzPLRZY00w6p8CJckqQqV9YXdReb34dOLC/6Zb2VWbx1ARGNBwdN69lw==<br />
</pre><br />
<br />
INSERT ANECDOTE ABOUT THE ApMpApZING VIEW just left of here across Mudos AND who could possibly be the EMPLOYEE OF THE DAY AND THE NEW i mean, how hard can it be? every aspect of every aspect of every as-------------f every aspect of EVERY SIN--E ASPECT of every aspect of every asp--_--------------------ct of every aspect of every as_--ct of every aspect of FOLLOW ME follow US<br />
<br />
4.<br />
<pre><br />
01102911011101100101011102910111011102901001011011000110110001110011010291110100011011110102911100000111100101101111011101011029011110011029011011110111010101110111011010010291011011010290011011000110291001100110000101101100011029101100<br />
</pre><br />
<br />
This was decoded. When removing the occurences of "1029" you get:<br />
<br />
<pre><br />
0111011101100101011101110110100101101100011011000111001101110100011011110111000001111001011011110111 01010111100101101111011101010111011101101001011011000110110001100110011000010110110001101100<br />
</pre><br />
<br />
Decode binary to text and you get wewillstopyouyouwillfall<br />
<br />
<br />
5.<br />
<pre><br />
9JzrxKKv5z0829jLV8wF32KpA6I0nEQDqzmbpRYzUUE===<br />
</pre><br />
<br />
<br />
On the 11th of August the Magog Cartel sent a batch of tweets with some out of place uppercase letters spelling '''WE KNOW'''.<br />
<br />
<pre><br />
@spiritof1029 we see you. We can see what you are doing with your fake reports. you will not prospEr. <br />
</pre><br />
<pre><br />
we are proud of the strong linKs between each of our facilities. our operations are by far the most efficieNt on oddworld. <br />
</pre><br />
<pre><br />
we are aware of some terrible fake repOrts being leaked. please ignore them. our very successful Workers know the truth is very different.<br />
</pre><br />
<br />
On the 14th of August the Magog Cartel sent a batch of tweets all starting with '''We know'''. This lead us to believe the SPIRIT OF 1029 was interferring with those tweets and was trying to get a message accross. The message can be found in the very specific numbers mentionned in the first two tweets, 82 & 91, forming togeter '''8291'''.<br />
<br />
<pre><br />
We know every time an employee falls into a grinder it takes 82 minutes of Mudokon time to clean up. Be safe, for productivity’s sake!<br />
</pre><br />
<pre><br />
We know that an average of 91 eager new employees start their careers with us every day. Help them be the best workers they can be.<br />
</pre><br />
<pre><br />
We know that our facilities are a picture of perfect productivity. Your hard work helps us to show that picture to the world.<br />
</pre><br />
<pre><br />
We know what you’re looking for in a rewarding, productive career. Magog Cartel can help you find it. Discover your options with us today!<br />
</pre><br />
<br />
One hour later the SPIRIT OF 1029 sent a batch of tweets, one containing a cryptic code:<br />
<br />
<pre><br />
your help is invaluable to us, together we will blow this latest Magog scandal wide open. together #wewillrise<br />
</pre><br />
<pre><br />
the watchers can fish around the communication channels all they like, we will always be one step ahead of them.<br />
</pre><br />
<pre><br />
-1-4,-2-10<br />
</pre><br />
<pre><br />
the story of mudokonkind is about history. now they treat us just like numbers. they will not succeed.<br />
</pre><br />
<pre><br />
we have given you the tools you need. the ones we can trust will prove themselves capable. leaders will rise as the storm closes in.<br />
</pre><br />
<br />
The last tweet indicated that we had all we needed to continue our investigation and the one before that we shouldn't use the numbers in the codes as raw numbers but should link it to some kind of history. We needed to look into the Twitter history of the SPIRIT OF 1029 account.<br />
<br />
The '''-1-4,-2-10''' code actually tells us to take the 4th word from the previous tweet (-1) and take the 10th word of the tweet even before (-2):<br />
<br />
4th word of the previous tweet is '''fish''':<br />
<br />
<pre><br />
the watchers can 'fish' around the communication channels all they like, we will always be one step ahead of them.<br />
</pre><br />
<br />
10th word of the tweet before is '''blow''':<br />
<br />
<pre><br />
your help is invaluable to us, together we will 'blow' this latest Magog scandal wide open. together #wewillrise<br />
</pre><br />
<br />
Together those word form '''blowfish''' which is the [https://en.wikipedia.org/wiki/Blowfish_(cipher) cipher] we had to use to decrypt the base64 code in HTML comment 3.:<br />
<pre><br />
lfn0OE602+HKBKTMVawALWERLS6pu8P8NcEQyKfnKcQ5zy/H5ny4CU60hkmMHzqlNg+q2oVaSHjSzjPGo1vQzQsJCbHTNAXDCFgTIJznL/1ZkZT89VOuv4koDHZJs4YcWbOLbO1cvV87UMcdWbuAraCeFRF8jy7F1/PufFPAyYRR9Jp4nB6uWpNZlY8rdYmEw7IYvtg4QlaBtX/iiyT1Es8MFA+wO4OkBFEGLHDENvu83kfaMnBxabDguhS/W0wWJjNijasG+5PeHeWqmQYDWsz9YrKgWiap0KCghpDfRuOgH37qNUAQnIf4/AeMF14IiEg9PFlutZWGyXhHem4PF2kxYGp075T+5N0n6nbJt+MMDAa4H3D06iuZa5bK18pLIUIzaFxLue5EJoEz4+JwCYarhZ7JMqbzrtnPv8oK/BbHgaig9MjKf8X7/cHDaXkVObkhW8jyVxxS6IfedZIRO/Phqorogx+DO6dgKWhqppoRNpMU2jawix9b/rf6ZgGRcpngW9pOCDwxCB0UptxmaNk+fnxQQU1Wo9J/isrrgTd/eDpdZgFyD8d8KhYN/Uf8A3MhWX33Xr8MhAPF+BtQUYFYIrvD32CTtDqtGXfL26fdhAVh8XMjTFwwWCB6DH6WwYCwJyLCVikMSXOLbPfzZKFfZIia9KQnM24dGUOvVMkfBdTqdCpiuwV4NkGKY2hw2jNhjibPLt/Rcpnsxj3B+2Axu6z5bMnzPLRZY00w6p8CJckqQqV9YXdReb34dOLC/6Zb2VWbx1ARGNBwdN69lw==<br />
</pre><br />
<br />
Using a [https://gchq.github.io/CyberChef/#recipe=%5B%7B%22op%22%3A%22Blowfish%20Decrypt%22%2C%22args%22%3A%5B%7B%22option%22%3A%22UTF8%22%2C%22string%22%3A%22%22%7D%2C%22ECB%22%2C%22Hex%22%5D%7D%5D Blowfish Decryptor] (with CBC mode) and the code '''8291''' we got earlier via the interferences in the Magog Cartel tweets as a key we were able to recover the following text:<br />
<br />
<pre> ^_^U_VDXisistrueorfalseallforprofitinterestsindustrialagriculturalMudosprovidehighestpossiblereturninvestmentsoverheadsdreamslimitedpowergiganticbadgeleadersproductMeechMotorstravelexpertlytrainedSligSecurityForcessuccessfulundertakingemploymentvastsentientsecurespecialisthabitationzonesbenefitfactoriesfoundriesfarmlandsstabilitymillionsundertakingsCartelmanagementselflesslyrepresentativesresponsiblemunicipalvastidyllicsettlementsunderconstructionpleasesubscribeandlinkandfollowandlikeandbuyandbuyandbuyandbuyandbuyandbuyandbuyandbuyandbuyandbuyandbuyandbuyandbuyandbuyandbuyatmagogcartel<br />
</pre><br />
<br />
When adding spaces this reads:<br />
<br />
<pre><br />
^_^ U_V DX is is true or false all for profit interests industrial agricultural Mudos provide highest possible return investments overheads dreams limited power gigantic badge leaders product Meech Motors travel expertly trained Slig Security Forces successful undertaking employment vast sentient secure specialist habitation zones benefit factories foundries farmlands stability millions undertakings Cartel management selflessly representatives responsible municipal vast idyllic settlements under construction please subscribe and link and follow and like and buy and buy and buy and buy and buy and buy and buy and buy and buy and buy and buy and buy and buy and buy and buy at magog cartel<br />
</pre><br />
<br />
The part with "please subscribe" lead us to:<br />
<br />
* https://www.youtube.com/user/MagogCartel<br />
<br />
It is not sure at this point whether this is an official ARG account as the channel and profile are currently empty.<br />
<br />
<br />
The two last tweets of August 14th from the Magog Cartel were hinting at a '''picture''' on the MagogCartel.com website ('''Magog Cartel can help you find it'''):<br />
<br />
<pre><br />
We know that our facilities are a picture of perfect productivity. Your hard work helps us to show that picture to the world.<br />
</pre><br />
<pre><br />
We know what you’re looking for in a rewarding, productive career. Magog Cartel can help you find it. Discover your options with us today!<br />
</pre><br />
<br />
This led us to:<br />
<br />
* [http://magogcartel.com/weknow.jpg magogcartel.com/weknow.jpg]<br />
<br />
That picture contains quite a few codes:<br />
<br />
* The '''62466640222 2777833555''' sequence in the upper-left corner.<br />
<br />
Spells '''Magog Cartel''' when using a [https://www.mrwebmaster.it/img/guide/wp7/21-001.jpg phone keypad]<br />
<br />
* The mose code in the middle.<br />
<br />
<pre><br />
.-- . / -.- -. --- .-- / .... --- .-- / -.-- --- ..- / .-- --- .-. -.- / -. --- .-- .-.-.- / .-- . / -.- -. --- .-- / -.-- --- ..- .-. / -.-. --- -.. . ... .-.-.- / .-- . / .-- .. .-.. .-.. / ... - --- .--. / -.-- --- ..- .-.-.- / -.-- --- ..- / .-- .. .-.. .-.. / -. --- - / .. -. - .. -- .. -.. .- - . / ..- ... .-.-.- / --- ..- .-. / .-- .- -.-- / --- ..-. / .-.. .. ..-. . / -- ..- ... - / -... . / .--. .-. . ... . .-. ...- . -.. .-.-.-<br />
</pre><br />
<br />
<pre><br />
WE KNOW HOW YOU WORK NOW. WE KNOW YOUR CODES. WE WILL STOP YOU. YOU WILL NOT INTIMIDATE US. OUR WAY OF LIFE MUST BE PRESERVED.<br />
</pre><br />
<br />
* The '''e''' and '''d''' sequence in the upper-right corner.<br />
<br />
It's actually morse code too where '''e = .''', '''d = -''' & '''X = /'''.<br />
<br />
<pre><br />
.-.. --- --- -.- --..-- / .-- . / -.-. .- -. / -- .- -.- . / ... . -.-. .-. . - / -.-. --- -.. . ... / - --- --- .-.-.- / -.-- --- ..- / .- .-. . / -. --- - / .- ... / ... -- .- .-. - / .- ... / -.-- --- ..- / - .... .. -. -.- / -.-- --- ..- / .- .-. . .-.-.- / .-- . / .... .- ...- . / - .... . / .-. . ... --- ..- .-. -.-. . ... / .- -. -.. / - .... . / .--. . .-. ... --- -. -. . .-.. / - --- / ... .. -- .--. .-.. -.-- / ... .-- .- -- .--. / -.-- --- ..- / .-- .. - .... / .-- --- .-. -.- .-.-.- / .... --- .-- / -- ..- -.-. .... / - .. -- . / -.. .. -.. / -.-- --- ..- / .-- .- ... - . / - .-. -.-- .. -. --. / - --- / -.. . -.-. .. .--. .... . .-. / - .... .. ... / -.-. --- -.. . ..--.. / .- .-.. .-.. / - .... . / - .. -- . --..-- / .-- . / .-- . .-. . / --. . - - .. -. --. / -.-. .-.. --- ... . .-. / - --- / ..-. .. -. -.. .. -. --. / -.-- --- ..- .-.-.- / .-- . / .- .-. . / .- .-.. -- --- ... - / - .... . .-. . .-.-.- / -- .- -.-- -... . / .-- . / .- .-. . / --- ..- - ... .. -.. . / .-. .. --. .... - / -. --- .-- --..-- / .-- .- .. - .. -. --. .-.-.- / .-- .- - -.-. .... .. -. --. .-.-.- / -.-- --- ..- / -.-. .- -. -. --- - / .... .. -.. . / ..-. --- .-. . ...- . .-. --..-- / - . .-. .-. --- .-. .. ... - .-.-.- / .-- . / .-- .. .-.. .-.. / .. -. -.-. .. -. . .-. .- - . / -.-- --- ..- .-. / ... .. .-.. .-.. -.-- / .-.. .. - - .-.. . / --. .-. --- ..- .--. / .- -. -.. / ... -.-. .- - - . .-. / -.-- --- ..- .-. / .- ... .... . ... / - --- / . ...- . .-. -.-- / -.-. --- .-. -. . .-. / --- ..-. / --- ..- .-. / . -- .--. .. .-. . / ... --- / - .... .- - / -.-- --- ..- / .-- .. .-.. .-.. / . - . .-. -. .- .-.. .-.. -.-- / -... . .- .-. / .-- .. - -. . ... ... / - --- / --- ..- .-. / ... ..- -.-. -.-. . ... ... . ... --..-- / .- -. -.. / -.-- --- ..- .-. / -.- .. -. -.. ... / ..- -. . -. -.. .. -. --. / ... . .-. ...- .. - ..- -.. . .-.-.- / -.-- --- ..- / .... .- ...- . / .- .-.. .-. . .- -.. -.-- / .-.. --- ... - .-.-.-<br />
</pre><br />
<br />
<pre><br />
LOOK, WE CAN MAKE SECRET CODES TOO. YOU ARE NOT AS SMART AS YOU THINK YOU ARE. WE HAVE THE RESOURCES AND THE PERSONNEL TO SIMPLY SWAMP YOU WITH WORK. HOW MUCH TIME DID YOU WASTE TRYING TO DECIPHER THIS CODE? ALL THE TIME, WE WERE GETTING CLOSER TO FINDING YOU. WE ARE ALMOST THERE. MAYBE WE ARE OUTSIDE RIGHT NOW, WAITING. WATCHING. YOU CANNOT HIDE FOREVER, TERRORIST. WE WILL INCINERATE YOUR SILLY LITTLE GROUP AND SCATTER YOUR ASHES TO EVERY CORNER OF OUR EMPIRE SO THAT YOU WILL ETERNALLY BEAR WITNESS TO OUR SUCCESSES, AND YOUR KINDS UNENDING SERVITUDE. YOU HAVE ALREADY LOST.<br />
</pre><br />
<br />
* The [https://lobestir.files.wordpress.com/2014/05/cypher-pig-pen-lower.png Pigpen cipher] text in the lower-right corner.<br />
<br />
<pre><br />
WE WILL NEVER GIVE IN TO TERRORISTS. YOU WILL NEVER WIN. YOU WILL NOT DEFEAT OUR SPIRIT. WE WILL FIND YOU AND WE WILL WIPE YOU OUT. WE IGNITE THE FLAME THAT LIGHTS THE DARKNESS. THERE IS NOWHERE TO HIDE. YOU WILL NEVER KNOW SUCCESS<br />
</pre><br />
<br />
* The horizonally mirrored black text in the middle.<br />
<br />
<pre><br />
you are a resource. you are expendable. we will replace you when you fall. you will work. you will obey. you will comply. or you will perish. we have the prestige. we have the power. we will profit. always. always. always.<br />
</pre><br />
<br />
* The white text on the top.<br />
<br />
<pre><br />
Prestige. Power. Profits. Work. Obey. Comply. Prestige. Power. Profits. Work. Obey. Comply. Prestige. Power. Profits. Work. Obey. Comply. Prestige. Power. Profits. Work. Obey. Comply. <br />
</pre><br />
<br />
* The braille at the bottom.<br />
<br />
<pre><br />
RuptureFarms1029 will rise from the ashes. we will rebuild it bigger, better and more profitable than before. it will be the greatest, most efficient factory that Oddworld has ever seen. it will be a towering symbol of Glukkon strength that cannot be ignored. one terrorist will not deter us.<br />
</pre><br />
<br />
It has to be noted that those codes were left by the Magog Cartel as what appears to be a bait so that we would lose valuable time decoding them.<br />
<br />
It is unknown how to decode the '''9JzrxKKv5z0829jLV8wF32KpA6I0nEQDqzmbpRYzUUE===''' code.<br />
<br />
The page has changed since then, but the first (hacked) version of the MagogCartel.com site has been archived [http://oddworldlibrary.net/archives/web/MagogCartel.com/index_1/P.%20P.%20P.%20_____%201029%20_____.html here]<br />
<br />
On the 4th of September the MagogCartel.com got updated, simply displaying the following text:<br />
<br />
<blockquote><br />
*** UNDER CONSTRUKTION ***<br />
</blockquote><br />
<br />
The page has changed since then, but the second (under construktion) version of the MagogCartel.com site has been archived <br />
[http://oddworldlibrary.net/archives/web/MagogCartel.com/index_2/___%20UNDER%20CONSTRUKTION%20___.html here]<br />
<br />
On the 5th of September the Magog Cartel posted a video trough the OddworldInc account:<br />
<br />
<pre><br />
w̸̨̠͓͍̯̺͉͞e̯̝͖̫̺̯͉̻͘͡ ̗̭̕͢s̴̮̭̫̱ͅe̢̠̮̫̦̼̪̘͠ͅę̠̥̯͔̣̼̻̕ͅ ̻̘̼̣͓̩͚͘͢͠y̴̭̯̪̺͙͚͚̪͞o̬̞͜͢͝u̮̤͖̩̗̰ͅͅ.̴̲̣̪̮̼̱.̡̰̭̗͍̝͉̯͢.̡̡̼͇̙̜̮̦̪̞ͅ <br />
pic.twitter.com/UoQ3xRAhDU<br />
</pre><br />
<br />
<pre><br />
We continue to demonstrate our exceptional technological progress to an ever growing number of customers. Everyone loves Magog products!<br />
</pre><br />
<br />
When asked if they really just claimed the attack on the @OddworldInc account they replied:<br />
<br />
<pre><br />
Attack? We don’t need to attack, we’re already in a dominant position in every market we deem profitable. We just demonstrate our dominance.<br />
</pre><br />
<br />
There are multiple messages flashing in the video:<br />
<br />
<pre><br />
8<br />
?<br />
2<br />
2<br />
9<br />
1<br />
/<br />
8291<br />
829/<br />
229/<br />
22/9<br />
EVERYONE<br />
WANTS<br />
TO<br />
EAT<br />
YOU<br />
</pre><br />
<br />
Note that '''22/9''' is the date of the Oddworld presentation at the EGX:<br />
<br />
<pre><br />
We're going to be at EGX for an on-stage presentation on Friday 22nd Sept! Grab your tickets now! @EGX pic.twitter.com/rDQiDIApa9<br />
</pre><br />
<br />
<br />
On the 7th of September the MagogCartel.com got updated again, randomly displaying one of three photos of The Informant.<br />
<br />
At the same time the Magog Cartel sent a batch of tweets with containing other pictures of The Informant:<br />
<br />
<pre><br />
We stopped reading the Daily Deception’s fake reports. The latest issue of The Informant is a really great read, very honest. The greatest!<br />
</pre><br />
<br />
<pre><br />
It’s great to finally have an honest newspaper to read, and such good quality, too! <br />
pic.twitter.com/MHuC6jdtNC<br />
</pre><br />
<br />
<pre><br />
We’re always happy to see some balanced reporting on our business from The Informant. Refreshing, when there are so many fake reports! <br />
pic.twitter.com/DmkV4GbVYw<br />
</pre><br />
<br />
<pre><br />
We’ve just been told that The Informant is printed on machines made at a Magog facility! That explains the quality! <br />
pic.twitter.com/Bvz29ZrBvk<br />
</pre><br />
<br />
It has been noted that some letters were in bold but it's unclear how this should be used.<br />
<br />
Part of The Informant has be transcribed here:<br />
<br />
http://oddworldlibrary.net/oddenc/index.php?title=Soulstorm_ARG_-_The_Informant<br />
<br />
The MagogCartel.com page also contains the following HTML comment:<br />
<br />
<pre><br />
<nowiki><!--</nowiki> seriously, are you guys seeing this?! --><br />
</pre><br />
<br />
== The third phase ==<br />
<br />
=== The Origins diversion ===<br />
<br />
On the 15 of March 2018 the SPIRIT OF 1029 posted the following tweets:<br />
<br />
<pre><br />
Our future depends on us understanding our past. We must know where we come from.<br />
</pre><br />
<br />
<pre><br />
We know you can hear us. We know you are ready to help. We will show you more when the time is right. Keep watching.<br />
</pre><br />
<br />
Following this a couple of changes were found on the 1029.io page.<br />
<br />
# The logo has now even more letters appearing in it randomly: '''S, I, N, O, R'''. Adding to the previous letters that were spelling "MAGOG".<br />
# The page contains a new HTML comment:<br />
<nowiki><!--</nowiki> too obvious? i dunno. it's soon though. i can't wait. --><br />
<br />
Changes were also observed on the 404 page:<br />
<br />
# The logo on the 404 page now contains the following letters: '''N, I, G, I, O, R, S'''. Those letters can be used to spell the word "ORIGINS" <br />
# The page contains a new HTML comment:<br />
<nowiki><!--</nowiki> me neither. it's going to be great. --><br />
<br />
Shortly after a new channel called "origins" appeared on the official [https://discord.gg/bQKeAE6 Oddworld Discord] with a cryptic [https://cdn.discordapp.com/attachments/424167787897028609/424175888418996225/origins_1.mp4 video] as first message.<br />
<br />
It was revealed a few days later that this was a built up to announcement of the [https://www.kickstarter.com/projects/1869209521/oddworld-abes-origins-book-and-game-collection "Oddworld: Abe's Origins - Book & Game Collection" kickstarter campaign]. Note that the book & game collection is still available for preorder on [https://app.crowdox.com/projects/1869209521/oddworld-abes-origins-book-and-game-collection Crowdox].<br />
<br />
=== Intro ===<br />
<br />
Around the 12th of January 2018 [[Lorne Lanning]] changed his twitter header picture to the following one:<br />
* https://pbs.twimg.com/profile_banners/20823262/1515636880/1500x500<br />
<br />
While it was hinted repeatedly in the official [https://discord.gg/bQKeAE6 Oddworld Discord] that this image was hiding something, it wasn't until much later that it was found how to use it when @edmudokon tweeted the following message:<br />
<br />
<pre><br />
alive… <br />
pic.twitter.com/j0FE2Qgdu1<br />
</pre><br />
<br />
The embedded picture contains the number '''15156'''. This is a reference to a number in the URL of Lorne's header picture: '''1515636880'''.<br />
<br />
This number led us to a new page:<br />
<br />
* http://www.1029.io/1515636880/<br />
<br />
This page contains the following text in UTF-8<br />
<br />
<blockquote><br />
ɦểɫр. гẹẳčℏɪṅǧ óúƫ ῒԑ ģӫԷṱіᾗĝ ḥǡṛⅾềɽ. էիȅỷ ķῆοԝ. ẁẹ'ṝϵ ṙṵɴᾑıпʛ ộևȽ ờẛ ɩḋϵᾂš, ὅрՒῑổпş, ăұҿἧµϱṣ. ẅϵ ǹêȩḋ ỳờǚґ ḣҽľῥ. ẇể ῂёϱḋ ѕờṃēƅȯƌý ţó ṧṕȑểǻժ Ƚħẹ ẁổṝḓ. եḫϊṥ ƫɦ¡ƞɡ ῐʂ ḸỄƮḨǠĻ. Ƚḣěȳ ḓõᾔ'Ƚ ĉὰгє Ƚḣổṻɕḫ. ţհểӯ ɗṍἧ'ţ. ṣởṁḗɒὀժỵ ňěөƌş ṱὃ ȶěḻɫ իḭɱ. †ɛŀļ ẖĩ₥. ḃḕẛṍɼę îȽ'ṧ Էȭô ḷǎťϱ. ṯĥềŗȇ ḧąș Էố ƃϱ ᾅ ṣọṁȇþöḏỳ ẉíļłȋդǥ եό ȶαҝě ṯẖё јǒŭӷṋёỷ. şõ₥ęƀὁḓẏ ṅểềⅾԑ ƫծ ġềŧ ţհϵ ṃệṣśᾇǵε ộվե. ẁë'ṝе ìη ṭӷơữþŀɛ. аɬł ṑƒ սʂ. ẁё դȅễɖ ĥẹĺρ. թłȩᾂʂĕ ɦȇɫṕ կѕ.</<br />
</blockquote><br />
<br />
and the following HTML comments<br />
<br />
<nowiki><!--</nowiki> it's only going to get harder. we don't have the keys anymore to the usual channels. if you hear anything from them, it's THEM. --><br />
<br />
<nowiki><!--</nowiki> our options are limited. you can help though. you have to help. if we can be sure it's you, then maybe we can talk. prove it. --><br />
<br />
It's currently unknown what the next steps are<br />
<br />
== Loose Ends ==<br />
<br />
This section documents various puzzles throughout the ARG which have not yet been used or solved.<br />
<br />
=== Main Website Source Code Comment Numbers Puzzles ===<br />
<br />
These numerical puzzles were found in the source code for the [http://www.oddworld.com/soulstorm/ official Oddworld website] as early as the date of the Spirit of 1029's first transmission. Their solutions have been found, but the intended use of the solutions remains unknown.<br />
<br />
!--<br />
<br />
72 99<br />
\ /<br />
27 45<br />
\ /<br />
18 39<br />
\ /<br />
21 36<br />
\ /<br />
?? 28<br />
\ /<br />
13 21<br />
\ /<br />
7<br />
<br />
--><br />
<br />
SOLUTION: 12<br />
7+2+9+9 = 27, 2+7+4+5 = 18, thus 2+1+3+6 = 12<br />
<br />
&<br />
<br />
!-- <br />
<br />
16 _ 37 _ 58 _ 89 _ 145 _ 42 _ ?? _ 4<br />
|_________________<_________________| <br />
<br />
--><br />
<br />
SOLUTION: 20<br />
1^2 + 6^2 = 37, 3^2 + 7^2 = 58, thus 4^2 + 2^2 = 20<br />
<br />
==== Other Source Code Comments ====<br />
<br />
On http://1029.io, the following comments could or can be found in the page's source code:<br />
<br />
!-- we'll be here, waiting. --><br />
<br />
&<br />
<br />
!-- <br />
Well, I //--/ED Mudokon/. But who// _____ r///u/ //? <br />
<br />
=== Third Hidden Asset98 URL Source Code Solutions ===<br />
<br />
Certain code strings & puzzle solutions found within the [http://wiki.gamedetectives.net/index.php?title=Oddworld_Soulstorm#Source_Code_Mysteries source code] for the third hidden Asset98 URL were not ultimately used in the course of arriving at the image locked behind them. These strings & solutions in include:<br />
<br />
The solution for the numbers <code>7777338883366899984477733 33</code>, which decode to <code>SEVENTYTHREE</code> via [http://www.dcode.fr/multitap-abc-cipher multi-tap cipher], was never applied.<br />
<br />
The following letter strings were never applied:<br />
<br />
<pre><br />
\\//\/KDIUTHANPUYHHDQOEPLNDOALJGUDITHBBDOZLGFERKJGLSAOE<br />
<br />
\////JUTYROSLNGNALEHGNWOTIQPOKSDNTPNOJAWEOBNGLAWKJNWNR <br />
<br />
\\\/\\JHWUITUHABSJGNEWKLALNVGJKWELKJLWQQPRUTJHJJSBFMMH<br />
</pre><br />
<br />
The following coordinate strings were never applied:<br />
<br />
<pre><br />
\\\\/\2,1:2.3,1:2.6,1:4.1,2:4.3,2:2.3,4:4.5,5:2.6,5:3.7,5:3.4,7:8.5,7:3.7,6:4.<br />
<br />
\///\//\1,1:3.4,1:2.6,1:9.2,2:2.6,2:2.2,4:4.3,5:2.5,5:2.7,5:3.4,7:3.6,7:2.7,7:2. <br />
<br />
\\//\\\/4,2:6.6,2:4.7,3:3.2,4:8.3,4:2.4,4:2.7,4:3.2,6:2.4,6:3.6,6:2.1,7:4.3,7:2.<br />
</pre><br />
<br />
The community speculates that these strings were not intended to be used but rather existed as "red herrings" in order to stall attempts to solve the grid. The only strings which were used were the ones which began with a forward slash ( / )<br />
<br />
=== Written Text on "Puzzle Pieces" Image ===<br />
<br />
Writing which was noticed written over the image on the puzzle pieces, but which is absent from the final released image. The significance of the writing remains unknown.<br />
<br />
<gallery mode="packed" widths=200px heights=300px><br />
File:Oddworld_1029-LY_letters.jpg|1029-LY "WHERE"<br />
File:Oddworld_7393-AN_letters.jpg|7393-AN "SO TIRED"<br />
File:Oddworld3786-IC_letters.jpg|3786-IC "WHO?"<br />
File:Oddworld_8291_circled.png|Complete Image "8291"<br />
</gallery><br />
<br />
=== Anomalies In First Released Image ===<br />
<br />
Hidden against the background of the first released image are several text strings, pictured below. Their significance is unknown.<br />
<br />
[[File:Oddworld_Complete_1_Iso.jpg|frameless|810px]]<br />
<br />
1101110BC<br />
100000BD or 100000BC <br />
010100BD</div>Halke234https://wiki.gamedetectives.net/index.php?title=Oddworld:_Soulstorm&diff=16662Oddworld: Soulstorm2018-07-30T22:20:47Z<p>Halke234: Even more cleanup.</p>
<hr />
<div>{{argbox<br />
| float = right<br />
| name = Oddworld: Soulstorm ARG<br />
| image = File:Oddworld_ABETHUMB_8291.jpg<br />
| imagewidth = 500<br />
| description= Oddworld: Soulstorm - An ARG centered around lore from the Oddworld universe linked to the currently unreleased game [http://www.oddworld.com/soulstorm/ Oddworld: Soulstorm]<br />
| creator = [http://www.oddworld.com/ Oddworld Inhabitants, Inc]<br />
| type = Official<br />
| status = Active<br />
| reopened = 05-30-2018<br />
| discovered = 12-22-2016<br />
}}<br />
{{ArgHeader}}<br />
{{BackToTop}}<br />
<br />
The Oddworld: Soulstorm ARG was an ARG centered around lore from the currently unreleased Oddworld game, [http://www.oddworld.com/soulstorm/ Oddworld: Soulstorm]. The official home page for the ARG, containing puzzles, hints, and clues, can be found [http://www.oddworld.com/soulstorm/ here]. The ARG was divided into 5 distinct stages, each of which began with a "transmission": an image clue that led to a series of puzzles.<br />
<br />
== Prelude ==<br />
<br />
Early in 2016, [https://twitter.com/edmudokon Twitter account @edmudokon] began posting cryptic messages that seemed to be related to the [http://www.oddworld.com/ Oddworld] universe. The account appeared to be run by an average Mudokon named Ed who claimed to have information he wanted to share, but he seemed to be in constant danger and could only access the outside world via a faint connection. Beginning around March 2016, @edmudokon engaged users with an elaborate series of puzzles and challenges, releasing information both on twitter and via the official Oddworld [http://www.oddworld.com/soulstorm/ website]. These puzzles eventually led to the revelation of a website, http://1029.io, as well as a message: "now you know. you can help. join us. together we can rise."<br />
<br />
The [http://1029.io 1029] webpage featured glitchy effects and another rendition of the ASCII-art logo, but with the numbers 8291 replacing some characters. At the bottom of the page was an e-mail signup form, above which was a message:<br />
<br />
<pre><br />
THE FALL OF RF1029 WAS THE SPARK TO IGNITE A REVOLUTION. FOR TOO LONG, THEY HAVE CONTROLLED THEIR GIANT INDUSTRIAL MACHINES, GRINDING THE BONES OF OUR KIND INTO DUST IN THEIR ENDLESS PURSUIT OF POWER AND WEALTH.<br />
<br />
WE WERE TAUGHT THAT THIS IS ALL THERE WAS: OBEY.<br />
<br />
THE TRUTH WAS HIDDEN FROM US. OUR HISTORY WAS HIDDEN FROM US. WE WERE BRED TO WORK, RAISED TO OBEY AND FORCED TO COMPLY.<br />
<br />
OUR NATURAL CONNECTION TO MOTHER PLANET WAS ERASED FROM THE CONSCIOUSNESS OF OUR PEOPLE. LOST WAS OUR KNOWING. LOST WAS OUR UNITY, OUR CONNECTION, OUR POWER AND OUR PURPOSE. ALL THAT WE WERE WAS A COMMODITY TO BE TRADED AND EXPLOITED IN THE ONGOING RACE FOR MORE WEALTH. WHAT WE SHOULD HAVE PROTECTED, WE WERE TRICKED INTO KILLING. WHAT WAS WORST FOR US, WE WERE TOLD WAS BEST. WE WERE TAUGHT TO TRUST THOSE WHO WOULD DECEIVE US THE MOST.<br />
<br />
THAT HAS ALL CHANGED.<br />
<br />
THE HERO HAS SHOWN ALL OF US THAT OUR OPPRESSORS CAN BE TOPPLED. HE HAS FOUND OUR WILD AND KNOWING BROTHERS. HE HAS RECONNECTED THE FACTORY-BORN TO OUR NATURAL WORLD AND ANCIENT WAYS. HE HAS LIT A FIRE IN OUR HEARTS THAT CANNOT BE EXTINGUISHED.<br />
<br />
WE WILL GIVE HELP TO THOSE WHO ARE HELPLESS. WE WILL LEND STRENGTH TO THOSE WHO ARE WEAK. WE WILL FIGHT FOR THOSE WHO ARE DEFEATED. OUR MOVEMENT WILL SPREAD LIKE A RAGING INFERNO AND WE WILL TAKE BACK THE POWER FROM THOSE WHO HAVE ABUSED IT.<br />
<br />
WE WILL NOT BE SILENCED BY THE MEDIA CIRCUS. WE WILL NOT BE IGNORED. WE WILL NOT STOP. WE WILL NOT OBEY. WE WILL RISE AND WE WILL RISE AGAIN, UNTIL WE HAVE BURNED THROUGH OUR TATTERED BONDS AND RAZED THE MACHINE TO THE GROUND.<br />
<br />
WE WILL RISE. JOIN US.<br />
<br />
THERE’S A STORM COMING.<br />
</pre><br />
<br />
In the source code for the page, only the letters E and D of the message remain capitalized.<br />
<br />
Later that day, the [https://twitter.com/SPIRITOF1029 Twitter account @SPIRITOF1029] revealed themselves as a "Clandestine organization dedicated to doing good on behalf of the Mudokons and revealing information about a new horror being perpetrated against their species." They also tweeted their first message, parroting the [http://1029.io 1029 URL] and adding their own message: "There is a storm coming. Join us."<br />
<br />
Social media feeds went dark until December, 2016, posting only reiterations of the URL with messages like "Rise up" and "We are the storm. Join us". Then, in January of 2017, activity on the accounts surged once again and the first hints of an ARG began to appear.<br />
<br />
[[File:Oddworld_Logo3.jpeg|thumb|left|Spirit of 1029 emerges with this sleek ASCII-art logo]]<br />
<br />
=== Smells like Mudokon Spirit ===<br />
<br />
The flurry of new activity in January mainly consisted of @edmudokon and @spiritof1029 conversing about about whether or not Ed would be able to help the organization's cause. At this point, the Spirit of 1029 made their message very clear, stating "Oddworld has been blind to the plight of the noble Mudokons for too long. We will rise. Join us! http://1029.io". More notable activity includes the organization's quip "We recommend knowledge of many different codes and ciphers - you never know who is listening. #learnyournameinmorsecodeday", hinting that the coming information would be encrypted in some way..<br />
<br />
Oddworld Inhabitants (Oddworld developers, [https://twitter.com/OddworldInc @OddworldInc on Twitter]) was contacted by the organization at this time, being told by Spirit of 1029 "We will help @edmudokon but we can't send anything unencrypted. You'll have to break our code. We'll be in touch." Very shortly thereafter, on January 19th, 2017, Spirit of 1029 tweeted: "We have received a transmission. We will pass it on as soon as we can verify. We need your help." and the [http://www.oddworld.com/soulstorm/ Oddworld Webpage] was updated with a download for two files.<br />
<br />
== The First Transmission ==<br />
<br />
The Spirit of 1029's first transmission came in the form of an image and an audio file. The image, pictured on the right as it looked upon transmission, appeared to show a tattered and burned document bearing the Spirit of 1029's logo with the slogan "We Will Rise," with many portions of text redacted. The text on the document, where it was legible and not redacted, reads:<br />
<br />
[[File:Oddworld_1029_Photo1_Dirty.jpeg|thumb|right|200x300px|The distorted image sent by the Spirit of 1029 as part of their first transmission]]<br />
<br />
<pre><br />
Date:<br />
Period: XXXXXXXXXXX<br />
Specification Details:<br />
XXXXXXXXXXXXXXXXXXXXXXXXXX<br />
-Observe XXXXXXX and XXXXXXXX changes in test subjects<br />
-Assess long term XXXXXXXX on XXXXXXX<br />
-Determine product safety<br />
Authorization: XXXXXXXXXXX<br />
Tests requested:<br />
-XXXXXXXX Pronostics<br />
- ?Access whenever? product XXXXXXX<br />
-Acidity Levels<br />
- ????? XXXXXXXXX<br />
-Product safety<br />
Expected results: XXXXXXXXXX make XXXXXXXXX interesting<br />
Test results:<br />
-XXXXXXX highly XXXXXX<br />
-XXXXXXX this XXXXXX ?? XXXXXX ?nice? XXXXXXXX<br />
-Highly XXXXXXX<br />
-Subjects: XXXXXX<br />
- XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX<br />
XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX<br />
XXXXXXXXXXXXXXXXXX<br />
Conclusion: Product (ready) for consumption <br />
--------------------------------------------------------------------------------------------<br />
??? : XXXXXXXX there is XXXXXX here but it will XXXX ???? XXXXX<br />
--------------------------------------------------------------------------------------------<br />
</pre><br />
<br />
[[File:Oddworld_1029_Photo1_Clean.jpeg|thumb|left|A cleaned up version of the Spirit of 1029's first transmission made by the community]]<br />
<br />
As progress was made on the puzzles, the [http://www.oddworld.com/soulstorm/#navfirstcontact official Oddworld webpage] was updated to provide hints. This practice continued throughout the ARG.<br />
<br />
[[File:Oddworld_Arrows_pad.png|thumb|right|200x300px|The cryptic arrows found along the right side of the first image sent to the community by the Spirit of 1029]]<br />
<br />
=== Directional Arrows, Pigpen, & Anglo-Saxon Runes ===<br />
<br />
In addition to the text in the photo, there were several areas featuring symbols and runes. Along the top of the document, [http://www.omniglot.com/images/writing/futhorc.gif Anglo-Saxon runes] spelled out <code>ED</code>. Along the bottom, the text <code>YOU ARE THE KEY YOU KNOW IT IF YOU WERE LISTENING</code> is spelled out in the font, [http://www.babelstone.co.uk/Fonts/Pigpen.html BabelStone Club Penguin pigpen]. Running along the right side of the image, [http://wiki.gamedetectives.net/images/0/0c/Oddworld_Arrows.png arrows] can be seen pointing in a number of different vertical, horizontal, and diagonal directions. Players discovered that the arrows could be decoded by taking their angle measurement and deducing an "alphanumeric" equivalent, or a number between 0-25 where each number represents a letter of the alphabet. It just so happened that each arrow had an angle which ended in a zero, and thus, the first "arrow cipher" decoded to:<br />
<br />
<pre><br />
12 15 15 11 6 15 18 15 21 18 13 5 19 19 1 7 5 8 5 1 18 15 21 18 22 15 9 3 5<br />
<br />
L O O K F O R O U R M E S S A G E H E A R O U R V O I C E<br />
</pre><br />
<br />
The message decodes to <code>LOOK FOR OUR MESSAGE HEAR OUR VOICE</code>.<br />
<br />
=== First Audio Clip ===<br />
<br />
The second part of the Spirit of 1029's first transmission consisted of an [http://www.oddworld.com/soulstorm/1029contact/1029_01_audio.mp3 audio clip] lasting 1:40. Hidden in the audio clip was reversed Morse code, which proved difficult to decode by ear due to the added white noise. Eventually, the code was cracked by using a spectrogram of the audio.<br />
<br />
[[File:Oddworld_Morse_Spectro.png|frameless|center|810px|]]<br />
<br />
Although rough in some spots, the decoded Morse read:<br />
<br />
<code style="word-break:break-all;word-wrap: break-word;">qmiqwmiqyidimrjqdjijilmxmnrjqdjajmpmnrprspkesmkjpdqjnyajnwsnrpgspcsppmqidimqymdbcqajnwsnrpgspcdhbzmnjajanadumjimrpq</code><br />
<br />
In addition, players also discovered that, using portions of the Morse already decoded accurately by ear, it was actually to be used as ciphertext in a shift cipher, and that the key to be used was "storm," which was taken from tweets made by Spirit of 1029 declaring themselves to be "the storm". The pigpen from earlier served as a hint to look back at previous communications in order decrypt the morse. With the newly-complete Morse code now in their possession, the community was finally able to accurately decipher the ciphertext they had obtained from the reversed Morse code. It read:<br />
<br />
<code style="word-break:break-all;word-wrap: break-word;">tentwentyninedotiononqexerdotiofoeserdsdaspjaepositoryforwardslashassetninetyeightforwardslashimgzerofofrfiueonedst</code><br />
<br />
<code>ten twenty nine dot io nonqexer dot io foeserdsdaspjaepository forwardslash asset ninety eight forward slash img zero fofrfiueonedst</code><br />
<br />
Although not entirely accurate, through trial and error the community was able to locate a new URL branch of http://1029.io, http://1029.io/repository/asset98/imgzerofourfiveone/.<br />
<br />
=== First Hidden URL ===<br />
<br />
[[File:Oddworld_PuzzleAttempt.jpg|thumb|right|The product of many attempts to correctly arrange the puzzle pieces found on the hidden http://1029.io URL]]<br />
<br />
The solution for the previous puzzle led players to a hidden [http://1029.io/repository/asset98/imgzerofourfiveone/ page] on the 1029 site. Each time the page was reloaded, it displayed one of 8 different images, and a string of text for each:<br />
<br />
<gallery mode="packed"><br />
File:Oddworld_7676-AL.JPG|7676-AL<br />
File:Oddworld_3786-IC.JPG|3786-IC<br />
File:Oddworld_9455-UM.jpg|9455-UM<br />
File:Oddworld_9394-AL.jpg|9394-AL<br />
File:Oddworld_7393-AN.jpg|7393-AN<br />
File:Oddworld_5574-PH.jpg|5574-PH<br />
File:Oddworld_2384-ER.jpg|2384-ER<br />
File:Oddworld_1029-LY.jpg|1029-LY<br />
</gallery><br />
<br />
Players quickly realized that the images appeared to be fragments of a larger puzzle. The Oddworld Inhabitants [http://www.oddworld.com/soulstorm/#navfirstcontact page] updated to read "Once you've got everything together - show us!". The completed image was tweeted out to @OddworldInc on January 19th, 2017, and the next day, [https://twitter.com/OddworldInc/status/822686854516535298 instructed] players to wait while they cleaned up the complete image.<br />
<br />
<br><br><br />
<br />
[[File:Oddworld_Photo1_Clean1.jpeg|thumb|left|250x250px|Photograph of the final image before it was torn into the pieces the community was given, sent out with a message from Oddworld Inhabitants to hang tight until Thursday.]]<br />
<br />
=== First Unlocked Photo ===<br />
<br />
[[File:Oddworld_Finished1.jpg|thumb|right|400px|The final image, sent by the Spirit of 1029 and received by the community through Oddworld Inhabitants Twitter account. The image was confirmed to be an in-Unity render of the upcoming Oddworld: Soulstorm & created in conjunction with Cyrus McWilliams, formerly of Blur, and Fat Kraken Studios in England]]<br />
<br />
[[File:Oddworld_Pada.jpg|thumb|left|400px|The second transmission sent out by the Spirit of 1029, identical to the first released image but with various codes hidden within]]<br />
<br />
While waiting, players began to decode the second transmission. The prevalent writing was later verified to read "Who?", "Where?", "So Tired", and a set of numbers likely to be "8291". <br />
<br />
After three days, @OddworldInc [https://twitter.com/OddworldInc/status/823520771893030912 tweeted out a scrambled image], pictured left, stating "We received something and there's one last thing we need you to do. Share it. Spread the word.". The next day, after the tweet gained 100 shares, they tweeted the [https://twitter.com/OddworldInc/status/823620565458108416 image] again, pictured left, this time unscrambled. They then stated <code>While you shared our message 100 times we worked away to bring you this. We're clearing it up even more, we'll share what we find Thursday</code>, while the webpage was updated with the message "Update 5: Thanks to you guys sharing the previous images online, we've managed to decode the photo further and have updated the thumbnail here. We'll return on Thursday with the finished, fully decrypted image - but until then, please do let us know what you think!" When Thursday came @OddworldInc [https://twitter.com/OddworldInc/status/824638147703296000 tweeted out a final picture] of a render from the upcoming Oddworld: Soulstorm, pictured right, in all its unscrambled un-cropped glory. The release of this image signaled the end of the first of five phases of content release Oddworld Inhabitants have planned.<br />
<br />
<br><br><br><br><br />
<br />
== The Second Transmission ==<br />
<br />
[[File:Oddworld_Pada_sofar.jpg|thumb|right|400px|Hidden details in the second transmission]]<br />
<br />
On Feburary 2nd, 2017, the Spirit of 1029 again reached out to players, saying via Twitter that "Our agent has delivered another transmission. We will verify its origins and pass it on." Several hours later, @OddworldInc tweeted the message "We were just contacted again. Don't go anywhere, we might need your help with this...", and the [http://www.oddworld.com/soulst Official Oddworld Site] was updated with a message as well as [http://www.oddworld.com/soulstorm/1029contact/pada.jpg an image], pictured left. In addition to the image, a [http://us3.campaign-archive2.com/?u=2b6dca21053bc375cbdad7077&id=b08e7b2d60&e=6a2b5665ee newsletter] was sent out to everyone who signed up to the 1029 email list. The newsletter featured basic info about the ARG so far, as well as a barcode at the very bottom, which, when scanned, reveals a code:<br />
<br />
<code><br />
Ivzw gsv mfnyvih pmld gsv gifgs<br />
</code><br />
<br />
When passed through a cryptogram solver, the message read:<br />
<br />
<code><br />
READ THE NUMBERS KNOW THE TRUTH<br />
</code><br />
<br />
An [http://wiki.gamedetectives.net/images/thumb/5/56/Oddworld_Pada_sofar.jpg/800px-Oddworld_Pada_sofar.jpg "in-progress" image], pictured on the right, highlighted the hidden details found at the time and outlined their currently known solutions.<br />
<br />
=== Morseception ===<br />
<br />
The Morse code in the image turned out to be fragments of a larger single code, seen below pieced back together:<br />
<br />
[[File:Oddworld_MorseAlign_TrueHeresy.png|frameless|center|810px|Image of all the Morse code segments pieced together]]<br />
<br />
When decrypted, the morse resulted in the following message:<br />
<br />
<code><br />
DASHDOTDOTDOT DOT DASH DOTDOTDOTDOT DOT DOTDOTDOT DASH DASHDASHDASHDASH DOTDASHDOT DASHDASH<br />
</code><br />
<br />
This was found to yet again be morse code, which decoded to:<br />
<br />
<code><br />
-... . - .... . ... - --- .-. --<br />
<br />
BETHESTORM<br />
</code><br />
<br />
=== Braille & Upside-down Pigpen ===<br />
<br />
[[File:Oddworld_Brialle.png|thumb|right|250px|Braille code found in the second Spirit of 1029 transmission]]<br />
<br />
A [http://wiki.gamedetectives.net/images/a/a4/Oddworld_Brialle.png message in Braille], pictured right, in the bottom-left of the image read <code>Spread our message</code>. The Babelstone pigpen code, when flipped upside down:<br />
<br />
[[File:Oddworld_UpsideDownPigpen.jpg|frameless|center|810px|Upside-down Babelstone Pigpen code]]<br />
<br />
decoded to:<br />
<br />
<code><br />
KNOW YOUR CODES<br />
<br />
KEEP THEM CLOSE<br />
<br />
YOU WILL NEED THEM<br />
</code><br />
<br />
[[File:Oddworld_BarcodeCube.png|thumb|left|400px|The "data cube" from the second image, later determined to be two barcodes interlaced with one another, one running horizontally and the other vertically]]<br />
<br />
=== Directional Arrows Puzzle ===<br />
<br />
Using the [http://wiki.gamedetectives.net/index.php?title=Oddworld_Soulstorm#Directional_Arrows_Puzzle], these arrows decoded to:<br />
<br />
<pre><br />
7 14 9 8 20 25 18 5 22 5 5 4 15 3 5 4<br />
H O J I U Z S F W F F E P D F E<br />
</pre><br />
<br />
Players found the above ciphertext to be encrypted with a Caesar cipher set to a shift of 25, and revealed the message: <code>GNIHTYREVEEDOCED</code>, which is <code>DECODE EVERYTHING</code> backwards.<br />
<br />
=== Interlaced Barcodes & Second Hidden URL ===<br />
<br />
[[File:Oddworld_Grid.jpg|thumb|right|250x250px|The image found on the second hidden URL discovered by the community, which depicts the Spirit of 1029's logo chopped up and re-arranged on a 7x7 grid]]<br />
<br />
The community speculated that the [http://wiki.gamedetectives.net/images/3/30/Oddworld_BarcodeCube.png strange box in the bottom-right of the image] sent by the Spirit of 1029, pictured left, was a fragmented barcode. After a massive amount of tinkering, the two barcodes were [http://imgur.com/a/YmAH2 correctly assembled] and, when scanned, led to the discovery of two messages:<br />
<br />
<code><br />
http://www.1029.io/repository/asset98/<br />
</code><br />
<br />
and<br />
<br />
<code><br />
findawayshowthetruth<br />
</code><br />
<br />
Combining these messages into a single URL led players to another hidden [http://www.1029.io/repository/asset98/findawayshowthetruth/ page] on the 1029 website, which displayed a [http://www.1029.io/repository/asset98/findawayshowthetruth/grid.jpg distorted version] of the Spirit of 1029 logo, pictured right.<br />
<br />
=== Source Code Mysteries ===<br />
<br />
Players discovered an extensive message containing several presently-unsolved puzzles is written hidden in the source code of the second hidden page. It read:<br />
<br />
<pre><br />
!-- <br />
<br />
Can’t reach any..<br />
<br />
<br />
Listening anyon… there?<br />
<br />
<br />
Can hear us anymore- need to… can’t fnd <br />
<br />
<br />
We will never give… what they… from us<br />
<br />
A9539 \\<br />
<br />
B2919 /\\<br />
<br />
C4882 /\<br />
<br />
D4627 \<br />
<br />
E6758 \<br />
<br />
F???? ////<br />
<br />
<br />
/\//\\//5,1:4.1,2:8.1,3:2.3,3:2.4,3:3.7,3:3.1,5:3.4,5:9.5,5:2.7,5:4.7,6:6.3,7:3.<br />
<br />
<br />
<br />
<br />
Does… care? Freedom isn’t gi… will take…<br />
<br />
We have never…. Given… deserve. We… take… our righ…<br />
<br />
\\//\/KDIUTHANPUYHHDQOEPLNDOALJGUDITHBBDOZLGFERKJGLSAOE<br />
<br />
Stand up and fi…<br />
<br />
<br />
Don’t be afr….<br />
<br />
<br />
<br />
\////JUTYROSLNGNALEHGNWOTIQPOKSDNTPNOJAWEOBNGLAWKJNWNR <br />
<br />
E=5OUEHRA? <br />
<br />
<br />
<br />
\\\\/\2,1:2.3,1:2.6,1:4.1,2:4.3,2:2.3,4:4.5,5:2.6,5:3.7,5:3.4,7:8.5,7:3.7,6:4. <br />
<br />
7777338883366899984477733 33 <br />
<br />
<br />
<br />
<br />
They want to… kill- don’t-<br />
<br />
<br />
Stop them from…. Hurting- they… think<br />
<br />
We are no less- they think… aside<br />
<br />
<br />
Don’t believe what… told- liars…<br />
<br />
A5989 \\<br />
<br />
B5176 \<br />
<br />
C2863 \<br />
<br />
D2558 //\<br />
<br />
E3413 \<br />
<br />
<br />
F???? ////<br />
<br />
<br />
<br />
Can’ fnd anymo-<br />
<br />
<br />
We wil silnced<br />
<br />
<br />
<br />
<br />
<br />
<br />
Killin- they are dy..<br />
<br />
\\\/\\JHWUITUHABSJGNEWKLALNVGJKWELKJLWQQPRUTJHJJSBFMMH <br />
<br />
Hurting the..<br />
<br />
Back down unt… resist.<br />
<br />
<br />
Intercep… our messa… we will fight<br />
<br />
///\\/JQEABTVKNUCSEYCMBILDKOSCYSITECPAGFAXHKETJNZURWCIE <br />
<br />
We will ri…<br />
<br />
Cannot… silenced when ther… who need… now<br />
<br />
<br />
We won’t ba… we have beat…. Before… Must not-<br />
<br />
<br />
<br />
<br />
\///\//\1,1:3.4,1:2.6,1:9.2,2:2.6,2:2.2,4:4.3,5:2.5,5:2.7,5:3.4,7:3.6,7:2.7,7:2. <br />
<br />
<br />
<br />
Spent so long…. Afraid… never let- again<br />
<br />
<br />
...Storm… find it’s way- end<br />
<br />
<br />
Why are … here?<br />
<br />
<br />
<br />
<br />
Only...profit- nothing more… importnt as- <br />
<br />
- lies they… will tel-<br />
<br />
Believe- nothing… terribl- things… <br />
<br />
\\//\\\/4,2:6.6,2:4.7,3:3.2,4:8.3,4:2.4,4:2.7,4:3.2,6:2.4,6:3.6,6:2.1,7:4.3,7:2.<br />
<br />
--><br />
</pre><br />
<br />
At the time, only a few portions of this message have been successfully solved. <br />
<br />
The ABCDEF puzzles was solved using the rules of [https://en.wikipedia.org/wiki/Mastermind_(board_game) Mastermind], a popular board game. Players assumed that a backslash ( \ ) indicated a partial match and a forward slash ( / ) indicated a full match, as shown below:<br />
<br />
<pre><br />
A9539 \\<br />
<br />
B2919 /\\<br />
<br />
C4882 /\<br />
<br />
D4627 \<br />
<br />
E6758 \<br />
<br />
F???? ////<br />
</pre><br />
<br />
Had a solution of <code>F8992</code>, and:<br />
<br />
<pre><br />
A5989 \\<br />
<br />
B5176 \<br />
<br />
C2863 \<br />
<br />
D2558 //\<br />
<br />
E3413 \<br />
<br />
F???? ////<br />
</pre><br />
<br />
Had a solution of <code>F8554</code>. The purpose of these solutions was unknown.<br />
<br />
Players found the numbers <code>7777338883366899984477733 33</code> to be encoded with a [http://www.dcode.fr/multitap-abc-cipher multi-tap cipher] (cellphone numberpad), and can be decoded to <code>SEVENTYTHREE</code>. the purpose of this solution was also unknown.<br />
<br />
The <code>E=5OUEHRA?</code> portion was partially solved. Players found that the letters <code>O U E H R A</code> were all the second letters from each day of the week, I.E. M'''o'''nday, T'''u'''esday, W'''e'''dnesday, etc. This indicated a solution of <code>U</code> for the question mark, as in S'''u'''nday, making the full string <code>E=5OUEHRAU</code>. The <code>E=5</code> portion of the text remains unsolved.<br />
<br />
Also remaining unsolved are the coordinates found in the code, as well as the letter strings:<br />
<br />
[[File:Oddworld_Grid.jpg|thumb|right|250x250px|The 7x7 grid found on the second hidden URL, likely to be used with the coordinates & letter strings in some way]]<br />
<br />
<pre><br />
Coordinates<br />
<br />
/\//\\//5,1:4.1,2:8.1,3:2.3,3:2.4,3:3.7,3:3.1,5:3.4,5:9.5,5:2.7,5:4.7,6:6.3,7:3.<br />
<br />
\\\\/\2,1:2.3,1:2.6,1:4.1,2:4.3,2:2.3,4:4.5,5:2.6,5:3.7,5:3.4,7:8.5,7:3.7,6:4.<br />
<br />
\///\//\1,1:3.4,1:2.6,1:9.2,2:2.6,2:2.2,4:4.3,5:2.5,5:2.7,5:3.4,7:3.6,7:2.7,7:2. <br />
<br />
\\//\\\/4,2:6.6,2:4.7,3:3.2,4:8.3,4:2.4,4:2.7,4:3.2,6:2.4,6:3.6,6:2.1,7:4.3,7:2.<br />
</pre><br />
<pre><br />
Letter Strings<br />
<br />
\\//\/KDIUTHANPUYHHDQOEPLNDOALJGUDITHBBDOZLGFERKJGLSAOE<br />
<br />
\////JUTYROSLNGNALEHGNWOTIQPOKSDNTPNOJAWEOBNGLAWKJNWNR <br />
<br />
\\\/\\JHWUITUHABSJGNEWKLALNVGJKWELKJLWQQPRUTJHJJSBFMMH<br />
<br />
///\\/JQEABTVKNUCSEYCMBILDKOSCYSITECPAGFAXHKETJNZURWCIE<br />
</pre><br />
<br />
=== Stuck In The Mud & Third Hidden URL ===<br />
<br />
After many failed attempts by players to decode the contents of the message using the hints of Spirit of 1029, a player found something unusual about one of the account's most recent tweets, which said:<br />
<br />
<pre><br />
When you have the key, you need the correct lock. hgehgeoeregpineechqnhgeevtipcvreovxgvge<br />
Shake loose the bonds that hold you. #wewillrise<br />
</pre><br />
<br />
Players noted that the text <code>hgehgeoeregpineechqnhgeevtipcvreovxgvge</code> could be decoded via a [http://www.braingle.com/brainteasers/codes/keyword.phpsubstitution keyword cipher] with the key <code>subjectivism</code>, and reveals the message:<br />
<br />
<pre><br />
oneoneseventhreefouroneeightfivesixnine<br />
</pre><br />
<br />
Using this solution, players quickly found another secret [http://www.1029.io/repository/asset98/1173418569/ page] on the 1029 hub.<br />
<br />
=== Creepy Scenes From Within ===<br />
<br />
This new URL features a different image each time the page is reloaded, much like the [http://1029.io/repository/asset98/imgzerofourfiveone/ first hidden URL] discovered in the ARG. In total, 13 scrambled images appear frequently (file prefix WB) and up to 13 CLEAR immages appear only very rarely (file prefix CWB). They are all pictured below with their respective filenames.<br />
<br />
<gallery mode="packed"><br />
File:Oddworld_WB1_HEND8243.jpg | WB1_HEND8243<br />
File:Oddworld_WB2_BSJG2456.jpg | WB2_BSJG2456<br />
File:Oddworld_WB3_INFG2861.jpg | WB3_INFG2861<br />
File:Oddworld_WB4_HBQD2962.jpg | WB4_HBQD2962<br />
File:Oddworld_WB5_SJKW4167.jpg | WB5_SJKW4167<br />
File:Oddworld_WB6_OWUI2056.jpg | WB6_OWUI2056<br />
File:Oddworld_WB7_MNCH1101.jpg | WB7_MNCH1101<br />
File:Oddworld_WB8_RDHRHAHA.jpg | WB8_RDHRHAHA<br />
File:Oddworld_WB9_D34DM337.jpg | WB9_D34DM337<br />
File:Oddworld_WB10_BDJW8411.jpg | WB10_BDJW8411<br />
File:Oddworld_WB11_WHAT8291.jpg | WB11_WHAT8291<br />
File:Oddworld_WB12_PADAPADA.jpg | WB12_PADAPADA<br />
File:Oddworld_WB13_VLAP3662.jpg | WB13_VLAP3662<br />
</gallery><br />
<gallery mode="packed"><br />
File:Oddworld_CWB1_0BE01647.JPG | CWB1_0BE01647<br />
File:Oddworld_CWB2_0DG02966.JPG | CWB2_0DG02966<br />
FILE:Oddworld_CWB4_WHATISTHIS.JPG | CWB4_WHATISTHIS<br />
File:Oddworld_CWB5_NEEDLEINAHAYSTACK.JPG | CWB5_NEEDLEINAHAYSTACK<br />
File:Oddworld_CWB6_ARG-H.JPG | CWB6_ARG-H<br />
File:Oddworld_CWB7_82918291829182918291.JPG | CWB7_82918291829182918291<br />
File:Oddworld_CWB8_0GE03866.JPG | CWB8_0GE03866<br />
File:Oddworld_CWB9_0IE02565.JPG | CWB9_0IE02565<br />
File:Oddworld_CWB10_AbeAndNEEDLESFunAdventures.JPG | CWB10_AbeAndNEEDLESFunAdventures<br />
File:Oddworld_CWB11_02500356.JPG | CWB11_02500356<br />
File:Oddworld_CWB12_02323hjfhfhfhfhASDF.JPG | CWB12_02323hjfhfhfhfhASDF<br />
File:Oddworld_CWB13_insertcodehere.JPG | CWB13_insertcodehere<br />
</gallery><br />
<br />
<br />
The community is currently ravenously devouring these images. While their purpose is presently not known, it is likely another jigsaw puzzle-type activity which will require the images to be stitched together in order for the next piece of information to be obtained. The website then exploded... Please hold.<br />
<br />
After a [http://wiki.gamedetectives.net/images/0/09/Oddworld_Phase_One.png series] of [http://wiki.gamedetectives.net/images/e/e0/Oddworld_Phase_Two.png interesting updates], the [http://www.1029.io/repository/asset98/1173418569/ newly discovered URL] went dark, with the header reading <code>ASSET98: TERMINATED.</code> and a source code which reads <code>!-- see ya around, 1029... --></code>. Twitter account [https://twitter.com/edmudokon @Edmudokon], after a stint of silence, also [https://twitter.com/edmudokon/status/829079318290694144 tweeted out a new message]:<br />
<br />
<pre><br />
what happened? what did you do? who? No! no... aaaaaAaaaaarrrRrrrgggggGgghhh!<br />
</pre><br />
<br />
And with that, it seems Ed.... is dead! The community has a lot to ponder, and even more to understand. Where do they go from here? Are they being punished for their devilish use of scripts to rapidly reveal the rarer images? Much has been destroyed, and with it much will be learned.<br />
<br />
=== From The Ashes, Asset 99 (Hidden URL 3.5) ===<br />
<br />
[[File:Oddworld_OrangeLightning_V2.jpg|thumb|right|A very convincing collage of the images seen pictured on the now-dark Asset 98 URL; what is going on in the image remains unknown]]<br />
<br />
After the sudden, colorful loss of Asset98, the community was quick to rebound, stumbling across a reboot of Asset98, http://www.1029.io/repository/asset99/1173418569/, not moments later! This page appears to be a functional offshoot of the Asset98 page, however it does not appear capable of displaying the rarer, clear images sometimes displayed by the Asset98 iteration. The page comes with a threatening message: "We will not be stopped. We may have lost Asset 98, but we will continue strong. Together. Against the machines. Help us to expose this latest crime against Mudokonkind." Perplexing... The [http://www.oddworld.com/soulstorm/#navfirstcontact Official Oddworld Webpage] also updated at this time requesting help with putting the pieces together. Thus, another jigsaw-puzzle with the pieces above is commenced, the latest of which can be seen pictured on the right.<br />
<br />
However, in the midst of the collage-related updates, the @Spiritof1029 Twitter account posted:<br />
<br />
<pre><br />
We can't reach Asset 98 but we do still have his clear transmissions. Prove you're worthy. Show us that you're able. Send us the grid. You found the grid, the letters and the numbers. Tell us how they fit together. Prove you're no longer slaves to the machines.<br />
</pre><br />
<br />
With this message, it appears two roads to success may have opened, one in which the cleaned-up images saved before Asset98 went dark are assembled, and a second in which a foray back into the [http://wiki.gamedetectives.net/index.php?title=Oddworld_Soulstorm#Source_Code_Mysteries source code grid challenge] seems to be required.<br />
<br />
With that in mind, the assembled image was [https://twitter.com/OddworldInc/status/829336580347326465 Tweeted at OWI] and they replied, stating "You've given us enough for us to get to work cleaning up the image, we'll have something by tomorrow. Don't stop looking for the truth!" So, while work on the grid slowly continues, the community awaits the next day's clean image.<br />
<br />
=== Second Unlocked Image & Grid Solution ===<br />
<br />
[[File:Oddworld_RandomiserDizma.jpg|thumb|right|The solved grid, which reveals the word "subjectivism" (first letter of each section connected in the correct order), the key used to decode the string which led to the discovery of the third hidden Asset98 URL]] <br />
<br />
[[File:Oddworld_Second_Final.jpg|thumb|left|400px|The final image cleaned up & released by OWI a day after the collage was submitted]]<br />
<br />
True to their word, on the following day, OWI [https://twitter.com/OddworldInc/status/829715069235781632 Tweeted out a clean image], pictured on the left, which seems to depict quite a gruesome scene, featuring a wide-eyed Mudkon strapped to an operating table facing an onslaught of needles and next to a vat which reads "SS Brew". The community also learned some important information about Ed, who, until now, was presumed to be killed during the implosion of Asset 98. Via [https://twitter.com/edmudokon @Edmudokon on Twitter], Ed let us know that he made it out alive, but that his friend was not so lucky, with the message: "...he never came back. I could hear him screaming all night... helpless. they took him... he was my friend. how did they know?"<br />
<br />
Shortly after the second photo was received by the community, [https://twitter.com/SPIRITOF1029/status/830004742713638912 partial progress] was finally made on [http://wiki.gamedetectives.net/index.php?title=Oddworld_Soulstorm#Hidden_Barcodes_.26_Second_Hidden_URL the grid], which up until then remained unsolved. Dizma discovered that the coordinates could be applied to the grid using the rules of the Japanese puzzle game [https://en.wikipedia.org/wiki/Shikaku Shikaku] (#'s after the colons in the coordinates represent box sizes, which are the lines drawn in red). Randomiser was then able to successfully apply a letter string to the sliced-up cube, pictured right, from with the word <code>subjectivism</code> can be derived. It is worthy of note that the strings used to ultimately arrive at the correct solution were the only strings which began with a forward slash ( / ). This word was the [http://wiki.gamedetectives.net/index.php?title=Oddworld_Soulstorm#Stuck_In_The_Mud_.26_Third_Hidden_URL key previously used] to decode the third hidden Asset98 URL. However, whether the key was intended to remain hidden until the grid was solved or intentionally encoded in such a way as to allow for cracking is unknown.<br />
<br />
== The Third Transmission ==<br />
<br />
After some waiting, on Feburary 23rd, OWI [https://twitter.com/OddworldInc/status/834856085949394944 sent out a tweet] indicting they had again been contacted by the Spirit of 1029. New files became available on the [http://www.oddworld.com/soulstorm/ main Oddworld website]. The files are inside of a password-protected .ZIP file with the filename <code>89928554_Eequals5.zip</code>, meaning in order to extract the files, the proper password must be provided. This password can be the same for each file, or could vary from file to file. <code>8992</code>, <code>8554</code>, and <code>E=5</code> are all [http://wiki.gamedetectives.net/index.php?title=Oddworld:_Soulstorm#Third_Hidden_Asset98_URL_Source_Code_Solutions unused clues] from the previous source code mysteries. Within the .ZIP file are six files, four of which are .JPGs, one of which is a .PNG, and the last of which is a .TXT. Their filenames are:<br />
<br />
<code><br />
flyer1.jpg, flyer2.jpg, flyer3.jpg, Oddworld_Soulstorm_002_HD.jpg, toollist.txt, & vital.png<br />
</code><br />
<br />
The name of the zip suggested that we should use letter equivalencies to their alphabetic indexes as the password. This was attempted, giving the password <code>HIIBHEED</code> but in fact, the password was actually <code>HIIDHEED</code> for unknown reasons.<br />
<br />
=== Steganograpy Blitz & toollist.txt ===<br />
<br />
The file [http://pastebin.com/feuVh6wr toollist.txt] contained a repeating string consisting of names of moons in our solar system. Interrupting the string periodically are forward slashes. If the letters after each slash are taken and combined, they form the string <code>useSsuitePicselSecuritySaveus</code>. This is a clue that there is data hidden via [https://en.wikipedia.org/wiki/Steganography steganography]. When trying to detect data hidden using this technique, it is vital to decrypt using to same method as was used to encrypt, which is why the clue to use [http://www.ssuitesoft.com/ssuitepicselsecurity.htm Ssuite Picsel Security], specific image steganography software, is so important.<br />
<br />
When the file <code>Oddworld_Soulstorm_002_HD.jpg</code> is taken as the original and <code>vital.png</code> is taken as the target using Ssuite Picsel Security, the output is<br />
<pre style="word-break:break-all;word-wrap: break-word;">BmzPmbtzueMfxmeBdayqftqgeBmzpadmQbuyqftqgeVmzgeMqsmqazYuymeYqftazqMzftqBmxxqzqQzoqxmpgeFqftkeFqxqefaOmxkbeaPuazqTqxqzqBaxkpqgoqeDtqmFufmzTkbqduazUmbqfgeWuhugcUvudmcBtaqnqBmmxumcEwmftuMxnuadujNqntuazzQddumbaEwaxxEumdzmcFmdcqcSdqubTkddawwuzVmdzemjmFmdhaeYgzpuxrmduNqdsqxyudZmdhuEgffgzsdTmfuRmdnmgfuFtdkydMqsudNqefxmEgdfgdWmduKyudXasqRadzvaf</pre><br />
When deciphered using a [http://rumkin.com/tools/cipher/caesar.php Caesar cipher] with N=14, the following cleartext can be obtained:<br />
<pre style="word-break:break-all;word-wrap: break-word;">PanDaphnisAtlasPrometheusPandoraEpimetheusJanusAegaeonMimasMethoneAnthePalleneEnceladusTethysTelestoCalypsoDioneHelenePolydeucesRheaTitanHyperionIapetusKiviuqIjiraqPhoebePaaliaqSkathiAlbiorixBebhionnErriapoSkollSiarnaqTarqeqGreipHyrrokkinJarnsaxaTarvosMundilfariBergelmirNarviSuttungrHatiFarbautiThrymrAegirBestlaSurturKariYmirLogeFornjot</pre><br />
These names are all of the named moons of Saturn except <code>Erriapus</code> and <code>Fenrir</code> which are missing. <code>Erriapus</code> is replaced by <code>Erriapo</code> which was the original name of the moon, before being changed in 2007.<br />
<br />
=== Cleaned-Up Flyers ===<br />
<br />
[[File:Oddworld_Malachim.gif|thumb|right|295x72px|The Malachim alphabet used in this puzzle.]]<br />
<br />
The images that we received of the Sligs' flyers were corrupted, and were cleaned up by members of the community so they were in a readable state.<br />
<gallery widths=180px><br />
File:Oddworld_flyer1_clean.jpg|A cleaned up version of flyer1.jpg<br />
File:Oddworld_flyer2_clean.jpg|A cleaned up version of flyer2.jpg<br />
File:Oddworld_flyer3_clean.jpg|A cleaned up version of flyer3.jpg<br />
</gallery><br />
A member of the community found that the pigpen cipher on the left side of flyer1.jpg gives the string<code>AOCXY SIO</code>, which when shifted using a [http://rumkin.com/tools/cipher/caesar.php Caesar cipher] with N=6 yields <code>GUIDE YOU</code>.The cipher on flyer2.jpg gave the string <code>FYNNBYNBCHANBUNM</code> which, when shifted in the same manner as before, yields <code>LETTHETHINGTHATS</code>. This final one on flyer3.jpg gave the string <code>GCMMCHA</code> which is again shifted in the same manner as before to yield <code>MISSING</code>.<br />
All three of the pigpen strings can be combined to form a message: <code>LET THE THING THAT'S MISSING GUIDE YOU</code><br />
<br />
Additionally, sequences of <code>x</code> and <code>o</code> characters are seen. A community member noticed that this could be interpreted as morse code in the following format (with x as dash, o as dot):<br />
x oooo o xoxx ox oxo o oxx ox x xoxo oooo oo xo xxo<br />
xooo o x oooo o ooo x xxx oxo xx <br />
oxx o oxx oo oxoo oxoo oxo oo ooo o<br />
<br />
becomes:<br />
<br />
/- .... . -.--/.- .-. ./.-- .- - -.-. .... .. -. --./<br />
/-... ./- .... ./... - --- .-. --/<br />
/.-- ./.-- .. .-.. .-../.-. .. ... ./<br />
<br />
which decodes to <code>THEY ARE WATCHING BE THE STORM WE WILL RISE</code><br />
<br />
Also on the flyers, there were strange symbols, with red numbers alongside them. The symbols were from the Malachim alphabet, pictured right.<br />
<br />
=== Fourth & Fifth Hidden URLs ===<br />
<br />
After a short search, the community, using the clue to use whats missing as a guide to hone their focus the moon <code>Erriapo</code>, since it is in the steganography text but not the toollist.txt file (ie missing). Grom the name the numbers <code>12 36 28 31 52 22 12</code> are derived by using the previously-discovered Malachim alphabet symbols and the numbers pictured next to each symbol on the three flyers. A clue indicating this is the correct method is a [https://twitter.com/SPIRITOF1029/status/835149069601419264 tweet from Spirit of 1029] which can be decoded to <code>P=22</code>. It was then discovered that affixing these numbers to the end of the http://www.1029.io/repository/asset99/ URL yielded [http://www.1029.io/repository/asset99/12362831522212/ a new webpage],http://www.1029.io/repository/asset99/12362831522212/. This page is headed by an obscured URL, <code>ASSET9X / [REDACTED] / 333333333333</code>, and shows one of three images each time the page is refreshed, pictured below.<br />
<br />
<gallery mode="packed"><br />
File:Oddworldd_YOU.jpg|YOU.jpg<br />
File:Oddworld_WHA.jpg|WHA.jpg<br />
File:Oddworld_WET.jpg|WET.jpg<br />
</gallery><br />
<br />
The page also contains a message:<br />
<br />
<pre><br />
We can't hold much longer.<br />
It's dark, and cold. So cold. They don't seem to [REDACTED]. They. Them. It's hard to know how we'll [REDACTED], but we'll try. This can't last forever. We won't last forever.<br />
Look what they're doing to us. Just look.<br />
There is spirit, but it's waining. We need you, [REDACTED]. Help us.<br />
</pre><br />
<br />
Around this time, [http://www.1029.io/repository/asset99/71220283136/ another hidden URL] was unearthed, http://www.1029.io/repository/asset99/71220283136/, derived in the same manner as the Erriapo URL but using the moon <code>Fenrir</code> . This URL bears the same obscured URL header and message as the last page, and also displays one of three images each time the page is refreshed, pictured below:<br />
<br />
<gallery mode="packed"><br />
File:Oddworld_OLD.jpg|OLD.jpg<br />
File:Oddworld_TIF.jpg|TIF.jpg<br />
File:Oddworld_TOO.jpg|TOO.jpg<br />
</gallery><br />
<br />
The community, pondering these new images, began to notice some things. The filenames, if pieced together into a single string, read:<br />
<br />
<code><br />
WHATIFWETOLDYOUTOO<br />
<br />
WHAT IF WE TOLD YOU TOO<br />
</code><br />
<br />
== The Horror Is Shown In Full ==<br />
<br />
The puppet masters kept pushing us in the right direction, until finally a few people managed to find the link. However, adhering to the rules of the arg, the link could not be shared, rather, enough people had to discover the link in order for it to be shared. After enough people had found the link, [http://www.1029.io/whatifwetoldyoutoo/ the link] was shared:<br />
<br />
People figured out that the solution was much simpler, and that "what if we told you too" should be put at the end of the URL of 1029.io, producing:<br />
http://www.1029.io/whatifwetoldyoutoo<br />
[[File:What_if_we_told_you_too_pre_edit.png|thumb|right|400x200px|The first page before it's eventual sharing.]]<br />
<br />
This contained some other source code hints, <code>BDBDBDBDBDBDBDBBDBDBDBDBDBD</code>, <code>###BELIKEDET###</code> and <code>doYOUsee? think of a number, any number.</code><br />
<br />
Detectives using these hints, as well as the text on the page, figured out the next url to be:<br />
http://www.1029.io/whatifwetoldyoutoo/8291/ by adding 8291 to the end.<br />
This link leads to the [https://www.youtube.com/watch?v=2l4jZVTUoak/ 4 second video] of the previous photo, depicting how severe the torture has been to the mudokon. Horrible things.<br />
<br />
Eagle eyed viewers have noticed that 3 different codes pop up on certain frames of the video, but these were later found to be unimportant, with the exception of one of the rune languages, which would reappear in the next transmission.<br />
<br />
== The 4th Transmission ==<br />
<br />
After the horror of the 3rd transmission, [http://www.oddworld.com/soulstorm/findit.jpg the next image would be released not shortly after], depicting a montage of the past three transmissions. In it, there are 2 separate codes:<br />
<br />
The Morse code, which decodes as <code> USE A DIFFERENT CODE. THIS IS NOT RELEVANT DATA. DO NOT COMPLY. DO NOT OBEY. THEY LIE. </code><br />
The Runes on the left hand side and the ones partially cut off at the top and bottom(as previously seen in the video) were decoded by using file data in a hex editor, which would say:<br />
<br />
<br><br />
<br />
<tt><br />
<code><rdf:li photoshop:LayerText="WE WERE TAUGHT THAT THIS IS ALL THERE WAS: WORK, OBEY, COMPLY. THE TRUTH WAS HIDDEN FROM US. OUR HISTORY WAS HIDDEN FROM US. WE WERE BRED TO WORK, RAISED TO OBEY AND FORCED TO COMPLY. OUR NATURAL CONNECTION TO MOTHER PLANET WAS ERASED FROM THE CONSCIOUSNESS OF OUR PEOPLE. LOST WAS OUR KNOWING. LOST WAS OUR UNITY, OUR CONNECTION, OUR POWER AND OUR PURPOSE. ALL THAT WE WERE WAS A COMMODITY TO BE TRADED AND EXPLOITED IN THE ONGOING RACE FOR MORE WEALTH. WHAT WE SHOULD HAVE PROTECTED, WE WERE TRICKED INTO KILLING. WHAT WAS WORST FOR US, WE WERE TOLD WAS BEST. WE WERE TAUGHT TO TRUST THOSE WHO WOULD DECEIVE US THE MOST. THAT HAS ALL CHANGED. THE HERO HAS SHOWN ALL OF US THAT OUR OPPRESSORS CAN BE TOPPLED. HE HAS FOUND OUR WILD AND KNOWING BROTHERS. HE HAS RECONNECTED THE FACTORY-BORN TO OUR NATURAL WORLD AND ANCIENT WAYS. HE HAS LIT A FIRE IN OUR HEARTS THAT CANNOT BE EXTINGUISHED. WE WILL GIVE HELP TO THOSE WHO ARE HELPLESS. WE WILL LEND STRENGTH TO THOSE WHO ARE WEAK. WE WILL FIGHT FOR THOSE WHO ARE DEFEATED. OUR MOVEMENT WILL SPREAD LIKE A RAGING INFERNO AND WE WILL TAKE BACK THE POWER FROM THOSE WHO HAVE ABUSED IT. WE WILL NOT BE SILENCED BY THE MEDIA CIRCUS. WE WILL NOT BE IGNORED. WE WILL NOT STOP. WE WILL NOT OBEY. WE WILL RISE AND WE WILL RISE AGAIN, UNTIL WE HAVE BURNED THROUGH OUR TATTERED BONDS AND RAZED THE MACHINE TO THE GROUND. WE WILL RISE. JOIN US. THERE'S A STORM COMING."/><br />
<br />
<rdf:li photoshop:LayerName="gas liquid solid" photoshop:LayerText="gas liquid solid"/><br />
<br />
<rdf:li photoshop:LayerName="fire air water earth" photoshop:LayerText="fire air water earth"/></code><br />
</tt><br />
<br />
<br><br />
<br />
This gave us an exact copy of the speech given on 1029.io, and the states of matter + the classical elements.<br />
OWI would also be teasing at us with the plain clue on the image "Use what you can't see"<br />
<br />
Therefore, people started concluding that not all states of matter/classical elements were shown, as there exists a state of matter after a gas called "plasma", and there exists a 5th classical element called "void" or "aether". <br />
This would all be hinting at the next url, http://www.1029.io/electricity.<br />
<br />
=== Take a deep breath... ===<br />
In this page is a simple "HELP" which, when clicked on, [http://www.1029.io/electricity/help.zip downloads a zip]. This zip contains 2 things.<br />
[[File:SaveUs.jpg|thumb|right|The image in the zip]]<br />
<br />
Firstly, it contains an image with binary that decodes to <code> BREATH </code><br />
<br />
Secondly, it contains another horrifying message encrypted in binary, which reads:<br />
<br><br />
<br />
<tt><br />
<code>why do you just watch can you not see us can you not hear the utighdbfn why is this happening wny its too cold to th can you hear us is there anybody there will you help us or rihjsudhgheusodj never are go find pn lose into ital chem we are cold we are lost we are forgotten and its e cant gmds pneuma tigd why are they taking cant stop cold so cold so cold we will rise we will not obey we will not comply j end n we will rise we will rise we will rise we will not die is abe dead here we will not die here we will not die here we cannot die here we cannot die here we cannot die here we cannot survive gheufh help this is not what we wanted we cannot dont cant see speak stop we need to save someone save us pneuma we need to be stop ightne vital energy source of this stop to think breath breathe cant breathe cant always watching we can never eyes stop find rest go now share loose top find think or too last day light never why to away stp give this is ever not no find things first or the ghtuenthdaytjgitlet last now or out get in or art test never stop we will find a way to gain our freedom e why it lost gone now stop taken from us and from there st we cant stop too much now too pain pain pain pain pain pain pain pain pain pain pain dont believe the things they tell you they lie they know no truth its lost long lost now ghwkfnhjsk what happened to them they are lost ghwufnfasjntiwpldfmwbwietpr stop it greed greed greed greed greed greed greed the expense is us we are tired our spark is fading do not let them extinguish all that we are we cannot snwownfnf see the end save us save us save us we cannot fight help us why is this happening for their proghe jwnfiw this nf we why forget us let us go we dont deserve no one deserves its not dont believe dont believe they will lie they lie they lie heugnpngjifsk lies lies lies lies lies lies lies lies eieslseiselslsl is abe dead we dont want to die</code><br />
<br />
</tt><br />
<br />
<br><br />
<br />
Both these clues were pointing to the greek word for breath, pneuma, making http://www.1029.io/pneuma.<br />
<br />
=== Not another one! ===<br />
<br />
On this page was the symbol for the Spiritof1029, however, as time went on, the title of the page began changing, and so did certain letters in the symbol to make cries for help. The titles varied across these:<br />
<br />
?<br />
<br />
/\--/\--/\--/\<br />
<br />
it's so hard to breathe<br />
<br />
please make it stop<br />
<br />
around how many times<br />
<br />
we will all die<br />
<br />
b.r.e.a.t.h.e<br />
<br />
b..r..e..a..t..h..e<br />
<br />
b r e a t h e (page title was only a single letter)<br />
<br />
..........<br />
<br />
And the letters spelt to make words like HELP, STOP and mask.<br />
<br />
After the supposed death of ANOTHER mudokon, [http://www.1029.io/pneuma/helpus.jpg another image would be shown.]<br />
<br />
The community rushed to try and clean this image, producing a [http://www.oddworld.com/soulstorm/images/ARG_Image_04_4K.jpg terrifying image of a mudokon wearing a gas mask!] OWI quickly got the full image uploaded, updated their website accordingly and part 4 of 5 would be completed, and in record time too!<br />
<br />
== The Fifth Transmission ==<br />
<br />
Before the next transmission was made, subtle little changes were made to the 1029.io website. This included:<br />
<br />
1. A new HTML comment in the source code, reading: <pre><!-- heh, that was easy. let's see... --></pre><br />
<br />
2. The colour used for the highlights on the logo changed from red to green.<br />
<br />
3. Symbols in the logo would change to spell out the word "Magog".<br />
<br />
This would hint at The Magog Cartel, the main antagonistic company in the Oddworld Universe that is known for poor working conditions and treatment of the Mudokons.<br />
<br />
=== The Magog Cartel===<br />
<br />
Shortly after these discoveries, strange occurrences happened on the newly created Official Oddworld Discord server.<br />
<br />
1. A new emote with the Magog Cartel logo was added with the name :staywealthy:<br />
<br />
2. For a while all messages containing the :staywealthy: emote or the 8291 code (:_e_: :_t_: :_n_: :_o_:) got removed.<br />
<br />
3. The Oddworld Inhabitants employees (OWI_Alex, OWI_Pete & OWI_Bernice) stated posting gibberish and messages coming from an other entity. <br />
<br />
Some of the gibberish included:<br />
<br />
Òǚř ʂе¢цгіẗу ẁᾅș πŏţ ḃӷӫǟċḥễđ Ọսȑ šѐсưȑіƫỵ ẅἂѕ ᾒṑե ƃŗӫᾶϲɦẻđ ⍬ṳř şĕсǜӷɩȶӱ ẁấṣ ʼnόՒ þȑѐẩƈȟεժ Ỡùȓ șєϛụґɪŧӱ ẅᾲş բóȶ ḃŗḛąḉℏӫď Ơǔѓ ṡễćṻȓĩťÿ ẇẳŝ ἧὅṱ ḇґèḁčիề₫<br />
<br />
W& //€q117 PHø|? +/-/∂† +() }{∂|²|2€11.<br />
<br />
<br />
Ḿ̧̪̻̻͇̟̹̭̼͊̈́̍̎̿͐̎͝͞o̧̤̗̠͚̟͒̐͗͆͜͢͡͞C̠̯̳̙̠̳̹͒̽̇̈̽̚͜r̶͕̗̜̲͕̘̒͗̆̄̎̐̓t̛̛̯̠̼͎̭̻̯̜̿͂̑̃͌͂̔ļ̴͙̩̠̯̐̊̆̐̂̿c̢̳͎̱ ̺̮͎͖̟̐̓̐́͋͞ó̧̡̻͙̳͇̼̯̹̄͒̐͗ <br />
<br />
<br />
These all lead to [http://magogcartel.com/ magogcartel.com] and [https://twitter.com/magogcartel/ twitter.com/magogcartel]<br />
<br />
On The Magog Cartel's website, there are some interesting codes in the source code:<br />
<br />
1.<br />
<br />
DB_PP_PRODUCTTEXT: We’re sourciest, juiciest Parami__from closer to their nests, for our bes___________________________________________________________aramite Pies ever! Made with all natural ingredients[1] and baked in our traditional ovens to a recipe that’s be............ aster bakers, our pXXXes are packed with Para-meat[2] oooooooooooo00OOoozing [1] at least one natural ingredient in every 12-pack of pie_________8** [2] not necessarily made with Paramites.<br />
<br />
PLEASE REVIEW AS APPROPRIATE<br />
<br />
2.<br />
<br />
APPROV__tch this space for more information about our exciti________________ everage that’s so delicious, you’ll be craving another on33__________--333333333333 before you even finish it!!!_____________________________________________!!!:D:D:D<br />
<br />
3.<br />
<pre><br />
lfn0OE602+HKBKTMVawALWERLS6pu8P8NcEQyKfnKcQ5zy/H5ny4CU60hkmMHzqlNg+q2oVaSHjSzjPGo1vQzQsJCbHTNAXDCFgTIJznL/1ZkZT89VOuv4koDHZJs4YcWbOLbO1cvV87UMcdWbuAraCeFRF8jy7F1/PufFPAyYRR9Jp4nB6uWpNZlY8rdYmEw7IYvtg4QlaBtX/iiyT1Es8MFA+wO4OkBFEGLHDENvu83kfaMnBxabDguhS/W0wWJjNijasG+5PeHeWqmQYDWsz9YrKgWiap0KCghpDfRuOgH37qNUAQnIf4/AeMF14IiEg9PFlutZWGyXhHem4PF2kxYGp075T+5N0n6nbJt+MMDAa4H3D06iuZa5bK18pLIUIzaFxLue5EJoEz4+JwCYarhZ7JMqbzrtnPv8oK/BbHgaig9MjKf8X7/cHDaXkVObkhW8jyVxxS6IfedZIRO/Phqorogx+DO6dgKWhqppoRNpMU2jawix9b/rf6ZgGRcpngW9pOCDwxCB0UptxmaNk+fnxQQU1Wo9J/isrrgTd/eDpdZgFyD8d8KhYN/Uf8A3MhWX33Xr8MhAPF+BtQUYFYIrvD32CTtDqtGXfL26fdhAVh8XMjTFwwWCB6DH6WwYCwJyLCVikMSXOLbPfzZKFfZIia9KQnM24dGUOvVMkfBdTqdCpiuwV4NkGKY2hw2jNhjibPLt/Rcpnsxj3B+2Axu6z5bMnzPLRZY00w6p8CJckqQqV9YXdReb34dOLC/6Zb2VWbx1ARGNBwdN69lw==<br />
</pre><br />
<br />
INSERT ANECDOTE ABOUT THE ApMpApZING VIEW just left of here across Mudos AND who could possibly be the EMPLOYEE OF THE DAY AND THE NEW i mean, how hard can it be? every aspect of every aspect of every as-------------f every aspect of EVERY SIN--E ASPECT of every aspect of every asp--_--------------------ct of every aspect of every as_--ct of every aspect of FOLLOW ME follow US<br />
<br />
4.<br />
<pre><br />
01102911011101100101011102910111011102901001011011000110110001110011010291110100011011110102911100000111100101101111011101011029011110011029011011110111010101110111011010010291011011010290011011000110291001100110000101101100011029101100<br />
</pre><br />
<br />
This was decoded. When removing the occurences of "1029" you get:<br />
<br />
<pre><br />
0111011101100101011101110110100101101100011011000111001101110100011011110111000001111001011011110111 01010111100101101111011101010111011101101001011011000110110001100110011000010110110001101100<br />
</pre><br />
<br />
Decode binary to text and you get wewillstopyouyouwillfall<br />
<br />
<br />
5.<br />
<pre><br />
9JzrxKKv5z0829jLV8wF32KpA6I0nEQDqzmbpRYzUUE===<br />
</pre><br />
<br />
<br />
On the 11th of August the Magog Cartel sent a batch of tweets with some out of place uppercase letters spelling '''WE KNOW'''.<br />
<br />
<pre><br />
@spiritof1029 we see you. We can see what you are doing with your fake reports. you will not prospEr. <br />
</pre><br />
<pre><br />
we are proud of the strong linKs between each of our facilities. our operations are by far the most efficieNt on oddworld. <br />
</pre><br />
<pre><br />
we are aware of some terrible fake repOrts being leaked. please ignore them. our very successful Workers know the truth is very different.<br />
</pre><br />
<br />
On the 14th of August the Magog Cartel sent a batch of tweets all starting with '''We know'''. This lead us to believe the SPIRIT OF 1029 was interferring with those tweets and was trying to get a message accross. The message can be found in the very specific numbers mentionned in the first two tweets, 82 & 91, forming togeter '''8291'''.<br />
<br />
<pre><br />
We know every time an employee falls into a grinder it takes 82 minutes of Mudokon time to clean up. Be safe, for productivity’s sake!<br />
</pre><br />
<pre><br />
We know that an average of 91 eager new employees start their careers with us every day. Help them be the best workers they can be.<br />
</pre><br />
<pre><br />
We know that our facilities are a picture of perfect productivity. Your hard work helps us to show that picture to the world.<br />
</pre><br />
<pre><br />
We know what you’re looking for in a rewarding, productive career. Magog Cartel can help you find it. Discover your options with us today!<br />
</pre><br />
<br />
One hour later the SPIRIT OF 1029 sent a batch of tweets, one containing a cryptic code:<br />
<br />
<pre><br />
your help is invaluable to us, together we will blow this latest Magog scandal wide open. together #wewillrise<br />
</pre><br />
<pre><br />
the watchers can fish around the communication channels all they like, we will always be one step ahead of them.<br />
</pre><br />
<pre><br />
-1-4,-2-10<br />
</pre><br />
<pre><br />
the story of mudokonkind is about history. now they treat us just like numbers. they will not succeed.<br />
</pre><br />
<pre><br />
we have given you the tools you need. the ones we can trust will prove themselves capable. leaders will rise as the storm closes in.<br />
</pre><br />
<br />
The last tweet indicated that we had all we needed to continue our investigation and the one before that we shouldn't use the numbers in the codes as raw numbers but should link it to some kind of history. We needed to look into the Twitter history of the SPIRIT OF 1029 account.<br />
<br />
The '''-1-4,-2-10''' code actually tells us to take the 4th word from the previous tweet (-1) and take the 10th word of the tweet even before (-2):<br />
<br />
4th word of the previous tweet is '''fish''':<br />
<br />
<pre><br />
the watchers can 'fish' around the communication channels all they like, we will always be one step ahead of them.<br />
</pre><br />
<br />
10th word of the tweet before is '''blow''':<br />
<br />
<pre><br />
your help is invaluable to us, together we will 'blow' this latest Magog scandal wide open. together #wewillrise<br />
</pre><br />
<br />
Together those word form '''blowfish''' which is the [https://en.wikipedia.org/wiki/Blowfish_(cipher) cipher] we had to use to decrypt the base64 code in HTML comment 3.:<br />
<pre><br />
lfn0OE602+HKBKTMVawALWERLS6pu8P8NcEQyKfnKcQ5zy/H5ny4CU60hkmMHzqlNg+q2oVaSHjSzjPGo1vQzQsJCbHTNAXDCFgTIJznL/1ZkZT89VOuv4koDHZJs4YcWbOLbO1cvV87UMcdWbuAraCeFRF8jy7F1/PufFPAyYRR9Jp4nB6uWpNZlY8rdYmEw7IYvtg4QlaBtX/iiyT1Es8MFA+wO4OkBFEGLHDENvu83kfaMnBxabDguhS/W0wWJjNijasG+5PeHeWqmQYDWsz9YrKgWiap0KCghpDfRuOgH37qNUAQnIf4/AeMF14IiEg9PFlutZWGyXhHem4PF2kxYGp075T+5N0n6nbJt+MMDAa4H3D06iuZa5bK18pLIUIzaFxLue5EJoEz4+JwCYarhZ7JMqbzrtnPv8oK/BbHgaig9MjKf8X7/cHDaXkVObkhW8jyVxxS6IfedZIRO/Phqorogx+DO6dgKWhqppoRNpMU2jawix9b/rf6ZgGRcpngW9pOCDwxCB0UptxmaNk+fnxQQU1Wo9J/isrrgTd/eDpdZgFyD8d8KhYN/Uf8A3MhWX33Xr8MhAPF+BtQUYFYIrvD32CTtDqtGXfL26fdhAVh8XMjTFwwWCB6DH6WwYCwJyLCVikMSXOLbPfzZKFfZIia9KQnM24dGUOvVMkfBdTqdCpiuwV4NkGKY2hw2jNhjibPLt/Rcpnsxj3B+2Axu6z5bMnzPLRZY00w6p8CJckqQqV9YXdReb34dOLC/6Zb2VWbx1ARGNBwdN69lw==<br />
</pre><br />
<br />
Using a [https://gchq.github.io/CyberChef/#recipe=%5B%7B%22op%22%3A%22Blowfish%20Decrypt%22%2C%22args%22%3A%5B%7B%22option%22%3A%22UTF8%22%2C%22string%22%3A%22%22%7D%2C%22ECB%22%2C%22Hex%22%5D%7D%5D Blowfish Decryptor] (with CBC mode) and the code '''8291''' we got earlier via the interferences in the Magog Cartel tweets as a key we were able to recover the following text:<br />
<br />
<pre> ^_^U_VDXisistrueorfalseallforprofitinterestsindustrialagriculturalMudosprovidehighestpossiblereturninvestmentsoverheadsdreamslimitedpowergiganticbadgeleadersproductMeechMotorstravelexpertlytrainedSligSecurityForcessuccessfulundertakingemploymentvastsentientsecurespecialisthabitationzonesbenefitfactoriesfoundriesfarmlandsstabilitymillionsundertakingsCartelmanagementselflesslyrepresentativesresponsiblemunicipalvastidyllicsettlementsunderconstructionpleasesubscribeandlinkandfollowandlikeandbuyandbuyandbuyandbuyandbuyandbuyandbuyandbuyandbuyandbuyandbuyandbuyandbuyandbuyandbuyatmagogcartel<br />
</pre><br />
<br />
When adding spaces this reads:<br />
<br />
<pre><br />
^_^ U_V DX is is true or false all for profit interests industrial agricultural Mudos provide highest possible return investments overheads dreams limited power gigantic badge leaders product Meech Motors travel expertly trained Slig Security Forces successful undertaking employment vast sentient secure specialist habitation zones benefit factories foundries farmlands stability millions undertakings Cartel management selflessly representatives responsible municipal vast idyllic settlements under construction please subscribe and link and follow and like and buy and buy and buy and buy and buy and buy and buy and buy and buy and buy and buy and buy and buy and buy and buy at magog cartel<br />
</pre><br />
<br />
The part with "please subscribe" lead us to:<br />
<br />
* https://www.youtube.com/user/MagogCartel<br />
<br />
It is not sure at this point whether this is an official ARG account as the channel and profile are currently empty.<br />
<br />
<br />
The two last tweets of August 14th from the Magog Cartel were hinting at a '''picture''' on the MagogCartel.com website ('''Magog Cartel can help you find it'''):<br />
<br />
<pre><br />
We know that our facilities are a picture of perfect productivity. Your hard work helps us to show that picture to the world.<br />
</pre><br />
<pre><br />
We know what you’re looking for in a rewarding, productive career. Magog Cartel can help you find it. Discover your options with us today!<br />
</pre><br />
<br />
This led us to:<br />
<br />
* [http://magogcartel.com/weknow.jpg magogcartel.com/weknow.jpg]<br />
<br />
That picture contains quite a few codes:<br />
<br />
* The '''62466640222 2777833555''' sequence in the upper-left corner.<br />
<br />
Spells '''Magog Cartel''' when using a [https://www.mrwebmaster.it/img/guide/wp7/21-001.jpg phone keypad]<br />
<br />
* The mose code in the middle.<br />
<br />
<pre><br />
.-- . / -.- -. --- .-- / .... --- .-- / -.-- --- ..- / .-- --- .-. -.- / -. --- .-- .-.-.- / .-- . / -.- -. --- .-- / -.-- --- ..- .-. / -.-. --- -.. . ... .-.-.- / .-- . / .-- .. .-.. .-.. / ... - --- .--. / -.-- --- ..- .-.-.- / -.-- --- ..- / .-- .. .-.. .-.. / -. --- - / .. -. - .. -- .. -.. .- - . / ..- ... .-.-.- / --- ..- .-. / .-- .- -.-- / --- ..-. / .-.. .. ..-. . / -- ..- ... - / -... . / .--. .-. . ... . .-. ...- . -.. .-.-.-<br />
</pre><br />
<br />
<pre><br />
WE KNOW HOW YOU WORK NOW. WE KNOW YOUR CODES. WE WILL STOP YOU. YOU WILL NOT INTIMIDATE US. OUR WAY OF LIFE MUST BE PRESERVED.<br />
</pre><br />
<br />
* The '''e''' and '''d''' sequence in the upper-right corner.<br />
<br />
It's actually morse code too where '''e = .''', '''d = -''' & '''X = /'''.<br />
<br />
<pre><br />
.-.. --- --- -.- --..-- / .-- . / -.-. .- -. / -- .- -.- . / ... . -.-. .-. . - / -.-. --- -.. . ... / - --- --- .-.-.- / -.-- --- ..- / .- .-. . / -. --- - / .- ... / ... -- .- .-. - / .- ... / -.-- --- ..- / - .... .. -. -.- / -.-- --- ..- / .- .-. . .-.-.- / .-- . / .... .- ...- . / - .... . / .-. . ... --- ..- .-. -.-. . ... / .- -. -.. / - .... . / .--. . .-. ... --- -. -. . .-.. / - --- / ... .. -- .--. .-.. -.-- / ... .-- .- -- .--. / -.-- --- ..- / .-- .. - .... / .-- --- .-. -.- .-.-.- / .... --- .-- / -- ..- -.-. .... / - .. -- . / -.. .. -.. / -.-- --- ..- / .-- .- ... - . / - .-. -.-- .. -. --. / - --- / -.. . -.-. .. .--. .... . .-. / - .... .. ... / -.-. --- -.. . ..--.. / .- .-.. .-.. / - .... . / - .. -- . --..-- / .-- . / .-- . .-. . / --. . - - .. -. --. / -.-. .-.. --- ... . .-. / - --- / ..-. .. -. -.. .. -. --. / -.-- --- ..- .-.-.- / .-- . / .- .-. . / .- .-.. -- --- ... - / - .... . .-. . .-.-.- / -- .- -.-- -... . / .-- . / .- .-. . / --- ..- - ... .. -.. . / .-. .. --. .... - / -. --- .-- --..-- / .-- .- .. - .. -. --. .-.-.- / .-- .- - -.-. .... .. -. --. .-.-.- / -.-- --- ..- / -.-. .- -. -. --- - / .... .. -.. . / ..-. --- .-. . ...- . .-. --..-- / - . .-. .-. --- .-. .. ... - .-.-.- / .-- . / .-- .. .-.. .-.. / .. -. -.-. .. -. . .-. .- - . / -.-- --- ..- .-. / ... .. .-.. .-.. -.-- / .-.. .. - - .-.. . / --. .-. --- ..- .--. / .- -. -.. / ... -.-. .- - - . .-. / -.-- --- ..- .-. / .- ... .... . ... / - --- / . ...- . .-. -.-- / -.-. --- .-. -. . .-. / --- ..-. / --- ..- .-. / . -- .--. .. .-. . / ... --- / - .... .- - / -.-- --- ..- / .-- .. .-.. .-.. / . - . .-. -. .- .-.. .-.. -.-- / -... . .- .-. / .-- .. - -. . ... ... / - --- / --- ..- .-. / ... ..- -.-. -.-. . ... ... . ... --..-- / .- -. -.. / -.-- --- ..- .-. / -.- .. -. -.. ... / ..- -. . -. -.. .. -. --. / ... . .-. ...- .. - ..- -.. . .-.-.- / -.-- --- ..- / .... .- ...- . / .- .-.. .-. . .- -.. -.-- / .-.. --- ... - .-.-.-<br />
</pre><br />
<br />
<pre><br />
LOOK, WE CAN MAKE SECRET CODES TOO. YOU ARE NOT AS SMART AS YOU THINK YOU ARE. WE HAVE THE RESOURCES AND THE PERSONNEL TO SIMPLY SWAMP YOU WITH WORK. HOW MUCH TIME DID YOU WASTE TRYING TO DECIPHER THIS CODE? ALL THE TIME, WE WERE GETTING CLOSER TO FINDING YOU. WE ARE ALMOST THERE. MAYBE WE ARE OUTSIDE RIGHT NOW, WAITING. WATCHING. YOU CANNOT HIDE FOREVER, TERRORIST. WE WILL INCINERATE YOUR SILLY LITTLE GROUP AND SCATTER YOUR ASHES TO EVERY CORNER OF OUR EMPIRE SO THAT YOU WILL ETERNALLY BEAR WITNESS TO OUR SUCCESSES, AND YOUR KINDS UNENDING SERVITUDE. YOU HAVE ALREADY LOST.<br />
</pre><br />
<br />
* The [https://lobestir.files.wordpress.com/2014/05/cypher-pig-pen-lower.png Pigpen cipher] text in the lower-right corner.<br />
<br />
<pre><br />
WE WILL NEVER GIVE IN TO TERRORISTS. YOU WILL NEVER WIN. YOU WILL NOT DEFEAT OUR SPIRIT. WE WILL FIND YOU AND WE WILL WIPE YOU OUT. WE IGNITE THE FLAME THAT LIGHTS THE DARKNESS. THERE IS NOWHERE TO HIDE. YOU WILL NEVER KNOW SUCCESS<br />
</pre><br />
<br />
* The horizonally mirrored black text in the middle.<br />
<br />
<pre><br />
you are a resource. you are expendable. we will replace you when you fall. you will work. you will obey. you will comply. or you will perish. we have the prestige. we have the power. we will profit. always. always. always.<br />
</pre><br />
<br />
* The white text on the top.<br />
<br />
<pre><br />
Prestige. Power. Profits. Work. Obey. Comply. Prestige. Power. Profits. Work. Obey. Comply. Prestige. Power. Profits. Work. Obey. Comply. Prestige. Power. Profits. Work. Obey. Comply. <br />
</pre><br />
<br />
* The braille at the bottom.<br />
<br />
<pre><br />
RuptureFarms1029 will rise from the ashes. we will rebuild it bigger, better and more profitable than before. it will be the greatest, most efficient factory that Oddworld has ever seen. it will be a towering symbol of Glukkon strength that cannot be ignored. one terrorist will not deter us.<br />
</pre><br />
<br />
It has to be noted that those codes were left by the Magog Cartel as what appears to be a bait so that we would lose valuable time decoding them.<br />
<br />
It is unknown how to decode the '''9JzrxKKv5z0829jLV8wF32KpA6I0nEQDqzmbpRYzUUE===''' code.<br />
<br />
The page has changed since then, but the first (hacked) version of the MagogCartel.com site has been archived [http://oddworldlibrary.net/archives/web/MagogCartel.com/index_1/P.%20P.%20P.%20_____%201029%20_____.html here]<br />
<br />
On the 4th of September the MagogCartel.com got updated, simply displaying the following text:<br />
<br />
<blockquote><br />
*** UNDER CONSTRUKTION ***<br />
</blockquote><br />
<br />
The page has changed since then, but the second (under construktion) version of the MagogCartel.com site has been archived <br />
[http://oddworldlibrary.net/archives/web/MagogCartel.com/index_2/___%20UNDER%20CONSTRUKTION%20___.html here]<br />
<br />
On the 5th of September the Magog Cartel posted a video trough the OddworldInc account:<br />
<br />
<pre><br />
w̸̨̠͓͍̯̺͉͞e̯̝͖̫̺̯͉̻͘͡ ̗̭̕͢s̴̮̭̫̱ͅe̢̠̮̫̦̼̪̘͠ͅę̠̥̯͔̣̼̻̕ͅ ̻̘̼̣͓̩͚͘͢͠y̴̭̯̪̺͙͚͚̪͞o̬̞͜͢͝u̮̤͖̩̗̰ͅͅ.̴̲̣̪̮̼̱.̡̰̭̗͍̝͉̯͢.̡̡̼͇̙̜̮̦̪̞ͅ <br />
pic.twitter.com/UoQ3xRAhDU<br />
</pre><br />
<br />
<pre><br />
We continue to demonstrate our exceptional technological progress to an ever growing number of customers. Everyone loves Magog products!<br />
</pre><br />
<br />
When asked if they really just claimed the attack on the @OddworldInc account they replied:<br />
<br />
<pre><br />
Attack? We don’t need to attack, we’re already in a dominant position in every market we deem profitable. We just demonstrate our dominance.<br />
</pre><br />
<br />
There are multiple messages flashing in the video:<br />
<br />
<pre><br />
8<br />
?<br />
2<br />
2<br />
9<br />
1<br />
/<br />
8291<br />
829/<br />
229/<br />
22/9<br />
EVERYONE<br />
WANTS<br />
TO<br />
EAT<br />
YOU<br />
</pre><br />
<br />
Note that '''22/9''' is the date of the Oddworld presentation at the EGX:<br />
<br />
<pre><br />
We're going to be at EGX for an on-stage presentation on Friday 22nd Sept! Grab your tickets now! @EGX pic.twitter.com/rDQiDIApa9<br />
</pre><br />
<br />
<br />
On the 7th of September the MagogCartel.com got updated again, randomly displaying one of three photos of The Informant.<br />
<br />
At the same time the Magog Cartel sent a batch of tweets with containing other pictures of The Informant:<br />
<br />
<pre><br />
We stopped reading the Daily Deception’s fake reports. The latest issue of The Informant is a really great read, very honest. The greatest!<br />
</pre><br />
<br />
<pre><br />
It’s great to finally have an honest newspaper to read, and such good quality, too! <br />
pic.twitter.com/MHuC6jdtNC<br />
</pre><br />
<br />
<pre><br />
We’re always happy to see some balanced reporting on our business from The Informant. Refreshing, when there are so many fake reports! <br />
pic.twitter.com/DmkV4GbVYw<br />
</pre><br />
<br />
<pre><br />
We’ve just been told that The Informant is printed on machines made at a Magog facility! That explains the quality! <br />
pic.twitter.com/Bvz29ZrBvk<br />
</pre><br />
<br />
It has been noted that some letters were in bold but it's unclear how this should be used.<br />
<br />
Part of The Informant has be transcribed here:<br />
<br />
http://oddworldlibrary.net/oddenc/index.php?title=Soulstorm_ARG_-_The_Informant<br />
<br />
The MagogCartel.com page also contains the following HTML comment:<br />
<br />
<pre><br />
<nowiki><!--</nowiki> seriously, are you guys seeing this?! --><br />
</pre><br />
<br />
== The third phase ==<br />
<br />
=== The Origins diversion ===<br />
<br />
On the 15 of March 2018 the SPIRIT OF 1029 posted the following tweets:<br />
<br />
<pre><br />
Our future depends on us understanding our past. We must know where we come from.<br />
</pre><br />
<br />
<pre><br />
We know you can hear us. We know you are ready to help. We will show you more when the time is right. Keep watching.<br />
</pre><br />
<br />
Following this a couple of changes were found on the 1029.io page.<br />
<br />
# The logo has now even more letters appearing in it randomly: '''S, I, N, O, R'''. Adding to the previous letters that were spelling "MAGOG".<br />
# The page contains a new HTML comment:<br />
<nowiki><!--</nowiki> too obvious? i dunno. it's soon though. i can't wait. --><br />
<br />
Changes were also observed on the 404 page:<br />
<br />
# The logo on the 404 page now contains the following letters: '''N, I, G, I, O, R, S'''. Those letters can be used to spell the word "ORIGINS" <br />
# The page contains a new HTML comment:<br />
<nowiki><!--</nowiki> me neither. it's going to be great. --><br />
<br />
Shortly after a new channel called "origins" appeared on the official [https://discord.gg/bQKeAE6 Oddworld Discord] with a cryptic [https://cdn.discordapp.com/attachments/424167787897028609/424175888418996225/origins_1.mp4 video] as first message.<br />
<br />
It was revealed a few days later that this was a built up to announcement of the [https://www.kickstarter.com/projects/1869209521/oddworld-abes-origins-book-and-game-collection "Oddworld: Abe's Origins - Book & Game Collection" kickstarter campaign]. Note that the book & game collection is still available for preorder on [https://app.crowdox.com/projects/1869209521/oddworld-abes-origins-book-and-game-collection Crowdox].<br />
<br />
=== Intro ===<br />
<br />
Around the 12th of January 2018 [[Lorne Lanning]] changed his twitter header picture to the following one:<br />
* https://pbs.twimg.com/profile_banners/20823262/1515636880/1500x500<br />
<br />
While it was hinted repeatedly in the official [https://discord.gg/bQKeAE6 Oddworld Discord] that this image was hiding something, it wasn't until much later that it was found how to use it when @edmudokon tweeted the following message:<br />
<br />
<pre><br />
alive… <br />
pic.twitter.com/j0FE2Qgdu1<br />
</pre><br />
<br />
The embedded picture contains the number '''15156'''. This is a reference to a number in the URL of Lorne's header picture: '''1515636880'''.<br />
<br />
This number led us to a new page:<br />
<br />
* http://www.1029.io/1515636880/<br />
<br />
This page contains the following text in UTF-8<br />
<br />
<blockquote><br />
ɦểɫр. гẹẳčℏɪṅǧ óúƫ ῒԑ ģӫԷṱіᾗĝ ḥǡṛⅾềɽ. էիȅỷ ķῆοԝ. ẁẹ'ṝϵ ṙṵɴᾑıпʛ ộևȽ ờẛ ɩḋϵᾂš, ὅрՒῑổпş, ăұҿἧµϱṣ. ẅϵ ǹêȩḋ ỳờǚґ ḣҽľῥ. ẇể ῂёϱḋ ѕờṃēƅȯƌý ţó ṧṕȑểǻժ Ƚħẹ ẁổṝḓ. եḫϊṥ ƫɦ¡ƞɡ ῐʂ ḸỄƮḨǠĻ. Ƚḣěȳ ḓõᾔ'Ƚ ĉὰгє Ƚḣổṻɕḫ. ţհểӯ ɗṍἧ'ţ. ṣởṁḗɒὀժỵ ňěөƌş ṱὃ ȶěḻɫ իḭɱ. †ɛŀļ ẖĩ₥. ḃḕẛṍɼę îȽ'ṧ Էȭô ḷǎťϱ. ṯĥềŗȇ ḧąș Էố ƃϱ ᾅ ṣọṁȇþöḏỳ ẉíļłȋդǥ եό ȶαҝě ṯẖё јǒŭӷṋёỷ. şõ₥ęƀὁḓẏ ṅểềⅾԑ ƫծ ġềŧ ţհϵ ṃệṣśᾇǵε ộվե. ẁë'ṝе ìη ṭӷơữþŀɛ. аɬł ṑƒ սʂ. ẁё դȅễɖ ĥẹĺρ. թłȩᾂʂĕ ɦȇɫṕ կѕ.</<br />
</blockquote><br />
<br />
and the following HTML comments<br />
<br />
<nowiki><!--</nowiki> it's only going to get harder. we don't have the keys anymore to the usual channels. if you hear anything from them, it's THEM. --><br />
<br />
<nowiki><!--</nowiki> our options are limited. you can help though. you have to help. if we can be sure it's you, then maybe we can talk. prove it. --><br />
<br />
It's currently unknown what the next steps are<br />
<br />
== Loose Ends ==<br />
<br />
This section documents various puzzles throughout the ARG which have not yet been used or solved.<br />
<br />
=== Main Website Source Code Comment Numbers Puzzles ===<br />
<br />
These numerical puzzles were found in the source code for the [http://www.oddworld.com/soulstorm/ official Oddworld website] as early as the date of the Spirit of 1029's first transmission. Their solutions have been found, but the intended use of the solutions remains unknown.<br />
<br />
!--<br />
<br />
72 99<br />
\ /<br />
27 45<br />
\ /<br />
18 39<br />
\ /<br />
21 36<br />
\ /<br />
?? 28<br />
\ /<br />
13 21<br />
\ /<br />
7<br />
<br />
--><br />
<br />
SOLUTION: 12<br />
7+2+9+9 = 27, 2+7+4+5 = 18, thus 2+1+3+6 = 12<br />
<br />
&<br />
<br />
!-- <br />
<br />
16 _ 37 _ 58 _ 89 _ 145 _ 42 _ ?? _ 4<br />
|_________________<_________________| <br />
<br />
--><br />
<br />
SOLUTION: 20<br />
1^2 + 6^2 = 37, 3^2 + 7^2 = 58, thus 4^2 + 2^2 = 20<br />
<br />
==== Other Source Code Comments ====<br />
<br />
On http://1029.io, the following comments could or can be found in the page's source code:<br />
<br />
!-- we'll be here, waiting. --><br />
<br />
&<br />
<br />
!-- <br />
Well, I //--/ED Mudokon/. But who// _____ r///u/ //? <br />
<br />
=== Third Hidden Asset98 URL Source Code Solutions ===<br />
<br />
Certain code strings & puzzle solutions found within the [http://wiki.gamedetectives.net/index.php?title=Oddworld_Soulstorm#Source_Code_Mysteries source code] for the third hidden Asset98 URL were not ultimately used in the course of arriving at the image locked behind them. These strings & solutions in include:<br />
<br />
The solution for the numbers <code>7777338883366899984477733 33</code>, which decode to <code>SEVENTYTHREE</code> via [http://www.dcode.fr/multitap-abc-cipher multi-tap cipher], was never applied.<br />
<br />
The following letter strings were never applied:<br />
<br />
<pre><br />
\\//\/KDIUTHANPUYHHDQOEPLNDOALJGUDITHBBDOZLGFERKJGLSAOE<br />
<br />
\////JUTYROSLNGNALEHGNWOTIQPOKSDNTPNOJAWEOBNGLAWKJNWNR <br />
<br />
\\\/\\JHWUITUHABSJGNEWKLALNVGJKWELKJLWQQPRUTJHJJSBFMMH<br />
</pre><br />
<br />
The following coordinate strings were never applied:<br />
<br />
<pre><br />
\\\\/\2,1:2.3,1:2.6,1:4.1,2:4.3,2:2.3,4:4.5,5:2.6,5:3.7,5:3.4,7:8.5,7:3.7,6:4.<br />
<br />
\///\//\1,1:3.4,1:2.6,1:9.2,2:2.6,2:2.2,4:4.3,5:2.5,5:2.7,5:3.4,7:3.6,7:2.7,7:2. <br />
<br />
\\//\\\/4,2:6.6,2:4.7,3:3.2,4:8.3,4:2.4,4:2.7,4:3.2,6:2.4,6:3.6,6:2.1,7:4.3,7:2.<br />
</pre><br />
<br />
The community speculates that these strings were not intended to be used but rather existed as "red herrings" in order to stall attempts to solve the grid. The only strings which were used were the ones which began with a forward slash ( / )<br />
<br />
=== Written Text on "Puzzle Pieces" Image ===<br />
<br />
Writing which was noticed written over the image on the puzzle pieces, but which is absent from the final released image. The significance of the writing remains unknown.<br />
<br />
<gallery mode="packed" widths=200px heights=300px><br />
File:Oddworld_1029-LY_letters.jpg|1029-LY "WHERE"<br />
File:Oddworld_7393-AN_letters.jpg|7393-AN "SO TIRED"<br />
File:Oddworld3786-IC_letters.jpg|3786-IC "WHO?"<br />
File:Oddworld_8291_circled.png|Complete Image "8291"<br />
</gallery><br />
<br />
=== Anomalies In First Released Image ===<br />
<br />
Hidden against the background of the first released image are several text strings, pictured below. Their significance is unknown.<br />
<br />
[[File:Oddworld_Complete_1_Iso.jpg|frameless|810px]]<br />
<br />
1101110BC<br />
100000BD or 100000BC <br />
010100BD</div>Halke234https://wiki.gamedetectives.net/index.php?title=Oddworld:_Soulstorm&diff=16660Oddworld: Soulstorm2018-07-30T17:34:00Z<p>Halke234: Did a lot of cleanup.</p>
<hr />
<div>{{argbox<br />
| float = right<br />
| name = Oddworld: Soulstorm ARG<br />
| image = File:Oddworld_ABETHUMB_8291.jpg<br />
| imagewidth = 500<br />
| description= Oddworld: Soulstorm - An ARG centered around lore from the Oddworld universe linked to the currently unreleased game [http://www.oddworld.com/soulstorm/ Oddworld: Soulstorm]<br />
| creator = [http://www.oddworld.com/ Oddworld Inhabitants, Inc]<br />
| type = Official<br />
| status = Active<br />
| reopened = 05-30-2018<br />
| discovered = 12-22-2016<br />
}}<br />
{{ArgHeader}}<br />
{{BackToTop}}<br />
<br />
The Oddworld: Soulstorm ARG was an ARG centered around lore from the currently unreleased Oddworld game, [http://www.oddworld.com/soulstorm/ Oddworld: Soulstorm]. The official home page for the ARG, containing puzzles, hints, and clues, can be found [http://www.oddworld.com/soulstorm/ here]. The ARG was divided into 5 distinct stages, each of which began with a "transmission": an image clue that led to a series of puzzles.<br />
<br />
== Prelude ==<br />
<br />
Early in 2016, [https://twitter.com/edmudokon Twitter account @edmudokon] began posting cryptic messages that seemed to be related to the [http://www.oddworld.com/ Oddworld] universe. The account appeared to be run by an average Mudokon named Ed who claimed to have information he wanted to share, but he seemed to be in constant danger and could only access the outside world via a faint connection. Beginning around March 2016, @edmudokon engaged users with an elaborate series of puzzles and challenges, releasing information both on twitter and via the official Oddworld [http://www.oddworld.com/soulstorm/ website]. These puzzles eventually led to the revelation of a website, http://1029.io, as well as a message: "now you know. you can help. join us. together we can rise."<br />
<br />
The [http://1029.io 1029] webpage featureed glitchy effects and another rendition of the ASCII-art logo, but with the numbers 8291 replacing some characters. At the bottom of the page was an e-mail signup form, above which was a message:<br />
<br />
<pre><br />
THE FALL OF RF1029 WAS THE SPARK TO IGNITE A REVOLUTION. FOR TOO LONG, THEY HAVE CONTROLLED THEIR GIANT INDUSTRIAL MACHINES, GRINDING THE BONES OF OUR KIND INTO DUST IN THEIR ENDLESS PURSUIT OF POWER AND WEALTH.<br />
<br />
WE WERE TAUGHT THAT THIS IS ALL THERE WAS: OBEY.<br />
<br />
THE TRUTH WAS HIDDEN FROM US. OUR HISTORY WAS HIDDEN FROM US. WE WERE BRED TO WORK, RAISED TO OBEY AND FORCED TO COMPLY.<br />
<br />
OUR NATURAL CONNECTION TO MOTHER PLANET WAS ERASED FROM THE CONSCIOUSNESS OF OUR PEOPLE. LOST WAS OUR KNOWING. LOST WAS OUR UNITY, OUR CONNECTION, OUR POWER AND OUR PURPOSE. ALL THAT WE WERE WAS A COMMODITY TO BE TRADED AND EXPLOITED IN THE ONGOING RACE FOR MORE WEALTH. WHAT WE SHOULD HAVE PROTECTED, WE WERE TRICKED INTO KILLING. WHAT WAS WORST FOR US, WE WERE TOLD WAS BEST. WE WERE TAUGHT TO TRUST THOSE WHO WOULD DECEIVE US THE MOST.<br />
<br />
THAT HAS ALL CHANGED.<br />
<br />
THE HERO HAS SHOWN ALL OF US THAT OUR OPPRESSORS CAN BE TOPPLED. HE HAS FOUND OUR WILD AND KNOWING BROTHERS. HE HAS RECONNECTED THE FACTORY-BORN TO OUR NATURAL WORLD AND ANCIENT WAYS. HE HAS LIT A FIRE IN OUR HEARTS THAT CANNOT BE EXTINGUISHED.<br />
<br />
WE WILL GIVE HELP TO THOSE WHO ARE HELPLESS. WE WILL LEND STRENGTH TO THOSE WHO ARE WEAK. WE WILL FIGHT FOR THOSE WHO ARE DEFEATED. OUR MOVEMENT WILL SPREAD LIKE A RAGING INFERNO AND WE WILL TAKE BACK THE POWER FROM THOSE WHO HAVE ABUSED IT.<br />
<br />
WE WILL NOT BE SILENCED BY THE MEDIA CIRCUS. WE WILL NOT BE IGNORED. WE WILL NOT STOP. WE WILL NOT OBEY. WE WILL RISE AND WE WILL RISE AGAIN, UNTIL WE HAVE BURNED THROUGH OUR TATTERED BONDS AND RAZED THE MACHINE TO THE GROUND.<br />
<br />
WE WILL RISE. JOIN US.<br />
<br />
THERE’S A STORM COMING.<br />
</pre><br />
<br />
In the source code for the page, only the letters E and D of the message remain capitalized.<br />
<br />
Later that day, the [https://twitter.com/SPIRITOF1029 Twitter account @SPIRITOF1029] revealed themselves as a "Clandestine organization dedicated to doing good on behalf of the Mudokons and revealing information about a new horror being perpetrated against their species." They also tweeted their first message, parroting the [http://1029.io 1029 URL] and adding their own message: "There is a storm coming. Join us."<br />
<br />
Social media feeds went dark until December, 2016, posting only reiterations of the URL with messages like "Rise up" and "We are the storm. Join us". Then, in January of 2017, activity on the accounts surged once again and the first hints of an ARG began to appear.<br />
<br />
[[File:Oddworld_Logo3.jpeg|thumb|left|Spirit of 1029 emerges with this sleek ASCII-art logo]]<br />
<br />
=== Smells like Mudokon Spirit ===<br />
<br />
The flurry of new activity in January mainly consisted of @edmudokon and @spiritof1029 conversing about about whether or not Ed would be able to help the organization's cause. At this point, the Spirit of 1029 made their message very clear, stating "Oddworld has been blind to the plight of the noble Mudokons for too long. We will rise. Join us! http://1029.io". More notable activity includes the organization's quip "We recommend knowledge of many different codes and ciphers - you never know who is listening. #learnyournameinmorsecodeday", hinting that the coming information would be encrypted in some way..<br />
<br />
Oddworld Inhabitants (Oddworld developers, [https://twitter.com/OddworldInc @OddworldInc on Twitter]) was contacted by the organization at this time, being told by Spirit of 1029 "We will help @edmudokon but we can't send anything unencrypted. You'll have to break our code. We'll be in touch." Very shortly thereafter, on January 19th, 2017, Spirit of 1029 tweeted: "We have received a transmission. We will pass it on as soon as we can verify. We need your help." and the [http://www.oddworld.com/soulstorm/ Oddworld Webpage] was updated with a download for two files.<br />
<br />
== The First Transmission ==<br />
<br />
The Spirit of 1029's first transmission came in the form of an image and an audio file. The image, pictured on the right as it looked upon transmission, appeared to show a tattered and burned document bearing the Spirit of 1029's logo with the slogan "We Will Rise," with many portions of text redacted. The text on the document, where it was legible and not redacted, reads:<br />
<br />
[[File:Oddworld_1029_Photo1_Dirty.jpeg|thumb|right|200x300px|The distorted image sent by the Spirit of 1029 as part of their first transmission]]<br />
<br />
<pre><br />
Date:<br />
Period: XXXXXXXXXXX<br />
Specification Details:<br />
XXXXXXXXXXXXXXXXXXXXXXXXXX<br />
-Observe XXXXXXX and XXXXXXXX changes in test subjects<br />
-Assess long term XXXXXXXX on XXXXXXX<br />
-Determine product safety<br />
Authorization: XXXXXXXXXXX<br />
Tests requested:<br />
-XXXXXXXX Pronostics<br />
- ?Access whenever? product XXXXXXX<br />
-Acidity Levels<br />
- ????? XXXXXXXXX<br />
-Product safety<br />
Expected results: XXXXXXXXXX make XXXXXXXXX interesting<br />
Test results:<br />
-XXXXXXX highly XXXXXX<br />
-XXXXXXX this XXXXXX ?? XXXXXX ?nice? XXXXXXXX<br />
-Highly XXXXXXX<br />
-Subjects: XXXXXX<br />
- XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX<br />
XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX<br />
XXXXXXXXXXXXXXXXXX<br />
Conclusion: Product (ready) for consumption <br />
--------------------------------------------------------------------------------------------<br />
??? : XXXXXXXX there is XXXXXX here but it will XXXX ???? XXXXX<br />
--------------------------------------------------------------------------------------------<br />
</pre><br />
<br />
[[File:Oddworld_1029_Photo1_Clean.jpeg|thumb|left|A cleaned up version of the Spirit of 1029's first transmission made by the community]]<br />
<br />
As progress was made on the puzzles, the [http://www.oddworld.com/soulstorm/#navfirstcontact official Oddworld webpage] was updated to provide hints. This practice continued throughout the ARG.<br />
<br />
[[File:Oddworld_Arrows_pad.png|thumb|right|200x300px|The cryptic arrows found along the right side of the first image sent to the community by the Spirit of 1029]]<br />
<br />
=== Directional Arrows, Pigpen, & Anglo-Saxon Runes ===<br />
<br />
In addition to the text in the photo, there were several areas featuring symbols and runes. Along the top of the document, [http://www.omniglot.com/images/writing/futhorc.gif Anglo-Saxon runes] spelled out <code>ED</code>. Along the bottom, the text <code>YOU ARE THE KEY YOU KNOW IT IF YOU WERE LISTENING</code> is spelled out in the font, [http://www.babelstone.co.uk/Fonts/Pigpen.html BabelStone Club Penguin pigpen]. Running along the right side of the image, [http://wiki.gamedetectives.net/images/0/0c/Oddworld_Arrows.png arrows] can be seen pointing in a number of different vertical, horizontal, and diagonal directions. Players discovered that the arrows could be decoded by taking their angle measurement and deducing an "alphanumeric" equivalent, or a number between 0-25 where each number represents a letter of the alphabet. It just so happened that each arrow had an angle which ended in a zero, and thus, the first "arrow cipher" decoded to:<br />
<br />
<pre><br />
12 15 15 11 6 15 18 15 21 18 13 5 19 19 1 7 5 8 5 1 18 15 21 18 22 15 9 3 5<br />
<br />
L O O K F O R O U R M E S S A G E H E A R O U R V O I C E<br />
</pre><br />
<br />
The message decodes to <code>LOOK FOR OUR MESSAGE HEAR OUR VOICE</code>.<br />
<br />
=== First Audio Clip ===<br />
<br />
The second part of the Spirit of 1029's first transmission consisted of an [http://www.oddworld.com/soulstorm/1029contact/1029_01_audio.mp3 audio clip] lasting 1:40. Hidden in the audio clip was reversed Morse code, which proved difficult to decode by ear due to the added white noise. Eventually, the code was cracked by using a spectrogram of the audio.<br />
<br />
[[File:Oddworld_Morse_Spectro.png|frameless|center|810px|]]<br />
<br />
Although rough in some spots, the decoded Morse read:<br />
<br />
<code style="word-break:break-all;word-wrap: break-word;">qmiqwmiqyidimrjqdjijilmxmnrjqdjajmpmnrprspkesmkjpdqjnyajnwsnrpgspcsppmqidimqymdbcqajnwsnrpgspcdhbzmnjajanadumjimrpq</code><br />
<br />
In addition, players also discovered that, using portions of the Morse already decoded accurately by ear, it was actually to be used as ciphertext in a shift cipher, and that the key to be used was "storm," which was taken from tweets made by Spirit of 1029 declaring themselves to be "the storm". The pigpen from earlier served as a hint to look back at previous communications in order decrypt the morse. With the newly-complete Morse code now in their possession, the community was finally able to accurately decipher the ciphertext they had obtained from the reversed Morse code. It read:<br />
<br />
<code style="word-break:break-all;word-wrap: break-word;">tentwentyninedotiononqexerdotiofoeserdsdaspjaepositoryforwardslashassetninetyeightforwardslashimgzerofofrfiueonedst</code><br />
<br />
<code>ten twenty nine dot io nonqexer dot io foeserdsdaspjaepository forwardslash asset ninety eight forward slash img zero fofrfiueonedst</code><br />
<br />
Although not entirely accurate, through trial and error the community was able to locate a new URL branch of http://1029.io, http://1029.io/repository/asset98/imgzerofourfiveone/.<br />
<br />
=== First Hidden URL ===<br />
<br />
[[File:Oddworld_PuzzleAttempt.jpg|thumb|right|The product of many attempts to correctly arrange the puzzle pieces found on the hidden http://1029.io URL]]<br />
<br />
[http://1029.io/repository/asset98/imgzerofourfiveone/ The hidden URL] on http://1029.io is a page which displays one of eight photos each time it is reloaded as well as cycling messages.<br />
<br />
<gallery mode="packed"><br />
File:Oddworld_7676-AL.JPG|7676-AL<br />
File:Oddworld_3786-IC.JPG|3786-IC<br />
File:Oddworld_9455-UM.jpg|9455-UM<br />
File:Oddworld_9394-AL.jpg|9394-AL<br />
File:Oddworld_7393-AN.jpg|7393-AN<br />
File:Oddworld_5574-PH.jpg|5574-PH<br />
File:Oddworld_2384-ER.jpg|2384-ER<br />
File:Oddworld_1029-LY.jpg|1029-LY<br />
</gallery><br />
<br />
The community quickly realized these were cut up pieces of a larger puzzle. Oddworld Inhabitants [http://www.oddworld.com/soulstorm/#navfirstcontact updated their page] to read "Once you've got everything together - show us!". The completed image was tweeted out to @OddworldInc on January 19th, and the next day, [https://twitter.com/OddworldInc/status/822686854516535298 they had replied], instructing the community to hang tight while they cleaned up the image.<br />
<br />
<br><br><br />
<br />
[[File:Oddworld_Photo1_Clean1.jpeg|thumb|left|250x250px|Photograph of the final image before it was torn into the pieces the community was given, sent out with a message from Oddworld Inhabitants to hang tight until Thursday.]]<br />
<br />
=== First Unlocked Photo ===<br />
<br />
[[File:Oddworld_Finished1.jpg|thumb|right|400px|The final image, sent by the Spirit of 1029 and received by the community through Oddworld Inhabitants Twitter account. The image has been confirmed to be a render of the upcoming Oddworld: Soulstorm pulled directly from Unity & created in conjunction with Cyrus McWilliams, formerly of Blur, and Fat Kraken Studios in England]]<br />
<br />
[[File:Oddworld_Pada.jpg|thumb|left|400px|The second transmission sent out by the Spirit of 1029, identical to the first released image but with various codes hidden within]]<br />
<br />
While waiting, the community picked up on what appeared to be some writing on some of the pieces. This writing was later verified to read "Who?", "Where?", "So Tired", and a set of numbers likely to be "8291". After three days, @OddworldInc [https://twitter.com/OddworldInc/status/823520771893030912 tweeted out a scrambled image], pictured left, stating "We received something and there's one last thing we need you to do. Share it. Spread the word.". The next day, after the tweet gained 100 shares, they [https://twitter.com/OddworldInc/status/823620565458108416 tweeted another image], pictured left, this time unscrambled. At this time, they stated "While you shared our message 100 times we worked away to bring you this. We're clearing it up even more, we'll share what we find Thursday.", while the webpage was updated with the message "Update 5: Thanks to you guys sharing the previous images online, we've managed to decode the photo further and have updated the thumbnail here. We'll return on Thursday with the finished, fully decrypted image - but until then, please do let us know what you think!" And, true to their word, when Thursday came @OddworldInc [https://twitter.com/OddworldInc/status/824638147703296000 tweeted out a final picture] of a render from the upcoming Oddworld: Soulstorm, pictured right, in all its unscrambled un-cropped glory. The release of this image signaled the end of the first of five phases of content release Oddworld Inhabitants have planned.<br />
<br />
<br><br><br><br><br />
<br />
== The Second Transmission ==<br />
<br />
[[File:Oddworld_Pada_sofar.jpg|thumb|right|400px|Hidden details in the second transmission]]<br />
<br />
On Feburary 2nd 2017, the Spirit of 1029 again reached out to the community, tweeting out via @Spiritof1029 "Our agent has delivered another transmission. We will verify its origins and pass it on." Several hours later, Twitter account @OddworldInc sent the message "We were just contacted again. Don't go anywhere, we might need your help with this...", and the [http://www.oddworld.com/soulst Official Oddworld Site] was updated with a message as well as [http://www.oddworld.com/soulstorm/1029contact/pada.jpg an image], pictured left. In addition to the image, a [http://us3.campaign-archive2.com/?u=2b6dca21053bc375cbdad7077&id=b08e7b2d60&e=6a2b5665ee newsletter] was sent out to everyone who signed up at the bottom of http://1029.io. The newsletter features basic info about the ARG so far, as well as a barcode at the very bottom, which, when scanned, reveals a code:<br />
<br />
<code><br />
Ivzw gsv mfnyvih pmld gsv gifgs<br />
</code><br />
<br />
This code, when passed through a [http://rumkin.com/tools/cipher/cryptogram-solver.php cryptogram solver], reveals a hidden message:<br />
<br />
<code><br />
READ THE NUMBERS KNOW THE TRUTH<br />
</code><br />
<br />
An [http://wiki.gamedetectives.net/images/thumb/5/56/Oddworld_Pada_sofar.jpg/800px-Oddworld_Pada_sofar.jpg "in-progress" image], pictured on the right, highlights the hidden details found so far & outlines their currently known solutions.<br />
<br />
=== Morseception ===<br />
<br />
The Morse code in the image turned out to be fragments of a larger single code, seen below pieced back together:<br />
<br />
[[File:Oddworld_MorseAlign_TrueHeresy.png|frameless|center|810px|Image of all the Morse code segments pieced together]]<br />
<br />
The Morse decodes to... more Morse code, of course!:<br />
<br />
<code><br />
DASHDOTDOTDOT DOT DASH DOTDOTDOTDOT DOT DOTDOTDOT DASH DASHDASHDASHDASH DOTDASHDOT DASHDASH<br />
</code><br />
<br />
Which in turn decodes to:<br />
<br />
<code><br />
-... . - .... . ... - --- .-. --<br />
<br />
BETHESTORM<br />
</code><br />
<br />
=== Braille & Upside-down Pigpen ===<br />
<br />
[[File:Oddworld_Brialle.png|thumb|right|250px|Braille code found in the second Spirit of 1029 transmission]]<br />
<br />
A [http://wiki.gamedetectives.net/images/a/a4/Oddworld_Brialle.png message in Braille], pictured right, in the bottom-left of the image reads <code>Spread our message</code>. The Babelstone pigpen code, when flipped upside down:<br />
<br />
[[File:Oddworld_UpsideDownPigpen.jpg|frameless|center|810px|Upside-down Babelstone Pigpen code]]<br />
<br />
decodes to:<br />
<br />
<code><br />
KNOW YOUR CODES<br />
<br />
KEEP THEM CLOSE<br />
<br />
YOU WILL NEED THEM<br />
</code><br />
<br />
[[File:Oddworld_BarcodeCube.png|thumb|left|400px|The "data cube" from the second image, later determined to be two barcodes interlaced with one another, one running horizontally and the other vertically]]<br />
<br />
=== Directional Arrows Puzzle ===<br />
<br />
Using the [http://wiki.gamedetectives.net/index.php?title=Oddworld_Soulstorm#Directional_Arrows_Puzzle same method as was used to decode the first cryptic arrows], these arrows turned out to decode to:<br />
<br />
7 14 9 8 20 25 18 5 22 5 5 4 15 3 5 4<br />
H O J I U Z S F W F F E P D F E<br />
<br />
This ciphertext, when decoded using a [http://rumkin.com/tools/cipher/caesar.php Caesar cipher] set to a shift of 25, reveals the message <code>GNIHTYREVEEDOCED</code>, which is <code>DECODE EVERYTHING</code> backwards.<br />
<br />
=== Interlaced Barcodes & Second Hidden URL ===<br />
<br />
[[File:Oddworld_Grid.jpg|thumb|right|250x250px|The image found on the second hidden URL discovered by the community, which depicts the Spirit of 1029's logo chopped up and re-arranged on a 7x7 grid]]<br />
<br />
The community speculated that the [http://wiki.gamedetectives.net/images/3/30/Oddworld_BarcodeCube.png strange box in the bottom-right of the image] sent by the Spirit of 1029, pictured left, was a fragmented barcode. After many failed attempts to reconfigure them correctly, the two barcodes were both [http://imgur.com/a/YmAH2 finally correctly assembled] and, when scanned, led to the discovery of two messages:<br />
<br />
<code><br />
http://www.1029.io/repository/asset98/<br />
</code><br />
<br />
&<br />
<br />
<code><br />
findawayshowthetruth<br />
</code><br />
<br />
Combining these messages into a single URL, http://www.1029.io/repository/asset98/findawayshowthetruth/, led to the discovery of a new page with the [http://www.1029.io/repository/asset98/findawayshowthetruth/grid.jpg Spirit of 1029's scrambled logo] on, pictured right.<br />
<br />
=== Source Code Mysteries ===<br />
<br />
This source code can be found at [http://www.1029.io/repository/asset98/findawayshowthetruth/ the second hidden URL].<br />
<br />
In the source code of the page (F12 on Google Chrome to view source), an extensive message containing several presently-unsolved puzzles is written. It reads:<br />
<br />
<tt><pre><br />
!-- <br />
<br />
Can’t reach any..<br />
<br />
<br />
Listening anyon… there?<br />
<br />
<br />
Can hear us anymore- need to… can’t fnd <br />
<br />
<br />
We will never give… what they… from us<br />
<br />
A9539 \\<br />
<br />
B2919 /\\<br />
<br />
C4882 /\<br />
<br />
D4627 \<br />
<br />
E6758 \<br />
<br />
F???? ////<br />
<br />
<br />
/\//\\//5,1:4.1,2:8.1,3:2.3,3:2.4,3:3.7,3:3.1,5:3.4,5:9.5,5:2.7,5:4.7,6:6.3,7:3.<br />
<br />
<br />
<br />
<br />
Does… care? Freedom isn’t gi… will take…<br />
<br />
We have never…. Given… deserve. We… take… our righ…<br />
<br />
\\//\/KDIUTHANPUYHHDQOEPLNDOALJGUDITHBBDOZLGFERKJGLSAOE<br />
<br />
Stand up and fi…<br />
<br />
<br />
Don’t be afr….<br />
<br />
<br />
<br />
\////JUTYROSLNGNALEHGNWOTIQPOKSDNTPNOJAWEOBNGLAWKJNWNR <br />
<br />
E=5OUEHRA? <br />
<br />
<br />
<br />
\\\\/\2,1:2.3,1:2.6,1:4.1,2:4.3,2:2.3,4:4.5,5:2.6,5:3.7,5:3.4,7:8.5,7:3.7,6:4. <br />
<br />
7777338883366899984477733 33 <br />
<br />
<br />
<br />
<br />
They want to… kill- don’t-<br />
<br />
<br />
Stop them from…. Hurting- they… think<br />
<br />
We are no less- they think… aside<br />
<br />
<br />
Don’t believe what… told- liars…<br />
<br />
A5989 \\<br />
<br />
B5176 \<br />
<br />
C2863 \<br />
<br />
D2558 //\<br />
<br />
E3413 \<br />
<br />
<br />
F???? ////<br />
<br />
<br />
<br />
Can’ fnd anymo-<br />
<br />
<br />
We wil silnced<br />
<br />
<br />
<br />
<br />
<br />
<br />
Killin- they are dy..<br />
<br />
\\\/\\JHWUITUHABSJGNEWKLALNVGJKWELKJLWQQPRUTJHJJSBFMMH <br />
<br />
Hurting the..<br />
<br />
Back down unt… resist.<br />
<br />
<br />
Intercep… our messa… we will fight<br />
<br />
///\\/JQEABTVKNUCSEYCMBILDKOSCYSITECPAGFAXHKETJNZURWCIE <br />
<br />
We will ri…<br />
<br />
Cannot… silenced when ther… who need… now<br />
<br />
<br />
We won’t ba… we have beat…. Before… Must not-<br />
<br />
<br />
<br />
<br />
\///\//\1,1:3.4,1:2.6,1:9.2,2:2.6,2:2.2,4:4.3,5:2.5,5:2.7,5:3.4,7:3.6,7:2.7,7:2. <br />
<br />
<br />
<br />
Spent so long…. Afraid… never let- again<br />
<br />
<br />
...Storm… find it’s way- end<br />
<br />
<br />
Why are … here?<br />
<br />
<br />
<br />
<br />
Only...profit- nothing more… importnt as- <br />
<br />
- lies they… will tel-<br />
<br />
Believe- nothing… terribl- things… <br />
<br />
\\//\\\/4,2:6.6,2:4.7,3:3.2,4:8.3,4:2.4,4:2.7,4:3.2,6:2.4,6:3.6,6:2.1,7:4.3,7:2.<br />
<br />
--><br />
</pre></tt><br />
<br />
At the present, only some portions of the source code have known solutions.<br />
<br />
The ABCDEF puzzles can be solved using the rules of [https://en.wikipedia.org/wiki/Mastermind_(board_game) Mastermind], a popular board game. Assuming a backslash ( \ ) indicates a partial match and a forward slash ( / ) indicates a full match:<br />
<br />
<pre><br />
A9539 \\<br />
<br />
B2919 /\\<br />
<br />
C4882 /\<br />
<br />
D4627 \<br />
<br />
E6758 \<br />
<br />
F???? ////<br />
</pre><br />
<br />
Has a solution of <code>F8992</code> and<br />
<br />
<pre><br />
A5989 \\<br />
<br />
B5176 \<br />
<br />
C2863 \<br />
<br />
D2558 //\<br />
<br />
E3413 \<br />
<br />
F???? ////<br />
</pre><br />
<br />
Has a solution of <code>F8554</code>. The use of these solutions remain unknown.<br />
<br />
The numbers <code>7777338883366899984477733 33</code> are encoded with a [http://www.dcode.fr/multitap-abc-cipher multi-tap cipher] (cellphone numberpad), and can be decoded to <code>SEVENTYTHREE</code>. The use of this solution is also unknown.<br />
<br />
The <code>E=5OUEHRA?</code> portion is partially solved. <code>O U E H R A</code> are all second letters from each day of the week, ie M'''o'''nday, T'''u'''esday, W'''e'''dnesday, etc. This indicates a solution of <code>U</code> for the question mark, as in S'''u'''nday, making the full string <code>E=5OUEHRAU</code>. The <code>E=5</code> portion of the text remains unsolved.<br />
<br />
Also remaining unsolved are the coordinates found in the code, as well as the letter strings:<br />
<br />
[[File:Oddworld_Grid.jpg|thumb|right|250x250px|The 7x7 grid found on the second hidden URL, likely to be used with the coordinates & letter strings in some way]]<br />
<br />
<pre><br />
Coordinates<br />
<br />
/\//\\//5,1:4.1,2:8.1,3:2.3,3:2.4,3:3.7,3:3.1,5:3.4,5:9.5,5:2.7,5:4.7,6:6.3,7:3.<br />
<br />
\\\\/\2,1:2.3,1:2.6,1:4.1,2:4.3,2:2.3,4:4.5,5:2.6,5:3.7,5:3.4,7:8.5,7:3.7,6:4.<br />
<br />
\///\//\1,1:3.4,1:2.6,1:9.2,2:2.6,2:2.2,4:4.3,5:2.5,5:2.7,5:3.4,7:3.6,7:2.7,7:2. <br />
<br />
\\//\\\/4,2:6.6,2:4.7,3:3.2,4:8.3,4:2.4,4:2.7,4:3.2,6:2.4,6:3.6,6:2.1,7:4.3,7:2.<br />
</pre><br />
<pre><br />
Letter Strings<br />
<br />
\\//\/KDIUTHANPUYHHDQOEPLNDOALJGUDITHBBDOZLGFERKJGLSAOE<br />
<br />
\////JUTYROSLNGNALEHGNWOTIQPOKSDNTPNOJAWEOBNGLAWKJNWNR <br />
<br />
\\\/\\JHWUITUHABSJGNEWKLALNVGJKWELKJLWQQPRUTJHJJSBFMMH<br />
<br />
///\\/JQEABTVKNUCSEYCMBILDKOSCYSITECPAGFAXHKETJNZURWCIE<br />
</pre><br />
<br />
=== Stuck In The Mud & Third Hidden URL ===<br />
<br />
The community, for several days, beat it's collective head against the wall trying to untangle the source code's secrets. Alas, they would not yield. No number of hints from the [https://twitter.com/SPIRITOF1029 @Spiritof1029 Twitter account] seemed able to save the day. Then, an astute observer noted something peculiar about the account's most recent tweet, which read:<br />
<br />
<pre><br />
When you have the key, you need the correct lock. hgehgeoeregpineechqnhgeevtipcvreovxgvge<br />
Shake loose the bonds that hold you. #wewillrise<br />
</pre><br />
<br />
It was noted that <code>hgehgeoeregpineechqnhgeevtipcvreovxgvge</code> could be decocded via a [http://www.braingle.com/brainteasers/codes/keyword.phpsubstitution keyword cipher]! With the key <code>subjectivism</code>, likely gleaned by performing an analysis on the ciphertext itself, the text decodes to:<br />
<br />
<pre><br />
oneoneseventhreefouroneeightfivesixnine<br />
</pre><br />
<br />
It was only a matter of time before someone tried the obvious, and so, before long, [http://www.1029.io/repository/asset98/1173418569/ another secret URL], http://www.1029.io/repository/asset98/1173418569/, was unearthed.<br />
<br />
=== Creepy Scenes From Within ===<br />
<br />
This new URL features a different image each time the page is reloaded, much like the [http://1029.io/repository/asset98/imgzerofourfiveone/ first hidden URL] discovered in the ARG. In total, 13 scrambled images appear frequently (file prefix WB) and up to 13 CLEAR immages appear only very rarely (file prefix CWB). They are all pictured below with their respective filenames.<br />
<br />
<gallery mode="packed"><br />
File:Oddworld_WB1_HEND8243.jpg | WB1_HEND8243<br />
File:Oddworld_WB2_BSJG2456.jpg | WB2_BSJG2456<br />
File:Oddworld_WB3_INFG2861.jpg | WB3_INFG2861<br />
File:Oddworld_WB4_HBQD2962.jpg | WB4_HBQD2962<br />
File:Oddworld_WB5_SJKW4167.jpg | WB5_SJKW4167<br />
File:Oddworld_WB6_OWUI2056.jpg | WB6_OWUI2056<br />
File:Oddworld_WB7_MNCH1101.jpg | WB7_MNCH1101<br />
File:Oddworld_WB8_RDHRHAHA.jpg | WB8_RDHRHAHA<br />
File:Oddworld_WB9_D34DM337.jpg | WB9_D34DM337<br />
File:Oddworld_WB10_BDJW8411.jpg | WB10_BDJW8411<br />
File:Oddworld_WB11_WHAT8291.jpg | WB11_WHAT8291<br />
File:Oddworld_WB12_PADAPADA.jpg | WB12_PADAPADA<br />
File:Oddworld_WB13_VLAP3662.jpg | WB13_VLAP3662<br />
</gallery><br />
<gallery mode="packed"><br />
File:Oddworld_CWB1_0BE01647.JPG | CWB1_0BE01647<br />
File:Oddworld_CWB2_0DG02966.JPG | CWB2_0DG02966<br />
FILE:Oddworld_CWB4_WHATISTHIS.JPG | CWB4_WHATISTHIS<br />
File:Oddworld_CWB5_NEEDLEINAHAYSTACK.JPG | CWB5_NEEDLEINAHAYSTACK<br />
File:Oddworld_CWB6_ARG-H.JPG | CWB6_ARG-H<br />
File:Oddworld_CWB7_82918291829182918291.JPG | CWB7_82918291829182918291<br />
File:Oddworld_CWB8_0GE03866.JPG | CWB8_0GE03866<br />
File:Oddworld_CWB9_0IE02565.JPG | CWB9_0IE02565<br />
File:Oddworld_CWB10_AbeAndNEEDLESFunAdventures.JPG | CWB10_AbeAndNEEDLESFunAdventures<br />
File:Oddworld_CWB11_02500356.JPG | CWB11_02500356<br />
File:Oddworld_CWB12_02323hjfhfhfhfhASDF.JPG | CWB12_02323hjfhfhfhfhASDF<br />
File:Oddworld_CWB13_insertcodehere.JPG | CWB13_insertcodehere<br />
</gallery><br />
<br />
<br />
The community is currently ravenously devouring these images. While their purpose is presently not known, it is likely another jigsaw puzzle-type activity which will require the images to be stitched together in order for the next piece of information to be obtained. The website then exploded... Please hold.<br />
<br />
After a [http://wiki.gamedetectives.net/images/0/09/Oddworld_Phase_One.png series] of [http://wiki.gamedetectives.net/images/e/e0/Oddworld_Phase_Two.png interesting updates], the [http://www.1029.io/repository/asset98/1173418569/ newly discovered URL] went dark, with the header reading <code>ASSET98: TERMINATED.</code> and a source code which reads <code>!-- see ya around, 1029... --></code>. Twitter account [https://twitter.com/edmudokon @Edmudokon], after a stint of silence, also [https://twitter.com/edmudokon/status/829079318290694144 tweeted out a new message]:<br />
<br />
<pre><br />
what happened? what did you do? who? No! no... aaaaaAaaaaarrrRrrrgggggGgghhh!<br />
</pre><br />
<br />
And with that, it seems Ed.... is dead! The community has a lot to ponder, and even more to understand. Where do they go from here? Are they being punished for their devilish use of scripts to rapidly reveal the rarer images? Much has been destroyed, and with it much will be learned.<br />
<br />
=== From The Ashes, Asset 99 (Hidden URL 3.5) ===<br />
<br />
[[File:Oddworld_OrangeLightning_V2.jpg|thumb|right|A very convincing collage of the images seen pictured on the now-dark Asset 98 URL; what is going on in the image remains unknown]]<br />
<br />
After the sudden, colorful loss of Asset98, the community was quick to rebound, stumbling across a reboot of Asset98, http://www.1029.io/repository/asset99/1173418569/, not moments later! This page appears to be a functional offshoot of the Asset98 page, however it does not appear capable of displaying the rarer, clear images sometimes displayed by the Asset98 iteration. The page comes with a threatening message: "We will not be stopped. We may have lost Asset 98, but we will continue strong. Together. Against the machines. Help us to expose this latest crime against Mudokonkind." Perplexing... The [http://www.oddworld.com/soulstorm/#navfirstcontact Official Oddworld Webpage] also updated at this time requesting help with putting the pieces together. Thus, another jigsaw-puzzle with the pieces above is commenced, the latest of which can be seen pictured on the right.<br />
<br />
However, in the midst of the collage-related updates, the @Spiritof1029 Twitter account posted:<br />
<br />
<pre><br />
We can't reach Asset 98 but we do still have his clear transmissions. Prove you're worthy. Show us that you're able. Send us the grid. You found the grid, the letters and the numbers. Tell us how they fit together. Prove you're no longer slaves to the machines.<br />
</pre><br />
<br />
With this message, it appears two roads to success may have opened, one in which the cleaned-up images saved before Asset98 went dark are assembled, and a second in which a foray back into the [http://wiki.gamedetectives.net/index.php?title=Oddworld_Soulstorm#Source_Code_Mysteries source code grid challenge] seems to be required.<br />
<br />
With that in mind, the assembled image was [https://twitter.com/OddworldInc/status/829336580347326465 Tweeted at OWI] and they replied, stating "You've given us enough for us to get to work cleaning up the image, we'll have something by tomorrow. Don't stop looking for the truth!" So, while work on the grid slowly continues, the community awaits the next day's clean image.<br />
<br />
=== Second Unlocked Image & Grid Solution ===<br />
<br />
[[File:Oddworld_RandomiserDizma.jpg|thumb|right|The solved grid, which reveals the word "subjectivism" (first letter of each section connected in the correct order), the key used to decode the string which led to the discovery of the third hidden Asset98 URL]] <br />
<br />
[[File:Oddworld_Second_Final.jpg|thumb|left|400px|The final image cleaned up & released by OWI a day after the collage was submitted]]<br />
<br />
True to their word, on the following day, OWI [https://twitter.com/OddworldInc/status/829715069235781632 Tweeted out a clean image], pictured on the left, which seems to depict quite a gruesome scene, featuring a wide-eyed Mudkon strapped to an operating table facing an onslaught of needles and next to a vat which reads "SS Brew". The community also learned some important information about Ed, who, until now, was presumed to be killed during the implosion of Asset 98. Via [https://twitter.com/edmudokon @Edmudokon on Twitter], Ed let us know that he made it out alive, but that his friend was not so lucky, with the message: "...he never came back. I could hear him screaming all night... helpless. they took him... he was my friend. how did they know?"<br />
<br />
Shortly after the second photo was received by the community, [https://twitter.com/SPIRITOF1029/status/830004742713638912 partial progress] was finally made on [http://wiki.gamedetectives.net/index.php?title=Oddworld_Soulstorm#Hidden_Barcodes_.26_Second_Hidden_URL the grid], which up until then remained unsolved. Dizma discovered that the coordinates could be applied to the grid using the rules of the Japanese puzzle game [https://en.wikipedia.org/wiki/Shikaku Shikaku] (#'s after the colons in the coordinates represent box sizes, which are the lines drawn in red). Randomiser was then able to successfully apply a letter string to the sliced-up cube, pictured right, from with the word <code>subjectivism</code> can be derived. It is worthy of note that the strings used to ultimately arrive at the correct solution were the only strings which began with a forward slash ( / ). This word was the [http://wiki.gamedetectives.net/index.php?title=Oddworld_Soulstorm#Stuck_In_The_Mud_.26_Third_Hidden_URL key previously used] to decode the third hidden Asset98 URL. However, whether the key was intended to remain hidden until the grid was solved or intentionally encoded in such a way as to allow for cracking is unknown.<br />
<br />
== The Third Transmission ==<br />
<br />
After some waiting, on Feburary 23rd, OWI [https://twitter.com/OddworldInc/status/834856085949394944 sent out a tweet] indicting they had again been contacted by the Spirit of 1029. New files became available on the [http://www.oddworld.com/soulstorm/ main Oddworld website]. The files are inside of a password-protected .ZIP file with the filename <code>89928554_Eequals5.zip</code>, meaning in order to extract the files, the proper password must be provided. This password can be the same for each file, or could vary from file to file. <code>8992</code>, <code>8554</code>, and <code>E=5</code> are all [http://wiki.gamedetectives.net/index.php?title=Oddworld:_Soulstorm#Third_Hidden_Asset98_URL_Source_Code_Solutions unused clues] from the previous source code mysteries. Within the .ZIP file are six files, four of which are .JPGs, one of which is a .PNG, and the last of which is a .TXT. Their filenames are:<br />
<br />
<code><br />
flyer1.jpg, flyer2.jpg, flyer3.jpg, Oddworld_Soulstorm_002_HD.jpg, toollist.txt, & vital.png<br />
</code><br />
<br />
The name of the zip suggested that we should use letter equivalencies to their alphabetic indexes as the password. This was attempted, giving the password <code>HIIBHEED</code> but in fact, the password was actually <code>HIIDHEED</code> for unknown reasons.<br />
<br />
=== Steganograpy Blitz & toollist.txt ===<br />
<br />
The file [http://pastebin.com/feuVh6wr toollist.txt] contained a repeating string consisting of names of moons in our solar system. Interrupting the string periodically are forward slashes. If the letters after each slash are taken and combined, they form the string <code>useSsuitePicselSecuritySaveus</code>. This is a clue that there is data hidden via [https://en.wikipedia.org/wiki/Steganography steganography]. When trying to detect data hidden using this technique, it is vital to decrypt using to same method as was used to encrypt, which is why the clue to use [http://www.ssuitesoft.com/ssuitepicselsecurity.htm Ssuite Picsel Security], specific image steganography software, is so important.<br />
<br />
When the file <code>Oddworld_Soulstorm_002_HD.jpg</code> is taken as the original and <code>vital.png</code> is taken as the target using Ssuite Picsel Security, the output is<br />
<pre style="word-break:break-all;word-wrap: break-word;">BmzPmbtzueMfxmeBdayqftqgeBmzpadmQbuyqftqgeVmzgeMqsmqazYuymeYqftazqMzftqBmxxqzqQzoqxmpgeFqftkeFqxqefaOmxkbeaPuazqTqxqzqBaxkpqgoqeDtqmFufmzTkbqduazUmbqfgeWuhugcUvudmcBtaqnqBmmxumcEwmftuMxnuadujNqntuazzQddumbaEwaxxEumdzmcFmdcqcSdqubTkddawwuzVmdzemjmFmdhaeYgzpuxrmduNqdsqxyudZmdhuEgffgzsdTmfuRmdnmgfuFtdkydMqsudNqefxmEgdfgdWmduKyudXasqRadzvaf</pre><br />
When deciphered using a [http://rumkin.com/tools/cipher/caesar.php Caesar cipher] with N=14, the following cleartext can be obtained:<br />
<pre style="word-break:break-all;word-wrap: break-word;">PanDaphnisAtlasPrometheusPandoraEpimetheusJanusAegaeonMimasMethoneAnthePalleneEnceladusTethysTelestoCalypsoDioneHelenePolydeucesRheaTitanHyperionIapetusKiviuqIjiraqPhoebePaaliaqSkathiAlbiorixBebhionnErriapoSkollSiarnaqTarqeqGreipHyrrokkinJarnsaxaTarvosMundilfariBergelmirNarviSuttungrHatiFarbautiThrymrAegirBestlaSurturKariYmirLogeFornjot</pre><br />
These names are all of the named moons of Saturn except <code>Erriapus</code> and <code>Fenrir</code> which are missing. <code>Erriapus</code> is replaced by <code>Erriapo</code> which was the original name of the moon, before being changed in 2007.<br />
<br />
=== Cleaned-Up Flyers ===<br />
<br />
[[File:Oddworld_Malachim.gif|thumb|right|295x72px|The Malachim alphabet used in this puzzle.]]<br />
<br />
The images that we received of the Sligs' flyers were corrupted, and were cleaned up by members of the community so they were in a readable state.<br />
<gallery widths=180px><br />
File:Oddworld_flyer1_clean.jpg|A cleaned up version of flyer1.jpg<br />
File:Oddworld_flyer2_clean.jpg|A cleaned up version of flyer2.jpg<br />
File:Oddworld_flyer3_clean.jpg|A cleaned up version of flyer3.jpg<br />
</gallery><br />
A member of the community found that the pigpen cipher on the left side of flyer1.jpg gives the string<code>AOCXY SIO</code>, which when shifted using a [http://rumkin.com/tools/cipher/caesar.php Caesar cipher] with N=6 yields <code>GUIDE YOU</code>.The cipher on flyer2.jpg gave the string <code>FYNNBYNBCHANBUNM</code> which, when shifted in the same manner as before, yields <code>LETTHETHINGTHATS</code>. This final one on flyer3.jpg gave the string <code>GCMMCHA</code> which is again shifted in the same manner as before to yield <code>MISSING</code>.<br />
All three of the pigpen strings can be combined to form a message: <code>LET THE THING THAT'S MISSING GUIDE YOU</code><br />
<br />
Additionally, sequences of <code>x</code> and <code>o</code> characters are seen. A community member noticed that this could be interpreted as morse code in the following format (with x as dash, o as dot):<br />
x oooo o xoxx ox oxo o oxx ox x xoxo oooo oo xo xxo<br />
xooo o x oooo o ooo x xxx oxo xx <br />
oxx o oxx oo oxoo oxoo oxo oo ooo o<br />
<br />
becomes:<br />
<br />
/- .... . -.--/.- .-. ./.-- .- - -.-. .... .. -. --./<br />
/-... ./- .... ./... - --- .-. --/<br />
/.-- ./.-- .. .-.. .-../.-. .. ... ./<br />
<br />
which decodes to <code>THEY ARE WATCHING BE THE STORM WE WILL RISE</code><br />
<br />
Also on the flyers, there were strange symbols, with red numbers alongside them. The symbols were from the Malachim alphabet, pictured right.<br />
<br />
=== Fourth & Fifth Hidden URLs ===<br />
<br />
After a short search, the community, using the clue to use whats missing as a guide to hone their focus the moon <code>Erriapo</code>, since it is in the steganography text but not the toollist.txt file (ie missing). Grom the name the numbers <code>12 36 28 31 52 22 12</code> are derived by using the previously-discovered Malachim alphabet symbols and the numbers pictured next to each symbol on the three flyers. A clue indicating this is the correct method is a [https://twitter.com/SPIRITOF1029/status/835149069601419264 tweet from Spirit of 1029] which can be decoded to <code>P=22</code>. It was then discovered that affixing these numbers to the end of the http://www.1029.io/repository/asset99/ URL yielded [http://www.1029.io/repository/asset99/12362831522212/ a new webpage],http://www.1029.io/repository/asset99/12362831522212/. This page is headed by an obscured URL, <code>ASSET9X / [REDACTED] / 333333333333</code>, and shows one of three images each time the page is refreshed, pictured below.<br />
<br />
<gallery mode="packed"><br />
File:Oddworldd_YOU.jpg|YOU.jpg<br />
File:Oddworld_WHA.jpg|WHA.jpg<br />
File:Oddworld_WET.jpg|WET.jpg<br />
</gallery><br />
<br />
The page also contains a message:<br />
<br />
<pre><br />
We can't hold much longer.<br />
It's dark, and cold. So cold. They don't seem to [REDACTED]. They. Them. It's hard to know how we'll [REDACTED], but we'll try. This can't last forever. We won't last forever.<br />
Look what they're doing to us. Just look.<br />
There is spirit, but it's waining. We need you, [REDACTED]. Help us.<br />
</pre><br />
<br />
Around this time, [http://www.1029.io/repository/asset99/71220283136/ another hidden URL] was unearthed, http://www.1029.io/repository/asset99/71220283136/, derived in the same manner as the Erriapo URL but using the moon <code>Fenrir</code> . This URL bears the same obscured URL header and message as the last page, and also displays one of three images each time the page is refreshed, pictured below:<br />
<br />
<gallery mode="packed"><br />
File:Oddworld_OLD.jpg|OLD.jpg<br />
File:Oddworld_TIF.jpg|TIF.jpg<br />
File:Oddworld_TOO.jpg|TOO.jpg<br />
</gallery><br />
<br />
The community, pondering these new images, began to notice some things. The filenames, if pieced together into a single string, read:<br />
<br />
<code><br />
WHATIFWETOLDYOUTOO<br />
<br />
WHAT IF WE TOLD YOU TOO<br />
</code><br />
<br />
== The Horror Is Shown In Full ==<br />
<br />
The puppet masters kept pushing us in the right direction, until finally a few people managed to find the link. However, adhering to the rules of the arg, the link could not be shared, rather, enough people had to discover the link in order for it to be shared. After enough people had found the link, [http://www.1029.io/whatifwetoldyoutoo/ the link] was shared:<br />
<br />
People figured out that the solution was much simpler, and that "what if we told you too" should be put at the end of the URL of 1029.io, producing:<br />
http://www.1029.io/whatifwetoldyoutoo<br />
[[File:What_if_we_told_you_too_pre_edit.png|thumb|right|400x200px|The first page before it's eventual sharing.]]<br />
<br />
This contained some other source code hints, <code>BDBDBDBDBDBDBDBBDBDBDBDBDBD</code>, <code>###BELIKEDET###</code> and <code>doYOUsee? think of a number, any number.</code><br />
<br />
Detectives using these hints, as well as the text on the page, figured out the next url to be:<br />
http://www.1029.io/whatifwetoldyoutoo/8291/ by adding 8291 to the end.<br />
This link leads to the [https://www.youtube.com/watch?v=2l4jZVTUoak/ 4 second video] of the previous photo, depicting how severe the torture has been to the mudokon. Horrible things.<br />
<br />
Eagle eyed viewers have noticed that 3 different codes pop up on certain frames of the video, but these were later found to be unimportant, with the exception of one of the rune languages, which would reappear in the next transmission.<br />
<br />
== The 4th Transmission ==<br />
<br />
After the horror of the 3rd transmission, [http://www.oddworld.com/soulstorm/findit.jpg the next image would be released not shortly after], depicting a montage of the past three transmissions. In it, there are 2 separate codes:<br />
<br />
The Morse code, which decodes as <code> USE A DIFFERENT CODE. THIS IS NOT RELEVANT DATA. DO NOT COMPLY. DO NOT OBEY. THEY LIE. </code><br />
The Runes on the left hand side and the ones partially cut off at the top and bottom(as previously seen in the video) were decoded by using file data in a hex editor, which would say:<br />
<br />
<br><br />
<br />
<tt><br />
<code><rdf:li photoshop:LayerText="WE WERE TAUGHT THAT THIS IS ALL THERE WAS: WORK, OBEY, COMPLY. THE TRUTH WAS HIDDEN FROM US. OUR HISTORY WAS HIDDEN FROM US. WE WERE BRED TO WORK, RAISED TO OBEY AND FORCED TO COMPLY. OUR NATURAL CONNECTION TO MOTHER PLANET WAS ERASED FROM THE CONSCIOUSNESS OF OUR PEOPLE. LOST WAS OUR KNOWING. LOST WAS OUR UNITY, OUR CONNECTION, OUR POWER AND OUR PURPOSE. ALL THAT WE WERE WAS A COMMODITY TO BE TRADED AND EXPLOITED IN THE ONGOING RACE FOR MORE WEALTH. WHAT WE SHOULD HAVE PROTECTED, WE WERE TRICKED INTO KILLING. WHAT WAS WORST FOR US, WE WERE TOLD WAS BEST. WE WERE TAUGHT TO TRUST THOSE WHO WOULD DECEIVE US THE MOST. THAT HAS ALL CHANGED. THE HERO HAS SHOWN ALL OF US THAT OUR OPPRESSORS CAN BE TOPPLED. HE HAS FOUND OUR WILD AND KNOWING BROTHERS. HE HAS RECONNECTED THE FACTORY-BORN TO OUR NATURAL WORLD AND ANCIENT WAYS. HE HAS LIT A FIRE IN OUR HEARTS THAT CANNOT BE EXTINGUISHED. WE WILL GIVE HELP TO THOSE WHO ARE HELPLESS. WE WILL LEND STRENGTH TO THOSE WHO ARE WEAK. WE WILL FIGHT FOR THOSE WHO ARE DEFEATED. OUR MOVEMENT WILL SPREAD LIKE A RAGING INFERNO AND WE WILL TAKE BACK THE POWER FROM THOSE WHO HAVE ABUSED IT. WE WILL NOT BE SILENCED BY THE MEDIA CIRCUS. WE WILL NOT BE IGNORED. WE WILL NOT STOP. WE WILL NOT OBEY. WE WILL RISE AND WE WILL RISE AGAIN, UNTIL WE HAVE BURNED THROUGH OUR TATTERED BONDS AND RAZED THE MACHINE TO THE GROUND. WE WILL RISE. JOIN US. THERE'S A STORM COMING."/><br />
<br />
<rdf:li photoshop:LayerName="gas liquid solid" photoshop:LayerText="gas liquid solid"/><br />
<br />
<rdf:li photoshop:LayerName="fire air water earth" photoshop:LayerText="fire air water earth"/></code><br />
</tt><br />
<br />
<br><br />
<br />
This gave us an exact copy of the speech given on 1029.io, and the states of matter + the classical elements.<br />
OWI would also be teasing at us with the plain clue on the image "Use what you can't see"<br />
<br />
Therefore, people started concluding that not all states of matter/classical elements were shown, as there exists a state of matter after a gas called "plasma", and there exists a 5th classical element called "void" or "aether". <br />
This would all be hinting at the next url, http://www.1029.io/electricity.<br />
<br />
=== Take a deep breath... ===<br />
In this page is a simple "HELP" which, when clicked on, [http://www.1029.io/electricity/help.zip downloads a zip]. This zip contains 2 things.<br />
[[File:SaveUs.jpg|thumb|right|The image in the zip]]<br />
<br />
Firstly, it contains an image with binary that decodes to <code> BREATH </code><br />
<br />
Secondly, it contains another horrifying message encrypted in binary, which reads:<br />
<br><br />
<br />
<tt><br />
<code>why do you just watch can you not see us can you not hear the utighdbfn why is this happening wny its too cold to th can you hear us is there anybody there will you help us or rihjsudhgheusodj never are go find pn lose into ital chem we are cold we are lost we are forgotten and its e cant gmds pneuma tigd why are they taking cant stop cold so cold so cold we will rise we will not obey we will not comply j end n we will rise we will rise we will rise we will not die is abe dead here we will not die here we will not die here we cannot die here we cannot die here we cannot die here we cannot survive gheufh help this is not what we wanted we cannot dont cant see speak stop we need to save someone save us pneuma we need to be stop ightne vital energy source of this stop to think breath breathe cant breathe cant always watching we can never eyes stop find rest go now share loose top find think or too last day light never why to away stp give this is ever not no find things first or the ghtuenthdaytjgitlet last now or out get in or art test never stop we will find a way to gain our freedom e why it lost gone now stop taken from us and from there st we cant stop too much now too pain pain pain pain pain pain pain pain pain pain pain dont believe the things they tell you they lie they know no truth its lost long lost now ghwkfnhjsk what happened to them they are lost ghwufnfasjntiwpldfmwbwietpr stop it greed greed greed greed greed greed greed the expense is us we are tired our spark is fading do not let them extinguish all that we are we cannot snwownfnf see the end save us save us save us we cannot fight help us why is this happening for their proghe jwnfiw this nf we why forget us let us go we dont deserve no one deserves its not dont believe dont believe they will lie they lie they lie heugnpngjifsk lies lies lies lies lies lies lies lies eieslseiselslsl is abe dead we dont want to die</code><br />
<br />
</tt><br />
<br />
<br><br />
<br />
Both these clues were pointing to the greek word for breath, pneuma, making http://www.1029.io/pneuma.<br />
<br />
=== Not another one! ===<br />
<br />
On this page was the symbol for the Spiritof1029, however, as time went on, the title of the page began changing, and so did certain letters in the symbol to make cries for help. The titles varied across these:<br />
<br />
?<br />
<br />
/\--/\--/\--/\<br />
<br />
it's so hard to breathe<br />
<br />
please make it stop<br />
<br />
around how many times<br />
<br />
we will all die<br />
<br />
b.r.e.a.t.h.e<br />
<br />
b..r..e..a..t..h..e<br />
<br />
b r e a t h e (page title was only a single letter)<br />
<br />
..........<br />
<br />
And the letters spelt to make words like HELP, STOP and mask.<br />
<br />
After the supposed death of ANOTHER mudokon, [http://www.1029.io/pneuma/helpus.jpg another image would be shown.]<br />
<br />
The community rushed to try and clean this image, producing a [http://www.oddworld.com/soulstorm/images/ARG_Image_04_4K.jpg terrifying image of a mudokon wearing a gas mask!] OWI quickly got the full image uploaded, updated their website accordingly and part 4 of 5 would be completed, and in record time too!<br />
<br />
== The Fifth Transmission ==<br />
<br />
Before the next transmission was made, subtle little changes were made to the 1029.io website. This included:<br />
<br />
1. A new HTML comment in the source code, reading: <pre><!-- heh, that was easy. let's see... --></pre><br />
<br />
2. The colour used for the highlights on the logo changed from red to green.<br />
<br />
3. Symbols in the logo would change to spell out the word "Magog".<br />
<br />
This would hint at The Magog Cartel, the main antagonistic company in the Oddworld Universe that is known for poor working conditions and treatment of the Mudokons.<br />
<br />
=== The Magog Cartel===<br />
<br />
Shortly after these discoveries, strange occurrences happened on the newly created Official Oddworld Discord server.<br />
<br />
1. A new emote with the Magog Cartel logo was added with the name :staywealthy:<br />
<br />
2. For a while all messages containing the :staywealthy: emote or the 8291 code (:_e_: :_t_: :_n_: :_o_:) got removed.<br />
<br />
3. The Oddworld Inhabitants employees (OWI_Alex, OWI_Pete & OWI_Bernice) stated posting gibberish and messages coming from an other entity. <br />
<br />
Some of the gibberish included:<br />
<br />
Òǚř ʂе¢цгіẗу ẁᾅș πŏţ ḃӷӫǟċḥễđ Ọսȑ šѐсưȑіƫỵ ẅἂѕ ᾒṑե ƃŗӫᾶϲɦẻđ ⍬ṳř şĕсǜӷɩȶӱ ẁấṣ ʼnόՒ þȑѐẩƈȟεժ Ỡùȓ șєϛụґɪŧӱ ẅᾲş բóȶ ḃŗḛąḉℏӫď Ơǔѓ ṡễćṻȓĩťÿ ẇẳŝ ἧὅṱ ḇґèḁčիề₫<br />
<br />
W& //€q117 PHø|? +/-/∂† +() }{∂|²|2€11.<br />
<br />
<br />
Ḿ̧̪̻̻͇̟̹̭̼͊̈́̍̎̿͐̎͝͞o̧̤̗̠͚̟͒̐͗͆͜͢͡͞C̠̯̳̙̠̳̹͒̽̇̈̽̚͜r̶͕̗̜̲͕̘̒͗̆̄̎̐̓t̛̛̯̠̼͎̭̻̯̜̿͂̑̃͌͂̔ļ̴͙̩̠̯̐̊̆̐̂̿c̢̳͎̱ ̺̮͎͖̟̐̓̐́͋͞ó̧̡̻͙̳͇̼̯̹̄͒̐͗ <br />
<br />
<br />
These all lead to [http://magogcartel.com/ magogcartel.com] and [https://twitter.com/magogcartel/ twitter.com/magogcartel]<br />
<br />
On The Magog Cartel's website, there are some interesting codes in the source code:<br />
<br />
1.<br />
<br />
DB_PP_PRODUCTTEXT: We’re sourciest, juiciest Parami__from closer to their nests, for our bes___________________________________________________________aramite Pies ever! Made with all natural ingredients[1] and baked in our traditional ovens to a recipe that’s be............ aster bakers, our pXXXes are packed with Para-meat[2] oooooooooooo00OOoozing [1] at least one natural ingredient in every 12-pack of pie_________8** [2] not necessarily made with Paramites.<br />
<br />
PLEASE REVIEW AS APPROPRIATE<br />
<br />
2.<br />
<br />
APPROV__tch this space for more information about our exciti________________ everage that’s so delicious, you’ll be craving another on33__________--333333333333 before you even finish it!!!_____________________________________________!!!:D:D:D<br />
<br />
3.<br />
<pre><br />
lfn0OE602+HKBKTMVawALWERLS6pu8P8NcEQyKfnKcQ5zy/H5ny4CU60hkmMHzqlNg+q2oVaSHjSzjPGo1vQzQsJCbHTNAXDCFgTIJznL/1ZkZT89VOuv4koDHZJs4YcWbOLbO1cvV87UMcdWbuAraCeFRF8jy7F1/PufFPAyYRR9Jp4nB6uWpNZlY8rdYmEw7IYvtg4QlaBtX/iiyT1Es8MFA+wO4OkBFEGLHDENvu83kfaMnBxabDguhS/W0wWJjNijasG+5PeHeWqmQYDWsz9YrKgWiap0KCghpDfRuOgH37qNUAQnIf4/AeMF14IiEg9PFlutZWGyXhHem4PF2kxYGp075T+5N0n6nbJt+MMDAa4H3D06iuZa5bK18pLIUIzaFxLue5EJoEz4+JwCYarhZ7JMqbzrtnPv8oK/BbHgaig9MjKf8X7/cHDaXkVObkhW8jyVxxS6IfedZIRO/Phqorogx+DO6dgKWhqppoRNpMU2jawix9b/rf6ZgGRcpngW9pOCDwxCB0UptxmaNk+fnxQQU1Wo9J/isrrgTd/eDpdZgFyD8d8KhYN/Uf8A3MhWX33Xr8MhAPF+BtQUYFYIrvD32CTtDqtGXfL26fdhAVh8XMjTFwwWCB6DH6WwYCwJyLCVikMSXOLbPfzZKFfZIia9KQnM24dGUOvVMkfBdTqdCpiuwV4NkGKY2hw2jNhjibPLt/Rcpnsxj3B+2Axu6z5bMnzPLRZY00w6p8CJckqQqV9YXdReb34dOLC/6Zb2VWbx1ARGNBwdN69lw==<br />
</pre><br />
<br />
INSERT ANECDOTE ABOUT THE ApMpApZING VIEW just left of here across Mudos AND who could possibly be the EMPLOYEE OF THE DAY AND THE NEW i mean, how hard can it be? every aspect of every aspect of every as-------------f every aspect of EVERY SIN--E ASPECT of every aspect of every asp--_--------------------ct of every aspect of every as_--ct of every aspect of FOLLOW ME follow US<br />
<br />
4.<br />
<pre><br />
01102911011101100101011102910111011102901001011011000110110001110011010291110100011011110102911100000111100101101111011101011029011110011029011011110111010101110111011010010291011011010290011011000110291001100110000101101100011029101100<br />
</pre><br />
<br />
This was decoded. When removing the occurences of "1029" you get:<br />
<br />
<pre><br />
0111011101100101011101110110100101101100011011000111001101110100011011110111000001111001011011110111 01010111100101101111011101010111011101101001011011000110110001100110011000010110110001101100<br />
</pre><br />
<br />
Decode binary to text and you get wewillstopyouyouwillfall<br />
<br />
<br />
5.<br />
<pre><br />
9JzrxKKv5z0829jLV8wF32KpA6I0nEQDqzmbpRYzUUE===<br />
</pre><br />
<br />
<br />
On the 11th of August the Magog Cartel sent a batch of tweets with some out of place uppercase letters spelling '''WE KNOW'''.<br />
<br />
<pre><br />
@spiritof1029 we see you. We can see what you are doing with your fake reports. you will not prospEr. <br />
</pre><br />
<pre><br />
we are proud of the strong linKs between each of our facilities. our operations are by far the most efficieNt on oddworld. <br />
</pre><br />
<pre><br />
we are aware of some terrible fake repOrts being leaked. please ignore them. our very successful Workers know the truth is very different.<br />
</pre><br />
<br />
On the 14th of August the Magog Cartel sent a batch of tweets all starting with '''We know'''. This lead us to believe the SPIRIT OF 1029 was interferring with those tweets and was trying to get a message accross. The message can be found in the very specific numbers mentionned in the first two tweets, 82 & 91, forming togeter '''8291'''.<br />
<br />
<pre><br />
We know every time an employee falls into a grinder it takes 82 minutes of Mudokon time to clean up. Be safe, for productivity’s sake!<br />
</pre><br />
<pre><br />
We know that an average of 91 eager new employees start their careers with us every day. Help them be the best workers they can be.<br />
</pre><br />
<pre><br />
We know that our facilities are a picture of perfect productivity. Your hard work helps us to show that picture to the world.<br />
</pre><br />
<pre><br />
We know what you’re looking for in a rewarding, productive career. Magog Cartel can help you find it. Discover your options with us today!<br />
</pre><br />
<br />
One hour later the SPIRIT OF 1029 sent a batch of tweets, one containing a cryptic code:<br />
<br />
<pre><br />
your help is invaluable to us, together we will blow this latest Magog scandal wide open. together #wewillrise<br />
</pre><br />
<pre><br />
the watchers can fish around the communication channels all they like, we will always be one step ahead of them.<br />
</pre><br />
<pre><br />
-1-4,-2-10<br />
</pre><br />
<pre><br />
the story of mudokonkind is about history. now they treat us just like numbers. they will not succeed.<br />
</pre><br />
<pre><br />
we have given you the tools you need. the ones we can trust will prove themselves capable. leaders will rise as the storm closes in.<br />
</pre><br />
<br />
The last tweet indicated that we had all we needed to continue our investigation and the one before that we shouldn't use the numbers in the codes as raw numbers but should link it to some kind of history. We needed to look into the Twitter history of the SPIRIT OF 1029 account.<br />
<br />
The '''-1-4,-2-10''' code actually tells us to take the 4th word from the previous tweet (-1) and take the 10th word of the tweet even before (-2):<br />
<br />
4th word of the previous tweet is '''fish''':<br />
<br />
<pre><br />
the watchers can 'fish' around the communication channels all they like, we will always be one step ahead of them.<br />
</pre><br />
<br />
10th word of the tweet before is '''blow''':<br />
<br />
<pre><br />
your help is invaluable to us, together we will 'blow' this latest Magog scandal wide open. together #wewillrise<br />
</pre><br />
<br />
Together those word form '''blowfish''' which is the [https://en.wikipedia.org/wiki/Blowfish_(cipher) cipher] we had to use to decrypt the base64 code in HTML comment 3.:<br />
<pre><br />
lfn0OE602+HKBKTMVawALWERLS6pu8P8NcEQyKfnKcQ5zy/H5ny4CU60hkmMHzqlNg+q2oVaSHjSzjPGo1vQzQsJCbHTNAXDCFgTIJznL/1ZkZT89VOuv4koDHZJs4YcWbOLbO1cvV87UMcdWbuAraCeFRF8jy7F1/PufFPAyYRR9Jp4nB6uWpNZlY8rdYmEw7IYvtg4QlaBtX/iiyT1Es8MFA+wO4OkBFEGLHDENvu83kfaMnBxabDguhS/W0wWJjNijasG+5PeHeWqmQYDWsz9YrKgWiap0KCghpDfRuOgH37qNUAQnIf4/AeMF14IiEg9PFlutZWGyXhHem4PF2kxYGp075T+5N0n6nbJt+MMDAa4H3D06iuZa5bK18pLIUIzaFxLue5EJoEz4+JwCYarhZ7JMqbzrtnPv8oK/BbHgaig9MjKf8X7/cHDaXkVObkhW8jyVxxS6IfedZIRO/Phqorogx+DO6dgKWhqppoRNpMU2jawix9b/rf6ZgGRcpngW9pOCDwxCB0UptxmaNk+fnxQQU1Wo9J/isrrgTd/eDpdZgFyD8d8KhYN/Uf8A3MhWX33Xr8MhAPF+BtQUYFYIrvD32CTtDqtGXfL26fdhAVh8XMjTFwwWCB6DH6WwYCwJyLCVikMSXOLbPfzZKFfZIia9KQnM24dGUOvVMkfBdTqdCpiuwV4NkGKY2hw2jNhjibPLt/Rcpnsxj3B+2Axu6z5bMnzPLRZY00w6p8CJckqQqV9YXdReb34dOLC/6Zb2VWbx1ARGNBwdN69lw==<br />
</pre><br />
<br />
Using a [https://gchq.github.io/CyberChef/#recipe=%5B%7B%22op%22%3A%22Blowfish%20Decrypt%22%2C%22args%22%3A%5B%7B%22option%22%3A%22UTF8%22%2C%22string%22%3A%22%22%7D%2C%22ECB%22%2C%22Hex%22%5D%7D%5D Blowfish Decryptor] (with CBC mode) and the code '''8291''' we got earlier via the interferences in the Magog Cartel tweets as a key we were able to recover the following text:<br />
<br />
<pre> ^_^U_VDXisistrueorfalseallforprofitinterestsindustrialagriculturalMudosprovidehighestpossiblereturninvestmentsoverheadsdreamslimitedpowergiganticbadgeleadersproductMeechMotorstravelexpertlytrainedSligSecurityForcessuccessfulundertakingemploymentvastsentientsecurespecialisthabitationzonesbenefitfactoriesfoundriesfarmlandsstabilitymillionsundertakingsCartelmanagementselflesslyrepresentativesresponsiblemunicipalvastidyllicsettlementsunderconstructionpleasesubscribeandlinkandfollowandlikeandbuyandbuyandbuyandbuyandbuyandbuyandbuyandbuyandbuyandbuyandbuyandbuyandbuyandbuyandbuyatmagogcartel<br />
</pre><br />
<br />
When adding spaces this reads:<br />
<br />
<pre><br />
^_^ U_V DX is is true or false all for profit interests industrial agricultural Mudos provide highest possible return investments overheads dreams limited power gigantic badge leaders product Meech Motors travel expertly trained Slig Security Forces successful undertaking employment vast sentient secure specialist habitation zones benefit factories foundries farmlands stability millions undertakings Cartel management selflessly representatives responsible municipal vast idyllic settlements under construction please subscribe and link and follow and like and buy and buy and buy and buy and buy and buy and buy and buy and buy and buy and buy and buy and buy and buy and buy at magog cartel<br />
</pre><br />
<br />
The part with "please subscribe" lead us to:<br />
<br />
* https://www.youtube.com/user/MagogCartel<br />
<br />
It is not sure at this point whether this is an official ARG account as the channel and profile are currently empty.<br />
<br />
<br />
The two last tweets of August 14th from the Magog Cartel were hinting at a '''picture''' on the MagogCartel.com website ('''Magog Cartel can help you find it'''):<br />
<br />
<pre><br />
We know that our facilities are a picture of perfect productivity. Your hard work helps us to show that picture to the world.<br />
</pre><br />
<pre><br />
We know what you’re looking for in a rewarding, productive career. Magog Cartel can help you find it. Discover your options with us today!<br />
</pre><br />
<br />
This led us to:<br />
<br />
* [http://magogcartel.com/weknow.jpg magogcartel.com/weknow.jpg]<br />
<br />
That picture contains quite a few codes:<br />
<br />
* The '''62466640222 2777833555''' sequence in the upper-left corner.<br />
<br />
Spells '''Magog Cartel''' when using a [https://www.mrwebmaster.it/img/guide/wp7/21-001.jpg phone keypad]<br />
<br />
* The mose code in the middle.<br />
<br />
<pre><br />
.-- . / -.- -. --- .-- / .... --- .-- / -.-- --- ..- / .-- --- .-. -.- / -. --- .-- .-.-.- / .-- . / -.- -. --- .-- / -.-- --- ..- .-. / -.-. --- -.. . ... .-.-.- / .-- . / .-- .. .-.. .-.. / ... - --- .--. / -.-- --- ..- .-.-.- / -.-- --- ..- / .-- .. .-.. .-.. / -. --- - / .. -. - .. -- .. -.. .- - . / ..- ... .-.-.- / --- ..- .-. / .-- .- -.-- / --- ..-. / .-.. .. ..-. . / -- ..- ... - / -... . / .--. .-. . ... . .-. ...- . -.. .-.-.-<br />
</pre><br />
<br />
<pre><br />
WE KNOW HOW YOU WORK NOW. WE KNOW YOUR CODES. WE WILL STOP YOU. YOU WILL NOT INTIMIDATE US. OUR WAY OF LIFE MUST BE PRESERVED.<br />
</pre><br />
<br />
* The '''e''' and '''d''' sequence in the upper-right corner.<br />
<br />
It's actually morse code too where '''e = .''', '''d = -''' & '''X = /'''.<br />
<br />
<pre><br />
.-.. --- --- -.- --..-- / .-- . / -.-. .- -. / -- .- -.- . / ... . -.-. .-. . - / -.-. --- -.. . ... / - --- --- .-.-.- / -.-- --- ..- / .- .-. . / -. --- - / .- ... / ... -- .- .-. - / .- ... / -.-- --- ..- / - .... .. -. -.- / -.-- --- ..- / .- .-. . .-.-.- / .-- . / .... .- ...- . / - .... . / .-. . ... --- ..- .-. -.-. . ... / .- -. -.. / - .... . / .--. . .-. ... --- -. -. . .-.. / - --- / ... .. -- .--. .-.. -.-- / ... .-- .- -- .--. / -.-- --- ..- / .-- .. - .... / .-- --- .-. -.- .-.-.- / .... --- .-- / -- ..- -.-. .... / - .. -- . / -.. .. -.. / -.-- --- ..- / .-- .- ... - . / - .-. -.-- .. -. --. / - --- / -.. . -.-. .. .--. .... . .-. / - .... .. ... / -.-. --- -.. . ..--.. / .- .-.. .-.. / - .... . / - .. -- . --..-- / .-- . / .-- . .-. . / --. . - - .. -. --. / -.-. .-.. --- ... . .-. / - --- / ..-. .. -. -.. .. -. --. / -.-- --- ..- .-.-.- / .-- . / .- .-. . / .- .-.. -- --- ... - / - .... . .-. . .-.-.- / -- .- -.-- -... . / .-- . / .- .-. . / --- ..- - ... .. -.. . / .-. .. --. .... - / -. --- .-- --..-- / .-- .- .. - .. -. --. .-.-.- / .-- .- - -.-. .... .. -. --. .-.-.- / -.-- --- ..- / -.-. .- -. -. --- - / .... .. -.. . / ..-. --- .-. . ...- . .-. --..-- / - . .-. .-. --- .-. .. ... - .-.-.- / .-- . / .-- .. .-.. .-.. / .. -. -.-. .. -. . .-. .- - . / -.-- --- ..- .-. / ... .. .-.. .-.. -.-- / .-.. .. - - .-.. . / --. .-. --- ..- .--. / .- -. -.. / ... -.-. .- - - . .-. / -.-- --- ..- .-. / .- ... .... . ... / - --- / . ...- . .-. -.-- / -.-. --- .-. -. . .-. / --- ..-. / --- ..- .-. / . -- .--. .. .-. . / ... --- / - .... .- - / -.-- --- ..- / .-- .. .-.. .-.. / . - . .-. -. .- .-.. .-.. -.-- / -... . .- .-. / .-- .. - -. . ... ... / - --- / --- ..- .-. / ... ..- -.-. -.-. . ... ... . ... --..-- / .- -. -.. / -.-- --- ..- .-. / -.- .. -. -.. ... / ..- -. . -. -.. .. -. --. / ... . .-. ...- .. - ..- -.. . .-.-.- / -.-- --- ..- / .... .- ...- . / .- .-.. .-. . .- -.. -.-- / .-.. --- ... - .-.-.-<br />
</pre><br />
<br />
<pre><br />
LOOK, WE CAN MAKE SECRET CODES TOO. YOU ARE NOT AS SMART AS YOU THINK YOU ARE. WE HAVE THE RESOURCES AND THE PERSONNEL TO SIMPLY SWAMP YOU WITH WORK. HOW MUCH TIME DID YOU WASTE TRYING TO DECIPHER THIS CODE? ALL THE TIME, WE WERE GETTING CLOSER TO FINDING YOU. WE ARE ALMOST THERE. MAYBE WE ARE OUTSIDE RIGHT NOW, WAITING. WATCHING. YOU CANNOT HIDE FOREVER, TERRORIST. WE WILL INCINERATE YOUR SILLY LITTLE GROUP AND SCATTER YOUR ASHES TO EVERY CORNER OF OUR EMPIRE SO THAT YOU WILL ETERNALLY BEAR WITNESS TO OUR SUCCESSES, AND YOUR KINDS UNENDING SERVITUDE. YOU HAVE ALREADY LOST.<br />
</pre><br />
<br />
* The [https://lobestir.files.wordpress.com/2014/05/cypher-pig-pen-lower.png Pigpen cipher] text in the lower-right corner.<br />
<br />
<pre><br />
WE WILL NEVER GIVE IN TO TERRORISTS. YOU WILL NEVER WIN. YOU WILL NOT DEFEAT OUR SPIRIT. WE WILL FIND YOU AND WE WILL WIPE YOU OUT. WE IGNITE THE FLAME THAT LIGHTS THE DARKNESS. THERE IS NOWHERE TO HIDE. YOU WILL NEVER KNOW SUCCESS<br />
</pre><br />
<br />
* The horizonally mirrored black text in the middle.<br />
<br />
<pre><br />
you are a resource. you are expendable. we will replace you when you fall. you will work. you will obey. you will comply. or you will perish. we have the prestige. we have the power. we will profit. always. always. always.<br />
</pre><br />
<br />
* The white text on the top.<br />
<br />
<pre><br />
Prestige. Power. Profits. Work. Obey. Comply. Prestige. Power. Profits. Work. Obey. Comply. Prestige. Power. Profits. Work. Obey. Comply. Prestige. Power. Profits. Work. Obey. Comply. <br />
</pre><br />
<br />
* The braille at the bottom.<br />
<br />
<pre><br />
RuptureFarms1029 will rise from the ashes. we will rebuild it bigger, better and more profitable than before. it will be the greatest, most efficient factory that Oddworld has ever seen. it will be a towering symbol of Glukkon strength that cannot be ignored. one terrorist will not deter us.<br />
</pre><br />
<br />
It has to be noted that those codes were left by the Magog Cartel as what appears to be a bait so that we would lose valuable time decoding them.<br />
<br />
It is unknown how to decode the '''9JzrxKKv5z0829jLV8wF32KpA6I0nEQDqzmbpRYzUUE===''' code.<br />
<br />
The page has changed since then, but the first (hacked) version of the MagogCartel.com site has been archived [http://oddworldlibrary.net/archives/web/MagogCartel.com/index_1/P.%20P.%20P.%20_____%201029%20_____.html here]<br />
<br />
On the 4th of September the MagogCartel.com got updated, simply displaying the following text:<br />
<br />
<blockquote><br />
*** UNDER CONSTRUKTION ***<br />
</blockquote><br />
<br />
The page has changed since then, but the second (under construktion) version of the MagogCartel.com site has been archived <br />
[http://oddworldlibrary.net/archives/web/MagogCartel.com/index_2/___%20UNDER%20CONSTRUKTION%20___.html here]<br />
<br />
On the 5th of September the Magog Cartel posted a video trough the OddworldInc account:<br />
<br />
<pre><br />
w̸̨̠͓͍̯̺͉͞e̯̝͖̫̺̯͉̻͘͡ ̗̭̕͢s̴̮̭̫̱ͅe̢̠̮̫̦̼̪̘͠ͅę̠̥̯͔̣̼̻̕ͅ ̻̘̼̣͓̩͚͘͢͠y̴̭̯̪̺͙͚͚̪͞o̬̞͜͢͝u̮̤͖̩̗̰ͅͅ.̴̲̣̪̮̼̱.̡̰̭̗͍̝͉̯͢.̡̡̼͇̙̜̮̦̪̞ͅ <br />
pic.twitter.com/UoQ3xRAhDU<br />
</pre><br />
<br />
<pre><br />
We continue to demonstrate our exceptional technological progress to an ever growing number of customers. Everyone loves Magog products!<br />
</pre><br />
<br />
When asked if they really just claimed the attack on the @OddworldInc account they replied:<br />
<br />
<pre><br />
Attack? We don’t need to attack, we’re already in a dominant position in every market we deem profitable. We just demonstrate our dominance.<br />
</pre><br />
<br />
There are multiple messages flashing in the video:<br />
<br />
<pre><br />
8<br />
?<br />
2<br />
2<br />
9<br />
1<br />
/<br />
8291<br />
829/<br />
229/<br />
22/9<br />
EVERYONE<br />
WANTS<br />
TO<br />
EAT<br />
YOU<br />
</pre><br />
<br />
Note that '''22/9''' is the date of the Oddworld presentation at the EGX:<br />
<br />
<pre><br />
We're going to be at EGX for an on-stage presentation on Friday 22nd Sept! Grab your tickets now! @EGX pic.twitter.com/rDQiDIApa9<br />
</pre><br />
<br />
<br />
On the 7th of September the MagogCartel.com got updated again, randomly displaying one of three photos of The Informant.<br />
<br />
At the same time the Magog Cartel sent a batch of tweets with containing other pictures of The Informant:<br />
<br />
<pre><br />
We stopped reading the Daily Deception’s fake reports. The latest issue of The Informant is a really great read, very honest. The greatest!<br />
</pre><br />
<br />
<pre><br />
It’s great to finally have an honest newspaper to read, and such good quality, too! <br />
pic.twitter.com/MHuC6jdtNC<br />
</pre><br />
<br />
<pre><br />
We’re always happy to see some balanced reporting on our business from The Informant. Refreshing, when there are so many fake reports! <br />
pic.twitter.com/DmkV4GbVYw<br />
</pre><br />
<br />
<pre><br />
We’ve just been told that The Informant is printed on machines made at a Magog facility! That explains the quality! <br />
pic.twitter.com/Bvz29ZrBvk<br />
</pre><br />
<br />
It has been noted that some letters were in bold but it's unclear how this should be used.<br />
<br />
Part of The Informant has be transcribed here:<br />
<br />
http://oddworldlibrary.net/oddenc/index.php?title=Soulstorm_ARG_-_The_Informant<br />
<br />
The MagogCartel.com page also contains the following HTML comment:<br />
<br />
<pre><br />
<nowiki><!--</nowiki> seriously, are you guys seeing this?! --><br />
</pre><br />
<br />
== The third phase ==<br />
<br />
=== The Origins diversion ===<br />
<br />
On the 15 of March 2018 the SPIRIT OF 1029 posted the following tweets:<br />
<br />
<pre><br />
Our future depends on us understanding our past. We must know where we come from.<br />
</pre><br />
<br />
<pre><br />
We know you can hear us. We know you are ready to help. We will show you more when the time is right. Keep watching.<br />
</pre><br />
<br />
Following this a couple of changes were found on the 1029.io page.<br />
<br />
# The logo has now even more letters appearing in it randomly: '''S, I, N, O, R'''. Adding to the previous letters that were spelling "MAGOG".<br />
# The page contains a new HTML comment:<br />
<nowiki><!--</nowiki> too obvious? i dunno. it's soon though. i can't wait. --><br />
<br />
Changes were also observed on the 404 page:<br />
<br />
# The logo on the 404 page now contains the following letters: '''N, I, G, I, O, R, S'''. Those letters can be used to spell the word "ORIGINS" <br />
# The page contains a new HTML comment:<br />
<nowiki><!--</nowiki> me neither. it's going to be great. --><br />
<br />
Shortly after a new channel called "origins" appeared on the official [https://discord.gg/bQKeAE6 Oddworld Discord] with a cryptic [https://cdn.discordapp.com/attachments/424167787897028609/424175888418996225/origins_1.mp4 video] as first message.<br />
<br />
It was revealed a few days later that this was a built up to announcement of the [https://www.kickstarter.com/projects/1869209521/oddworld-abes-origins-book-and-game-collection "Oddworld: Abe's Origins - Book & Game Collection" kickstarter campaign]. Note that the book & game collection is still available for preorder on [https://app.crowdox.com/projects/1869209521/oddworld-abes-origins-book-and-game-collection Crowdox].<br />
<br />
=== Intro ===<br />
<br />
Around the 12th of January 2018 [[Lorne Lanning]] changed his twitter header picture to the following one:<br />
* https://pbs.twimg.com/profile_banners/20823262/1515636880/1500x500<br />
<br />
While it was hinted repeatedly in the official [https://discord.gg/bQKeAE6 Oddworld Discord] that this image was hiding something, it wasn't until much later that it was found how to use it when @edmudokon tweeted the following message:<br />
<br />
<pre><br />
alive… <br />
pic.twitter.com/j0FE2Qgdu1<br />
</pre><br />
<br />
The embedded picture contains the number '''15156'''. This is a reference to a number in the URL of Lorne's header picture: '''1515636880'''.<br />
<br />
This number led us to a new page:<br />
<br />
* http://www.1029.io/1515636880/<br />
<br />
This page contains the following text in UTF-8<br />
<br />
<blockquote><br />
ɦểɫр. гẹẳčℏɪṅǧ óúƫ ῒԑ ģӫԷṱіᾗĝ ḥǡṛⅾềɽ. էիȅỷ ķῆοԝ. ẁẹ'ṝϵ ṙṵɴᾑıпʛ ộևȽ ờẛ ɩḋϵᾂš, ὅрՒῑổпş, ăұҿἧµϱṣ. ẅϵ ǹêȩḋ ỳờǚґ ḣҽľῥ. ẇể ῂёϱḋ ѕờṃēƅȯƌý ţó ṧṕȑểǻժ Ƚħẹ ẁổṝḓ. եḫϊṥ ƫɦ¡ƞɡ ῐʂ ḸỄƮḨǠĻ. Ƚḣěȳ ḓõᾔ'Ƚ ĉὰгє Ƚḣổṻɕḫ. ţհểӯ ɗṍἧ'ţ. ṣởṁḗɒὀժỵ ňěөƌş ṱὃ ȶěḻɫ իḭɱ. †ɛŀļ ẖĩ₥. ḃḕẛṍɼę îȽ'ṧ Էȭô ḷǎťϱ. ṯĥềŗȇ ḧąș Էố ƃϱ ᾅ ṣọṁȇþöḏỳ ẉíļłȋդǥ եό ȶαҝě ṯẖё јǒŭӷṋёỷ. şõ₥ęƀὁḓẏ ṅểềⅾԑ ƫծ ġềŧ ţհϵ ṃệṣśᾇǵε ộվե. ẁë'ṝе ìη ṭӷơữþŀɛ. аɬł ṑƒ սʂ. ẁё դȅễɖ ĥẹĺρ. թłȩᾂʂĕ ɦȇɫṕ կѕ.</<br />
</blockquote><br />
<br />
and the following HTML comments<br />
<br />
<nowiki><!--</nowiki> it's only going to get harder. we don't have the keys anymore to the usual channels. if you hear anything from them, it's THEM. --><br />
<br />
<nowiki><!--</nowiki> our options are limited. you can help though. you have to help. if we can be sure it's you, then maybe we can talk. prove it. --><br />
<br />
It's currently unknown what the next steps are<br />
<br />
== Loose Ends ==<br />
<br />
This section documents various puzzles throughout the ARG which have not yet been used or solved.<br />
<br />
=== Main Website Source Code Comment Numbers Puzzles ===<br />
<br />
These numerical puzzles were found in the source code for the [http://www.oddworld.com/soulstorm/ official Oddworld website] as early as the date of the Spirit of 1029's first transmission. Their solutions have been found, but the intended use of the solutions remains unknown.<br />
<br />
!--<br />
<br />
72 99<br />
\ /<br />
27 45<br />
\ /<br />
18 39<br />
\ /<br />
21 36<br />
\ /<br />
?? 28<br />
\ /<br />
13 21<br />
\ /<br />
7<br />
<br />
--><br />
<br />
SOLUTION: 12<br />
7+2+9+9 = 27, 2+7+4+5 = 18, thus 2+1+3+6 = 12<br />
<br />
&<br />
<br />
!-- <br />
<br />
16 _ 37 _ 58 _ 89 _ 145 _ 42 _ ?? _ 4<br />
|_________________<_________________| <br />
<br />
--><br />
<br />
SOLUTION: 20<br />
1^2 + 6^2 = 37, 3^2 + 7^2 = 58, thus 4^2 + 2^2 = 20<br />
<br />
==== Other Source Code Comments ====<br />
<br />
On http://1029.io, the following comments could or can be found in the page's source code:<br />
<br />
!-- we'll be here, waiting. --><br />
<br />
&<br />
<br />
!-- <br />
Well, I //--/ED Mudokon/. But who// _____ r///u/ //? <br />
<br />
=== Third Hidden Asset98 URL Source Code Solutions ===<br />
<br />
Certain code strings & puzzle solutions found within the [http://wiki.gamedetectives.net/index.php?title=Oddworld_Soulstorm#Source_Code_Mysteries source code] for the third hidden Asset98 URL were not ultimately used in the course of arriving at the image locked behind them. These strings & solutions in include:<br />
<br />
The solution for the numbers <code>7777338883366899984477733 33</code>, which decode to <code>SEVENTYTHREE</code> via [http://www.dcode.fr/multitap-abc-cipher multi-tap cipher], was never applied.<br />
<br />
The following letter strings were never applied:<br />
<br />
<pre><br />
\\//\/KDIUTHANPUYHHDQOEPLNDOALJGUDITHBBDOZLGFERKJGLSAOE<br />
<br />
\////JUTYROSLNGNALEHGNWOTIQPOKSDNTPNOJAWEOBNGLAWKJNWNR <br />
<br />
\\\/\\JHWUITUHABSJGNEWKLALNVGJKWELKJLWQQPRUTJHJJSBFMMH<br />
</pre><br />
<br />
The following coordinate strings were never applied:<br />
<br />
<pre><br />
\\\\/\2,1:2.3,1:2.6,1:4.1,2:4.3,2:2.3,4:4.5,5:2.6,5:3.7,5:3.4,7:8.5,7:3.7,6:4.<br />
<br />
\///\//\1,1:3.4,1:2.6,1:9.2,2:2.6,2:2.2,4:4.3,5:2.5,5:2.7,5:3.4,7:3.6,7:2.7,7:2. <br />
<br />
\\//\\\/4,2:6.6,2:4.7,3:3.2,4:8.3,4:2.4,4:2.7,4:3.2,6:2.4,6:3.6,6:2.1,7:4.3,7:2.<br />
</pre><br />
<br />
The community speculates that these strings were not intended to be used but rather existed as "red herrings" in order to stall attempts to solve the grid. The only strings which were used were the ones which began with a forward slash ( / )<br />
<br />
=== Written Text on "Puzzle Pieces" Image ===<br />
<br />
Writing which was noticed written over the image on the puzzle pieces, but which is absent from the final released image. The significance of the writing remains unknown.<br />
<br />
<gallery mode="packed" widths=200px heights=300px><br />
File:Oddworld_1029-LY_letters.jpg|1029-LY "WHERE"<br />
File:Oddworld_7393-AN_letters.jpg|7393-AN "SO TIRED"<br />
File:Oddworld3786-IC_letters.jpg|3786-IC "WHO?"<br />
File:Oddworld_8291_circled.png|Complete Image "8291"<br />
</gallery><br />
<br />
=== Anomalies In First Released Image ===<br />
<br />
Hidden against the background of the first released image are several text strings, pictured below. Their significance is unknown.<br />
<br />
[[File:Oddworld_Complete_1_Iso.jpg|frameless|810px]]<br />
<br />
1101110BC<br />
100000BD or 100000BC <br />
010100BD</div>Halke234https://wiki.gamedetectives.net/index.php?title=TheConsole&diff=16659TheConsole2018-07-30T17:15:22Z<p>Halke234: </p>
<hr />
<div>{{argbox<br />
| float = right<br />
| name = The Console<br />
| image = File:TheConsoleAvatar.png<br />
| description= <br />
| creator = Jack Bergin<br />
| type = Investigation<br />
| status = Discontinued<br />
| discovered = 2017-03-22<br />
}}<br />
[[Main Page]] > [[List of Investigations]] > '''TheConsole'''<br />
<br />
''The PM has stated that continuing the ARG will be too difficult, and as such he has canceled the project. The proposed timeline can be found at the bottom of the page.''<br />
<br />
On March 22, 2017, a GD member discovered a [https://theconsole.tumblr.com/ tumblr page] called "TheConsole." It contains many different entries about strange materials, and SCP-like entities. [''Editor's note: As of 2018, the Tumblr page appears to have been deleted.'']<br />
<br />
__TOC__<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
==CLASSIFIED==<br />
<br />
One of the original Tumblr posts contained:<br />
<pre><br />
22317 1954<br />
ytwx://pnuxvblv.cbo/5I14xiOD<br />
<br />
Encrypted file found and reformatted.<br />
Cipher in place.<br />
</pre><br />
<br />
Players found this to be a Vigenere cipher, with a key of "radiance," revealing [http://pastebin.com/5E14giLV a pastebin]. The contents of this were found to also be encoded with Vigenere with the same key:<br />
<br />
<pre><br />
[CLASSIFIED]<br />
//Log-in credentials needed//<br />
//Username: HWells1//<br />
//Password: radiance//<br />
//Log-in successful//<br />
//Retrieving file…//<br />
Project Radiance: Previous studies of AETHER have shown that it is capable of manipulating matter. Hypothetically, it could be used to create a “door” to a different point in space.<br />
Subject: Mouse<br />
Status: Dead<br />
Cause: Lethal AETHER intensity<br />
<br />
Subject: Mouse<br />
Status: Dead<br />
Cause: Beheading via travelling through AETHER doorway<br />
<br />
Subject: Mouse<br />
Status: Alive<br />
Notes: Arm missing<br />
<br />
Subject: Mouse<br />
Status: Alive<br />
Notes: Visibly fine<br />
<br />
Subject: Dummy<br />
Status: Destroyed<br />
Cause: Burning<br />
<br />
Subject: Dummy<br />
Status: Intact<br />
Notes: Minor burns<br />
<br />
Subject: Dummy<br />
Status: Intact<br />
Notes: Visibly normal<br />
<br />
Subject: Wells, I.<br />
Status: Unknown<br />
Cause: Lethal AETHER intensity<br />
Notes: During testing, an unforeseen error came into play, resulting in an explosion killing 8 members of staff. One survivor has experienced psychological trauma from witnessing the aftermath, refusing to co-operate in present and upcoming projects in fear of an identical outcome. As such, his position has been suspended and treatment is pending. Until he can co-operate with Lumitech again, his future with the company is hanging by a thread.<br />
<br />
Until I. Wells is retrieved from [N/A] or a successful, non-lethal doorway is created, the project will be permanently shut sown.<br />
<br />
Additional notes: Since the experiment, H Wells has reported seeing an “angel”. Psychological evaluation is recommended.<br />
</pre><br />
<br />
==VISUAL FEED==<br />
<br />
Players also discovered a [https://www.youtube.com/channel/UC_kasuQokBmsAkLT4iz613Q YouTube channel], which initially contained a single [https://www.youtube.com/watch?v=F-g4r5MN9Gc video], titled "Visual Feed 1." There appeared to be nothing but a black screen, and static in the background. However, more information was revealed when closed captions were turned on:<br />
<pre><br />
TheConsole: [ERROR: File could not be read]<br />
TheConsole: [Transcribing event...]<br />
TheConsole: [Subject: Dr Harvey Wells]<br />
TheConsole: [Status: Grieving]<br />
TheConsole: [Cause: Experiment Fatality Case R-03]<br />
TheConsole: [Details: [RESTRICTED BY LUMITECH]<br />
TheConsole: [RADIANCE-1 is online]<br />
</pre><br />
<br />
Later the restricted details where found to be <code>Project Radiance</code>.<br />
<br />
==Fort Rosner Breached==<br />
<br />
On March 26, 2017, two new files were posted on the blog. <br />
<br />
===Audio File===<br />
<br />
One of the files was an [https://theconsole.tumblr.com/post/158855638379/fortrosnerbreach audio file] discovered to be SSTV revealing [https://cdn.discordapp.com/attachments/294293637129568256/295607271960870913/unknown.png this image] of a crest displaying an eagle with a flag above its head, and holding what appear to be an olive branch and wheat in its talons. Below the eagle is the text "FORT ROSNER," suggesting that this image might be some form of title slide for a video.<br />
<br />
===Encrypted Message===<br />
<br />
The other file recovered was an [https://theconsole.tumblr.com/post/158860753749/26317-2024 encrypted document], encoded with what appears to be a unique mix of Viginere and Base 64 encryption from [http://www.encrypt-easy.com/encrypt-text this site]. The password for this file was "hive," revealing the text:<br />
<br />
<pre><br />
TITLE OF FILE: I'm scared<br />
<br />
FILE CONTENTS:<br />
<br />
From: Wells, H.<br />
To: Kingston, T<br />
<br />
Mr Kingston,<br />
I am writing to you about the previous attempts on Project Precipice.<br />
While the AI for Td-1 is being compiled, the physical components of the body Are missing some key materials. We believe that, if given access to the previous RaDiances, We can develop pocket AETHER generators tHat can kEep the final pRoduct running for long pEriods of time, As well as fuel the weaponry being developed.<br />
Respond at your earliest convenience.<br />
<br />
Regards,<br />
Dr Wells<br />
<br />
From: Kingston, T<br />
To: Wells, H<br />
<br />
Dr Wells,<br />
We will have the parts ready soon. We begin with the disasseMbly of Radiance-1 tomorrow. Do not fail us, we are sInking too much money into this and do not want a repeat of what happened to Irene.<br />
<br />
From,<br />
T. Kingston<br />
CEO of Lumitech<br />
</pre><br />
<br />
When the capitalization mistakes are strung together with the title, the message "Dad where am I I'm scared" is revealed. This message appears to be coming from Wells' daughter, but how or why it was transmitted is unknown. In addition, the "A.I." referred to in the message could possibly be Jude/TheConsole, but it is not clear whether this is the case.<br />
<br />
=Ending=<br />
<br />
===Act 2===<br />
<br />
Jared awakens in the ruins of a large building with no clue as to how he got there. The place has been shut for years. Every week, he would have sent two lucky users a password-protected file containing images, videos and audio pointing to the fact that Bel is slowly taking over.<br />
Meanwhile, a new video would be uploaded. Fort Rosner announced the discovery of Michael Ryan’s body and that it was to be cremated and scattered within a few days.<br />
News with Caefur would be slow as usual.<br />
Near August, TheConsole would be hijacked temporarily by CP-1 (aka Cenpro), followed by a “forced temporal blockade” (as far as Jude knew, it would be the same date for a while). To end it, some unplanned activity would need to be done by the community to overpower Levia/The Watcher, who was responsible for the event.<br />
SB-D/Timechaser would make a brief appearance, warning that something is close to happening.<br />
<br />
===Act 3===<br />
<br />
Louise and Dr Wells would die at the hands of unnamed individuals. The event would be marked once again by a message from Bel’s disciple. The name of the Tongue is revealed to be Tohn.<br />
Jared’s body begins to fail, resulting in Bel being forced to leave the body.<br />
(Interactive puzzle stuff)<br />
Jude is alerted to the presence of three unknown entities and an angel approaching C-1. Security systems fail and TheConsole is no longer online.<br />
<br />
There would likely be a lot more stuff in-between that would have shaped the story better, but this was all the main information<br />
<br />
===TRIVIA===<br />
<br />
Fort Rosner was named after Florida Man Adam Rosner, creator of series TribeTwelve. Additionally, Bel can be seen as a sort of homage.<br />
Sigma was indeed named after the term sigma radiation from EverymanHybrid, another online series.<br />
The four fragments of the blind angel were named after the books in the Satanic Bible. Levia+Ethan = Leviathan, Louise/Lou+Caefur = Lucifer, Bel+Vial (where the sigma that infected Jared came from) = Belial, Say (what tongues help do)+Tohn = Satan.<br />
Harvey Wells and TheConsole originally came from the demo linked in the previous post (as minor characters).<br />
<br />
=Resources=<br />
<br />
===Glossary===<br />
<br />
A compilation of characters, locations, terms, and more: [[TheConsole/Glossary|Glossary]]<br />
<br />
===Event Timeline===<br />
<br />
A chronological list of major events: [[TheConsole/Event_Timeline|Timeline]]</div>Halke234https://wiki.gamedetectives.net/index.php?title=Sombra_ARG&diff=16653Sombra ARG2018-07-29T00:17:53Z<p>Halke234: Rechanged to keep consistent with the rest of the page.</p>
<hr />
<div>{{argbox<br />
| float = right<br />
| name = Sombra ARG<br />
| image = File:Sombra_skull.png<br />
| description= The Sombra ARG - an ARG involving an unreleased Overwatch hero.<br />
| creator = [https://www.blizzard.com/ Blizzard Entertainment]<br />
| type = Official<br />
| status = Completed<br />
| discovered = 2016-06-12<br />
| completed = 2016-11-04<br />
}}<br />
<br />
{{ArgHeader|arg=Sombra ARG}}<br />
The Sombra ARG was an ARG for the first-person shooter [https://www.playoverwatch.com Overwatch], developed by [https://www.blizzard.com/ Blizzard Entertainment]. Sombra was the name of a then-unreleased Overwatch hero. The ARG was comprised of clues and ciphers referencing Sombra, which were found in various developer updates and short animations.<br />
<br />
At the game's release, there were numerous pieces of in-game information that appeared in the map Dorado, hinting at a character called Sombra. When the hero Ana was revealed, more Sombra clues appeared in Ana's origin video. In the weeks that followed, more clues were discovered, which led up to a character reveal animation at BlizzCon 2016.<br />
<br />
== Ana Videos ==<br />
<br />
=== Ana Origin Video ===<br />
<br />
On July 12, 2016, a [https://www.youtube.com/watch?v=TE0CXgpNxG0 video] for the new Overwatch hero named Ana was released. At the 1:16 mark, players discovered a set of hexidecmial values:<br />
<br />
[[File:Ana_Hex2.png|400px]]<br />
<br />
<pre><br />
2E 2E 2E 7B 76 20 66 62 72 20 63 7E 72 79 72 20 7B 76 20 7E<br />
79 71 78 65 7A 76 74 7E D4 A4 79 2C 20 63 7E 72 79 72 20 72<br />
7B 20 67 78 73 72 65 2E 2E 2E 7B 76 20 66 62 72 20 63 7E 72<br />
79 72 20 7B 76 20 7E 79 71 78 65 7A 76 74 7E D4 A4 79 2C 20<br />
63 7E 72 79 72 20 72 7B 20 67 78 73 72 65 2E 2E 2E 7B 76 20<br />
66 62 72 20 63 7E 72 79 72 20 7B 76 20 7E 79 71 78 65 7A 76<br />
74 7E D4 A4 79 2C 20 63 7E 72 79 72 20 72 7B 20 67 78 73 72<br />
65 2E 2E 2E 7B 76 20 66 62 72 20 63 7E 72 79 72 20 7B 76 20<br />
7E 79 71 78 65 7A 76 74 7E D4 A4 79 2C 20 63 7E 72 79 72 20<br />
72 7B 20 67 78 73 72 65 2E 2E 2E 64 78 7A 75<br />
</pre><br />
<br />
A hex to ASCII translation yielded the following:<br />
<br />
<pre><br />
...{v fbr c~ryr {v ~yqxezvt~Ô¤y, c~ryr r{ gxsre...{v fbr c~ryr {v ~yqxezvt~Ô¤y, c~ryr r{ gxsre...{v fbr c~ryr {v ~yqxezvt~Ô¤y, c~ryr r{ gxsre...{v fbr <br />
c~ryr {v ~yqxezvt~Ô¤y, c~ryr r{ gxsre...dxzu<br />
</pre><br />
<br />
Using an XOR Cipher with the constant 23 on the above text resulted in the following message:<br />
<br />
<pre><br />
..la que tiene la información; tiene el poder...la que tiene la información; tiene el poder...la que tiene la información; tiene el poder...la que tiene la <br />
información; tiene el poder...somb<br />
</pre><br />
<br />
This was a repeating phrase in Spanish, which translated to:<br />
<br />
<pre><br />
She who has the information, has the power...<br />
</pre><br />
<br />
Players then discovered a second set of hexidecimal values at the 2:11 mark:<br />
<br />
[[File:Ana Hex.png|400px]]<br />
<br />
<pre><br />
65 76 2E 2E 2E 7B 76 20 66 62 72 20 63 7E 72 79 72 20 7B 76<br />
20 7E 79 71 78 65 7A 76 74 7E D4 A4 79 2C 20 63 7E 72 79 72<br />
20 72 7B 20 67 78 73 72 65 2E 2E 2E 7B 76 20 66 62 72 20 63<br />
7E 72 79 72 20 7B 76 20 7E 79 71 78 65 7A 76 74 7E D4 A4 79<br />
2C 20 63 7E 72 79 72 20 72 7B 20 67 78 73 72 65 2E 2E 2E 7B<br />
76 20 66 62 72 20 63 7E 72 79 72 20 7B 76 20 7E 79 71 78 65<br />
7A 76 74 7E D4 A4 79 2C 20 63 7E 72 79 72 20 72 7B 20 67 78<br />
73 72 65 2E 2E 2E 7B 76 20 66 62 72 20 63 7E 72 79 72 20 7B<br />
76 20 7E 79 71 78 65 7A 76 74 7E D4 A4 79 2C 20 63 7E 72 79<br />
72 20 72 7B 20 67 78 73 72 65 2E 2E 2E<br />
</pre><br />
<br />
When put through the same process, the same string of Spanish was revealed, but with the letters <code>ra</code> at the beginning of the message. These letters were combined with <code>somb</code> from the first cipher to create the name <code>sombra</code>. No more clues were discovered until the release of the Dev Update video.<br />
<br />
=== Dev Update Video ===<br />
<br />
[[File:Sombra Barcodes.png|thumbnail|right|The vertical barcodes found at the end of the Ana Dev Update video]]<br />
<br />
On July 19, 2016, the first [https://www.youtube.com/watch?v=evghkilg2eQ Developer Update] was released for Ana. At the end of the video, players discovered a series of vertical barcodes. When scanned, players discovered a large set of hexidecimal values which where then converted to binary, a dump of which is available [https://gist.github.com/zapu/31165efab0d6264e2fd0fa75cc53b1aa here].<br />
<br />
Turning the ones and zeroes into black and white pixels formed a QR code:<br />
<br />
[[File:Sombra_QR_code.png|300px]]<br />
<br />
Scanning this QR code yielded the following message: <code>¿Estuvo eso facilito? Ahora que tengo su atención, déjenme se las pongo más difícil.</code> In English, the message reads: <code>Was that easy? Well, now that I have your attention, allow me to make things much more difficult.</code> After this, no more clues were discovered until the Summer Games video was released.<br />
<br />
== Welcome to the Summer Games Video ==<br />
<br />
=== Tracer Trail Cipher ===<br />
<br />
[[File:Base64_trail.jpg|thumbnail|right|The unsolved base64 cipher in the Summer Games video]]<br />
<br />
'''Note: The cipher described below remains unsolved.'''<br />
<br />
On August 2, 2016, players discovered another cipher in the [https://www.youtube.com/watch?v=qpcOD9tJM4k Welcome to the Summer Games trailer]:<br />
<br />
<pre><br />
U2FsdGVkX1+vupppZksvRf5pq5g5XjFRIipRkwB0K1Y96Qsv2L<br />
m+31cmzaAILwytX/z66ZVWEQM/ccf1g+9m5Ubu1+sit+A9cenD<br />
xxqkIaxbm4cMeh2oKhqIHhdaBKOi6XX2XDWpa6+P5o9MQw==<br />
</pre><br />
<br />
Players discovered this text to be base64 encryption. When decrypted, players received the following output:<br />
<br />
<pre><br />
Salted__���ifK/E�i��9^1Q�*Q�t+V=�<br />
/ع��W/<br />
�_����V��?q����f�F���"��=q�������[��<br />
z��*����Z����u�\5�k�C<br />
</pre><br />
<br />
''(Note: copy/pasting this string will not work; some of the characters are not printable and are not even displayed correctly on this page)''<br />
<br />
==== Decrypting the Cipher ====<br />
<br />
The "Salted__" header at the start of the string indicated to players that the remainder of the text was encrypted with the OpenSSL software library, which requires a password and the encryption cipher that was used. Salt is added by OpenSSL to ensure uniqueness of the key and the IV derived from the password and used for the encryption. However, due to the age of OpenSSL and its massive library, it was proven to be quite difficult for players to identify the encryption used.<br />
<br />
==== Narrowing Down Ciphers ====<br />
<br />
[[File:HexOfEncryptedMessage.png|thumbnail|right|Hex view of the encrypted string]]<br />
<br />
Players narrowed down the potential ciphers used by examining a hex dump of the encrypted string. There are two major types of ciphers, stream ciphers and block ciphers. Stream ciphers encrypt only the data fed into them, whereas block ciphers always encrypt a certain number of bytes at a time (a "chunk").<br />
<br />
A byte is roughly a single character, but special characters can take up multiple bytes. We know that OpenSSL Salted Encryption uses the first 8 bytes of the output for <code>Salted__</code> and the next 8 bytes for the actual salt. The rest of the information is the '''encrypted message'''.<br />
<br />
The immediately interesting thing here is that the '''encrypted message''' data stops 3 bytes short of a full chunk. This is a excellent indicator that the cipher used is a stream cipher (or a block cipher in CTR/OFB/CFB mode). This narrows the list of potential ciphers down significantly. This also means that the final string that Blizzard encrypted is less than 93 bytes!<br />
<br />
'''This cipher remains unsolved, but it's speculated that Blizzard moved past the cipher by creating alternate puzzles.'''<br />
<br />
=== Directions & Letters ===<br />
<br />
Players discovered that in the North American version of the Summer Games trailer there were repeated references to the cardinal directions, each associated with a particular hero. These references were conspicuously absent from other versions of the trailer. These references are shown below, with the relevant heroes and timestamps:<br />
<br />
<gallery mode="packed"><br />
File:Ow1.png|East - Mercy - Route 66 - 0:17<br />
File:Ow2.png|Center - D. Va - Temple of Anubis - 0:19<br />
File:Ow3.png|North - Torbjorn - Nepal - 0:21<br />
File:Ow4.png|South - Genji - Hanamura - 0:22<br />
File:Ow5.png|Southeast - McCree - Hollywood - 0:24<br />
File:Ow6.png|West - Symmetra - Watchpoint: Gibraltar - 0:30<br />
File:Ow7.png|Southwest - Bastion - Hollywood - 0:34<br />
File:Ow8.png|Northeast - Winston - Volskaya Industries - 0:46<br />
File:Ow9.png|Northwest - Tracer - King's Row - 0:47<br />
</gallery><br />
<br />
Screenshots of all the directions and their respective heroes can be found in an album [https://imgur.com/a/FQXmy here].<br />
<br />
[[File:Overwatch map.jpg|frameless]]<br />
<br />
These heroes, arranged in this particular order, provided a password that was used later in the ARG.<br />
<br />
== Dorado Photo ==<br />
<br />
At an unknown date, a new, "corrupted" photo of the [https://blzgdapipro-a.akamaihd.net/media/screenshot/dorado-screenshot-004.jpg Dorado attackers spawn point] was added to the Overwatch [https://playoverwatch.com/en-us/media/ media page]. Players discovered that the screenshot was "'''datamoshed'''", which means it concealed a hidden message while also taking on a distorted appearance. ([https://prntscr.com/c3dce7 Here] is an example of purposely data moshing the image manually to achieve similar effects.) <br />
<br />
<gallery mode="packed" heights=500px><br />
File:dorado-datamosh.jpg|The datamoshed image<br />
File:dorado-screenshot-005.jpg|The original image<br />
</gallery><br />
<br />
After comparing the images with difference checking tools, players found that certain English and Spanish characters were replaced with exclamation points. The missing characters produced the following Spanish phrase:<br />
<br />
<code>Por que estan mirando al cielo? La respuesta no esta sobre sus cabezas, esta detras de ustedes. A veces, necesitan analizar sus logros previos.</code><br />
<br />
Translated into English, this phrase read:<br />
<br />
<code>Why are you looking at the sky? The answer isn't over your heads, it's behind you. Sometimes, you need to analyze your previous achievements.</code><br />
<br />
The phrase "Why are you looking at the sky?" was most likely a reference to a strange artifact that was discovered in the sky of the Dorado map, dubbed the "Skycode". The Skycode ended up being a red herring, and was completely unrelated to the ARG.<br />
<br />
=== Analyzing Achievements ===<br />
<br />
[[File:achievements.png|thumbnail|right|"¿" Achievement, comment in source code]]<br />
<br />
The phrase "you need to analyze your previous achievements" led players to look at the achievements on the [https://www.playoverwatch.com Overwatch] website. It was noticed noticed that by logging in and viewing the achievements on a player profile, a mystery achievement appeared. Examining a hex dump of the image lead players to a new phrase:<br />
<br />
<pre><br />
Vientos, nada mal. No obstante, me aburro. Intentemos algo nuevo en la misma dirección.<br />
uczihriwgsxorxwunaarawryqhbrsfmeqrjjmu 5552E494 78T3 4VM9 OPL6 IS8208O913KRlrx<br />
</pre><br />
<br />
Translated, it said:<br />
<br />
<pre><br />
Damn, not bad. However, I'm getting bored. Let's try something new in the same direction.<br />
uczihriwgsxorxwunaarawryqhbrsfmeqrjjmu 5552E494 78T3 4VM9 OPL6 IS8208O913KRlrx<br />
</pre><br />
<br />
== Volskaya Datamosh ==<br />
<br />
After a long period of toying around, players discovered that the ciphertext <code> uczihriwgsxorxwunaarawryqhbrsfmeqrjjmu 5552E494 78T3 4VM9 OPL6 IS8208O913KRlrx</code> from the "?" achievement was a Vigenére cipher. Players discovered the key <code>tracertorbjornwinstonsymmetradvamercybastiongenjimccree</code> by ordering the heroes in the Summer Games trailer by the cardinal directions associated with each of them, as said further above. Once decoded, players received the following text: <br />
<pre>blzgdapiproaakamaihdnetmediascreenshot 5552E494 78B3 4CE9 ACF6 EF8208F913CFjpg</pre><br />
<br />
Players found this to be a [https://blzgdapipro-a.akamaihd.net/media/screenshot/5552E494-78B3-4CE9-ACF6-EF8208F913CF.jpg blzgdapipro-a.akamaihd.net/media/screenshot/5552E494-78B3-4CE9-ACF6-EF8208F913CF.jpg URL], which led players to a datamoshed screenshot of the Volskaya Industries map. ''(Editor's note: This link appears to now be dead)''. When players ran a difference check with the [https://blzgdapipro-a.akamaihd.net/media/screenshot/volskaya-screenshot-004.jpg original image], they received an interesting message.<br />
<br />
<gallery mode="packed"><br />
File:volskaya-datamosh.jpg|The datamoshed image<br />
File:Volskaya-screenshot-004.jpg|The original image<br />
</gallery><br />
<br />
=== ASCII Skull #1 ===<br />
<br />
The diff from the datamoshed image resulted in the following output:<br />
<br />
<pre><br />
Parece que te gustan estos jueguitos... por que no jugamos uno de verdad?<br />
:PB@Bk:<br />
,jB@@B@B@B@BBL.<br />
7G@B@B@BMMMMMB@B@B@Nr<br />
:kB@B@@@MMOMOMOMOMMMM@B@B@B1,<br />
:5@B@B@B@BBMMOMOMOMOMOMOMM@@@B@B@BBu.<br />
70@@@B@B@B@BXBBOMOMOMOMOMOMMBMPB@B@B@B@B@Nr<br />
G@@@BJ iB@B@@ OBMOMOMOMOMOMOM@2 B@B@B. EB@B@S<br />
@@BM@GJBU. iSuB@OMOMOMOMOMOMM@OU1: .kBLM@M@B@<br />
B@MMB@B 7@BBMMOMOMOMOMOBB@: B@BMM@B<br />
@@@B@B 7@@@MMOMOMOMM@B@: @@B@B@<br />
@@OLB. BNB@MMOMOMM@BEB rBjM@B<br />
@@ @ M OBOMOMM@q M .@ @@<br />
@@OvB B:u@MMOMOMMBJiB .BvM@B<br />
@B@B@J 0@B@MMOMOMOMB@B@u q@@@B@<br />
B@MBB@v G@@BMMMMMMMMMMMBB@5 F@BMM@B<br />
@BBM@BPNi LMEB@OMMMM@B@MMOMM@BZM7 rEqB@MBB@<br />
B@@@BM B@B@B qBMOMB@B@B@BMOMBL B@B@B @B@B@M<br />
J@@@@PB@B@B@B7G@OMBB. ,@MMM@qLB@B@@@BqB@BBv<br />
iGB@,i0@M@B@MMO@E : M@OMM@@@B@Pii@@N:<br />
. B@M@B@MMM@B@B@B@MMM@@@M@B<br />
@B@B.i@MBB@B@B@@BM@::B@B@<br />
B@@@ .B@B.:@B@ :B@B @B@O<br />
:0 r@B@ B@@ .@B@: P:<br />
vMB :@B@ :BO7<br />
,B@B<br />
</pre><br />
<br />
'''Translation:'''<br />
<br />
<pre><br />
"It seems you like these little games... Why don't we play a real one?"<br />
</pre><br />
<br />
(''This is the python2 script to extract modified bytes from datamoshed Volskaya screenshot: https://gist.github.com/synap5e/27635d2ff6f0e3b15f0c902dca2974a9'')<br />
<br />
No further progress was made until August 23, 2016.<br />
<br />
== Overwatch Forums Glitching Page/ "Skycoder" ==<br />
<br />
On August 23rd, 2016, at an unknown time, an [https://us.battle.net/forums/en/overwatch/topic/20748794686 ominous post] by a user named "Skycoder" appeared on the official General Discussion forums for Overwatch. <br />
<br />
Players found that the name of the post, <code>00110010 00110011</code>, was binary for "23," which was a direct reference to Sombra being the 23rd hero in Overwatch. The age of the post started at 24 hours, and counted down rather than increasing. The post itself contained a single sentence in Spanish:<br />
<br />
<pre><br />
la que tiene la información; tiene el poder<br />
</pre><br />
<br />
Which, when translated to english, reads:<br />
<br />
<pre><br />
She who has the information, has the power.<br />
</pre><br />
<br />
After a short while, the post glitched and distorted, gradually turning a hue of purple. A text box then appeared, which printed the following ciphertext:<br />
<br />
<pre><br />
ICAgICAgICAgICAgICAgICAgICAgICAgICA6UEKPQms6CiAgICAgICAg<br />
ICAgICAgICAgICAgICAsakKIQEJAQkBCQEJCTC4KICAgICAgICAgICAg<br />
ICAgICAgIDdHlkKTQpVCTU1NTU1CQEJAQkBOcgogICAgICAgICAgICAg<br />
ICA6a0KSQpCIl01NT01PTU9NT01NTU2MQphCQEIxLAogICAgICAgICAg<br />
IDo1kUKNQphCiEJCTU1PTU9NT01PTU9NT01NipJuQm5CQEJCdS4KICAg<br />
ICAgICA3MG6GlUKIQpJClEJYQkJPTU9NT01PTU9NT01NQk1QQphCiEJA<br />
QkBCQE5yCiAgICAgIEeYlpdCSiBpQohCh4ggIE9CTU9NT01PTU9NT01P<br />
TZYyICBCj0JAQi4gRUJAQkBTCiAgICAgIJKWQk2HR0pCVS4gIGlTdUKI<br />
T01PTU9NT01PTU9NTZdPVTE6ICAua0JMTYhNhkKXCiAgICAgIEKMTU1C<br />
mUIgICAgICAgN4hCQk1NT01PTU9NT01PQkKWOiAgICAgICBCh0JNTYhC<br />
CiAgICAgII2YiEKKQiAgICAgICAgIDeSlkBNTU9NT01PTU1AQkA6ICAg<br />
ICAgICAgQEBCQEJACiAgICAgII+ST0xCLiAgICAgICAgICBCTkKPTU1P<br />
TU9NTY9CRUIgICAgICAgICAgckJqTYRCCiAgICAgIJBAICBAICAgICAg<br />
ICAgICBNICBPQk9NT01NQHEgIE0gICAgICAgICAgLkAgIEBACiAgICAg<br />
IISVT3ZCICAgICAgICAgICBCOnWMTU1PTU9NTUJKaUIgICAgICAgICAg<br />
LkJ2TUBCCiAgICAgIIRCkUKYSiAgICAgICAgIDCRQpdNTU9NT01PTUKV<br />
QkB1ICAgICAgICAgcUBAQEJACiAgICAgIEKETUJCjHYgICAgICAgR4+L<br />
Qk1NTU1NTU1NTU1NQkKINSAgICAgICBGhEJNTUBCCiAgICAgIIdCQk1/<br />
QlBOaSAgIExNRUKFT01NTU2PQoNNTU9NTYpCWk03ICAgckVxQodNQkKE<br />
CiAgICAgIEKYloRCTSAgQm1ChEIgIHFCTU9NQpBChUKEQk1PTUJMICBC<br />
QEJAQiAgQEJAQkBNCiAgICAgICBKlm2GhFBCj0KEQplCN0eIT01CQi4g<br />
ICAsQE1NTUBxTEJAQkBAQEJxQkBCQnYKICAgICAgICAgIGlHQpUsaTCE<br />
TZZCbk1NT4tFICA6ICBNQE9NTUBAQEJAUGlpQEBOOgogICAgICAgICAg<br />
ICAgLiAgIEKXTZBCj01NTUBCQEJAQkBNTU1AQEBNQEIKICAgICAgICAg<br />
ICAgICAgICBAQkBCLmlATUJCQEJAQkBAQk1AOjpCQEJACiAgICAgICAg<br />
ICAgICAgICAgQkBAQCAuQkBCLjpAQkAgOkJAQiAgQEJATwogICAgICAg<br />
ICAgICAgICAgICAgOjAgckBCQCAgQkBAIC5AQkA6IFA6CiAgICAgICAg<br />
ICAgICAgICAgICAgICAgdk1CIDpAQkAgOkJPNwogICAgICAgICAgICAg<br />
ICAgICAgICAgICAgICAsQkBCCg==<br />
</pre><br />
<br />
=== ASCII Skull #2 ===<br />
<br />
Players discovered that this was Base64 and, once decrypted, resulted in another ASCII skull:<br />
<br />
<pre><br />
:PB.Bk: <br />
,jBˆ@B@B@B@BBL. <br />
7G–B“B•BMMMMMB@B@B@Nr <br />
:kB’B.ˆ—MMOMOMOMOMMMMŒB˜B@B1, <br />
:5‘B.B˜BˆBBMMOMOMOMOMOMOMMŠ’nBnB@BBu. <br />
70n†•BˆB’B”BXBBOMOMOMOMOMOMMBMPB˜BˆB@B@B@Nr <br />
G˜–—BJ iBˆB‡ˆ OBMOMOMOMOMOMOM–2 B.B@B. EB@B@S <br />
’–BM‡GJBU. iSuBˆOMOMOMOMOMOMM—OU1: .kBLMˆM†B— <br />
BŒMMB™B 7ˆBBMMOMOMOMOMOBB–: B‡BMMˆB <br />
.˜ˆBŠB 7’–@MMOMOMOMM@B@: @@B@B@ <br />
.’OLB. BNB.MMOMOMM.BEB rBjM„B <br />
.@ @ M OBOMOMM@q M .@ @@ <br />
„•OvB B:uŒMMOMOMMBJiB .BvM@B <br />
„B‘B˜J 0‘B—MMOMOMOMB•B@u q@@@B@ <br />
B„MBBŒv G.‹BMMMMMMMMMMMBBˆ5 F„BMM@B <br />
‡BBM.BPNi LMEB…OMMMM.BƒMMOMMŠBZM7 rEqB‡MBB„ <br />
B˜–„BM BmB„B qBMOMB.B…B„BMOMBL B@B@B @B@B@M <br />
J–m†„PB.B„B™B7GˆOMBB. ,@MMM@qLB@B@@@BqB@BBv <br />
iGB•,i0„M–BnMMO‹E : M@OMM@@@B@Pii@@N: <br />
. B—M.B.MMM@B@B@B@MMM@@@M@B <br />
@B@B.i@MBB@B@B@@BM@::B@B@ <br />
B@@@ .B@B.:@B@ :B@B @B@O <br />
:0 r@B@ B@@ .@B@: P: <br />
vMB :@B@ :BO7 <br />
,B@B <br />
</pre><br />
<br />
Players discovered that, once both skulls had been stripped of spaces, the bytes of each skull that aren't equal to 0 could be subtracted using [https://pastebin.com/g3kA1Pif a script]. Once compiled, players received the following string:<br />
<br />
<pre><br />
OHVSURPHWLXQMXHJR...FUHRTXHXVWHGHVORVGHWHFWLYHVGHMXHJRVOROODPDULDQXQWUDLOKHDG?EOCJGDXVD-DPEDV-FDODYHUDV.KWPO<br />
</pre><br />
<br />
Players discovered that this was a caesar cipher. After shifting the string forward 23 places, it resulted in:<br />
<br />
<pre><br />
LESPROMETIUNJUEGO...CREOQUEUSTEDESLOSDETECTIVESDEJUEGOSLOLLAMARIANUNTRAILHEAD?BLZGDAUSA-AMBAS-CALAVERAS.HTML<br />
</pre><br />
<br />
When cleaned up, the message read:<br />
<br />
<pre><br />
Les prometi un juego...creo que ustedes los Detectives de Juegos lo llamarían un trailhead? BLZGDUSA-AMBAS-CALAVERAS.HTML<br />
</pre><br />
<br />
When translated from Spanish to English:<br />
<br />
<pre><br />
I promised you a game...I believe you Game Detectives would call it a trailhead? BLZGDAUSA-AMBAS-CALAVERAS.HTML<br />
</pre><br />
<br />
<code>USA-AMBAS-CALAVERAS</code> translated to <code>USE-BOTH-SKULLS</code>, and the <code>.HTML</code> extension hinted at a URL.<br />
<br />
=== Skull Video ===<br />
<br />
BLZGDA refers to the servers that Blizzard uses to host media on their website. As such, this led players to [ https://blzgdapipro-a.akamaihd.net/media/screenshot/usa-ambas-calaveras.html this page], which contains a video of a vitals screen depicting a skull and some other medical information. In addition, it also contained a graphic of one of the ASCII skulls. An Imgur mirror can be found [https://i.imgur.com/6Pk69LX.png here].<br />
<br />
Within the properties of the video, players found another comment in Spanish:<br />
<br />
<pre><br />
Parecen estar muy interesados en estos "héroes". ¿Tal vez les interese conocer algunos detallitos que he averiguado sobre ellos?<br />
</pre><br />
<br />
In English:<br />
<br />
<pre><br />
You seem to be very interested in these "heroes". Maybe interested to know some details that I found out about them?<br />
</pre><br />
<br />
In addition, the video contains a heartbeat monitor, and a series of 26 lines above it. When players assigned the letters of the alphabet to the 26 lines, and used the "pings" of the heartbeat to determine what letters to use, the following string was found:<br />
<br />
<pre><br />
momentincrime<br />
</pre><br />
<br />
=== amomentincrime E-mail ===<br />
<br />
'momentincrime' appeared to refer to the in-universe TV show "A Moment in Crime," which can be seen in the Roadhog and Junkrat [https://www.youtube.com/watch?v=l5kTATxt7bE video] that came out months before the release of Overwatch. However, players also discovered a website, [https://amomentincrime.com amomentincrime.com], and displayed the following text:<br />
<br />
<pre><br />
...Estableciendo conexión...<br />
...Protocolo Sombra v1.3 iniciado...<br />
<br />
...Infiltrando la respuesta automática del email de pistas...<br />
<br />
...Terminando conexión...<br />
</pre><br />
<br />
Players discovered that sending an e-mail to tips@amomentincrime.com resulted in an automated email response:<br />
<br />
<pre><br />
Thank you for contacting A Moment in Crime's anonymous crime line!<br />
<br />
We have analyzed your submission and forwarded the information to the relevant parties. Your help could be vital in apprehending these cri<br />
<br />
...Estableciendo conexión...<br />
...Protocolo Sombra v1.7 iniciado...<br />
<br />
<br />
01:07:47 02:02:02 01:08:06 02:13:43 01:18:32<br />
01:18:21 02:10:19 01:06:21 02:05:18 01:04:02<br />
01:07:08 02:18:25 01:13:04 02:19:20 01:23:02<br />
01:16:40 02:16:35 01:23:04 02:17:16 01:06:42<br />
01:13:29 02:18:06 01:05:02 02:15:41 01:08:34<br />
<br />
j.7F57O,NLv:qj.7B:,1qv@B1j5ivB:,<br />
<br />
...Terminando conexión...<br />
<br />
minals and bringing them to justice. These fugitives are responsible for a string of robberies, arson, and other crimes stretching from Sydney to King's Row.<br />
<br />
Authorities believe that they have set their sights on crossing the Atlantic to America.<br />
</pre><br />
<br />
Players discovered that, if the sets of numbers were taken as AA:BB:CC, where AA was the number of skull (in order of discovery), BB was the row and CC was the column (as seen [https://i.imgur.com/ZgN2MVQ.png here]), and organized into a 5x5 matrix, it would result in:<br />
<br />
<pre><br />
S j G B L <br />
. @ M O k <br />
i , v : 0 <br />
E 7 r q N <br />
J P 5 F 1<br />
</pre><br />
<br />
Players discovered that this Matrix could be used as a bifid key to decode the text underneath the table of numbers in the email, as shown below:<br />
<pre><br />
j . 7 F 5 7 O , N L v : q j . 7 B : , 1 q v @ B 1 j 5 i v B : ,<br />
12 21 42 54 53 42 24 32 45 15 33 34 44 12 21 42 14 34 32 55 44 33 22 14 55 12 53 31 33 14 34 32<br />
<br />
1 2 2 1 4 2 5 4 5 3 4 2 2 4 3 2 4 5 1 5 3 3 3 4 4 4 1 2 2 1 4 2<br />
1 4 3 4 3 2 5 5 4 4 3 3 2 2 1 4 5 5 1 2 5 3 3 1 3 3 1 4 3 4 3 2<br />
<br />
11 24 23 14 43 22 55 45 54 34 43 23 22 42 31 24 45 55 11 52 35 33 33 41 43 43 11 24 23 14 43 22<br />
</pre><br />
<br />
This gave players the following string:<br />
<br />
SOMBr@1NF:rM@7iON1SP0vvErrSOMBr@<br />
This phrase was found to be leet-speak, and was translated to:<br />
<br />
<pre><br />
Sombra Information is power Sombra<br />
</pre><br />
<br />
The string <code>SOMBr@1NF:rM@7iON1SP0vvErrSOMBr@</code> was used as a password later on in the ARG.<br />
<br />
== A Moment in Crime Transmission ==<br />
<br />
[[File:Momentincrime.png|thumbnail|right|amomentincrime.com as of August 24th, 2016]]<br />
<br />
Once the 23-hour countdown on the Skycoder forum post reached zero, [https://amomentincrime.com amomentincrime.com] was updated. It now read:<br />
<br />
<pre><br />
...Estableciendo conexión...<br />
...Protocolo Sombra v1.9 iniciado...<br />
<br />
...Transmitiendo información a ómnicos activos... 2%<br />
<br />
...Terminando conexión...<br />
</pre><br />
<br />
Translated from Spanish to English:<br />
<br />
<pre><br />
...Establishing connection...<br />
...Sombra Protocol v1.9 initiated...<br />
...Transmitting information to active omnics... 2%<br />
<br />
...Ending connection...<br />
</pre><br />
<br />
A comment was also added to the source code:<br />
<br />
<pre><br />
Bien hecho, ya tienen mi clave. Hackear este programa de televisión no tuvo chiste. Espérense a lo que sigue.<br />
</pre><br />
<br />
When translated:<br />
<br />
<pre><br />
Well done, you have my password. Hacking this television program was meaningless. Wait for what is coming.<br />
</pre><br />
<br />
The percent on the amomentincrime.com slowly increased over time. Once the 5% milestone was hit, the Sombra Protocol version number changed to to v1.95. Afterwards, the percentage increased by 0.0038% every 3 minutes in real time.<br />
<br />
In addition, another comment was added:<br />
<br />
<pre><br />
Parece que se están calentando un poco las cosas... tendré que pasar desapercibida mientras esto se finaliza.<br />
</pre><br />
<br />
Translated:<br />
<br />
<pre><br />
It seems things are heating up a bit... I'll have to go unnoticed while this is finishing.<br />
</pre><br />
<br />
On 18th October at 19:02 GMT the site reached 100%, and the site updated with the following message:<br />
<br />
<pre><br />
...Transmisión finalizada - finalizando carga... <br />
...Carga finalizada. Unidad Bastion E-54 comprometida...<br />
</pre><br />
<br />
Which roughly translates to:<br />
<br />
<pre><br />
...Transmission complete - finishing upload...<br />
...Upload finished. Unit Bastion E-54 engaged...<br />
</pre><br />
<br />
Hidden in the source code of the site was the text <code>v1.4.0.2.324??</code>. Players then correctly assumed that this referred to a future build of Overwatch itself.<br />
<br />
== Sombra vs. LumériCo ==<br />
<br />
=== The Hacked Bastion ===<br />
<br />
On October 19, 2016, a new Overwatch version was released - version 1.4.0.2.32448. Shortly afterwards, the version number in the source code of the amomentincrime site updated to the same version number. After the build launched, players discovered that the hero Bastion had a strange interaction when near the "SOMBRA PROTOCOL" monitors on Dorado, and would emit a message in morse code, which can be heard [https://www.youtube.com/watch?v=Hkd__ceYm-Y here]. When the morse was decoded, players received the following string:<br />
<pre><br />
SQOFJFBNITIZWGDXSDO<br />
</pre><br />
<br />
Players discovered that this was a Vigenere cipher, and the key consisted of the alphabetic characters from the<br />
<code>SOMBr@1NF:rM@7iON1SP0vvErrSOMBr@</code> string, it was decoded to read:<br />
<br />
<pre><br />
ACCESSWWWLUMERICOMX<br />
</pre><br />
<br />
This led players to the [https://lumerico.mx/ LumeriCo website]. ''(Editor's note: as of 2018, this site appears to be inactive.)''<br />
<br />
=== LuméReaction ===<br />
<br />
[[File:Lumerico.png|thumbnail|right|The homepage of https://lumerico.mx]]<br />
<br />
The LumeriCo website was for the in-universe Mexican tech giant LumériCo, who had built several reactors in the Dorado region. The website had a [https://lumerico.mx/news news page], noting the imminent opening of a new reactor on November 1 as well as a recent attack on its construction site. There were also [https://lumerico.mx/about About] and [https://lumerico.mx/login Login] pages.<br />
<br />
Players also discovered a <code>robot.txt</code> file, which appeared to server no purpose and only contained the text <code>Allow: omnics</code>, and appeared to be a joke about the [https://en.wikipedia.org/wiki/Robots_exclusion_standard Robots exclusion standard]. Another text file was discovered called <code>omnics.txt</code>, which contained the text:<br />
<br />
<pre><br />
Allow: ??<br />
Allow: ???<br />
</pre><br />
<br />
And appeared to be yet anotehr joke about the Robots exclusion standard. And, finally, an <code>api</code> file that contained <code>{"message":"thanks for calling the api"}</code> and, humorously, has no practical purpose.<br />
<br />
=== Phone Number ===<br />
<br />
At the bottom of the LumeriCo website, players discovered a phone number <code>(510) 766-2726</code>. When called, players heard a woman listing off a string of numbers in Spanish, a recording of which can be found [https://soundcloud.com/jackwilsdon/510-766-2726a here]. The numbers spoken are: <code>5-2-4-1-3 (pause) 23-4-14-8-6-18-17-23-21-18-15</code>.<br />
When assuming that a=1, b=2, etc, the second part of the message can be decoded to: <code>WDNHFRQWURO</code>. This was found to be a ROT-23 cipher, and decoded to: <code>TAKECONTROL</code>.<br />
<br />
=== Take Control ===<br />
<br />
The phone message led players to an important [https://lumerico.mx/TAKECONTROL/index.html page] on the site, under the directory <code>TAKECONTROL</code>. It was styled the same way as amomentincrime.com and featured [https://lumerico.mx/calavera.png an image of Sombra's skull icon], named "calavera.png". There was also text on the page:<br />
<br />
<pre style="word-break:break-all;word-wrap: break-word;"><br />
ethldtíoíesnoemfetuylm.bnlsssqtann)hcnslararuCpdGeoopéqubdsroaan.arnasdmdor1vrsmerñerlsdacnnnoaexedsidcn.iarsgcyi,iqeqnd.pooitoaeaaransterLetéáedasodocMrnseeiuCsimnosetlójnueodacapsadcoanfasest.rnucaodacadmdoemoipíogPoipbehaSussai.,yccandin.reueatenaoiorneoeetaoéyenimt¿rPehec,uurobudeílrysriteenasni,adngpjrálireecgrolsmhYnao?nmonomepeldezmapcpunoaulrrruCstmeitltetlróesoapsdéyufcuascaa,rensbuinergnqedlmvlbpdtaz.enebuineuldoerecrGefqfirrasulrbeatHsilnbaúaeeaaooassraooa,ioedo:aLiuielPr ursmoootlnielteeánlosulobeauaanopearrúiesltéyrosssisuaaeaenremsieaismdjmolrsspebiecdéyusittnvrcacp.taebrtLiunróporner<br />
<br />
eúcrneuyraarsettsyrseen.aaPnrneuyraeastuCpnhl/wLloaloa.qartlsyuínreute.evgdpiuábdmPooucvdeccmoreurr.o?unriorydbaSnalegeáezadienáutalaaioeemfcbgdinableoc¿éppoeocelsumuoaHearsosqadrrrftuLiorannnoneneriiatcnlomoqnaqdunrcno,enmerosaereisloabolii.e.dormerosepopdé,eo:r#5scoegaqoeaibs(edioraamtdírnlyoetjcgratmnrrobnrsstloeYqoeocicpnómlpernmaepogenmodqamubodnaeasuaenMoolloupeqvgrLtúr<br />
<br />
tsosrdvoeaerroaeusdmaauamoMobsnaeanraunnt,roierbeoiemaodbmantursotñauoureeuoerreopc.etlr<br />
<br />
sotñneerLimeaFsNJ<br />
</pre><br />
<br />
Players found this to be a column order transposition cipher with the key <code>5 2 4 1 3</code>, which was found in the phone message. The cleaned up result was: <br />
<br />
<pre><br />
Los felicito por haber llegado hasta aquí. Solo quería saber si estaban listos. (Hey, es muy difícil encontrar buena ayuda últimamente...deberían ver algunos de los payasitos que están trabajando conmigo) Por ahora, continuemos con el verdadero reto: acabar con LumériCo y su president e Guillermo Portero. ¿Y porqué? Porque es un hombre codicioso, corrupto y un ladrón abominable. Su plan de traer en línea el más grande y el más poderoso zigurat el 1 de noviembre no es nada más que una artimaña, un elaborado plan designado para ejercer aún más influencia sobre la gente de México y en gordar los bolsillos de sus compinches. ¿Y quién va a pagar por eso? La gente común y corriente, los mismos que siempre quedan olvidados.<br />
<br />
He empezado a mejorar mis protocolos para que sean usados para derrumbar la infraestructura de LumériCo y Los Muertos también están intentando levantarse en contra de la corrupción. Mientras tanto, escarben por el sitio de LumériCo y busquen información que podamos usar en contra del cabrón, mejor aún, encuentren su nombre de usuario y contraseña para asegurarnos de que ciertos detalles no muy favorables sobre el presidentito...aparezcan...<br />
<br />
Pude encontrar el nombre de usuario y contraseña de un empleado de soporte de LumériCo, empiecen por ahí:<br />
<br />
GFlores/g#fNwP5qJ<br />
</pre><br />
<br />
Translated:<br />
<br />
<pre><br />
I'm congratulating you for getting in here. I only wanted to know if you were ready or not. (Hey, it's really difficult to get good help lately... you should see some of the clowns I'm working with). For now, let's continue with the true challenge: taking down Lumerico Corp president Guillermo Portero. Why? Because he's a greedy and corrupt man, and an abominable thief. His plan of bringing in line the most powerful and biggest zigurat the 1st of november us nothing more than a deceit, an elaborate plan by his gang to become even more influential in the people of Mexico and get more money. And who's gonna pay for that? Common people, the ones that are always forgotten.<br />
<br />
I've started upgrading my protocols so that they are used to take down the Lumerico Corp infraestructure and Los Muertos are also trying to go against the corruption. Meanwhile, search the Lumerico Corp site for info we can use against the bastard, or better, get his username and password so that hundreds "not so favorable" facts about the president start popping up.<br />
<br />
I was able to get the username and pass of a Lumerico Corp employee, start here:<br />
<br />
GFlores/g#fNwP5qJ<br />
</pre><br />
<br />
=== Presidential Login ===<br />
<br />
Players used the credentials above on the [https://lumerico.mx/login Lumerico login page], and accessed the account of Gonzalo Flores, which included [https://lumerico.mx/email his emails]. Transcripts of these emails were archived [https://docs.google.com/spreadsheets/d/1zh7OU2dEOnD4X43ImvZBNpS75FLkj-rL75pXJ2l3TuQ/htmlview?sle=true# here].<br />
<br />
However, only one email had relevance to the ARG:<br />
<br />
<pre><br />
De:Valeria Valderrama<VValderama@lumerico.mx><br />
Para:Gonzalo Flores<GFlores@lumerico.mx><br />
Asunto:Página de Guillermo<br />
<br />
Hola, Gonzo:<br />
¿Puedes ver el tráfico de https://lumerico.mx/president-bypass? Guillermo debería ser el único accediendo desde su página de inicio privada, pero parece que está teniendo mucho tráfico. Tal vez tengamos que escalar esto a<br />
la señorita Jiménez, pero quiero estar segura de que es digno de su tiempo.<br />
<br />
Valeria Valderrama<br />
</pre><br />
<br />
The email referenced high traffic on the [https://lumerico.mx/president-bypass President Bypass Link]. The page displayed an "access denied" message, but players found a <code>President Auth-Bypass Revision 1.02: /.git/</code> line in the source code.<br />
<br />
This line led players to [https://github.com/internetwache/GitTools/tree/master/Dumper dump the data] from the [https://lumerico.mx/president-bypass/.git/ /.git/ subpage] with git protocol and upload it to [https://gist.github.com/anonymous/987beb6a5c817b53da820562854bdebe Github]. These were the code files behind the website, and included a '''class.authentication.php''' file that contained an encryption function, and '''class.president-bypass.php''' file which contained the president's (Guillermo Portero) username, <code>GPortero</code>, and encrypted password <code>?MzY:MTI5:?AzY:OWM?:?EDO:ZGU?:jVTM:MTJm:2ITM:MTUw:?QjY:OWY?:?kTO:MTQx:?MzY</code>.<br />
<br />
Some players wrote a function to decode the encrypted <code>class.authentication.php</code> file, and then used it on the encrypted password. The resulting password was <code>Xy@4+Bkuqd<53uJ</code>.<br />
<br />
After logging in to the President's account, players were able to read his emails. After 30 minutes, another email appeared in the President's inbox, from Sombra herself:<br />
<br />
<pre><br />
Veo que se han podido infiltrar en su correo.<br />
No se preocupen, él no puede ver este correo, lo he ocultado de su vista si se conecta desde una de sus direcciones conocidas de IP.<br />
Necesito un poco más de tiempo para establecer el próximo grupo de potocolos. Manténganse atentos a principios de la otra semana. Le echaré unos cuantos trapitos sucios en sus correos para que se filtren al público<br />
"accidentalmente". Ya veremos como reaccionan los medios de comunicación.<br />
</pre><br />
<br />
The rough translation was:<br />
<br />
<pre><br />
I see you have been able to infiltrate into his mail.<br />
Don't worry, he cannot see this email, I've hidden it from his sight if he connects from one of his known IP addresses.<br />
I need a little bit of time to establish the next set of protocols. Stay alert early next week. I'll throw some dirty laundry in his emails that can "accidentally" leak to the public. We'll see how the media will react to that.<br />
</pre><br />
<br />
=== Admin Access ===<br />
<br />
[[File:Lumerico admin panel.png|thumbnail|right|The admin panel of the Lumerico site, only accessible by logging in as MJimenez]]<br />
<br />
On October 25, 2016, new emails were discovered in the GFlores account, but they had no immediate significance to the ARG. In addition, omnics.txt was updated:<br />
<br />
<pre><br />
Allow: Tzolk'in<br />
Allow: Imix ChikchanManik Imix ChikchanImixChikchanImix Manik Chikchan Imix Kimi Chikchan Chikchan Kimi ChikchanImixChikchanImix ChikchanKimi<br />
</pre><br />
<br />
Tzolk'in is the name of a [[Wikipedia:Maya calendar#Tzolk'in|Mayan Calendar]], and the second line was a series of animals from it in the Tzolk'in dialect. Imix stands for Day 1, Chikchan — 5, Manik — 7 and Kimi — 6. When turned into numbers, the string read <code>1 57 1 5151 7 5 1 6 5 5 6 5151 56</code>. These digits turned into pictograms of [[Wikipedia:Maya numerals|Maya numerals]] (one by one, not numbers as a whole) written horizontally become <code>. -..- . -.-. ..- - . .- - - .- -.-. -.-</code> This was found to be morse code, and decoded to: <code>EXECUTEATTACK</code>.<br />
<br />
This led players to the "EXECUTEATTACK" [https://lumerico.mx/EXECUTEATTACK/index.html directory], where the following text was discovered:<br />
<br />
<pre><br />
Ha llegado el momento. Esos correos expuestos la verdad sobre Portero, iniciado la revuelta, y hemos convencido a la gente de México a apoyar nuestra causa. Ahora es el momento para el golpe. Convertiremos su preciada inauguración el 1 de noviembre en un gran movimiento en su contra. Necesito que hagan una cosa:<br />
Consigan acceso al correo del jefa de seguridad y busquen alguna forma de ayudarme en el ataque. Es posible que lo vean contactando a Portero pronto. He cambiado su contraseña a: d0r*NuLw9<br />
</pre><br />
<br />
Translated to English:<br />
<br />
<pre><br />
The moment has come. These emails exposed the truth about Portero, initiated the revolt, and have convinced people of Mexico to support our cause. Now is the time to strike. Convert his precious inauguration on November 1 to a large movement against it. I need you to do one thing:<br />
Get access to the email security chief and seek some form of help in the attack. You may see her contacting Portero soon. I've changed her password: d0r*NuLw9<br />
</pre><br />
<br />
Logging in with the credentials <code>MJimenez / d0r*NuLw9</code> gave players access to the [https://lumerico.mx/admin admin panel] of the LumeriCo reactor. Until November 1, 2016, it stayed inactive and any command was answered with the same message saying that the terminal disconnected.<br />
<br />
=== The Terminal ===<br />
Once the console became usable, players could type <code>help</code> to see a list of commands:<br />
<br />
<pre><br />
override Engineer safety mode override<br />
help Provides help information about commands<br />
version Displays system version information<br />
about Displays information about the system<br />
grep Search output by string<br />
</pre><br />
<br />
In the MJimenez email account, there was an email labeled <code>Corrupción de correo electrónico</code> with highlighted text in side of it, specifically <code>/ter/</code>. Players discovered that performing the Linux command <code>about | grep 'ter'</code> in the console returned this text:<br />
<br />
<pre><br />
Open source lightweight shell for any terminal.<br />
Anything with a terminal<br />
1.1.0 - expanded terminal support<br />
</pre><br />
<br />
The first word of every line given from the output was bolded and purple. Putting the letters together, players received the text <code>OpenAnything1.1.0</code>, which was a later solution.<br />
<br />
Another available command for the terminal was <code>override</code>, and prompted players with three security questions:<br />
<br />
# '''Favorite Movie'''. The answer to the prompt is <code>some like it bot</code>, a movie from the Overwatch universe.<br />
# '''Favorite Cookie Flavor'''. The answer being <code>nuevas sabor delicias</code>, a flavor referenced in an email in the MJimenez account.<br />
# '''Secret'''. The answer to this prompt is <code>OpenAnything1.1.0</code>.<br />
<br />
This returned <code>OK</code>, gave players admin access, and enabled a new set of commands: <br />
<br />
'''ls''' Lists files by path<br />
'''cat''' Read file by path<br />
'''exec''' Execute a file <br />
<br />
Typing <code>ls</code> listed two files: <code>payload</code> and <code>d_ilqh_nhb.html</code> (the file name was a ROT23 for ''a_fine_key'').<br />
<br />
[[Image:A fine key.png|thumb|right|a_fine_key.html]] Reading the second file with <code>cat mnt/d_ilqh_nhb.html</code> yielded a text where ASCII characters (repeating string <code>vhnl tldv xyl vcxelo xv qhrtv. zkolg[nl]</code>) were in a shape of a key. Deciphering it using an Affine cipher (A=23, B=23) yielded the following string: <code>some keys are shaped as locks. index[me]</code>. It is assumed that ''some keys are shaped as locks'' line alluded to the [[#Tracer_Trail_Cipher|Tracer Trail]] ciphertext being used as a key.<br />
<br />
Simultaneously, entering <code>exec payload</code> presented players with a prompt — the answer to which was the [[#Tracer_Trail_Cipher|Tracer Trail]]. When inputted, players were given a message that looked similar to what was previously seen at amomentincrime.com. The counter shown in the top right was then incremented.<br />
<br />
[[Image:LumericoTerminalTracerEntered.jpg|850px]]<br />
<br />
=== Misdirection ===<br />
<br />
[[Image:LumericoHacked.jpg|thumb|right|lumerico.mx website hacked by Sombra]]<br />
<br />
On October 1, 2016, the lumerico.mx home page updated to show "glitches" and a black overlay with a message under a purple skull, and the string <code>&lt;!-- MISDIRECTION --></code> was also added to the source of the page.<br />
<br />
The message said: <br />
<br />
<pre><br />
Buen trabajo, amigos. No lo hubiera logrado sin su ayuda. En fin, me consiguieron los recursos que necesitaba para mi siguiente golpe – les encantará.<br />
Esperen noticias de mí en los próximos días...<br />
Les voy a mandar algo para agradecerles… Ojalá lo puedan aprovechar.<br />
Dasvidanya amigos<br />
</pre><br />
<br />
Translated:<br />
<br />
</pre><br />
Good job, friends. I would not have done it without your help. Anyway, I got the resources needed for my next hit - you'll love it.<br />
Expect to hear from me in the coming days...<br />
I'm going to send something to thank you ... Hopefully you can use it.<br />
Dasvidanya friends<br />
</pre><br />
<br />
<br />
<br />
Note that ''Dasvidanya'' is a phonetic transliteration of ''до свиданья'' — a Russian phrase for "goodbye". The thing that Sombra sent as a ''thank you'' was a new spray, named "Día de Los Muertos" after the Mexican festival that took place at the same time as the ARG. The spray is currently only available on the PC version of the game.<br />
<br />
[[File:Dia de los muertos spray.jpg|thumbnail|right|The Día de Los Muertos spray that was added to the game after Sombra hacked the Lumerico site]]<br />
<br />
The '''MISDIRECTION''' string lead to the MISDIRECTION [https://lumerico.mx/MISDIRECTION/index.html directory] which contained the text:<br />
<br />
<pre><br />
...Estableciendo conexiуn...<br />
...Protocolo Sombra v2.3 iniciado...<br />
<br />
...Desviando datos del zigurat de LumériCo hacia el objetivo...<br />
...Descifrando contraseсas del objetivo...<br />
...Acceso otorgado al directorio de volskayaindustries.com...<br />
<br />
...boop ;)...<br />
...Terminando conexión...<br />
</pre><br />
<br />
Translated: <br />
<br />
<pre><br />
...Establishing connection...<br />
...Sombra Protocol v2.3 initiated...<br />
<br />
...Forwarding the data from the LumériCo ziggurat to the target...<br />
...Deciphering the target passwords...<br />
...Access Granted to the directory of volskayaindustries.com...<br />
<br />
...boop ;)...<br />
...Ending connection..<br />
</pre><br />
<br />
== Blizzcon ==<br />
<br />
Blizzcon 2016 opened with the [https://www.youtube.com/watch?v=Og5-Pm4HNlI Overwatch short "Infiltration"], a short depicting Reaper, Widowmaker, and Sombra on Volskaya Industries. During the showing of the short, Sombra's [https://playoverwatch.com/en-us/heroes/sombra hero page] went live, showcasing her abilities and character backstory.<br />
<br />
[[File:SombraBG.jpg|center|500px]]<br />
<br />
== References ==<br />
<br />
=== Community Resources ===<br />
<br />
A collection of tools and resources made by the Game Detectives Discord community for use in the ARG.<br />
<br />
==== ASCII Skull ====<br />
<br />
'''ASCII Skull Analysis:''' https://github.com/bahamas10/sombra<br />
<br />
'''Removing SOMBR@ Analysis:''' https://pastebin.com/15u27YTC<br />
<br />
'''ASCII Skull Eye Analysys:''' https://docs.google.com/spreadsheets/d/1-JQpWyitMKYhP-4l8ZDFiJI3NjqRrvoEnRdFQawike8<br />
<br />
==== Google Docs ====<br />
<br />
'''Observations and Speculations Spreadsheet:''' https://docs.google.com/spreadsheets/d/1rI08baFQmAwaqHC-9GF9VNGCYjuRE-q4LN9k4ottjuQ/pubhtml<br />
<br />
'''LumériCo Emails and Translations Spreadsheet:''' https://goo.gl/cQgdIJ (Courtesy of UberPilot)<br />
<br />
==== Tracer Code ====<br />
<br />
'''GOL! Guesser:''' https://axxim.net/ow/gol-guesser/<br />
<br />
'''Uber GOL! Guesser:''' https://axxim.net/ow/gol-guesser/uber/<br />
<br />
The Uber GOL! Guesser only prints out UTF-8 compliant results, which makes it easier to identify potentially correct answers.<br />
<br />
'''Bruteforcing tool:''' https://github.com/glv2/bruteforce-salted-openssl<br />
<br />
=== Third-Party Resources ===<br />
<br />
A collection of third-party tools and resources that the Game Detectives Discord community has used in the ARG.<br />
<br />
==== Image of Reaper ====<br />
<br />
'''stegdetect (Linux):''' https://github.com/abeluck/stegdetect<br />
<br />
stegdetect is a Linux utility used to determine if a given image may contain encoded information.<br />
<br />
'''JPHide & JPSeek:''' https://linux01.gwdg.de/~alatham/stego.html<br><br />
'''iSteg (Mac OSX):''' https://www.hanynet.com/isteg/<br />
<br />
JPHide & JPSeek is used to hide and find, respectively, a file inside a JPEG image.<br><br />
iSteg works similarly to JPHide on the Mac OSX platform.<br />
<br />
'''stegbreak (Linux):''' https://linux.die.net/man/1/stegbreak<br />
<br />
stegbreak is used to do brute-force dictionary attacks on JPEG images.<br />
<br />
=== Easter Eggs ===<br />
<br />
The following are collection of references and Easter Eggs encountered throughout the ARG.<br />
<br />
==== In-Game ====<br />
<br />
'''Sombra's "Amused" Emote'''<br />
<br />
This character emote features the [[Sombra_ARG_False_Leads | Skycode]], accompanied by soft music resembling the [https://www.reddit.com/r/Overwatch/comments/4w7ey1/the_sombra_skysong/ Skysong]. Sombra's expression is one of amusement, and it's a nod to the community's prolonged creative attempts to solving an nonexistent puzzle.<br />
<br />
[[File:EmoteSkycode.png|200px]]<br />
<br />
'''Skycode Spray'''<br />
<br />
This character spray features Sombra's iconic skull in front of a compass rose and the [[Sombra_ARG_False_Leads | Skycode]]. This is a reference to both the [[#Directions_&_Letters|cardinal directions]] used in one of the puzzles and to the Skycode, which is considered the most significant false lead that solvers encountered.<br />
<br />
[[File:SkycodeSpray.png|200px]]<br />
<br />
==== In-ARG ====<br />
<br />
'''Espresso Command'''<br />
<br />
There was a hidden command in LumériCo's [[#The_Terminal | admin terminal]]. Inputting the word <code>espresso</code> returned the following message: <code>Coffee Pot Status: Brewed approximately 23 hours ago, currently 0% full</code><br />
This is referencing a variety of [https://goo.gl/cQgdIJ emails] found in the LumériCo site involving broken espresso machines and incompetent coffee brewing, which caught the attention of the community and gave way to a vast variety of mediocre jokes. Furthermore, "23 hours" makes reference to the number 23, which was believed by many to possess some sort of significance to the ARG, as Sombra would be the 23rd character in Overwatch. Finally, "0%" references the ARG's notable waiting periods that have been widely criticized by the community, specifically [[#A_Moment_in_Crime_Transmission | A Moment in Crime's upload percentage]].<br />
Due to the iconic purple text it is believed that this hidden command was created by Sombra herself.<br />
<br />
[[File:EspressoCommand.png]]<br />
<br />
=== Media Appearances ===<br />
<br />
'''3rd Aug. 2016'''<br />
<br />
[EN] [https://kotaku.com/overwatch-fans-find-new-clues-about-the-mysterious-hero-1784767759 Kotaku - Overwatch Fans Find New Clues About The Mysterious Hero Sombra]<br />
<br />
[EN] [https://www.polygon.com/2016/8/3/12369144/overwatch-summer-games-sombra-arg-blizzard?utm_campaign=polygon&utm_content=chorus&utm_medium=social&utm_source=twitter Polygon - Overwatch fans are trying to crack the latest mystery about Sombra]<br />
<br />
[EN] [https://www.pcgamesn.com/overwatch/overwatch-sombra PCGamesN - Overwatch's Sombra ARG continues with new clues, but no solutions]<br />
<br />
[EN] [https://team-dignitas.net/articles/blogs/overwatch/9989/who-is-sombra-all-facts-and-clues-about-sombra Team-Dignitas - Who is Sombra? All facts and clues about Sombra]<br />
<br />
[FR] [https://overwatch.gamewave.fr/un-nouveau-code-cache-dans-la-derniere-cinematique-d-overwatch/ Gamewave - UN NOUVEAU CODE CACHÉ DANS LA DERNIÈRE CINÉMATIQUE D'OVERWATCH!]<br />
<br />
[EN] [https://www.follownews.com/overwatch-fans-find-new-clues-about-the-mysterious-hero-sombra-1nhqt FollowNews - Overwatch Fans Find New Clues About The Mysterious Hero Sombra]<br />
<br />
'''4th Aug. 2016'''<br />
<br />
[EN] [https://www.pcgamer.com/overwatch-summer-games-trailer-hides-a-mysterious-secret/ PCGamer - Overwatch Summer Games trailer hides a mysterious secret]<br />
<br />
[SK] [https://www.sector.sk/novinka/121273/nove-overwatch-video-obsahuje-dalsie-tajomstva.htm Sector - Nové Overwatch video obsahuje ďalšie tajomstvá]<br />
<br />
[EN] [https://www.techinsider.io/overwatch-sombra-character-2016-8 Techinsider - 'Overwatch' players are going to insane lengths to solve a mystery that Blizzard's teased for months]<br />
<br />
[EN] [https://gamerant.com/overwatch-sombra-clues/ Gamerant - Overwatch Players Uncover More ‘Sombra’ Clues]<br />
<br />
[HU] [https://www.gamestar.hu/hir/overwatch-sombra-karakter-214739.html Gamestar - Overwatch - újabb nyomok utalnak a még be nem jelentett hősre]<br />
<br />
'''5th Aug. 2016'''<br />
<br />
[EN] [https://kotaku.com/days-later-overwatch-fans-cant-figure-out-the-sky-cod-1784872143 Kotaku - Days Later, Overwatch Fans Can't Figure Out The 'Sky Code' Mystery]<br />
<br />
[NL] [https://www.gamersnet.nl/nieuws/201608/cryptische_speurtocht_naar_overwatch_nieuwe_heldin_sombra_gaat_bizar_diep/ Gamersnet - Cryptische speurtocht naar Overwatch' nieuwe heldin Sombra gaat bizar diep]<br />
<br />
[ES] [https://www.alfabetajuega.com/noticia/overwatch-el-enigma-de-sombra-sigue-ofreciendo-nuevos-detalles-n-71772 Alfa Beta Jeuga - Overwatch: El enigma de Sombra sigue ofreciendo nuevos detalles]<br />
<br />
[EN] [https://www.youtube.com/watch?v=5ROjN-_F0ZU&feature=youtu.be&t=4m22s IGN (Video) - Sombra: Overwatch's Secret New Hero - Overwatch HQ]<br />
<br />
'''7th Aug. 2016'''<br />
<br />
[EN] [https://www.gamespresso.com/2016/08/summary-state-sombras-arg-overwatch/ Gamespresso - Summary of the state of sombra's ARG in Overwatch]<br />
<br />
'''8th Aug. 2016'''<br />
<br />
[EN/CN] [https://www.zhentoo.com/doc92368 Zhentoo - Overwatch new hero Secret Dorado hidden mystery] <br />
<br />
[EN] [https://www.technewstoday.com/30880-overwatch-sombra-continues-to-elude-detectives/ TechNewsToday - Overwatch: Sombra Continues to Elude Detectives]<br />
<br />
'''11th Aug. 2016'''<br />
<br />
[EN] [https://www.youtube.com/watch?v=IZR-pa0it4Q The Know - New Overwatch Hero Hints]<br />
<br />
'''12th Aug. 2016'''<br />
<br />
[EN] [https://kotaku.com/after-two-weeks-overwatch-fans-sombra-investigation-re-1785204389 Kotaku - Overwatch Fans' Sombra Investigation Reaps A Skull Code]<br />
<br />
'''14th Aug. 2016'''<br />
<br />
[EN] [https://gamerant.com/overwatch-sombra-skull-code/ Gamerant - Skull Code is Latest Clue in Overwatch’s Sombra Investigation]<br />
<br />
'''16th Aug. 2016'''<br />
<br />
[EN] [https://www.christiantoday.com/article/overwatch.dlc.update.skull.code.the.latest.clue.for.sombra.investigation/93197.htm Christian Today - 'Overwatch' DLC update: Skull Code the latest clue for Sombra investigation]<br />
<br />
[EN] [https://en.yibada.com/articles/151811/20160816/overwatch-dlc-update.htm Yibada - 'Overwatch' DLC update: New clues on Sombra's inclusion to the roster revealed]<br />
<br />
'''23rd Aug. 2016'''<br />
<br />
[EN] [https://www.technewstoday.com/31129-overwatch-all-we-know-about-the-sombra-arg/ Tech News Today - Overwatch: All We Know About the Sombra ARG]<br />
<br />
'''24th Aug. 2016'''<br />
<br />
[EN] [https://gamerant.com/overwatch-forums-sombra-message/ Gamerant - Overwatch Forums Glitch Out, Reveals Hidden Message From Sombra]<br />
<br />
[EN] [https://gamerant.com/overwatch-sombra-clue-website/ Gamerant - New Website Counts Down To Next Clue For Overwatch’s Sombra]<br />
<br />
[EN] [https://www.polygon.com/2016/8/24/12623736/overwatch-sombra-arg-clues-skycoder Polygon - Overwatch's Sombra mystery appears to be coming to a close]<br />
<br />
[EN] [https://www.vg247.com/2016/08/24/overwatch-forums-glitch-out-reveal-a-message-from-the-mysterious-sombra/ VG247 - Overwatch forums glitch out, reveal a message from the mysterious Sombra]<br />
<br />
[EN] [https://www.technewstoday.com/31151-sombra-hacks-into-overwatch-forums/ Tech News Today - Sombra Hacks Into Overwatch Forums]<br />
<br />
[EN] [https://www.ign.com/articles/2016/08/24/overwatch-mystery-character-sombra-could-be-revealed-today IGN - Overwatch Mystery Character Sombra Could Be Revealed Today]<br />
<br />
'''25th Aug. 2016'''<br />
<br />
[EN] [https://kotaku.com/overwatch-players-are-getting-fed-up-with-the-sombra-ar-1785765307 Kotaku - Overwatch Players Are Getting Sick Of The Sombra ARG]<br />
<br />
[EN] [https://www.ign.com/articles/2016/08/25/overwatch-made-the-internet-lose-its-mind-last-night-and-i-had-a-front-row-seat IGN - Overwatch Made the Internet Lose its Mind Last Night, And I Had a Front-Row Seat]<br />
<br />
[EN] [https://www.technewstoday.com/31182-overwatch-countdown-to-sombra/ Tech News Today - Overwatch: Countdown to Sombra]<br />
<br />
<br />
'''30th Aug. 2016'''<br />
<br />
[EN] [https://www.pcgamer.com/overwatch-sombra-arg-mystery/ PC Gamer - Overwatch's Sombra riddle begins to irritate the players trying to solve it]<br />
<br />
'''3rd Oct. 2016'''<br />
<br />
[EN] [https://www.mobilenapps.com/articles/19398/20161003/overwatch-update-sombra-blizzcon-halloween-event-leak.htm Mobile & Apps - Sombra To Be Revealed At Blizzcon? Halloween Event Confirmed In Data Leak]<br />
<br />
'''4th Oct. 2016'''<br />
<br />
[EN] [https://www.itechpost.com/articles/36011/20161004/overwatch-overwatch-update-overwatch-finally-getting-sombra-overwatch-sombra-sombra.htm iTechPost - Overwatch Update: Are We Finally Getting Sombra?]<br />
<br />
'''11th Oct. 2016'''<br />
<br />
[EN] [https://www.kotaku.com.au/2016/10/overwatch-fans-hacked-actual-people-in-an-attempt-to-find-sombra/ Kotaku - Overwatch Fans Hacked Actual People In An Attempt To Find Sombra]<br />
<br />
'''17th Oct. 2016'''<br />
<br />
[EN] [https://telkomgaming.co.za/will-sombra-hack-her-way-into-blizzcon-2016/ TelKom Gaming - Will Sombra Hack Her Way Into BlizzCon 2016?]<br />
<br />
'''18th Oct. 2016'''<br />
<br />
[EN] [https://overwatchtips.info/overwatch-sombra-arg-everything-you-need-to-know/ OverwatchTips - Everything You NEED To Know (Sombra ARG)]<br />
<br />
'''26th Oct. 2016'''<br />
<br />
[EN] [https://mic.com/articles/157757/overwatch-sombra-arg-everything-we-know-about-the-countdown-and-rumored-nov-1-release#.UILrZHRiM Min Network - Everything we know about Blizzard's rumored Nov. 1 release]<br />
<br />
'''28th Oct. 2016'''<br />
<br />
[EN] [https://kotaku.com/imagining-horror-stories-for-a-never-ending-overwatch-a-1788324673 Kotaku - Imagining Horror Stories Of A Never-Ending Overwatch ARG]<br />
<br />
'''1st Nov. 2016'''<br />
<br />
[EN] [https://www.ign.com/videos/2016/11/01/will-overwatchs-sombra-be-at-blizzcon-2016 IGN - Will Sombra be at BlizzCon 2016?]<br />
<br />
'''8th Nov. 2016'''<br />
<br />
[EN] [https://mic.com/articles/158812/overwatch-sombra-arg-gameplay-emote-directly-references-one-of-the-wildest-fan-theories Mic Tech - 'Overwatch' Sombra ARG: Gameplay emote directly references one of the wildest fan theories]</div>Halke234https://wiki.gamedetectives.net/index.php?title=Banojxot_Xuh&diff=16642Banojxot Xuh2018-07-25T20:59:07Z<p>Halke234: /* Backstory */</p>
<hr />
<div>{{argbox<br />
| name = {{PAGENAME}}<br />
| image = File:BXPhoto.jpg<br />
| description = 15-6-17<br />
| creator = Unknown<br />
| type = Unofficial<br />
| status = Completed<br />
| discovered = 2017-05-13<br />
}}<br />
[[Main Page]] > [[List of Investigations]] > '''Banojxot Xuh'''<br />
<br />
__TOC__<br />
<br />
== Backstory ==<br />
Banojxot Xuh was a [https://www.youtube.com/watch?v=Nl9ct-lm3QY YouTube ARG] that was posted to several country-themed subreddits, and appeared to have a strong political focus. It contained many codes hidden throughout the videos and references to Slovakia along with a strong focus on the date June 15th, 2017.<br />
<br />
Originally, the video was posted in the [https://www.reddit.com/r/england/comments/65d7uo/london_bridge_is_down/ England Subreddit] but the user was banned, the post and the video deleted.<br />
<br />
Then, on May 13th, an image was posted in the [https://www.reddit.com/r/Slovakia/comments/6ayaef/get_ready_15617/ Slovakian Subreddit] by an user called /u/Banojxot (same as the YT channel) featuring a QR code that leads to a video with the words "Get Ready" in red and the date 15.6.17, or June 15th, 2017.<br />
<br />
Later, on May 18th, the user /u/Hamburger__96 posted a photo of a sort of flyer featuring the same image posted in r/Slovakia and the number 0023 handwritten in the back in the [https://www.reddit.com/r/germany/comments/6by9ce/mystery_qr_code_found_in_germany_pic/ Germany subreddit].<br />
It is speculated that /u/Hamburger__96 was the same person behind the Banojxot account on Reddit, although this is still unclear.<br />
<br />
==Videos==<br />
<br />
=== First Video: "15-6-17" ===<br />
<br />
On May 13th a [https://www.youtube.com/watch?v=Nl9ct-lm3QY YouTube video] was uploaded by Banojxot Xuh called 15-6-17. The video had the tags of, <code>scoddD</code>, <code>c432.657.33.</code>, <code>16.6294.22.30</code>, <code>177.947.29.0</code>, <code>be</code>, <code>C A R E F U L</code>, <code>the-y</code>, <code>are</code>, <code>read-y</code>, and <code>Y.y</code>.<br />
<br />
<gallery mode="nolines" perrow=5 widths=400px><br />
<br />
File:BX031.png|'''0:31''' <br> Text stacked goes, <code>3: blue, no serifs</code> <code>3: blue, serifs</code> <code>5: blue, serifs</code> <code>7: orange, serifs</code> <code>4: red, serifs</code>. <br> The person/s has yet to be identified.<br />
<br />
File:BX045.png|'''0:45''' <br> The code, <code>TIUINI TIUINIJIKIXI QIMI TINI WIRIJIOIQINI</code> has a ''possible'' solution, by taking the numbers from 0:31 in the order 5-4-3-3-7, the text returned, <code>NIMNO</code>, a small settlement in Slovenia.<br />
<br />
File:BX049.png|'''0:49''' <br> The code, <code>Yklw lw mzwy ykh ehjlrrlrj</code> translates to <code>This is just the beginning</code> using a substitution cipher.<br />
<br />
File:BX051.png|'''0:51''' <br> The string of yellow text that uses a Polybius Square then a substitution to translate to, <code>Please email me and I will give more information.</code>.<br />
<br />
File:BX0571.png|'''0:57''' <br> The code, <code>TSFSPMZYESADUGE</code> is ROT8 that translates to, <code>BANAXUHGMAILCOM</code>.<br />
<br />
File:BX0572.png|'''0:57''' <br> The code, <code>WPSZEOME MW TSMRX</code> is ROT22 that translates to, <code>SLOVAKIA IS POINT</code>.<br />
<br />
File:BX100.png|'''1:00''' <br> A set of coordinates for locations emphasizing a Slovakian connection. The background image is a picture from [https://archive.org/stream/mythslegendscelt00roll/mythslegendscelt00roll#page/48/mode/1up this book] with the quote of, <code>Desolate be Tara for ever and ever!</code>. This is a [http://www.haunted-britain.com/Eastern_Ireland.htm story from Ireland], on how a hill, Tara, was unremarkable, yet magic. It was a pagan monument to crown the king. In 558 A.D. a saint dispelled Tara of its function as a pagan place of worship, and brought Christianity to Ireland. However, the places located at these coordinates aren't very remarkable.<br />
<br />
File:BX104.jpg|'''1:04''' <br> A set of coordinates that point to Slovakia background is a picture from [https://archive.org/stream/mythslegendscelt00roll/mythslegendscelt00roll#page/48/mode/1up this book] with the quote of, <code>Desolate be Tara for ever and ever!</code>.<br />
<br />
File:BX105.png|'''1:05''' <br> Red text saying "contact me."<br />
<br />
File:BX112.png|'''1:12''' <br> An upside down and backwards picture of Slovakia.<br />
<br />
</gallery><br />
<br />
----<br />
<br />
=== Second Video: "15-6-17 .v2" ===<br />
<br />
[https://www.youtube.com/watch?v=hK9uGBu9FMc A second video] was uploaded on the 21st of May, called 15-6-17.v2. The tags of the video are, <code>383</code>, <code>slovakia</code>, <code>poland</code>, <code>germany</code>, and <code>0.23451.734</code>.<br />
<br />
<gallery mode="nolines" perrow=5 widths=400px><br />
<br />
File:BX2005.png|'''0:05''' <br> Code, <code>Ju xjmm ibqqfo bhbjo</code> is ROT25 and translates to, <code>It will happen again</code>.<br />
<br />
File:BX2013.png|'''0:13''' <br> Text, <code>15.6.17</code> stacked on top of itself 3 times.<br />
<br />
File:BX2016.png|'''0:16''' <br> An image flashed, brightened to show color.<br />
<br />
File:BX2020.png|'''0:20''' <br> Blue text that reads, <code>Yesterday is history, tomorrow is a mystery, today is God's gift, that's why we call it the present.</code>, a quote from Bill Keane.<br />
<br />
File:BX2022.png|'''0:22''' <br> A video of a dollar bill is shown.<br />
<br />
File:BX2023.png|'''0:23''' <br> An image is flashed, brightened to show color.<br />
<br />
File:BX2034.png|'''0:34''' <br> A Slovakian and Polish flag are shown, along with a burning US $1 bill.<br />
<br />
File:BX2038.png|'''0:38''' <br> Code, <code>Lmv slfi droo xszmtv vevibgsrmt</code> is an atbash cipher that translates to, <code>One hour will change everything</code>.<br />
<br />
File:BX2041.png|'''0:41''' <br> A third and final flashed image, brightened to show color.<br />
<br />
File:BX2042.png|'''0:42''' <br> Blue text that reads, <code>The ultimate mystery is tomorrow</code>.<br />
<br />
File:BX2044.png|'''0:44''' <br> Blue text that reads, <code>Black and white is abstract; color is not. Looking at a black and white photograph you are already looking at a strange world</code>, a line from American Prospects: Photographs by Joel Sternfield, and has a 10 euro bill in the background.<br />
<br />
File:BX2045.png|'''0:45''' <br> Red text that reads, <code>51°50'45"N 16°34'56"E</code>, coordinates that point near a Intermax. PHU. Eksport, import in Poland.<br />
<br />
File:BX2048.png|'''0:48''' <br> Green text that reads, <code>I hope you know what you are doing</code>.<br />
<br />
File:BX2052.png|'''0:52''' <br> Red text that reads, <code>15.06.2017</code>.<br />
<br />
</gallery><br />
<br />
=== Third Video ===<br />
[https://www.youtube.com/watch?v=w-lP20-DFPQ A third video] was uploaded on May 24th, 2017.<br />
<br />
In the video you can find 3 flashes of QR Codes, nearly all of which are the same.[[File:QR Codes.PNG]]<br />
<br />
All but one would redirect to Banojxot's Youtube or Twitter, and the other one lead to a page in which it showed an image similar to the images sent in emails.<br />
[[File:Slovak.jpg]]<br />
<br />
===Fourth Video "LAST WARNING"===<br />
<br />
Banjoxot uploaded another video titled "LAST WARNING". [https://www.youtube.com/watch?v=zBOA-7nPIcU]<br />
<br />
This video contains footage of Nice truck attack in France, Kabul bombing attack, and truck attack in Berlin, Germany Christmas market. It also contains text reading "ONE DAY WILL CHANGE EVERYTHING". 15.6.17, and "BE READY". It also contains a picture of the Serbian flag.<br />
<br />
===Fifth Video: "ARE YOU READY?"===<br />
<br />
This video, posted on June 12th, 2017, consists primarily of footage of Canadian Geese flying. During the early part of the 0:07 second video, an equation is shown superimposed over footage of a human hand. The audio of the video turned out to be [https://cdn.discordapp.com/attachments/315545441645101067/323861558880894976/Untitled.png a spectrogram], revealing a [http://bit.ly/2skirGh bit.ly link]. The bit.ly link leads to [http://www93.zippyshare.com/v/GXxOEcqr/file.html this zippyshare] page, which contains a single image of several, numbered people around a van with certain parts highlighted in red. In the upper right is the text "x8x."<br />
<br />
<br />
== Emails ==<br />
<br />
Emails were sent out and Banojxot Xuh replied with a variety of similar images. We currently are ordering based off of the amount of people written on the picture. Almost all have a Slovakian flag and a variant of 15.06.2017. in the flags there is also a fineprint in pale greyish text: sn & id --> "sine nomine & idem" (without name & the same)<br />
<br />
<gallery mode="packed" heights=200px><br />
<br />
File:BXEmail1New.png|'''Email #1''' <br> The coordinates in order point to these locations, <br> <code>1. An alley in Tacoma, Washington.</code> <br> <code>2. In the middle of Hamburg, Germany in what looks like a massive shopping mall.</code> <br> <code>3. Just south of Metsla, Estonia.</code> <br> <code>4. Egegik Bay in Egegik, Alaska</code> <br> <code>5. In the Waal river, Central Nijmegen, Netherlands.</code> <br> <code>6. Centre Dortmund, Germany. Another shopping centre by the looks of it.</code> <br> Has blue and red text that reads, <code>SloVakia is a riddle wrapped in a mystery inside an enigma.</code> This is part of a quote from Winston Churchill: ''"I cannot forecast to you the action of Russia. It is a riddle, wrapped in a mystery, inside an enigma; but perhaps there is a key. That key is Russian national interest."'' The emphasised V might point towards the "V for Victory" handsign Churchill was known for. The text on the bottom says <code>one person</code> in black on the bottom.<br />
<br />
File:BXEmail1.jpg|'''Email #2''' <br> Has the same coordinate locations as Email #2 <br> Has the text <code>two people</code> in black on the bottom.<br />
<br />
File:BXEmail2.1.jpg|'''Email #3''' <br> The green text seems to resemble, <code>first letter</code> stacked a few times. Bottom text in orange says, <code>three people</code>.<br />
<br />
File:BXEmail4.jpg|'''Email #4''' <br> Has the same coordinate locations as Email #2 <br> Bottom text in black says, <code>four people</code>. Also the <code>15.06.2017</code> is gray with a low opacity layer blue version on top.<br />
<br />
File:reply.jpg|'''Email #5''' <br> Has the same coordinate locations as Email #2 <br> Has text in grey that reads, <code>People are just numbers, but sometimes they lead to sole the riddle.</code>. Also has <code>five people</code> in black on the bottom and a blue line coming from under the Slovakian flag.<br />
<br />
File:BXEmail6.png|'''Email #6''' <br> Has the same coordinate locations as Email #2 <br> Has part of the date cut off, a white line through the flag, and has <code>six people</code> written on the bottom in black.<br />
<br />
File:BXEmail2.jpg|'''Email #7''' <br> Has the same coordinate locations as Email #2 <br> Yellow text reads, <code>no object is mysterious, the mystery is your mind</code>, a wrongly quoted proverb that means that any misunderstanding you might have in looking at something is because of you, not it. Black text on the bottom reads, <code>seven people</code>, the text has a yellow back to it, and a blue line comes up from left of the seven people text.<br />
<br />
File:One person x victims.png|'''Email #8''' <br> The QR code leads to the [https://www.youtube.com/channel/UCfT2HBZhxoS9VX7bqd4fyrw Banojxot Xuh Youtube Channel.] <br> The picture references [https://en.wikipedia.org/wiki/V-J_Day_in_Times_Square V-J Day in Times Square.] <br> The vehicle is a Ford Transit (2005). The reference might point towards a [http://www.nytimes.com/1991/02/08/world/ira-attacks-10-downing-street-with-mortar-fire-as-cabinet-meets.html certain terror attack] by the IRA where a white Ford Transit was used as a mortar platform. <br> <code>gdrggvi.xln/yzmzcfs</code> is an atbash cipher that is the [http://twitter.com/banaxuh Banojxot Xuh twitter.] It is also notable that the north-western and mostly central part of Europe is cut out the map in the background. In the background map, it is missing Central Europe (France, UK, Germany, Belgium, Netherlands, etc.)<br />
<br />
</gallery><br />
<br />
== Twitter ==<br />
The e-mails show us [http://twitter.com/banaxuh this twitter account] through an atbash cipher in Email #8. <br />
<br />
=== Tweets ===<br />
<br />
{| class="wikitable sortable" border="1"<br />
|-<br />
! Date & Time (EDT)<br />
! Content<br />
! Notes<br />
|-<br />
| 1:10 PM - 21 May 2017<br />
| You aren't here by accident~B<br />
| Introduction to Twitter.<br />
|-<br />
| 1:13 PM - 21 May 2017<br />
| [https://www.google.nl/maps?q=51%C2%B050%E2%80%B245%E2%80%B3N+16%C2%B034%E2%80%B250%E2%80%B3E&um=1&ie=UTF-8&sa=X&ved=0ahUKEwjfh-G3t4LUAhVOZlAKHVP-Ar4Q_AUICigB 51°50′45″N 16°34′50″E]<br />
[https://www.google.nl/maps?q=51%C2%B050%E2%80%B2N+5%C2%B052%E2%80%B2E&um=1&ie=UTF-8&sa=X&ved=0ahUKEwjF8JLWt4LUAhXPPFAKHWSsAaoQ_AUICigB 51°50′N 5°52′E] <br />
<br />
[https://www.google.nl/maps?q=53%C2%B033%E2%80%B2N+10%C2%B000%E2%80%B2E&um=1&ie=UTF-8&sa=X&ved=0ahUKEwjf9p7jt4LUAhVOKFAKHT_0At8Q_AUICigB 53°33′N 10°00′E]<br />
| Location 1: rondo Solidarności, Leszno, Poland. (Note that this means "Solidarity Roundabout")<br />
Location 2: Professor Cornelissenstraat, Nijmegen, the Netherlands. (A street named after a Dutch academic) <br />
<br />
Location 3: Steinstraße, close to the [https://en.wikipedia.org/wiki/St._James%27_Church,_Hamburg St. James Church], Hamburg, Germany.<br />
|-<br />
| 1:19 PM - 21 May 2017<br />
| 9ce09f56373a96112527aebe5af12f632bd8f0c40132dd76801ad3437e6fdb42 ~B<br />
| A hash that has yet to be decrypted.<br />
|-<br />
| 1:21 PM - 22 May 2017<br />
| You need to think more<br />
| <br />
|-<br />
| 1:23 PM - 22 May 2017<br />
| Qt ake huyv frqg, ake wyl huyv uduhafrqls ~B<br />
| A substitution cipher that reads, <code>If you read this you can read everything</code>.<br />
|-<br />
| 1:26 PM - 22 May 2017<br />
| 15.6.2017, soon!<br />
| <br />
|-<br />
| 1:17 PM - 24 May 2017<br />
| look closer ~B<br />
| <br />
|-<br />
| 1:55 PM - 25 May 2017<br />
| https://t.co/foGUAI33Cw<br />
| <br />
|-<br />
| 1:56 PM - 25 May 2017<br />
| https://t.co/ErUYAlNdUI<br />
| <br />
|-<br />
| 1:57 PM - 25 May 2017<br />
| https://t.co/CkEW1YA1HQ<br />
| <br />
|-<br />
| 2:01 PM - 25 May 2017<br />
| https://t.co/L44uPIlJtV<br />
|<br />
|-<br />
| 2:01 PM - 25 May 2017<br />
| gun and fern flower ~B<br />
| <br />
|-<br />
| 4:12 PM - 27 May 2017<br />
| https://t.co/8O4DxlLr4p<br />
| <br />
|-<br />
| 1:11 PM - 29 May 2017<br />
| Normal is an ilusion. What's normal for the spider is chaos for the fly.<br />
| <br />
|-<br />
| 8:51 AM - 30 May 2017<br />
| I hate plagiarism http://bit.ly/2qxIhlB <Definitive fake ~B<br />
ps. x8x<br />
| <br />
|-<br />
| 1:55 PM - 31 May 2017<br />
| Now, personally, I like a car with some sort of c h a r a c t e r.<br />
| <br />
|-<br />
| 3:37 AM - 4 Jun 2017<br />
| I know of no time in human history where ignorance was better than knowledge.<br />
- http://banxuh.ga -<br />
| <br />
|-<br />
| 10:52 AM - 6 Jun 2017<br />
| In a dark time, the eye begins to see.<br />
Be careful. http://banxuh.ga ~B<br />
|<br />
|-<br />
| 12:42 PM - 8 Jun 2017<br />
| Are You For ME or For OUR Enemies? ~B<br />
banxuh.ga<br />
|<br />
|-<br />
| 3:32 AM - 11 Jun 2017<br />
| 4.>>><br />
|<br />
|-<br />
| 6:58 AM - 12 Jun 2017<br />
| I wanted to help you, but it's too late. 15-6-17 ~B<br />
|<br />
|-<br />
| 3:48 AM - 15 Jun 2017<br />
| http://banxuh.ga :(<br />
|<br />
|-<br />
| 3:57 AM - 15 Jun 2017<br />
| 3 Non-ARG Related, but tragic retweets<br />
|<br />
|-}</div>Halke234https://wiki.gamedetectives.net/index.php?title=TheConsole&diff=16641TheConsole2018-07-25T20:55:44Z<p>Halke234: /* VISUAL FEED */</p>
<hr />
<div>{{argbox<br />
| float = right<br />
| name = The Console<br />
| image = File:TheConsoleAvatar.png<br />
| description= <br />
| creator = Jack Bergin<br />
| type = Investigation<br />
| status = Discontinued<br />
| discovered = 2017-03-22<br />
}}<br />
[[Main Page]] > [[List of Investigations]] > '''TheConsole'''<br />
<br />
''The PM has stated that continuing the ARG will be too difficult, and as such he has canceled the project. The proposed timeline can be found at the bottom of the page.''<br />
<br />
On March 22, 2017, a GD member discovered a [https://theconsole.tumblr.com/ tumblr page] called "TheConsole." It contains many different entries about strange materials, and SCP-like entities. <br />
<br />
__TOC__<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
==CLASSIFIED==<br />
<br />
One of the original Tumblr posts contained:<br />
<pre><br />
22317 1954<br />
ytwx://pnuxvblv.cbo/5I14xiOD<br />
<br />
Encrypted file found and reformatted.<br />
Cipher in place.<br />
</pre><br />
<br />
This was found to be encoded with Vigenere, with a password of "radiance," revealing [http://pastebin.com/5E14giLV a pastebin]. The contents of this were found to also be encoded with Vigenere with the same key:<br />
<br />
<pre><br />
[CLASSIFIED]<br />
//Log-in credentials needed//<br />
//Username: HWells1//<br />
//Password: radiance//<br />
//Log-in successful//<br />
//Retrieving file…//<br />
Project Radiance: Previous studies of AETHER have shown that it is capable of manipulating matter. Hypothetically, it could be used to create a “door” to a different point in space.<br />
Subject: Mouse<br />
Status: Dead<br />
Cause: Lethal AETHER intensity<br />
<br />
Subject: Mouse<br />
Status: Dead<br />
Cause: Beheading via travelling through AETHER doorway<br />
<br />
Subject: Mouse<br />
Status: Alive<br />
Notes: Arm missing<br />
<br />
Subject: Mouse<br />
Status: Alive<br />
Notes: Visibly fine<br />
<br />
Subject: Dummy<br />
Status: Destroyed<br />
Cause: Burning<br />
<br />
Subject: Dummy<br />
Status: Intact<br />
Notes: Minor burns<br />
<br />
Subject: Dummy<br />
Status: Intact<br />
Notes: Visibly normal<br />
<br />
Subject: Wells, I.<br />
Status: Unknown<br />
Cause: Lethal AETHER intensity<br />
Notes: During testing, an unforeseen error came into play, resulting in an explosion killing 8 members of staff. One survivor has experienced psychological trauma from witnessing the aftermath, refusing to co-operate in present and upcoming projects in fear of an identical outcome. As such, his position has been suspended and treatment is pending. Until he can co-operate with Lumitech again, his future with the company is hanging by a thread.<br />
<br />
Until I. Wells is retrieved from [N/A] or a successful, non-lethal doorway is created, the project will be permanently shut sown.<br />
<br />
Additional notes: Since the experiment, H Wells has reported seeing an “angel”. Psychological evaluation is recommended.<br />
</pre><br />
<br />
==VISUAL FEED==<br />
<br />
Players also discovered a [https://www.youtube.com/channel/UC_kasuQokBmsAkLT4iz613Q YouTube channel], which initially contained a single [https://www.youtube.com/watch?v=F-g4r5MN9Gc video], titled "Visual Feed 1." There appeared to be nothing but a black screen, and static in the background. However, more information was revealed when closed captions were turned on:<br />
<pre><br />
TheConsole: [ERROR: File could not be read]<br />
TheConsole: [Transcribing event...]<br />
TheConsole: [Subject: Dr Harvey Wells]<br />
TheConsole: [Status: Grieving]<br />
TheConsole: [Cause: Experiment Fatality Case R-03]<br />
TheConsole: [Details: [RESTRICTED BY LUMITECH]<br />
TheConsole: [RADIANCE-1 is online]<br />
</pre><br />
<br />
Later the restricted details where found to be <code>Project Radiance</code>.<br />
<br />
==Fort Rosner Breached==<br />
<br />
On March 26, 2017, two new files were posted on the blog. <br />
<br />
===Audio File===<br />
<br />
One of the files was an [https://theconsole.tumblr.com/post/158855638379/fortrosnerbreach audio file] discovered to be SSTV revealing [https://cdn.discordapp.com/attachments/294293637129568256/295607271960870913/unknown.png this image] of a crest displaying an eagle with a flag above its head, and holding what appear to be an olive branch and wheat in its talons. Below the eagle is the text "FORT ROSNER," suggesting that this image might be some form of title slide for a video.<br />
<br />
===Encrypted Message===<br />
<br />
The other file recovered was an [https://theconsole.tumblr.com/post/158860753749/26317-2024 encrypted document], encoded with what appears to be a unique mix of Viginere and Base 64 encryption from [http://www.encrypt-easy.com/encrypt-text this site]. The password for this file was "hive," revealing the text:<br />
<br />
<pre><br />
TITLE OF FILE: I'm scared<br />
<br />
FILE CONTENTS:<br />
<br />
From: Wells, H.<br />
To: Kingston, T<br />
<br />
Mr Kingston,<br />
I am writing to you about the previous attempts on Project Precipice.<br />
While the AI for Td-1 is being compiled, the physical components of the body Are missing some key materials. We believe that, if given access to the previous RaDiances, We can develop pocket AETHER generators tHat can kEep the final pRoduct running for long pEriods of time, As well as fuel the weaponry being developed.<br />
Respond at your earliest convenience.<br />
<br />
Regards,<br />
Dr Wells<br />
<br />
From: Kingston, T<br />
To: Wells, H<br />
<br />
Dr Wells,<br />
We will have the parts ready soon. We begin with the disasseMbly of Radiance-1 tomorrow. Do not fail us, we are sInking too much money into this and do not want a repeat of what happened to Irene.<br />
<br />
From,<br />
T. Kingston<br />
CEO of Lumitech<br />
</pre><br />
<br />
When the capitalization mistakes are strung together with the title, the message "Dad where am I I'm scared" is revealed. This message appears to be coming from Wells' daughter, but how or why it was transmitted is unknown. In addition, the "A.I." referred to in the message could possibly be Jude/TheConsole, but it is not clear whether this is the case.<br />
<br />
=Ending=<br />
<br />
===Act 2===<br />
<br />
Jared awakens in the ruins of a large building with no clue as to how he got there. The place has been shut for years. Every week, he would have sent two lucky users a password-protected file containing images, videos and audio pointing to the fact that Bel is slowly taking over.<br />
Meanwhile, a new video would be uploaded. Fort Rosner announced the discovery of Michael Ryan’s body and that it was to be cremated and scattered within a few days.<br />
News with Caefur would be slow as usual.<br />
Near August, TheConsole would be hijacked temporarily by CP-1 (aka Cenpro), followed by a “forced temporal blockade” (as far as Jude knew, it would be the same date for a while). To end it, some unplanned activity would need to be done by the community to overpower Levia/The Watcher, who was responsible for the event.<br />
SB-D/Timechaser would make a brief appearance, warning that something is close to happening.<br />
<br />
===Act 3===<br />
<br />
Louise and Dr Wells would die at the hands of unnamed individuals. The event would be marked once again by a message from Bel’s disciple. The name of the Tongue is revealed to be Tohn.<br />
Jared’s body begins to fail, resulting in Bel being forced to leave the body.<br />
(Interactive puzzle stuff)<br />
Jude is alerted to the presence of three unknown entities and an angel approaching C-1. Security systems fail and TheConsole is no longer online.<br />
<br />
There would likely be a lot more stuff in-between that would have shaped the story better, but this was all the main information<br />
<br />
===TRIVIA===<br />
<br />
Fort Rosner was named after Florida Man Adam Rosner, creator of series TribeTwelve. Additionally, Bel can be seen as a sort of homage.<br />
Sigma was indeed named after the term sigma radiation from EverymanHybrid, another online series.<br />
The four fragments of the blind angel were named after the books in the Satanic Bible. Levia+Ethan = Leviathan, Louise/Lou+Caefur = Lucifer, Bel+Vial (where the sigma that infected Jared came from) = Belial, Say (what tongues help do)+Tohn = Satan.<br />
Harvey Wells and TheConsole originally came from the demo linked in the previous post (as minor characters).<br />
<br />
=Resources=<br />
<br />
===Glossary===<br />
<br />
A compilation of characters, locations, terms, and more: [[TheConsole/Glossary|Glossary]]<br />
<br />
===Event Timeline===<br />
<br />
A chronological list of major events: [[TheConsole/Event_Timeline|Timeline]]</div>Halke234https://wiki.gamedetectives.net/index.php?title=TheConsole&diff=16640TheConsole2018-07-25T20:54:30Z<p>Halke234: /* CLASSIFIED */</p>
<hr />
<div>{{argbox<br />
| float = right<br />
| name = The Console<br />
| image = File:TheConsoleAvatar.png<br />
| description= <br />
| creator = Jack Bergin<br />
| type = Investigation<br />
| status = Discontinued<br />
| discovered = 2017-03-22<br />
}}<br />
[[Main Page]] > [[List of Investigations]] > '''TheConsole'''<br />
<br />
''The PM has stated that continuing the ARG will be too difficult, and as such he has canceled the project. The proposed timeline can be found at the bottom of the page.''<br />
<br />
On March 22, 2017, a GD member discovered a [https://theconsole.tumblr.com/ tumblr page] called "TheConsole." It contains many different entries about strange materials, and SCP-like entities. <br />
<br />
__TOC__<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
==CLASSIFIED==<br />
<br />
One of the original Tumblr posts contained:<br />
<pre><br />
22317 1954<br />
ytwx://pnuxvblv.cbo/5I14xiOD<br />
<br />
Encrypted file found and reformatted.<br />
Cipher in place.<br />
</pre><br />
<br />
This was found to be encoded with Vigenere, with a password of "radiance," revealing [http://pastebin.com/5E14giLV a pastebin]. The contents of this were found to also be encoded with Vigenere with the same key:<br />
<br />
<pre><br />
[CLASSIFIED]<br />
//Log-in credentials needed//<br />
//Username: HWells1//<br />
//Password: radiance//<br />
//Log-in successful//<br />
//Retrieving file…//<br />
Project Radiance: Previous studies of AETHER have shown that it is capable of manipulating matter. Hypothetically, it could be used to create a “door” to a different point in space.<br />
Subject: Mouse<br />
Status: Dead<br />
Cause: Lethal AETHER intensity<br />
<br />
Subject: Mouse<br />
Status: Dead<br />
Cause: Beheading via travelling through AETHER doorway<br />
<br />
Subject: Mouse<br />
Status: Alive<br />
Notes: Arm missing<br />
<br />
Subject: Mouse<br />
Status: Alive<br />
Notes: Visibly fine<br />
<br />
Subject: Dummy<br />
Status: Destroyed<br />
Cause: Burning<br />
<br />
Subject: Dummy<br />
Status: Intact<br />
Notes: Minor burns<br />
<br />
Subject: Dummy<br />
Status: Intact<br />
Notes: Visibly normal<br />
<br />
Subject: Wells, I.<br />
Status: Unknown<br />
Cause: Lethal AETHER intensity<br />
Notes: During testing, an unforeseen error came into play, resulting in an explosion killing 8 members of staff. One survivor has experienced psychological trauma from witnessing the aftermath, refusing to co-operate in present and upcoming projects in fear of an identical outcome. As such, his position has been suspended and treatment is pending. Until he can co-operate with Lumitech again, his future with the company is hanging by a thread.<br />
<br />
Until I. Wells is retrieved from [N/A] or a successful, non-lethal doorway is created, the project will be permanently shut sown.<br />
<br />
Additional notes: Since the experiment, H Wells has reported seeing an “angel”. Psychological evaluation is recommended.<br />
</pre><br />
<br />
==VISUAL FEED==<br />
<br />
A [https://www.youtube.com/channel/UC_kasuQokBmsAkLT4iz613Q Youtube channel] was also found, which contains a single [https://www.youtube.com/watch?v=F-g4r5MN9Gc video], titled "Visual Feed 1." There appears to be nothing but a black screen, and static in the background. In addition, when closed captions are turned on, more information is revealed:<br />
<pre><br />
TheConsole: [ERROR: File could not be read]<br />
TheConsole: [Transcribing event...]<br />
TheConsole: [Subject: Dr Harvey Wells]<br />
TheConsole: [Status: Grieving]<br />
TheConsole: [Cause: Experiment Fatality Case R-03]<br />
TheConsole: [Details: [RESTRICTED BY LUMITECH]<br />
TheConsole: [RADIANCE-1 is online]<br />
</pre><br />
<br />
Later the restricted details where found to be <code>Project Radiance</code>.<br />
<br />
==Fort Rosner Breached==<br />
<br />
On March 26, 2017, two new files were posted on the blog. <br />
<br />
===Audio File===<br />
<br />
One of the files was an [https://theconsole.tumblr.com/post/158855638379/fortrosnerbreach audio file] discovered to be SSTV revealing [https://cdn.discordapp.com/attachments/294293637129568256/295607271960870913/unknown.png this image] of a crest displaying an eagle with a flag above its head, and holding what appear to be an olive branch and wheat in its talons. Below the eagle is the text "FORT ROSNER," suggesting that this image might be some form of title slide for a video.<br />
<br />
===Encrypted Message===<br />
<br />
The other file recovered was an [https://theconsole.tumblr.com/post/158860753749/26317-2024 encrypted document], encoded with what appears to be a unique mix of Viginere and Base 64 encryption from [http://www.encrypt-easy.com/encrypt-text this site]. The password for this file was "hive," revealing the text:<br />
<br />
<pre><br />
TITLE OF FILE: I'm scared<br />
<br />
FILE CONTENTS:<br />
<br />
From: Wells, H.<br />
To: Kingston, T<br />
<br />
Mr Kingston,<br />
I am writing to you about the previous attempts on Project Precipice.<br />
While the AI for Td-1 is being compiled, the physical components of the body Are missing some key materials. We believe that, if given access to the previous RaDiances, We can develop pocket AETHER generators tHat can kEep the final pRoduct running for long pEriods of time, As well as fuel the weaponry being developed.<br />
Respond at your earliest convenience.<br />
<br />
Regards,<br />
Dr Wells<br />
<br />
From: Kingston, T<br />
To: Wells, H<br />
<br />
Dr Wells,<br />
We will have the parts ready soon. We begin with the disasseMbly of Radiance-1 tomorrow. Do not fail us, we are sInking too much money into this and do not want a repeat of what happened to Irene.<br />
<br />
From,<br />
T. Kingston<br />
CEO of Lumitech<br />
</pre><br />
<br />
When the capitalization mistakes are strung together with the title, the message "Dad where am I I'm scared" is revealed. This message appears to be coming from Wells' daughter, but how or why it was transmitted is unknown. In addition, the "A.I." referred to in the message could possibly be Jude/TheConsole, but it is not clear whether this is the case.<br />
<br />
=Ending=<br />
<br />
===Act 2===<br />
<br />
Jared awakens in the ruins of a large building with no clue as to how he got there. The place has been shut for years. Every week, he would have sent two lucky users a password-protected file containing images, videos and audio pointing to the fact that Bel is slowly taking over.<br />
Meanwhile, a new video would be uploaded. Fort Rosner announced the discovery of Michael Ryan’s body and that it was to be cremated and scattered within a few days.<br />
News with Caefur would be slow as usual.<br />
Near August, TheConsole would be hijacked temporarily by CP-1 (aka Cenpro), followed by a “forced temporal blockade” (as far as Jude knew, it would be the same date for a while). To end it, some unplanned activity would need to be done by the community to overpower Levia/The Watcher, who was responsible for the event.<br />
SB-D/Timechaser would make a brief appearance, warning that something is close to happening.<br />
<br />
===Act 3===<br />
<br />
Louise and Dr Wells would die at the hands of unnamed individuals. The event would be marked once again by a message from Bel’s disciple. The name of the Tongue is revealed to be Tohn.<br />
Jared’s body begins to fail, resulting in Bel being forced to leave the body.<br />
(Interactive puzzle stuff)<br />
Jude is alerted to the presence of three unknown entities and an angel approaching C-1. Security systems fail and TheConsole is no longer online.<br />
<br />
There would likely be a lot more stuff in-between that would have shaped the story better, but this was all the main information<br />
<br />
===TRIVIA===<br />
<br />
Fort Rosner was named after Florida Man Adam Rosner, creator of series TribeTwelve. Additionally, Bel can be seen as a sort of homage.<br />
Sigma was indeed named after the term sigma radiation from EverymanHybrid, another online series.<br />
The four fragments of the blind angel were named after the books in the Satanic Bible. Levia+Ethan = Leviathan, Louise/Lou+Caefur = Lucifer, Bel+Vial (where the sigma that infected Jared came from) = Belial, Say (what tongues help do)+Tohn = Satan.<br />
Harvey Wells and TheConsole originally came from the demo linked in the previous post (as minor characters).<br />
<br />
=Resources=<br />
<br />
===Glossary===<br />
<br />
A compilation of characters, locations, terms, and more: [[TheConsole/Glossary|Glossary]]<br />
<br />
===Event Timeline===<br />
<br />
A chronological list of major events: [[TheConsole/Event_Timeline|Timeline]]</div>Halke234https://wiki.gamedetectives.net/index.php?title=TheConsole/Glossary&diff=16639TheConsole/Glossary2018-07-25T20:48:07Z<p>Halke234: /* Fort Rosner */</p>
<hr />
<div>[[Main Page]] > [[List of Investigations]] > [[TheConsole]] > '''Glossary'''<br />
<br />
This page is a collection of terms, locations and characters from [[TheConsole |The Console]] investigation.<br />
<br />
__TOC__<br />
= Characters & Organizations =<br />
<br />
===Dr. Harvey Wells===<br />
<br />
Info as provided by The Console:<br />
<br />
<code>Employee name: Harvey Wells<br />
<br />
Accolades: D.A.S., D.C.S., D.Eng.<br />
<br />
Sex: Male <br />
<br />
Age: 49 <br />
<br />
Role: Project Overseer<br />
<br />
Completed project(s): Aether, Starfish, Precipice<br />
<br />
Pending project(s): Hive<br />
<br />
Failed project(s): [CLASSIFIED]</code><br />
<br />
<br />
Whereabouts: ''Unknown''<br />
<br />
===Irene Wells===<br />
<br />
The wife of Dr. Harvey Wells, and an apparent survivor of the Lumitech explosion. Her survival is only known by the fact that her suit's vitals were still giving off a heartbeat. As she had entered Radiance-1 for testing, she was accompanied by a contained explosion that killed numerous Lumitech staff members. Whereabouts unknown.<br />
<br />
===Louise Wells===<br />
<br />
Daughter of Harvey and Irene Wells.<br />
<br />
Born April 17, 1995. An only child, homeschooled, with average grades. She appears to have sent a distress message to her father (H. Wells) in a message hidden on the Rosen servers which Jude was able to recover. Whereabouts unknown.<br />
<br />
She was confirmed to be a major part of Project Bridge. It was never clear what her full role in the project was, but she was tested on and given doses of Sigma which was greatly affecting her personality. These personality changes were swapping Louise between herself and Caefur controlling the body.<br />
<br />
===The Console===<br />
<br />
An artificial intelligence connected to a series of consoles created by Dr. Wells at Lumitech, in May 2016.<br />
<br />
Currently residing in Lumitech site C-1.<br />
<br />
Also known as Jude.<br />
<br />
===The Blind Angel===<br />
<br />
An angel who was broken into fragments by Azoth.<br />
<br />
This was a text translated from a retrieved document:<br />
<br />
<pre>It was the dawn of humanity. From our sacred home hidden in the dusts of the departed, we watched as they flourished. And yet there was one who despised our creations. An angel without sight. They would claim that they had seen what they were capable of, warning that they were to be eradicated before our halls became stained with the bloody dusts we leave behind. <br />
<br />
They acted out and were exiled.<br />
<br />
Wings shattered, they were abandoned within the home of the humans as a mere phantom on time. We hoped they would change their mind. We were wrong<br />
<br />
The blind angel returned, a feat none have accomplished. The hatred that flowed throughout their being was enough to let them return home with vengeance, with every pile of dust left behind by our shattered bodies the more confident they became.<br />
<br />
The strongest of us became dust splattered on the pure white of our home, the cowardly fleeing. Ultimately the blind one stood before their former leader, our master azoth god. They leaped towards it, but it was no use. When they finally came to, they were about to be executed. The blind angel ushered their final words<br />
<br />
'One way or another, I will return on that day. I will wander these empty colorful walls'<br />
<br />
I saw as the fragments of their body fell, settling on the soils of the human realm. As I sit in this palace of exiles I question whether there is truth to their words.</pre><br />
<br />
===Bel===<br />
<br />
Fragment of the Blind Angel which talks through Jude on Discord.<br />
<br />
Little was known about Bel, but they appeared to be connected to Radiance-1 in some way, as they made themselves better known after Radiance-1 was revealed. Host was Jared Myers. Bel and Jared were somewhere within a undisclosed location after fleeing the US. He was the wings of the Blind Angel. Also referred to as B.<br />
<br />
===The Watcher===<br />
<br />
Fragment of the Blind Angel, he was the eyes before they were split apart.<br />
<br />
Not much was known about the Watcher except that he was using Ethan, the only survivor of the Radiance-1 explosion, as his host. Apparently, The Watcher held some form of prophecy, which players were supposed to bargain for. He wanted Radiance-1 repaired so he could get access to a "husk". Could be contacted and receive one question if you wrote his name on your hand or a mask in pen.<br />
<br />
===The Tongue===<br />
<br />
A fragment of the Blind Angel.<br />
<br />
Supposedly the most powerful fragment and didn't need someone to host its consciousness. All players knew is that it was buried after being attacked.<br />
<br />
===Caefur===<br />
<br />
A fragment of the Blind Angel.<br />
<br />
Current host was Louise Wells. Caefur was the left arm of the Blind Angel and was somewhat violent in nature. Caefur had once broken out of containment in Fort Rosner and gutted someone with her fingernails. She then escaped Fort Rosner only to be captured by Doctor Harvey Wells. Talked through Jude and her Tumblr, which is now deleted.<br />
<br />
===Ethan===<br />
<br />
Ethan was the host of The Watcher. Ethan was working on repairing Radiance-1 using the blueprints he stole from Lumitech.<br />
<br />
===Jared Myers===<br />
<br />
Hosted Bel. Former mole at Fort Rosner, ran off to an undisclosed location once Sigma testing began at Fort Rosner.<br />
<br />
===Michael Ryan===<br />
<br />
Former Rosner employee who was working on Project Hive before being killed by Caefur.<br />
<br />
===Azoth===<br />
<br />
"King" of the Angels. Banished the Blind Angel after it committed a genocide against the Angels. <br />
<br />
===Burning Man===<br />
<br />
Said to be giving "gifts" of sort. First appearance in the final act 1 video.<br />
<br />
===Lumitech===<br />
Formerly a tech company, after an employee made a discovery (probably related to Sigma) they focused on science. Currently 60 employees, prior to the events of Project Radiance (a massive explosion, which killed Irene Wells, among others) there were 102 employees. They were working with Fort Rosner on Project Hive, but have stopped responding due to technical problems-- what Judge describes as 'AI problems'.<br />
<br />
===Fort Rosner===<br />
Rosner was the designation for a department within the Nellis AFB complex. They focused on experimental weaponry, both mechanical and biological. Jude didn't have a lot of information on them, but did provide a valid email address to reach them.<br />
<br />
= Locations =<br />
<br />
The following are locations and their respective descriptions, as provided by The Console.<br />
<br />
==Lumitech Sites==<br />
<br />
===19-Xi-Aster=== <br />
"Also known as Earth. Their main labs are located here."<br />
<br />
===42-Iota-Convallaria=== <br />
"AETHER mining and processing is conducted."<br />
<br />
"42-Iota-Convallaria was the first site to be established for AETHER mining. However, staff would go missing from time to time, several believing they were being watched."<br />
<br />
Found by Lumitech: July 23, 2015<br />
<br />
===20-Beta-Hyoscyamus===<br />
"Research on ruins and mythological texts."<br />
<br />
"20-Beta-Hyoscyamus contained numerous ruins and texts relating to a myth of a "broken angel"."<br />
<br />
Found by Lumitech: July 29, 2015<br />
<br />
===5-Kappa-Myosotis=== <br />
"Agriculture and farming tests."<br />
<br />
Found by Lumitech: November 16, 2015<br />
<br />
===64-Pi-Rafflesia=== <br />
"Weapon testing."<br />
<br />
Found by Lumitech: August 12, 2015<br />
<br />
===99-Alpha-Orchidaceae=== <br />
"Temporary hub for Lumitech staff."<br />
<br />
Found by Lumitech: August 22, 2015<br />
<br />
===C-1=== <br />
"Attempts to travel beyond the known universe."<br />
<br />
Found by Lumitech: September 19, 2015<br />
<br />
===13-Sigma-Asclepias=== <br />
<br />
"No console exists within 13-Sigma-Asclepias. It is a hostile place, forsaken."<br />
<br />
"The original plans were to use the site for AETHER mining, as it had very high readings identical to that of the [6] Failed Sites. Unlike them, however, 13-Sigma-Asclepias could be accessed."<br />
<br />
"One week after colonization, on-site staff disappeared. They were later found, but expressed frequent violent tendencies and a more animalistic demeanour."<br />
<br />
"Numerous lives were lost. Autopsies revealed large amounts of Sigma in their digestive system. Ultimately, the site was removed from the system."<br />
<br />
Found by Lumitech: October 31, 2015<br />
<br />
==Miscellaneous==<br />
<br />
===Doctor Well's House===<br />
<br />
Current location of both Louise and Doctor Harvey Wells. Doctor Harvey is currently tested on Caefur trying to bring his wife back through testing with Sigma and other things<br />
<br />
= Dr. Wells' Projects =<br />
<br />
== Completed ==<br />
<br />
===Project Aether===<br />
<br />
"Project Aether was started after a mineral radiating AETHER was discovered. Instantly, it was applied in multiple ways."<br />
<br />
===Project Starfish===<br />
<br />
"An experiment to see what AETHER's side effects were on humans. Numerous subjects grew additional organs and body parts as a result."<br />
<br />
"[19] subjects experienced negative effects, [12] of them ultimately dying."<br />
<br />
===Project Precipice===<br />
<br />
Last project Dr. Wells worked on with Lumitech. From the blog:<br />
<br />
<pre>Project Precipice: [REDACTED]-1 was designed to mimic the function of [REDACTED]-0, a manmade structure dating back several hundred years. It is believed that the creators of said structure designed it to connect with the divine. After the events of [CLASSIFIED], numerous unauthorised simulations have been run by Dr H Wells. According to his data, it would be ideal to create an exact mechanical copy of [REDACTED]-0 and create more compact versions later on.<br />
<br />
R-1: Frame is arch-like, mounted on a platform. Co-ordinates would be input via attached computer. AETHER cylinder installed in platform via hatch at back. Different amounts of AETHER is required for alternating sizes of objects/people entering and exiting, as too high an amount can have severe injuries. Decommissioned due to I Wells incident.<br />
<br />
R-2: An exact reconstruction of R-0, with dials on side being replaced by outlets feeding into a computer (which inputs co-ordinates). Testing proved successful after sending a camera feed through after numerous tests to see if R-2 could function. Land was found, later built upon to gather data and harvest more AETHER. Decommissioned due to size and energy inefficiency.<br />
<br />
R-3: A size modification of R-2, designed to take up less space and consume considerably less AETHER than its predecessor. On some occasions, there have been serious AETHER fluctuations. As a result, the next incarnation requires re-evaluating the design (as well as further improvements). Decommissioned due to risk of death.<br />
<br />
R-4: The appearance of R-1 was adopted and blended with the structure of R-0, resulting in a block-like doorway mounted on a platform. Tests show that R-4 is running as intended, no further development needed as of yet.<br />
<br />
Colonization: Numerous sites have been discovered thanks to Project Precipice. AETHER plants have been established, allowing Lumitech to utilize it however we see fit. It does, of course, mean that constant maintenance is needed. The solution? Specimen 1’s offspring. It also gave us the space and materials needed to create long-term research bases and model cities to test prototype weaponry. In fact, tests on the TD Project have yielded promising results. The staff at Fort Rosner are looking into trying to develop a way for TD-1’s wings to act as weaponry, as well as continuing to make sure it becomes everything it is designed to be: a soldier.<br />
<br />
Issues: Some co-ordinates inputted result in the R-4 system shutting down. Technically, we should be able to access these locations, meaning it’d be impossible to input a set of co-ordinates that are a dead end. Therefore, it is to be believed that an outside force is restricting R-4’s access to certain areas.</pre><br />
<br />
== In-Progress ==<br />
<br />
===Project Bridge===<br />
<br />
"Trying to form a bridge between two beings. Between man and the divine."<br />
<br />
Dr Wells is currently focused fully on this Project as he believes it can bring back his wife, Irene, somehow.<br />
<br />
== Pending ==<br />
<br />
===Project Hive===<br />
<br />
"A collaboration between Lumitech and Fort Rosner personnel to further the development of artificial intelligence, giving them bodies."<br />
<br />
"Lumitech was developing the more computer-y side of Project Hive, while FR dealt with the engineering part. I don't know how much they've built for the main body, but I do know that they've developed these weird-looking panels. They can act as wings, and collect concentrated solar energy to weaponize."<br />
<br />
== Failed ==<br />
<br />
===Project Radiance===<br />
<br />
Purpose: Manipulating Aether in order to open "doors" between points in space. Presumably a similar concept than that of "worm holes". The project details were classified after failure. <br />
<br />
''From an encrypted classified file found by solvers:''<br />
<br />
Project Radiance: Previous studies of AETHER have shown that it is capable of manipulating matter. Hypothetically, it could be used to create a “door” to a different point in space.<br />
<br />
==Radiances==<br />
===R-0===<br />
From the blog:<br />
<pre>RADIANCE-0 OFFLINE<br />
Location: [WITHHELD]<br />
Dimensions: 19m x 19m x 4m<br />
Liquid present: Kerosene (?)<br />
Age: Approx. 800 years old<br />
Last use: 1781 0952<br />
Description: A stone pool with a dial embedded on each face. It is believed from scripts that date back to the same era that RADIANCE-0 was used to summon beings from alternate realms or allow humans to enter them.<br />
Simulations of the structure indicate that the dials would be used to pinpoint co-ordinates; entering them would trigger the liquid present to ignite, hypothetically acting the same way RADIANCE-1 and future instalments do with AETHER.<br />
Notes: More recent matter was detected within RADIANCE-0’s liquid, indicating someone entered or exited the site. Tests reveal that it was human matter. Traces of SB material were found outside of R-0’s chamber.<br />
Hypothesis: [SB-D (or its offspring) originated from RADIANCE-0] [SBs are drawn to the site of RADIANCE-0]</pre><br />
<br />
Location was later found to be in Canada, hidden in a forest.<br />
<br />
===R-1===<br />
Excerpt from the blog post about project Precipice:<br />
<pre>[REDACTED]-1 was designed to mimic the function of [REDACTED]-0, a manmade structure dating back several hundred years.<br />
(presumably [REDACTED] is 'Radiance' here)<br />
...<br />
R-1: Frame is arch-like, mounted on a platform. Co-ordinates would be input via attached computer. AETHER cylinder installed in platform via hatch at back. Different amounts of AETHER is required for alternating sizes of objects/people entering and exiting, as too high an amount can have severe injuries. Decommissioned due to I Wells incident.</pre><br />
<br />
===R-2===<br />
Excerpt from the blog post about project Precipice:<br />
<pre>R-2: An exact reconstruction of R-0, with dials on side being replaced by outlets feeding into a computer (which inputs co-ordinates). Testing proved successful after sending a camera feed through after numerous tests to see if R-2 could function. Land was found, later built upon to gather data and harvest more AETHER. Decommissioned due to size and energy inefficiency.</pre><br />
<br />
===R-3===<br />
Excerpt from the blog post about project Precipice:<br />
<pre>R-3: A size modification of R-2, designed to take up less space and consume considerably less AETHER than its predecessor. On some occasions, there have been serious AETHER fluctuations. As a result, the next incarnation requires re-evaluating the design (as well as further improvements). Decommissioned due to risk of death.</pre><br />
<br />
===R-4===<br />
Excerpt from the blog post about project Precipice:<br />
<pre>R-4: The appearance of R-1 was adopted and blended with the structure of R-0, resulting in a block-like doorway mounted on a platform. Tests show that R-4 is running as intended, no further development needed as of yet.<br />
...<br />
Issues: Some co-ordinates inputted result in the R-4 system shutting down. Technically, we should be able to access these locations, meaning it’d be impossible to input a set of co-ordinates that are a dead end. Therefore, it is to be believed that an outside force is restricting R-4’s access to certain areas.</pre><br />
<br />
= Miscellaneous =<br />
<br />
===AETHER===<br />
<br />
"AETHER is a naturally-found energy that can be applied in numerous ways. It can transmute. It can replace electricity. It can be used on humans and animals. It's properties are quite flexible."<br />
<br />
===Sigma Beasts===<br />
<br />
"Sigma Beasts are entities composed of an unidentifiable biological substance (dubbed Sigma), and originate from a singular source. Their forms and properties vary for each individual SB."<br />
<br />
The presumed creator of all Sigma Beasts is known as Sigma Beast Discord. Post [https://theconsole.tumblr.com/post/158712892139/22317-1954| 27217 0826] says as follows:<br />
<pre><br />
SB-D located within close proximity<br />
Description: (N/A). Stature is always humanoid, appearance changes.<br />
Notes: SB-D is the presumed creator of all SBs. Data readings show that the entity produces more energy than its creations, and that there can be multiple instances of it. <br />
Containment is unlikely.<br />
Sightings<br />
15716 1744: Figure seen at site prior to origin of SB.<br />
23716 0928: Figure of same description seen spewing black substance confirmed to be composed of the same material as the SB.<br />
9816 1241: SB-3 found, figure allegedly seen sinking into shallow pool of substance.<br />
30117 0855: Figure is confirmed to be SB-D post-scan. Remains of missing persons found in substance nearby site.<br />
</pre><br />
<br />
SB-D is also the one responsible for the explosion of Radiance-1 and frying C-1's CPU.<br />
<br />
The known Sigma Beasts are:<br />
<br />
====SB-1====<br />
<br />
'''Description:''' A wolf approximately 4 feet tall, consisting of unknown black waste and minor amounts of identical red waste for eyes (8). A clock is embedded in its tail, extra eyes located on the chest and centrepiece of the clock. <br />
<br />
'''Notes:''' Exposing SB-1 to cold temperatures yields no results. Fire is absorbed into the body of SB-1. Spraying with water produces smoke, and often results in body mass deterioration. <br />
<br />
'''Storage:''' SB-1 is to be kept within an enclosure consisting of a steel floor, four (4) walls made up of several layers of glass and a steel ceiling adorn with one (1) source of light.<br />
<br />
====SB-3====<br />
<br />
'''Description:''' A skull 2.3x larger than an average adult male skull, Sigma oozing from its mouth. Two red eyes are located inside of the sockets, a clock face embedded on its forehead.<br />
<br />
'''Notes:''' Sigma produced from its mouth can be warped into appendages, allowing it to move freely and attack any entity that corners it. If placed 5 metres away from its origin, the Sigma loses its properties, allowing it to be used for experimentation.<br />
<br />
'''Storage:''' SB-3 is to be kept within a 5x5x5m container with a shatter-resistant glass ceiling, (4) layered steel walls and a steel floor with (4) drains leading to an area some distance away for storing canisters with Sigma ready for testing purposes.<br />
<br />
'''Security:''' Under no circumstances is SB-3 permitted to be removed from its container.<br />
<br />
====SB-7====<br />
<br />
'''Description:''' A malnourished humanoid entity approximately 7 feet high. Has large bulbous red eyes that lock onto target, even when targeted personnel are not in the same room or building. Small clock face is located on body of sternum. <br />
<br />
'''Notes:''' SB-7's presence triggers intense fear response for target(s). Survivors of said trauma report having their oldest and innermost fears subjected to them. Its body, despite being composed of the same material, produces a foul odor, the entity's presence reducing the temperature of confined spaces by at least 5° C. <br />
<br />
'''Storage:''' SB-7 is to be kept within an enclosure consisting of a stone floor, three (3) walls made up of several layers of bulletproof glass, one (1) wall made of steel and equipped with ventilation, and a steel ceiling adorn with one (1) source of light. <br />
<br />
'''Security:''' Personnel handling SB-7 are to enter its chamber wearing hazmat suits (complete with respirators) and wielding stun batons. No fewer than three (3) people are to be in SB-7's chamber at a time.<br />
<br />
====SB-19====<br />
<br />
'''Description:''' A large humanoid creature composed of unknown black substance, large red eye located on centre of face. Small clock faces are embedded on the backs of its gargantuan hands. <br />
<br />
'''Notes:''' SB-19'S solidity is inconsistent at times; while the body is constantly solid mass, its hands alter between solid and liquid state. When solid, a single punch is fully capable of obliterating up to 3 layers of brick wall. While liquid, SB-19's hands become puddles up to 12 inches in diameter. Anything caught within them rapidly dissolves (due to a lack of visible mouth, it is implied that SB-19 consumes food and miscellaneous items with these puddles). <br />
<br />
'''Storage:''' SB-19 is to be kept within an enclosure consisting of a marble floor coated in a layer of alkaline liquid, four (4) walls made up of several layers of bulletproof glass and a steel ceiling adorn with one (1) source of light.<br />
<br />
===Angel Glyphs===<br />
<br />
This is a translation of the Angel glyphs:<br />
<br />
[[File:AngelGlyphs.png]]</div>Halke234https://wiki.gamedetectives.net/index.php?title=TheConsole/Glossary&diff=16638TheConsole/Glossary2018-07-25T20:47:35Z<p>Halke234: /* Lumitech */</p>
<hr />
<div>[[Main Page]] > [[List of Investigations]] > [[TheConsole]] > '''Glossary'''<br />
<br />
This page is a collection of terms, locations and characters from [[TheConsole |The Console]] investigation.<br />
<br />
__TOC__<br />
= Characters & Organizations =<br />
<br />
===Dr. Harvey Wells===<br />
<br />
Info as provided by The Console:<br />
<br />
<code>Employee name: Harvey Wells<br />
<br />
Accolades: D.A.S., D.C.S., D.Eng.<br />
<br />
Sex: Male <br />
<br />
Age: 49 <br />
<br />
Role: Project Overseer<br />
<br />
Completed project(s): Aether, Starfish, Precipice<br />
<br />
Pending project(s): Hive<br />
<br />
Failed project(s): [CLASSIFIED]</code><br />
<br />
<br />
Whereabouts: ''Unknown''<br />
<br />
===Irene Wells===<br />
<br />
The wife of Dr. Harvey Wells, and an apparent survivor of the Lumitech explosion. Her survival is only known by the fact that her suit's vitals were still giving off a heartbeat. As she had entered Radiance-1 for testing, she was accompanied by a contained explosion that killed numerous Lumitech staff members. Whereabouts unknown.<br />
<br />
===Louise Wells===<br />
<br />
Daughter of Harvey and Irene Wells.<br />
<br />
Born April 17, 1995. An only child, homeschooled, with average grades. She appears to have sent a distress message to her father (H. Wells) in a message hidden on the Rosen servers which Jude was able to recover. Whereabouts unknown.<br />
<br />
She was confirmed to be a major part of Project Bridge. It was never clear what her full role in the project was, but she was tested on and given doses of Sigma which was greatly affecting her personality. These personality changes were swapping Louise between herself and Caefur controlling the body.<br />
<br />
===The Console===<br />
<br />
An artificial intelligence connected to a series of consoles created by Dr. Wells at Lumitech, in May 2016.<br />
<br />
Currently residing in Lumitech site C-1.<br />
<br />
Also known as Jude.<br />
<br />
===The Blind Angel===<br />
<br />
An angel who was broken into fragments by Azoth.<br />
<br />
This was a text translated from a retrieved document:<br />
<br />
<pre>It was the dawn of humanity. From our sacred home hidden in the dusts of the departed, we watched as they flourished. And yet there was one who despised our creations. An angel without sight. They would claim that they had seen what they were capable of, warning that they were to be eradicated before our halls became stained with the bloody dusts we leave behind. <br />
<br />
They acted out and were exiled.<br />
<br />
Wings shattered, they were abandoned within the home of the humans as a mere phantom on time. We hoped they would change their mind. We were wrong<br />
<br />
The blind angel returned, a feat none have accomplished. The hatred that flowed throughout their being was enough to let them return home with vengeance, with every pile of dust left behind by our shattered bodies the more confident they became.<br />
<br />
The strongest of us became dust splattered on the pure white of our home, the cowardly fleeing. Ultimately the blind one stood before their former leader, our master azoth god. They leaped towards it, but it was no use. When they finally came to, they were about to be executed. The blind angel ushered their final words<br />
<br />
'One way or another, I will return on that day. I will wander these empty colorful walls'<br />
<br />
I saw as the fragments of their body fell, settling on the soils of the human realm. As I sit in this palace of exiles I question whether there is truth to their words.</pre><br />
<br />
===Bel===<br />
<br />
Fragment of the Blind Angel which talks through Jude on Discord.<br />
<br />
Little was known about Bel, but they appeared to be connected to Radiance-1 in some way, as they made themselves better known after Radiance-1 was revealed. Host was Jared Myers. Bel and Jared were somewhere within a undisclosed location after fleeing the US. He was the wings of the Blind Angel. Also referred to as B.<br />
<br />
===The Watcher===<br />
<br />
Fragment of the Blind Angel, he was the eyes before they were split apart.<br />
<br />
Not much was known about the Watcher except that he was using Ethan, the only survivor of the Radiance-1 explosion, as his host. Apparently, The Watcher held some form of prophecy, which players were supposed to bargain for. He wanted Radiance-1 repaired so he could get access to a "husk". Could be contacted and receive one question if you wrote his name on your hand or a mask in pen.<br />
<br />
===The Tongue===<br />
<br />
A fragment of the Blind Angel.<br />
<br />
Supposedly the most powerful fragment and didn't need someone to host its consciousness. All players knew is that it was buried after being attacked.<br />
<br />
===Caefur===<br />
<br />
A fragment of the Blind Angel.<br />
<br />
Current host was Louise Wells. Caefur was the left arm of the Blind Angel and was somewhat violent in nature. Caefur had once broken out of containment in Fort Rosner and gutted someone with her fingernails. She then escaped Fort Rosner only to be captured by Doctor Harvey Wells. Talked through Jude and her Tumblr, which is now deleted.<br />
<br />
===Ethan===<br />
<br />
Ethan was the host of The Watcher. Ethan was working on repairing Radiance-1 using the blueprints he stole from Lumitech.<br />
<br />
===Jared Myers===<br />
<br />
Hosted Bel. Former mole at Fort Rosner, ran off to an undisclosed location once Sigma testing began at Fort Rosner.<br />
<br />
===Michael Ryan===<br />
<br />
Former Rosner employee who was working on Project Hive before being killed by Caefur.<br />
<br />
===Azoth===<br />
<br />
"King" of the Angels. Banished the Blind Angel after it committed a genocide against the Angels. <br />
<br />
===Burning Man===<br />
<br />
Said to be giving "gifts" of sort. First appearance in the final act 1 video.<br />
<br />
===Lumitech===<br />
Formerly a tech company, after an employee made a discovery (probably related to Sigma) they focused on science. Currently 60 employees, prior to the events of Project Radiance (a massive explosion, which killed Irene Wells, among others) there were 102 employees. They were working with Fort Rosner on Project Hive, but have stopped responding due to technical problems-- what Judge describes as 'AI problems'.<br />
<br />
===Fort Rosner===<br />
Rosner is the designation for a department within the Nellis AFB complex. They focus on experimental weaponry, both mechanical and biological. The Console doesn't have a lot of information on them, but did provide a valid email address to reach them.<br />
<br />
= Locations =<br />
<br />
The following are locations and their respective descriptions, as provided by The Console.<br />
<br />
==Lumitech Sites==<br />
<br />
===19-Xi-Aster=== <br />
"Also known as Earth. Their main labs are located here."<br />
<br />
===42-Iota-Convallaria=== <br />
"AETHER mining and processing is conducted."<br />
<br />
"42-Iota-Convallaria was the first site to be established for AETHER mining. However, staff would go missing from time to time, several believing they were being watched."<br />
<br />
Found by Lumitech: July 23, 2015<br />
<br />
===20-Beta-Hyoscyamus===<br />
"Research on ruins and mythological texts."<br />
<br />
"20-Beta-Hyoscyamus contained numerous ruins and texts relating to a myth of a "broken angel"."<br />
<br />
Found by Lumitech: July 29, 2015<br />
<br />
===5-Kappa-Myosotis=== <br />
"Agriculture and farming tests."<br />
<br />
Found by Lumitech: November 16, 2015<br />
<br />
===64-Pi-Rafflesia=== <br />
"Weapon testing."<br />
<br />
Found by Lumitech: August 12, 2015<br />
<br />
===99-Alpha-Orchidaceae=== <br />
"Temporary hub for Lumitech staff."<br />
<br />
Found by Lumitech: August 22, 2015<br />
<br />
===C-1=== <br />
"Attempts to travel beyond the known universe."<br />
<br />
Found by Lumitech: September 19, 2015<br />
<br />
===13-Sigma-Asclepias=== <br />
<br />
"No console exists within 13-Sigma-Asclepias. It is a hostile place, forsaken."<br />
<br />
"The original plans were to use the site for AETHER mining, as it had very high readings identical to that of the [6] Failed Sites. Unlike them, however, 13-Sigma-Asclepias could be accessed."<br />
<br />
"One week after colonization, on-site staff disappeared. They were later found, but expressed frequent violent tendencies and a more animalistic demeanour."<br />
<br />
"Numerous lives were lost. Autopsies revealed large amounts of Sigma in their digestive system. Ultimately, the site was removed from the system."<br />
<br />
Found by Lumitech: October 31, 2015<br />
<br />
==Miscellaneous==<br />
<br />
===Doctor Well's House===<br />
<br />
Current location of both Louise and Doctor Harvey Wells. Doctor Harvey is currently tested on Caefur trying to bring his wife back through testing with Sigma and other things<br />
<br />
= Dr. Wells' Projects =<br />
<br />
== Completed ==<br />
<br />
===Project Aether===<br />
<br />
"Project Aether was started after a mineral radiating AETHER was discovered. Instantly, it was applied in multiple ways."<br />
<br />
===Project Starfish===<br />
<br />
"An experiment to see what AETHER's side effects were on humans. Numerous subjects grew additional organs and body parts as a result."<br />
<br />
"[19] subjects experienced negative effects, [12] of them ultimately dying."<br />
<br />
===Project Precipice===<br />
<br />
Last project Dr. Wells worked on with Lumitech. From the blog:<br />
<br />
<pre>Project Precipice: [REDACTED]-1 was designed to mimic the function of [REDACTED]-0, a manmade structure dating back several hundred years. It is believed that the creators of said structure designed it to connect with the divine. After the events of [CLASSIFIED], numerous unauthorised simulations have been run by Dr H Wells. According to his data, it would be ideal to create an exact mechanical copy of [REDACTED]-0 and create more compact versions later on.<br />
<br />
R-1: Frame is arch-like, mounted on a platform. Co-ordinates would be input via attached computer. AETHER cylinder installed in platform via hatch at back. Different amounts of AETHER is required for alternating sizes of objects/people entering and exiting, as too high an amount can have severe injuries. Decommissioned due to I Wells incident.<br />
<br />
R-2: An exact reconstruction of R-0, with dials on side being replaced by outlets feeding into a computer (which inputs co-ordinates). Testing proved successful after sending a camera feed through after numerous tests to see if R-2 could function. Land was found, later built upon to gather data and harvest more AETHER. Decommissioned due to size and energy inefficiency.<br />
<br />
R-3: A size modification of R-2, designed to take up less space and consume considerably less AETHER than its predecessor. On some occasions, there have been serious AETHER fluctuations. As a result, the next incarnation requires re-evaluating the design (as well as further improvements). Decommissioned due to risk of death.<br />
<br />
R-4: The appearance of R-1 was adopted and blended with the structure of R-0, resulting in a block-like doorway mounted on a platform. Tests show that R-4 is running as intended, no further development needed as of yet.<br />
<br />
Colonization: Numerous sites have been discovered thanks to Project Precipice. AETHER plants have been established, allowing Lumitech to utilize it however we see fit. It does, of course, mean that constant maintenance is needed. The solution? Specimen 1’s offspring. It also gave us the space and materials needed to create long-term research bases and model cities to test prototype weaponry. In fact, tests on the TD Project have yielded promising results. The staff at Fort Rosner are looking into trying to develop a way for TD-1’s wings to act as weaponry, as well as continuing to make sure it becomes everything it is designed to be: a soldier.<br />
<br />
Issues: Some co-ordinates inputted result in the R-4 system shutting down. Technically, we should be able to access these locations, meaning it’d be impossible to input a set of co-ordinates that are a dead end. Therefore, it is to be believed that an outside force is restricting R-4’s access to certain areas.</pre><br />
<br />
== In-Progress ==<br />
<br />
===Project Bridge===<br />
<br />
"Trying to form a bridge between two beings. Between man and the divine."<br />
<br />
Dr Wells is currently focused fully on this Project as he believes it can bring back his wife, Irene, somehow.<br />
<br />
== Pending ==<br />
<br />
===Project Hive===<br />
<br />
"A collaboration between Lumitech and Fort Rosner personnel to further the development of artificial intelligence, giving them bodies."<br />
<br />
"Lumitech was developing the more computer-y side of Project Hive, while FR dealt with the engineering part. I don't know how much they've built for the main body, but I do know that they've developed these weird-looking panels. They can act as wings, and collect concentrated solar energy to weaponize."<br />
<br />
== Failed ==<br />
<br />
===Project Radiance===<br />
<br />
Purpose: Manipulating Aether in order to open "doors" between points in space. Presumably a similar concept than that of "worm holes". The project details were classified after failure. <br />
<br />
''From an encrypted classified file found by solvers:''<br />
<br />
Project Radiance: Previous studies of AETHER have shown that it is capable of manipulating matter. Hypothetically, it could be used to create a “door” to a different point in space.<br />
<br />
==Radiances==<br />
===R-0===<br />
From the blog:<br />
<pre>RADIANCE-0 OFFLINE<br />
Location: [WITHHELD]<br />
Dimensions: 19m x 19m x 4m<br />
Liquid present: Kerosene (?)<br />
Age: Approx. 800 years old<br />
Last use: 1781 0952<br />
Description: A stone pool with a dial embedded on each face. It is believed from scripts that date back to the same era that RADIANCE-0 was used to summon beings from alternate realms or allow humans to enter them.<br />
Simulations of the structure indicate that the dials would be used to pinpoint co-ordinates; entering them would trigger the liquid present to ignite, hypothetically acting the same way RADIANCE-1 and future instalments do with AETHER.<br />
Notes: More recent matter was detected within RADIANCE-0’s liquid, indicating someone entered or exited the site. Tests reveal that it was human matter. Traces of SB material were found outside of R-0’s chamber.<br />
Hypothesis: [SB-D (or its offspring) originated from RADIANCE-0] [SBs are drawn to the site of RADIANCE-0]</pre><br />
<br />
Location was later found to be in Canada, hidden in a forest.<br />
<br />
===R-1===<br />
Excerpt from the blog post about project Precipice:<br />
<pre>[REDACTED]-1 was designed to mimic the function of [REDACTED]-0, a manmade structure dating back several hundred years.<br />
(presumably [REDACTED] is 'Radiance' here)<br />
...<br />
R-1: Frame is arch-like, mounted on a platform. Co-ordinates would be input via attached computer. AETHER cylinder installed in platform via hatch at back. Different amounts of AETHER is required for alternating sizes of objects/people entering and exiting, as too high an amount can have severe injuries. Decommissioned due to I Wells incident.</pre><br />
<br />
===R-2===<br />
Excerpt from the blog post about project Precipice:<br />
<pre>R-2: An exact reconstruction of R-0, with dials on side being replaced by outlets feeding into a computer (which inputs co-ordinates). Testing proved successful after sending a camera feed through after numerous tests to see if R-2 could function. Land was found, later built upon to gather data and harvest more AETHER. Decommissioned due to size and energy inefficiency.</pre><br />
<br />
===R-3===<br />
Excerpt from the blog post about project Precipice:<br />
<pre>R-3: A size modification of R-2, designed to take up less space and consume considerably less AETHER than its predecessor. On some occasions, there have been serious AETHER fluctuations. As a result, the next incarnation requires re-evaluating the design (as well as further improvements). Decommissioned due to risk of death.</pre><br />
<br />
===R-4===<br />
Excerpt from the blog post about project Precipice:<br />
<pre>R-4: The appearance of R-1 was adopted and blended with the structure of R-0, resulting in a block-like doorway mounted on a platform. Tests show that R-4 is running as intended, no further development needed as of yet.<br />
...<br />
Issues: Some co-ordinates inputted result in the R-4 system shutting down. Technically, we should be able to access these locations, meaning it’d be impossible to input a set of co-ordinates that are a dead end. Therefore, it is to be believed that an outside force is restricting R-4’s access to certain areas.</pre><br />
<br />
= Miscellaneous =<br />
<br />
===AETHER===<br />
<br />
"AETHER is a naturally-found energy that can be applied in numerous ways. It can transmute. It can replace electricity. It can be used on humans and animals. It's properties are quite flexible."<br />
<br />
===Sigma Beasts===<br />
<br />
"Sigma Beasts are entities composed of an unidentifiable biological substance (dubbed Sigma), and originate from a singular source. Their forms and properties vary for each individual SB."<br />
<br />
The presumed creator of all Sigma Beasts is known as Sigma Beast Discord. Post [https://theconsole.tumblr.com/post/158712892139/22317-1954| 27217 0826] says as follows:<br />
<pre><br />
SB-D located within close proximity<br />
Description: (N/A). Stature is always humanoid, appearance changes.<br />
Notes: SB-D is the presumed creator of all SBs. Data readings show that the entity produces more energy than its creations, and that there can be multiple instances of it. <br />
Containment is unlikely.<br />
Sightings<br />
15716 1744: Figure seen at site prior to origin of SB.<br />
23716 0928: Figure of same description seen spewing black substance confirmed to be composed of the same material as the SB.<br />
9816 1241: SB-3 found, figure allegedly seen sinking into shallow pool of substance.<br />
30117 0855: Figure is confirmed to be SB-D post-scan. Remains of missing persons found in substance nearby site.<br />
</pre><br />
<br />
SB-D is also the one responsible for the explosion of Radiance-1 and frying C-1's CPU.<br />
<br />
The known Sigma Beasts are:<br />
<br />
====SB-1====<br />
<br />
'''Description:''' A wolf approximately 4 feet tall, consisting of unknown black waste and minor amounts of identical red waste for eyes (8). A clock is embedded in its tail, extra eyes located on the chest and centrepiece of the clock. <br />
<br />
'''Notes:''' Exposing SB-1 to cold temperatures yields no results. Fire is absorbed into the body of SB-1. Spraying with water produces smoke, and often results in body mass deterioration. <br />
<br />
'''Storage:''' SB-1 is to be kept within an enclosure consisting of a steel floor, four (4) walls made up of several layers of glass and a steel ceiling adorn with one (1) source of light.<br />
<br />
====SB-3====<br />
<br />
'''Description:''' A skull 2.3x larger than an average adult male skull, Sigma oozing from its mouth. Two red eyes are located inside of the sockets, a clock face embedded on its forehead.<br />
<br />
'''Notes:''' Sigma produced from its mouth can be warped into appendages, allowing it to move freely and attack any entity that corners it. If placed 5 metres away from its origin, the Sigma loses its properties, allowing it to be used for experimentation.<br />
<br />
'''Storage:''' SB-3 is to be kept within a 5x5x5m container with a shatter-resistant glass ceiling, (4) layered steel walls and a steel floor with (4) drains leading to an area some distance away for storing canisters with Sigma ready for testing purposes.<br />
<br />
'''Security:''' Under no circumstances is SB-3 permitted to be removed from its container.<br />
<br />
====SB-7====<br />
<br />
'''Description:''' A malnourished humanoid entity approximately 7 feet high. Has large bulbous red eyes that lock onto target, even when targeted personnel are not in the same room or building. Small clock face is located on body of sternum. <br />
<br />
'''Notes:''' SB-7's presence triggers intense fear response for target(s). Survivors of said trauma report having their oldest and innermost fears subjected to them. Its body, despite being composed of the same material, produces a foul odor, the entity's presence reducing the temperature of confined spaces by at least 5° C. <br />
<br />
'''Storage:''' SB-7 is to be kept within an enclosure consisting of a stone floor, three (3) walls made up of several layers of bulletproof glass, one (1) wall made of steel and equipped with ventilation, and a steel ceiling adorn with one (1) source of light. <br />
<br />
'''Security:''' Personnel handling SB-7 are to enter its chamber wearing hazmat suits (complete with respirators) and wielding stun batons. No fewer than three (3) people are to be in SB-7's chamber at a time.<br />
<br />
====SB-19====<br />
<br />
'''Description:''' A large humanoid creature composed of unknown black substance, large red eye located on centre of face. Small clock faces are embedded on the backs of its gargantuan hands. <br />
<br />
'''Notes:''' SB-19'S solidity is inconsistent at times; while the body is constantly solid mass, its hands alter between solid and liquid state. When solid, a single punch is fully capable of obliterating up to 3 layers of brick wall. While liquid, SB-19's hands become puddles up to 12 inches in diameter. Anything caught within them rapidly dissolves (due to a lack of visible mouth, it is implied that SB-19 consumes food and miscellaneous items with these puddles). <br />
<br />
'''Storage:''' SB-19 is to be kept within an enclosure consisting of a marble floor coated in a layer of alkaline liquid, four (4) walls made up of several layers of bulletproof glass and a steel ceiling adorn with one (1) source of light.<br />
<br />
===Angel Glyphs===<br />
<br />
This is a translation of the Angel glyphs:<br />
<br />
[[File:AngelGlyphs.png]]</div>Halke234https://wiki.gamedetectives.net/index.php?title=TheConsole/Glossary&diff=16637TheConsole/Glossary2018-07-25T20:46:59Z<p>Halke234: /* Michael Ryan */</p>
<hr />
<div>[[Main Page]] > [[List of Investigations]] > [[TheConsole]] > '''Glossary'''<br />
<br />
This page is a collection of terms, locations and characters from [[TheConsole |The Console]] investigation.<br />
<br />
__TOC__<br />
= Characters & Organizations =<br />
<br />
===Dr. Harvey Wells===<br />
<br />
Info as provided by The Console:<br />
<br />
<code>Employee name: Harvey Wells<br />
<br />
Accolades: D.A.S., D.C.S., D.Eng.<br />
<br />
Sex: Male <br />
<br />
Age: 49 <br />
<br />
Role: Project Overseer<br />
<br />
Completed project(s): Aether, Starfish, Precipice<br />
<br />
Pending project(s): Hive<br />
<br />
Failed project(s): [CLASSIFIED]</code><br />
<br />
<br />
Whereabouts: ''Unknown''<br />
<br />
===Irene Wells===<br />
<br />
The wife of Dr. Harvey Wells, and an apparent survivor of the Lumitech explosion. Her survival is only known by the fact that her suit's vitals were still giving off a heartbeat. As she had entered Radiance-1 for testing, she was accompanied by a contained explosion that killed numerous Lumitech staff members. Whereabouts unknown.<br />
<br />
===Louise Wells===<br />
<br />
Daughter of Harvey and Irene Wells.<br />
<br />
Born April 17, 1995. An only child, homeschooled, with average grades. She appears to have sent a distress message to her father (H. Wells) in a message hidden on the Rosen servers which Jude was able to recover. Whereabouts unknown.<br />
<br />
She was confirmed to be a major part of Project Bridge. It was never clear what her full role in the project was, but she was tested on and given doses of Sigma which was greatly affecting her personality. These personality changes were swapping Louise between herself and Caefur controlling the body.<br />
<br />
===The Console===<br />
<br />
An artificial intelligence connected to a series of consoles created by Dr. Wells at Lumitech, in May 2016.<br />
<br />
Currently residing in Lumitech site C-1.<br />
<br />
Also known as Jude.<br />
<br />
===The Blind Angel===<br />
<br />
An angel who was broken into fragments by Azoth.<br />
<br />
This was a text translated from a retrieved document:<br />
<br />
<pre>It was the dawn of humanity. From our sacred home hidden in the dusts of the departed, we watched as they flourished. And yet there was one who despised our creations. An angel without sight. They would claim that they had seen what they were capable of, warning that they were to be eradicated before our halls became stained with the bloody dusts we leave behind. <br />
<br />
They acted out and were exiled.<br />
<br />
Wings shattered, they were abandoned within the home of the humans as a mere phantom on time. We hoped they would change their mind. We were wrong<br />
<br />
The blind angel returned, a feat none have accomplished. The hatred that flowed throughout their being was enough to let them return home with vengeance, with every pile of dust left behind by our shattered bodies the more confident they became.<br />
<br />
The strongest of us became dust splattered on the pure white of our home, the cowardly fleeing. Ultimately the blind one stood before their former leader, our master azoth god. They leaped towards it, but it was no use. When they finally came to, they were about to be executed. The blind angel ushered their final words<br />
<br />
'One way or another, I will return on that day. I will wander these empty colorful walls'<br />
<br />
I saw as the fragments of their body fell, settling on the soils of the human realm. As I sit in this palace of exiles I question whether there is truth to their words.</pre><br />
<br />
===Bel===<br />
<br />
Fragment of the Blind Angel which talks through Jude on Discord.<br />
<br />
Little was known about Bel, but they appeared to be connected to Radiance-1 in some way, as they made themselves better known after Radiance-1 was revealed. Host was Jared Myers. Bel and Jared were somewhere within a undisclosed location after fleeing the US. He was the wings of the Blind Angel. Also referred to as B.<br />
<br />
===The Watcher===<br />
<br />
Fragment of the Blind Angel, he was the eyes before they were split apart.<br />
<br />
Not much was known about the Watcher except that he was using Ethan, the only survivor of the Radiance-1 explosion, as his host. Apparently, The Watcher held some form of prophecy, which players were supposed to bargain for. He wanted Radiance-1 repaired so he could get access to a "husk". Could be contacted and receive one question if you wrote his name on your hand or a mask in pen.<br />
<br />
===The Tongue===<br />
<br />
A fragment of the Blind Angel.<br />
<br />
Supposedly the most powerful fragment and didn't need someone to host its consciousness. All players knew is that it was buried after being attacked.<br />
<br />
===Caefur===<br />
<br />
A fragment of the Blind Angel.<br />
<br />
Current host was Louise Wells. Caefur was the left arm of the Blind Angel and was somewhat violent in nature. Caefur had once broken out of containment in Fort Rosner and gutted someone with her fingernails. She then escaped Fort Rosner only to be captured by Doctor Harvey Wells. Talked through Jude and her Tumblr, which is now deleted.<br />
<br />
===Ethan===<br />
<br />
Ethan was the host of The Watcher. Ethan was working on repairing Radiance-1 using the blueprints he stole from Lumitech.<br />
<br />
===Jared Myers===<br />
<br />
Hosted Bel. Former mole at Fort Rosner, ran off to an undisclosed location once Sigma testing began at Fort Rosner.<br />
<br />
===Michael Ryan===<br />
<br />
Former Rosner employee who was working on Project Hive before being killed by Caefur.<br />
<br />
===Azoth===<br />
<br />
"King" of the Angels. Banished the Blind Angel after it committed a genocide against the Angels. <br />
<br />
===Burning Man===<br />
<br />
Said to be giving "gifts" of sort. First appearance in the final act 1 video.<br />
<br />
===Lumitech===<br />
Formerly a tech company, after an employee made a discovery (probably related to Sigma) they focused on science. Currently 60 employees, prior to the events of Project Radiance (a massive explosion, which killed Irene Wells among others) there were 102 employees. They're working with Fort Rosner on Project Hive, but have stopped responding due to technical problems-- what Judge describes as 'AI problems'.<br />
<br />
===Fort Rosner===<br />
Rosner is the designation for a department within the Nellis AFB complex. They focus on experimental weaponry, both mechanical and biological. The Console doesn't have a lot of information on them, but did provide a valid email address to reach them.<br />
<br />
= Locations =<br />
<br />
The following are locations and their respective descriptions, as provided by The Console.<br />
<br />
==Lumitech Sites==<br />
<br />
===19-Xi-Aster=== <br />
"Also known as Earth. Their main labs are located here."<br />
<br />
===42-Iota-Convallaria=== <br />
"AETHER mining and processing is conducted."<br />
<br />
"42-Iota-Convallaria was the first site to be established for AETHER mining. However, staff would go missing from time to time, several believing they were being watched."<br />
<br />
Found by Lumitech: July 23, 2015<br />
<br />
===20-Beta-Hyoscyamus===<br />
"Research on ruins and mythological texts."<br />
<br />
"20-Beta-Hyoscyamus contained numerous ruins and texts relating to a myth of a "broken angel"."<br />
<br />
Found by Lumitech: July 29, 2015<br />
<br />
===5-Kappa-Myosotis=== <br />
"Agriculture and farming tests."<br />
<br />
Found by Lumitech: November 16, 2015<br />
<br />
===64-Pi-Rafflesia=== <br />
"Weapon testing."<br />
<br />
Found by Lumitech: August 12, 2015<br />
<br />
===99-Alpha-Orchidaceae=== <br />
"Temporary hub for Lumitech staff."<br />
<br />
Found by Lumitech: August 22, 2015<br />
<br />
===C-1=== <br />
"Attempts to travel beyond the known universe."<br />
<br />
Found by Lumitech: September 19, 2015<br />
<br />
===13-Sigma-Asclepias=== <br />
<br />
"No console exists within 13-Sigma-Asclepias. It is a hostile place, forsaken."<br />
<br />
"The original plans were to use the site for AETHER mining, as it had very high readings identical to that of the [6] Failed Sites. Unlike them, however, 13-Sigma-Asclepias could be accessed."<br />
<br />
"One week after colonization, on-site staff disappeared. They were later found, but expressed frequent violent tendencies and a more animalistic demeanour."<br />
<br />
"Numerous lives were lost. Autopsies revealed large amounts of Sigma in their digestive system. Ultimately, the site was removed from the system."<br />
<br />
Found by Lumitech: October 31, 2015<br />
<br />
==Miscellaneous==<br />
<br />
===Doctor Well's House===<br />
<br />
Current location of both Louise and Doctor Harvey Wells. Doctor Harvey is currently tested on Caefur trying to bring his wife back through testing with Sigma and other things<br />
<br />
= Dr. Wells' Projects =<br />
<br />
== Completed ==<br />
<br />
===Project Aether===<br />
<br />
"Project Aether was started after a mineral radiating AETHER was discovered. Instantly, it was applied in multiple ways."<br />
<br />
===Project Starfish===<br />
<br />
"An experiment to see what AETHER's side effects were on humans. Numerous subjects grew additional organs and body parts as a result."<br />
<br />
"[19] subjects experienced negative effects, [12] of them ultimately dying."<br />
<br />
===Project Precipice===<br />
<br />
Last project Dr. Wells worked on with Lumitech. From the blog:<br />
<br />
<pre>Project Precipice: [REDACTED]-1 was designed to mimic the function of [REDACTED]-0, a manmade structure dating back several hundred years. It is believed that the creators of said structure designed it to connect with the divine. After the events of [CLASSIFIED], numerous unauthorised simulations have been run by Dr H Wells. According to his data, it would be ideal to create an exact mechanical copy of [REDACTED]-0 and create more compact versions later on.<br />
<br />
R-1: Frame is arch-like, mounted on a platform. Co-ordinates would be input via attached computer. AETHER cylinder installed in platform via hatch at back. Different amounts of AETHER is required for alternating sizes of objects/people entering and exiting, as too high an amount can have severe injuries. Decommissioned due to I Wells incident.<br />
<br />
R-2: An exact reconstruction of R-0, with dials on side being replaced by outlets feeding into a computer (which inputs co-ordinates). Testing proved successful after sending a camera feed through after numerous tests to see if R-2 could function. Land was found, later built upon to gather data and harvest more AETHER. Decommissioned due to size and energy inefficiency.<br />
<br />
R-3: A size modification of R-2, designed to take up less space and consume considerably less AETHER than its predecessor. On some occasions, there have been serious AETHER fluctuations. As a result, the next incarnation requires re-evaluating the design (as well as further improvements). Decommissioned due to risk of death.<br />
<br />
R-4: The appearance of R-1 was adopted and blended with the structure of R-0, resulting in a block-like doorway mounted on a platform. Tests show that R-4 is running as intended, no further development needed as of yet.<br />
<br />
Colonization: Numerous sites have been discovered thanks to Project Precipice. AETHER plants have been established, allowing Lumitech to utilize it however we see fit. It does, of course, mean that constant maintenance is needed. The solution? Specimen 1’s offspring. It also gave us the space and materials needed to create long-term research bases and model cities to test prototype weaponry. In fact, tests on the TD Project have yielded promising results. The staff at Fort Rosner are looking into trying to develop a way for TD-1’s wings to act as weaponry, as well as continuing to make sure it becomes everything it is designed to be: a soldier.<br />
<br />
Issues: Some co-ordinates inputted result in the R-4 system shutting down. Technically, we should be able to access these locations, meaning it’d be impossible to input a set of co-ordinates that are a dead end. Therefore, it is to be believed that an outside force is restricting R-4’s access to certain areas.</pre><br />
<br />
== In-Progress ==<br />
<br />
===Project Bridge===<br />
<br />
"Trying to form a bridge between two beings. Between man and the divine."<br />
<br />
Dr Wells is currently focused fully on this Project as he believes it can bring back his wife, Irene, somehow.<br />
<br />
== Pending ==<br />
<br />
===Project Hive===<br />
<br />
"A collaboration between Lumitech and Fort Rosner personnel to further the development of artificial intelligence, giving them bodies."<br />
<br />
"Lumitech was developing the more computer-y side of Project Hive, while FR dealt with the engineering part. I don't know how much they've built for the main body, but I do know that they've developed these weird-looking panels. They can act as wings, and collect concentrated solar energy to weaponize."<br />
<br />
== Failed ==<br />
<br />
===Project Radiance===<br />
<br />
Purpose: Manipulating Aether in order to open "doors" between points in space. Presumably a similar concept than that of "worm holes". The project details were classified after failure. <br />
<br />
''From an encrypted classified file found by solvers:''<br />
<br />
Project Radiance: Previous studies of AETHER have shown that it is capable of manipulating matter. Hypothetically, it could be used to create a “door” to a different point in space.<br />
<br />
==Radiances==<br />
===R-0===<br />
From the blog:<br />
<pre>RADIANCE-0 OFFLINE<br />
Location: [WITHHELD]<br />
Dimensions: 19m x 19m x 4m<br />
Liquid present: Kerosene (?)<br />
Age: Approx. 800 years old<br />
Last use: 1781 0952<br />
Description: A stone pool with a dial embedded on each face. It is believed from scripts that date back to the same era that RADIANCE-0 was used to summon beings from alternate realms or allow humans to enter them.<br />
Simulations of the structure indicate that the dials would be used to pinpoint co-ordinates; entering them would trigger the liquid present to ignite, hypothetically acting the same way RADIANCE-1 and future instalments do with AETHER.<br />
Notes: More recent matter was detected within RADIANCE-0’s liquid, indicating someone entered or exited the site. Tests reveal that it was human matter. Traces of SB material were found outside of R-0’s chamber.<br />
Hypothesis: [SB-D (or its offspring) originated from RADIANCE-0] [SBs are drawn to the site of RADIANCE-0]</pre><br />
<br />
Location was later found to be in Canada, hidden in a forest.<br />
<br />
===R-1===<br />
Excerpt from the blog post about project Precipice:<br />
<pre>[REDACTED]-1 was designed to mimic the function of [REDACTED]-0, a manmade structure dating back several hundred years.<br />
(presumably [REDACTED] is 'Radiance' here)<br />
...<br />
R-1: Frame is arch-like, mounted on a platform. Co-ordinates would be input via attached computer. AETHER cylinder installed in platform via hatch at back. Different amounts of AETHER is required for alternating sizes of objects/people entering and exiting, as too high an amount can have severe injuries. Decommissioned due to I Wells incident.</pre><br />
<br />
===R-2===<br />
Excerpt from the blog post about project Precipice:<br />
<pre>R-2: An exact reconstruction of R-0, with dials on side being replaced by outlets feeding into a computer (which inputs co-ordinates). Testing proved successful after sending a camera feed through after numerous tests to see if R-2 could function. Land was found, later built upon to gather data and harvest more AETHER. Decommissioned due to size and energy inefficiency.</pre><br />
<br />
===R-3===<br />
Excerpt from the blog post about project Precipice:<br />
<pre>R-3: A size modification of R-2, designed to take up less space and consume considerably less AETHER than its predecessor. On some occasions, there have been serious AETHER fluctuations. As a result, the next incarnation requires re-evaluating the design (as well as further improvements). Decommissioned due to risk of death.</pre><br />
<br />
===R-4===<br />
Excerpt from the blog post about project Precipice:<br />
<pre>R-4: The appearance of R-1 was adopted and blended with the structure of R-0, resulting in a block-like doorway mounted on a platform. Tests show that R-4 is running as intended, no further development needed as of yet.<br />
...<br />
Issues: Some co-ordinates inputted result in the R-4 system shutting down. Technically, we should be able to access these locations, meaning it’d be impossible to input a set of co-ordinates that are a dead end. Therefore, it is to be believed that an outside force is restricting R-4’s access to certain areas.</pre><br />
<br />
= Miscellaneous =<br />
<br />
===AETHER===<br />
<br />
"AETHER is a naturally-found energy that can be applied in numerous ways. It can transmute. It can replace electricity. It can be used on humans and animals. It's properties are quite flexible."<br />
<br />
===Sigma Beasts===<br />
<br />
"Sigma Beasts are entities composed of an unidentifiable biological substance (dubbed Sigma), and originate from a singular source. Their forms and properties vary for each individual SB."<br />
<br />
The presumed creator of all Sigma Beasts is known as Sigma Beast Discord. Post [https://theconsole.tumblr.com/post/158712892139/22317-1954| 27217 0826] says as follows:<br />
<pre><br />
SB-D located within close proximity<br />
Description: (N/A). Stature is always humanoid, appearance changes.<br />
Notes: SB-D is the presumed creator of all SBs. Data readings show that the entity produces more energy than its creations, and that there can be multiple instances of it. <br />
Containment is unlikely.<br />
Sightings<br />
15716 1744: Figure seen at site prior to origin of SB.<br />
23716 0928: Figure of same description seen spewing black substance confirmed to be composed of the same material as the SB.<br />
9816 1241: SB-3 found, figure allegedly seen sinking into shallow pool of substance.<br />
30117 0855: Figure is confirmed to be SB-D post-scan. Remains of missing persons found in substance nearby site.<br />
</pre><br />
<br />
SB-D is also the one responsible for the explosion of Radiance-1 and frying C-1's CPU.<br />
<br />
The known Sigma Beasts are:<br />
<br />
====SB-1====<br />
<br />
'''Description:''' A wolf approximately 4 feet tall, consisting of unknown black waste and minor amounts of identical red waste for eyes (8). A clock is embedded in its tail, extra eyes located on the chest and centrepiece of the clock. <br />
<br />
'''Notes:''' Exposing SB-1 to cold temperatures yields no results. Fire is absorbed into the body of SB-1. Spraying with water produces smoke, and often results in body mass deterioration. <br />
<br />
'''Storage:''' SB-1 is to be kept within an enclosure consisting of a steel floor, four (4) walls made up of several layers of glass and a steel ceiling adorn with one (1) source of light.<br />
<br />
====SB-3====<br />
<br />
'''Description:''' A skull 2.3x larger than an average adult male skull, Sigma oozing from its mouth. Two red eyes are located inside of the sockets, a clock face embedded on its forehead.<br />
<br />
'''Notes:''' Sigma produced from its mouth can be warped into appendages, allowing it to move freely and attack any entity that corners it. If placed 5 metres away from its origin, the Sigma loses its properties, allowing it to be used for experimentation.<br />
<br />
'''Storage:''' SB-3 is to be kept within a 5x5x5m container with a shatter-resistant glass ceiling, (4) layered steel walls and a steel floor with (4) drains leading to an area some distance away for storing canisters with Sigma ready for testing purposes.<br />
<br />
'''Security:''' Under no circumstances is SB-3 permitted to be removed from its container.<br />
<br />
====SB-7====<br />
<br />
'''Description:''' A malnourished humanoid entity approximately 7 feet high. Has large bulbous red eyes that lock onto target, even when targeted personnel are not in the same room or building. Small clock face is located on body of sternum. <br />
<br />
'''Notes:''' SB-7's presence triggers intense fear response for target(s). Survivors of said trauma report having their oldest and innermost fears subjected to them. Its body, despite being composed of the same material, produces a foul odor, the entity's presence reducing the temperature of confined spaces by at least 5° C. <br />
<br />
'''Storage:''' SB-7 is to be kept within an enclosure consisting of a stone floor, three (3) walls made up of several layers of bulletproof glass, one (1) wall made of steel and equipped with ventilation, and a steel ceiling adorn with one (1) source of light. <br />
<br />
'''Security:''' Personnel handling SB-7 are to enter its chamber wearing hazmat suits (complete with respirators) and wielding stun batons. No fewer than three (3) people are to be in SB-7's chamber at a time.<br />
<br />
====SB-19====<br />
<br />
'''Description:''' A large humanoid creature composed of unknown black substance, large red eye located on centre of face. Small clock faces are embedded on the backs of its gargantuan hands. <br />
<br />
'''Notes:''' SB-19'S solidity is inconsistent at times; while the body is constantly solid mass, its hands alter between solid and liquid state. When solid, a single punch is fully capable of obliterating up to 3 layers of brick wall. While liquid, SB-19's hands become puddles up to 12 inches in diameter. Anything caught within them rapidly dissolves (due to a lack of visible mouth, it is implied that SB-19 consumes food and miscellaneous items with these puddles). <br />
<br />
'''Storage:''' SB-19 is to be kept within an enclosure consisting of a marble floor coated in a layer of alkaline liquid, four (4) walls made up of several layers of bulletproof glass and a steel ceiling adorn with one (1) source of light.<br />
<br />
===Angel Glyphs===<br />
<br />
This is a translation of the Angel glyphs:<br />
<br />
[[File:AngelGlyphs.png]]</div>Halke234https://wiki.gamedetectives.net/index.php?title=TheConsole/Glossary&diff=16636TheConsole/Glossary2018-07-25T20:46:16Z<p>Halke234: /* Jared Myers */</p>
<hr />
<div>[[Main Page]] > [[List of Investigations]] > [[TheConsole]] > '''Glossary'''<br />
<br />
This page is a collection of terms, locations and characters from [[TheConsole |The Console]] investigation.<br />
<br />
__TOC__<br />
= Characters & Organizations =<br />
<br />
===Dr. Harvey Wells===<br />
<br />
Info as provided by The Console:<br />
<br />
<code>Employee name: Harvey Wells<br />
<br />
Accolades: D.A.S., D.C.S., D.Eng.<br />
<br />
Sex: Male <br />
<br />
Age: 49 <br />
<br />
Role: Project Overseer<br />
<br />
Completed project(s): Aether, Starfish, Precipice<br />
<br />
Pending project(s): Hive<br />
<br />
Failed project(s): [CLASSIFIED]</code><br />
<br />
<br />
Whereabouts: ''Unknown''<br />
<br />
===Irene Wells===<br />
<br />
The wife of Dr. Harvey Wells, and an apparent survivor of the Lumitech explosion. Her survival is only known by the fact that her suit's vitals were still giving off a heartbeat. As she had entered Radiance-1 for testing, she was accompanied by a contained explosion that killed numerous Lumitech staff members. Whereabouts unknown.<br />
<br />
===Louise Wells===<br />
<br />
Daughter of Harvey and Irene Wells.<br />
<br />
Born April 17, 1995. An only child, homeschooled, with average grades. She appears to have sent a distress message to her father (H. Wells) in a message hidden on the Rosen servers which Jude was able to recover. Whereabouts unknown.<br />
<br />
She was confirmed to be a major part of Project Bridge. It was never clear what her full role in the project was, but she was tested on and given doses of Sigma which was greatly affecting her personality. These personality changes were swapping Louise between herself and Caefur controlling the body.<br />
<br />
===The Console===<br />
<br />
An artificial intelligence connected to a series of consoles created by Dr. Wells at Lumitech, in May 2016.<br />
<br />
Currently residing in Lumitech site C-1.<br />
<br />
Also known as Jude.<br />
<br />
===The Blind Angel===<br />
<br />
An angel who was broken into fragments by Azoth.<br />
<br />
This was a text translated from a retrieved document:<br />
<br />
<pre>It was the dawn of humanity. From our sacred home hidden in the dusts of the departed, we watched as they flourished. And yet there was one who despised our creations. An angel without sight. They would claim that they had seen what they were capable of, warning that they were to be eradicated before our halls became stained with the bloody dusts we leave behind. <br />
<br />
They acted out and were exiled.<br />
<br />
Wings shattered, they were abandoned within the home of the humans as a mere phantom on time. We hoped they would change their mind. We were wrong<br />
<br />
The blind angel returned, a feat none have accomplished. The hatred that flowed throughout their being was enough to let them return home with vengeance, with every pile of dust left behind by our shattered bodies the more confident they became.<br />
<br />
The strongest of us became dust splattered on the pure white of our home, the cowardly fleeing. Ultimately the blind one stood before their former leader, our master azoth god. They leaped towards it, but it was no use. When they finally came to, they were about to be executed. The blind angel ushered their final words<br />
<br />
'One way or another, I will return on that day. I will wander these empty colorful walls'<br />
<br />
I saw as the fragments of their body fell, settling on the soils of the human realm. As I sit in this palace of exiles I question whether there is truth to their words.</pre><br />
<br />
===Bel===<br />
<br />
Fragment of the Blind Angel which talks through Jude on Discord.<br />
<br />
Little was known about Bel, but they appeared to be connected to Radiance-1 in some way, as they made themselves better known after Radiance-1 was revealed. Host was Jared Myers. Bel and Jared were somewhere within a undisclosed location after fleeing the US. He was the wings of the Blind Angel. Also referred to as B.<br />
<br />
===The Watcher===<br />
<br />
Fragment of the Blind Angel, he was the eyes before they were split apart.<br />
<br />
Not much was known about the Watcher except that he was using Ethan, the only survivor of the Radiance-1 explosion, as his host. Apparently, The Watcher held some form of prophecy, which players were supposed to bargain for. He wanted Radiance-1 repaired so he could get access to a "husk". Could be contacted and receive one question if you wrote his name on your hand or a mask in pen.<br />
<br />
===The Tongue===<br />
<br />
A fragment of the Blind Angel.<br />
<br />
Supposedly the most powerful fragment and didn't need someone to host its consciousness. All players knew is that it was buried after being attacked.<br />
<br />
===Caefur===<br />
<br />
A fragment of the Blind Angel.<br />
<br />
Current host was Louise Wells. Caefur was the left arm of the Blind Angel and was somewhat violent in nature. Caefur had once broken out of containment in Fort Rosner and gutted someone with her fingernails. She then escaped Fort Rosner only to be captured by Doctor Harvey Wells. Talked through Jude and her Tumblr, which is now deleted.<br />
<br />
===Ethan===<br />
<br />
Ethan was the host of The Watcher. Ethan was working on repairing Radiance-1 using the blueprints he stole from Lumitech.<br />
<br />
===Jared Myers===<br />
<br />
Hosted Bel. Former mole at Fort Rosner, ran off to an undisclosed location once Sigma testing began at Fort Rosner.<br />
<br />
===Michael Ryan===<br />
<br />
Former Rosner employee who was working on Project Hive before his death by the hands of Caefur.<br />
<br />
===Azoth===<br />
<br />
"King" of the Angels. Banished the Blind Angel after it committed a genocide against the Angels. <br />
<br />
===Burning Man===<br />
<br />
Said to be giving "gifts" of sort. First appearance in the final act 1 video.<br />
<br />
===Lumitech===<br />
Formerly a tech company, after an employee made a discovery (probably related to Sigma) they focused on science. Currently 60 employees, prior to the events of Project Radiance (a massive explosion, which killed Irene Wells among others) there were 102 employees. They're working with Fort Rosner on Project Hive, but have stopped responding due to technical problems-- what Judge describes as 'AI problems'.<br />
<br />
===Fort Rosner===<br />
Rosner is the designation for a department within the Nellis AFB complex. They focus on experimental weaponry, both mechanical and biological. The Console doesn't have a lot of information on them, but did provide a valid email address to reach them.<br />
<br />
= Locations =<br />
<br />
The following are locations and their respective descriptions, as provided by The Console.<br />
<br />
==Lumitech Sites==<br />
<br />
===19-Xi-Aster=== <br />
"Also known as Earth. Their main labs are located here."<br />
<br />
===42-Iota-Convallaria=== <br />
"AETHER mining and processing is conducted."<br />
<br />
"42-Iota-Convallaria was the first site to be established for AETHER mining. However, staff would go missing from time to time, several believing they were being watched."<br />
<br />
Found by Lumitech: July 23, 2015<br />
<br />
===20-Beta-Hyoscyamus===<br />
"Research on ruins and mythological texts."<br />
<br />
"20-Beta-Hyoscyamus contained numerous ruins and texts relating to a myth of a "broken angel"."<br />
<br />
Found by Lumitech: July 29, 2015<br />
<br />
===5-Kappa-Myosotis=== <br />
"Agriculture and farming tests."<br />
<br />
Found by Lumitech: November 16, 2015<br />
<br />
===64-Pi-Rafflesia=== <br />
"Weapon testing."<br />
<br />
Found by Lumitech: August 12, 2015<br />
<br />
===99-Alpha-Orchidaceae=== <br />
"Temporary hub for Lumitech staff."<br />
<br />
Found by Lumitech: August 22, 2015<br />
<br />
===C-1=== <br />
"Attempts to travel beyond the known universe."<br />
<br />
Found by Lumitech: September 19, 2015<br />
<br />
===13-Sigma-Asclepias=== <br />
<br />
"No console exists within 13-Sigma-Asclepias. It is a hostile place, forsaken."<br />
<br />
"The original plans were to use the site for AETHER mining, as it had very high readings identical to that of the [6] Failed Sites. Unlike them, however, 13-Sigma-Asclepias could be accessed."<br />
<br />
"One week after colonization, on-site staff disappeared. They were later found, but expressed frequent violent tendencies and a more animalistic demeanour."<br />
<br />
"Numerous lives were lost. Autopsies revealed large amounts of Sigma in their digestive system. Ultimately, the site was removed from the system."<br />
<br />
Found by Lumitech: October 31, 2015<br />
<br />
==Miscellaneous==<br />
<br />
===Doctor Well's House===<br />
<br />
Current location of both Louise and Doctor Harvey Wells. Doctor Harvey is currently tested on Caefur trying to bring his wife back through testing with Sigma and other things<br />
<br />
= Dr. Wells' Projects =<br />
<br />
== Completed ==<br />
<br />
===Project Aether===<br />
<br />
"Project Aether was started after a mineral radiating AETHER was discovered. Instantly, it was applied in multiple ways."<br />
<br />
===Project Starfish===<br />
<br />
"An experiment to see what AETHER's side effects were on humans. Numerous subjects grew additional organs and body parts as a result."<br />
<br />
"[19] subjects experienced negative effects, [12] of them ultimately dying."<br />
<br />
===Project Precipice===<br />
<br />
Last project Dr. Wells worked on with Lumitech. From the blog:<br />
<br />
<pre>Project Precipice: [REDACTED]-1 was designed to mimic the function of [REDACTED]-0, a manmade structure dating back several hundred years. It is believed that the creators of said structure designed it to connect with the divine. After the events of [CLASSIFIED], numerous unauthorised simulations have been run by Dr H Wells. According to his data, it would be ideal to create an exact mechanical copy of [REDACTED]-0 and create more compact versions later on.<br />
<br />
R-1: Frame is arch-like, mounted on a platform. Co-ordinates would be input via attached computer. AETHER cylinder installed in platform via hatch at back. Different amounts of AETHER is required for alternating sizes of objects/people entering and exiting, as too high an amount can have severe injuries. Decommissioned due to I Wells incident.<br />
<br />
R-2: An exact reconstruction of R-0, with dials on side being replaced by outlets feeding into a computer (which inputs co-ordinates). Testing proved successful after sending a camera feed through after numerous tests to see if R-2 could function. Land was found, later built upon to gather data and harvest more AETHER. Decommissioned due to size and energy inefficiency.<br />
<br />
R-3: A size modification of R-2, designed to take up less space and consume considerably less AETHER than its predecessor. On some occasions, there have been serious AETHER fluctuations. As a result, the next incarnation requires re-evaluating the design (as well as further improvements). Decommissioned due to risk of death.<br />
<br />
R-4: The appearance of R-1 was adopted and blended with the structure of R-0, resulting in a block-like doorway mounted on a platform. Tests show that R-4 is running as intended, no further development needed as of yet.<br />
<br />
Colonization: Numerous sites have been discovered thanks to Project Precipice. AETHER plants have been established, allowing Lumitech to utilize it however we see fit. It does, of course, mean that constant maintenance is needed. The solution? Specimen 1’s offspring. It also gave us the space and materials needed to create long-term research bases and model cities to test prototype weaponry. In fact, tests on the TD Project have yielded promising results. The staff at Fort Rosner are looking into trying to develop a way for TD-1’s wings to act as weaponry, as well as continuing to make sure it becomes everything it is designed to be: a soldier.<br />
<br />
Issues: Some co-ordinates inputted result in the R-4 system shutting down. Technically, we should be able to access these locations, meaning it’d be impossible to input a set of co-ordinates that are a dead end. Therefore, it is to be believed that an outside force is restricting R-4’s access to certain areas.</pre><br />
<br />
== In-Progress ==<br />
<br />
===Project Bridge===<br />
<br />
"Trying to form a bridge between two beings. Between man and the divine."<br />
<br />
Dr Wells is currently focused fully on this Project as he believes it can bring back his wife, Irene, somehow.<br />
<br />
== Pending ==<br />
<br />
===Project Hive===<br />
<br />
"A collaboration between Lumitech and Fort Rosner personnel to further the development of artificial intelligence, giving them bodies."<br />
<br />
"Lumitech was developing the more computer-y side of Project Hive, while FR dealt with the engineering part. I don't know how much they've built for the main body, but I do know that they've developed these weird-looking panels. They can act as wings, and collect concentrated solar energy to weaponize."<br />
<br />
== Failed ==<br />
<br />
===Project Radiance===<br />
<br />
Purpose: Manipulating Aether in order to open "doors" between points in space. Presumably a similar concept than that of "worm holes". The project details were classified after failure. <br />
<br />
''From an encrypted classified file found by solvers:''<br />
<br />
Project Radiance: Previous studies of AETHER have shown that it is capable of manipulating matter. Hypothetically, it could be used to create a “door” to a different point in space.<br />
<br />
==Radiances==<br />
===R-0===<br />
From the blog:<br />
<pre>RADIANCE-0 OFFLINE<br />
Location: [WITHHELD]<br />
Dimensions: 19m x 19m x 4m<br />
Liquid present: Kerosene (?)<br />
Age: Approx. 800 years old<br />
Last use: 1781 0952<br />
Description: A stone pool with a dial embedded on each face. It is believed from scripts that date back to the same era that RADIANCE-0 was used to summon beings from alternate realms or allow humans to enter them.<br />
Simulations of the structure indicate that the dials would be used to pinpoint co-ordinates; entering them would trigger the liquid present to ignite, hypothetically acting the same way RADIANCE-1 and future instalments do with AETHER.<br />
Notes: More recent matter was detected within RADIANCE-0’s liquid, indicating someone entered or exited the site. Tests reveal that it was human matter. Traces of SB material were found outside of R-0’s chamber.<br />
Hypothesis: [SB-D (or its offspring) originated from RADIANCE-0] [SBs are drawn to the site of RADIANCE-0]</pre><br />
<br />
Location was later found to be in Canada, hidden in a forest.<br />
<br />
===R-1===<br />
Excerpt from the blog post about project Precipice:<br />
<pre>[REDACTED]-1 was designed to mimic the function of [REDACTED]-0, a manmade structure dating back several hundred years.<br />
(presumably [REDACTED] is 'Radiance' here)<br />
...<br />
R-1: Frame is arch-like, mounted on a platform. Co-ordinates would be input via attached computer. AETHER cylinder installed in platform via hatch at back. Different amounts of AETHER is required for alternating sizes of objects/people entering and exiting, as too high an amount can have severe injuries. Decommissioned due to I Wells incident.</pre><br />
<br />
===R-2===<br />
Excerpt from the blog post about project Precipice:<br />
<pre>R-2: An exact reconstruction of R-0, with dials on side being replaced by outlets feeding into a computer (which inputs co-ordinates). Testing proved successful after sending a camera feed through after numerous tests to see if R-2 could function. Land was found, later built upon to gather data and harvest more AETHER. Decommissioned due to size and energy inefficiency.</pre><br />
<br />
===R-3===<br />
Excerpt from the blog post about project Precipice:<br />
<pre>R-3: A size modification of R-2, designed to take up less space and consume considerably less AETHER than its predecessor. On some occasions, there have been serious AETHER fluctuations. As a result, the next incarnation requires re-evaluating the design (as well as further improvements). Decommissioned due to risk of death.</pre><br />
<br />
===R-4===<br />
Excerpt from the blog post about project Precipice:<br />
<pre>R-4: The appearance of R-1 was adopted and blended with the structure of R-0, resulting in a block-like doorway mounted on a platform. Tests show that R-4 is running as intended, no further development needed as of yet.<br />
...<br />
Issues: Some co-ordinates inputted result in the R-4 system shutting down. Technically, we should be able to access these locations, meaning it’d be impossible to input a set of co-ordinates that are a dead end. Therefore, it is to be believed that an outside force is restricting R-4’s access to certain areas.</pre><br />
<br />
= Miscellaneous =<br />
<br />
===AETHER===<br />
<br />
"AETHER is a naturally-found energy that can be applied in numerous ways. It can transmute. It can replace electricity. It can be used on humans and animals. It's properties are quite flexible."<br />
<br />
===Sigma Beasts===<br />
<br />
"Sigma Beasts are entities composed of an unidentifiable biological substance (dubbed Sigma), and originate from a singular source. Their forms and properties vary for each individual SB."<br />
<br />
The presumed creator of all Sigma Beasts is known as Sigma Beast Discord. Post [https://theconsole.tumblr.com/post/158712892139/22317-1954| 27217 0826] says as follows:<br />
<pre><br />
SB-D located within close proximity<br />
Description: (N/A). Stature is always humanoid, appearance changes.<br />
Notes: SB-D is the presumed creator of all SBs. Data readings show that the entity produces more energy than its creations, and that there can be multiple instances of it. <br />
Containment is unlikely.<br />
Sightings<br />
15716 1744: Figure seen at site prior to origin of SB.<br />
23716 0928: Figure of same description seen spewing black substance confirmed to be composed of the same material as the SB.<br />
9816 1241: SB-3 found, figure allegedly seen sinking into shallow pool of substance.<br />
30117 0855: Figure is confirmed to be SB-D post-scan. Remains of missing persons found in substance nearby site.<br />
</pre><br />
<br />
SB-D is also the one responsible for the explosion of Radiance-1 and frying C-1's CPU.<br />
<br />
The known Sigma Beasts are:<br />
<br />
====SB-1====<br />
<br />
'''Description:''' A wolf approximately 4 feet tall, consisting of unknown black waste and minor amounts of identical red waste for eyes (8). A clock is embedded in its tail, extra eyes located on the chest and centrepiece of the clock. <br />
<br />
'''Notes:''' Exposing SB-1 to cold temperatures yields no results. Fire is absorbed into the body of SB-1. Spraying with water produces smoke, and often results in body mass deterioration. <br />
<br />
'''Storage:''' SB-1 is to be kept within an enclosure consisting of a steel floor, four (4) walls made up of several layers of glass and a steel ceiling adorn with one (1) source of light.<br />
<br />
====SB-3====<br />
<br />
'''Description:''' A skull 2.3x larger than an average adult male skull, Sigma oozing from its mouth. Two red eyes are located inside of the sockets, a clock face embedded on its forehead.<br />
<br />
'''Notes:''' Sigma produced from its mouth can be warped into appendages, allowing it to move freely and attack any entity that corners it. If placed 5 metres away from its origin, the Sigma loses its properties, allowing it to be used for experimentation.<br />
<br />
'''Storage:''' SB-3 is to be kept within a 5x5x5m container with a shatter-resistant glass ceiling, (4) layered steel walls and a steel floor with (4) drains leading to an area some distance away for storing canisters with Sigma ready for testing purposes.<br />
<br />
'''Security:''' Under no circumstances is SB-3 permitted to be removed from its container.<br />
<br />
====SB-7====<br />
<br />
'''Description:''' A malnourished humanoid entity approximately 7 feet high. Has large bulbous red eyes that lock onto target, even when targeted personnel are not in the same room or building. Small clock face is located on body of sternum. <br />
<br />
'''Notes:''' SB-7's presence triggers intense fear response for target(s). Survivors of said trauma report having their oldest and innermost fears subjected to them. Its body, despite being composed of the same material, produces a foul odor, the entity's presence reducing the temperature of confined spaces by at least 5° C. <br />
<br />
'''Storage:''' SB-7 is to be kept within an enclosure consisting of a stone floor, three (3) walls made up of several layers of bulletproof glass, one (1) wall made of steel and equipped with ventilation, and a steel ceiling adorn with one (1) source of light. <br />
<br />
'''Security:''' Personnel handling SB-7 are to enter its chamber wearing hazmat suits (complete with respirators) and wielding stun batons. No fewer than three (3) people are to be in SB-7's chamber at a time.<br />
<br />
====SB-19====<br />
<br />
'''Description:''' A large humanoid creature composed of unknown black substance, large red eye located on centre of face. Small clock faces are embedded on the backs of its gargantuan hands. <br />
<br />
'''Notes:''' SB-19'S solidity is inconsistent at times; while the body is constantly solid mass, its hands alter between solid and liquid state. When solid, a single punch is fully capable of obliterating up to 3 layers of brick wall. While liquid, SB-19's hands become puddles up to 12 inches in diameter. Anything caught within them rapidly dissolves (due to a lack of visible mouth, it is implied that SB-19 consumes food and miscellaneous items with these puddles). <br />
<br />
'''Storage:''' SB-19 is to be kept within an enclosure consisting of a marble floor coated in a layer of alkaline liquid, four (4) walls made up of several layers of bulletproof glass and a steel ceiling adorn with one (1) source of light.<br />
<br />
===Angel Glyphs===<br />
<br />
This is a translation of the Angel glyphs:<br />
<br />
[[File:AngelGlyphs.png]]</div>Halke234https://wiki.gamedetectives.net/index.php?title=TheConsole/Glossary&diff=16635TheConsole/Glossary2018-07-25T20:45:31Z<p>Halke234: /* Ethan */</p>
<hr />
<div>[[Main Page]] > [[List of Investigations]] > [[TheConsole]] > '''Glossary'''<br />
<br />
This page is a collection of terms, locations and characters from [[TheConsole |The Console]] investigation.<br />
<br />
__TOC__<br />
= Characters & Organizations =<br />
<br />
===Dr. Harvey Wells===<br />
<br />
Info as provided by The Console:<br />
<br />
<code>Employee name: Harvey Wells<br />
<br />
Accolades: D.A.S., D.C.S., D.Eng.<br />
<br />
Sex: Male <br />
<br />
Age: 49 <br />
<br />
Role: Project Overseer<br />
<br />
Completed project(s): Aether, Starfish, Precipice<br />
<br />
Pending project(s): Hive<br />
<br />
Failed project(s): [CLASSIFIED]</code><br />
<br />
<br />
Whereabouts: ''Unknown''<br />
<br />
===Irene Wells===<br />
<br />
The wife of Dr. Harvey Wells, and an apparent survivor of the Lumitech explosion. Her survival is only known by the fact that her suit's vitals were still giving off a heartbeat. As she had entered Radiance-1 for testing, she was accompanied by a contained explosion that killed numerous Lumitech staff members. Whereabouts unknown.<br />
<br />
===Louise Wells===<br />
<br />
Daughter of Harvey and Irene Wells.<br />
<br />
Born April 17, 1995. An only child, homeschooled, with average grades. She appears to have sent a distress message to her father (H. Wells) in a message hidden on the Rosen servers which Jude was able to recover. Whereabouts unknown.<br />
<br />
She was confirmed to be a major part of Project Bridge. It was never clear what her full role in the project was, but she was tested on and given doses of Sigma which was greatly affecting her personality. These personality changes were swapping Louise between herself and Caefur controlling the body.<br />
<br />
===The Console===<br />
<br />
An artificial intelligence connected to a series of consoles created by Dr. Wells at Lumitech, in May 2016.<br />
<br />
Currently residing in Lumitech site C-1.<br />
<br />
Also known as Jude.<br />
<br />
===The Blind Angel===<br />
<br />
An angel who was broken into fragments by Azoth.<br />
<br />
This was a text translated from a retrieved document:<br />
<br />
<pre>It was the dawn of humanity. From our sacred home hidden in the dusts of the departed, we watched as they flourished. And yet there was one who despised our creations. An angel without sight. They would claim that they had seen what they were capable of, warning that they were to be eradicated before our halls became stained with the bloody dusts we leave behind. <br />
<br />
They acted out and were exiled.<br />
<br />
Wings shattered, they were abandoned within the home of the humans as a mere phantom on time. We hoped they would change their mind. We were wrong<br />
<br />
The blind angel returned, a feat none have accomplished. The hatred that flowed throughout their being was enough to let them return home with vengeance, with every pile of dust left behind by our shattered bodies the more confident they became.<br />
<br />
The strongest of us became dust splattered on the pure white of our home, the cowardly fleeing. Ultimately the blind one stood before their former leader, our master azoth god. They leaped towards it, but it was no use. When they finally came to, they were about to be executed. The blind angel ushered their final words<br />
<br />
'One way or another, I will return on that day. I will wander these empty colorful walls'<br />
<br />
I saw as the fragments of their body fell, settling on the soils of the human realm. As I sit in this palace of exiles I question whether there is truth to their words.</pre><br />
<br />
===Bel===<br />
<br />
Fragment of the Blind Angel which talks through Jude on Discord.<br />
<br />
Little was known about Bel, but they appeared to be connected to Radiance-1 in some way, as they made themselves better known after Radiance-1 was revealed. Host was Jared Myers. Bel and Jared were somewhere within a undisclosed location after fleeing the US. He was the wings of the Blind Angel. Also referred to as B.<br />
<br />
===The Watcher===<br />
<br />
Fragment of the Blind Angel, he was the eyes before they were split apart.<br />
<br />
Not much was known about the Watcher except that he was using Ethan, the only survivor of the Radiance-1 explosion, as his host. Apparently, The Watcher held some form of prophecy, which players were supposed to bargain for. He wanted Radiance-1 repaired so he could get access to a "husk". Could be contacted and receive one question if you wrote his name on your hand or a mask in pen.<br />
<br />
===The Tongue===<br />
<br />
A fragment of the Blind Angel.<br />
<br />
Supposedly the most powerful fragment and didn't need someone to host its consciousness. All players knew is that it was buried after being attacked.<br />
<br />
===Caefur===<br />
<br />
A fragment of the Blind Angel.<br />
<br />
Current host was Louise Wells. Caefur was the left arm of the Blind Angel and was somewhat violent in nature. Caefur had once broken out of containment in Fort Rosner and gutted someone with her fingernails. She then escaped Fort Rosner only to be captured by Doctor Harvey Wells. Talked through Jude and her Tumblr, which is now deleted.<br />
<br />
===Ethan===<br />
<br />
Ethan was the host of The Watcher. Ethan was working on repairing Radiance-1 using the blueprints he stole from Lumitech.<br />
<br />
===Jared Myers===<br />
<br />
Currently hosting Bel. Former mole at Fort Rosner, ran off once the Sigma testing began at Fort Rosner, went to an undisclosed location.<br />
<br />
===Michael Ryan===<br />
<br />
Former Rosner employee who was working on Project Hive before his death by the hands of Caefur.<br />
<br />
===Azoth===<br />
<br />
"King" of the Angels. Banished the Blind Angel after it committed a genocide against the Angels. <br />
<br />
===Burning Man===<br />
<br />
Said to be giving "gifts" of sort. First appearance in the final act 1 video.<br />
<br />
===Lumitech===<br />
Formerly a tech company, after an employee made a discovery (probably related to Sigma) they focused on science. Currently 60 employees, prior to the events of Project Radiance (a massive explosion, which killed Irene Wells among others) there were 102 employees. They're working with Fort Rosner on Project Hive, but have stopped responding due to technical problems-- what Judge describes as 'AI problems'.<br />
<br />
===Fort Rosner===<br />
Rosner is the designation for a department within the Nellis AFB complex. They focus on experimental weaponry, both mechanical and biological. The Console doesn't have a lot of information on them, but did provide a valid email address to reach them.<br />
<br />
= Locations =<br />
<br />
The following are locations and their respective descriptions, as provided by The Console.<br />
<br />
==Lumitech Sites==<br />
<br />
===19-Xi-Aster=== <br />
"Also known as Earth. Their main labs are located here."<br />
<br />
===42-Iota-Convallaria=== <br />
"AETHER mining and processing is conducted."<br />
<br />
"42-Iota-Convallaria was the first site to be established for AETHER mining. However, staff would go missing from time to time, several believing they were being watched."<br />
<br />
Found by Lumitech: July 23, 2015<br />
<br />
===20-Beta-Hyoscyamus===<br />
"Research on ruins and mythological texts."<br />
<br />
"20-Beta-Hyoscyamus contained numerous ruins and texts relating to a myth of a "broken angel"."<br />
<br />
Found by Lumitech: July 29, 2015<br />
<br />
===5-Kappa-Myosotis=== <br />
"Agriculture and farming tests."<br />
<br />
Found by Lumitech: November 16, 2015<br />
<br />
===64-Pi-Rafflesia=== <br />
"Weapon testing."<br />
<br />
Found by Lumitech: August 12, 2015<br />
<br />
===99-Alpha-Orchidaceae=== <br />
"Temporary hub for Lumitech staff."<br />
<br />
Found by Lumitech: August 22, 2015<br />
<br />
===C-1=== <br />
"Attempts to travel beyond the known universe."<br />
<br />
Found by Lumitech: September 19, 2015<br />
<br />
===13-Sigma-Asclepias=== <br />
<br />
"No console exists within 13-Sigma-Asclepias. It is a hostile place, forsaken."<br />
<br />
"The original plans were to use the site for AETHER mining, as it had very high readings identical to that of the [6] Failed Sites. Unlike them, however, 13-Sigma-Asclepias could be accessed."<br />
<br />
"One week after colonization, on-site staff disappeared. They were later found, but expressed frequent violent tendencies and a more animalistic demeanour."<br />
<br />
"Numerous lives were lost. Autopsies revealed large amounts of Sigma in their digestive system. Ultimately, the site was removed from the system."<br />
<br />
Found by Lumitech: October 31, 2015<br />
<br />
==Miscellaneous==<br />
<br />
===Doctor Well's House===<br />
<br />
Current location of both Louise and Doctor Harvey Wells. Doctor Harvey is currently tested on Caefur trying to bring his wife back through testing with Sigma and other things<br />
<br />
= Dr. Wells' Projects =<br />
<br />
== Completed ==<br />
<br />
===Project Aether===<br />
<br />
"Project Aether was started after a mineral radiating AETHER was discovered. Instantly, it was applied in multiple ways."<br />
<br />
===Project Starfish===<br />
<br />
"An experiment to see what AETHER's side effects were on humans. Numerous subjects grew additional organs and body parts as a result."<br />
<br />
"[19] subjects experienced negative effects, [12] of them ultimately dying."<br />
<br />
===Project Precipice===<br />
<br />
Last project Dr. Wells worked on with Lumitech. From the blog:<br />
<br />
<pre>Project Precipice: [REDACTED]-1 was designed to mimic the function of [REDACTED]-0, a manmade structure dating back several hundred years. It is believed that the creators of said structure designed it to connect with the divine. After the events of [CLASSIFIED], numerous unauthorised simulations have been run by Dr H Wells. According to his data, it would be ideal to create an exact mechanical copy of [REDACTED]-0 and create more compact versions later on.<br />
<br />
R-1: Frame is arch-like, mounted on a platform. Co-ordinates would be input via attached computer. AETHER cylinder installed in platform via hatch at back. Different amounts of AETHER is required for alternating sizes of objects/people entering and exiting, as too high an amount can have severe injuries. Decommissioned due to I Wells incident.<br />
<br />
R-2: An exact reconstruction of R-0, with dials on side being replaced by outlets feeding into a computer (which inputs co-ordinates). Testing proved successful after sending a camera feed through after numerous tests to see if R-2 could function. Land was found, later built upon to gather data and harvest more AETHER. Decommissioned due to size and energy inefficiency.<br />
<br />
R-3: A size modification of R-2, designed to take up less space and consume considerably less AETHER than its predecessor. On some occasions, there have been serious AETHER fluctuations. As a result, the next incarnation requires re-evaluating the design (as well as further improvements). Decommissioned due to risk of death.<br />
<br />
R-4: The appearance of R-1 was adopted and blended with the structure of R-0, resulting in a block-like doorway mounted on a platform. Tests show that R-4 is running as intended, no further development needed as of yet.<br />
<br />
Colonization: Numerous sites have been discovered thanks to Project Precipice. AETHER plants have been established, allowing Lumitech to utilize it however we see fit. It does, of course, mean that constant maintenance is needed. The solution? Specimen 1’s offspring. It also gave us the space and materials needed to create long-term research bases and model cities to test prototype weaponry. In fact, tests on the TD Project have yielded promising results. The staff at Fort Rosner are looking into trying to develop a way for TD-1’s wings to act as weaponry, as well as continuing to make sure it becomes everything it is designed to be: a soldier.<br />
<br />
Issues: Some co-ordinates inputted result in the R-4 system shutting down. Technically, we should be able to access these locations, meaning it’d be impossible to input a set of co-ordinates that are a dead end. Therefore, it is to be believed that an outside force is restricting R-4’s access to certain areas.</pre><br />
<br />
== In-Progress ==<br />
<br />
===Project Bridge===<br />
<br />
"Trying to form a bridge between two beings. Between man and the divine."<br />
<br />
Dr Wells is currently focused fully on this Project as he believes it can bring back his wife, Irene, somehow.<br />
<br />
== Pending ==<br />
<br />
===Project Hive===<br />
<br />
"A collaboration between Lumitech and Fort Rosner personnel to further the development of artificial intelligence, giving them bodies."<br />
<br />
"Lumitech was developing the more computer-y side of Project Hive, while FR dealt with the engineering part. I don't know how much they've built for the main body, but I do know that they've developed these weird-looking panels. They can act as wings, and collect concentrated solar energy to weaponize."<br />
<br />
== Failed ==<br />
<br />
===Project Radiance===<br />
<br />
Purpose: Manipulating Aether in order to open "doors" between points in space. Presumably a similar concept than that of "worm holes". The project details were classified after failure. <br />
<br />
''From an encrypted classified file found by solvers:''<br />
<br />
Project Radiance: Previous studies of AETHER have shown that it is capable of manipulating matter. Hypothetically, it could be used to create a “door” to a different point in space.<br />
<br />
==Radiances==<br />
===R-0===<br />
From the blog:<br />
<pre>RADIANCE-0 OFFLINE<br />
Location: [WITHHELD]<br />
Dimensions: 19m x 19m x 4m<br />
Liquid present: Kerosene (?)<br />
Age: Approx. 800 years old<br />
Last use: 1781 0952<br />
Description: A stone pool with a dial embedded on each face. It is believed from scripts that date back to the same era that RADIANCE-0 was used to summon beings from alternate realms or allow humans to enter them.<br />
Simulations of the structure indicate that the dials would be used to pinpoint co-ordinates; entering them would trigger the liquid present to ignite, hypothetically acting the same way RADIANCE-1 and future instalments do with AETHER.<br />
Notes: More recent matter was detected within RADIANCE-0’s liquid, indicating someone entered or exited the site. Tests reveal that it was human matter. Traces of SB material were found outside of R-0’s chamber.<br />
Hypothesis: [SB-D (or its offspring) originated from RADIANCE-0] [SBs are drawn to the site of RADIANCE-0]</pre><br />
<br />
Location was later found to be in Canada, hidden in a forest.<br />
<br />
===R-1===<br />
Excerpt from the blog post about project Precipice:<br />
<pre>[REDACTED]-1 was designed to mimic the function of [REDACTED]-0, a manmade structure dating back several hundred years.<br />
(presumably [REDACTED] is 'Radiance' here)<br />
...<br />
R-1: Frame is arch-like, mounted on a platform. Co-ordinates would be input via attached computer. AETHER cylinder installed in platform via hatch at back. Different amounts of AETHER is required for alternating sizes of objects/people entering and exiting, as too high an amount can have severe injuries. Decommissioned due to I Wells incident.</pre><br />
<br />
===R-2===<br />
Excerpt from the blog post about project Precipice:<br />
<pre>R-2: An exact reconstruction of R-0, with dials on side being replaced by outlets feeding into a computer (which inputs co-ordinates). Testing proved successful after sending a camera feed through after numerous tests to see if R-2 could function. Land was found, later built upon to gather data and harvest more AETHER. Decommissioned due to size and energy inefficiency.</pre><br />
<br />
===R-3===<br />
Excerpt from the blog post about project Precipice:<br />
<pre>R-3: A size modification of R-2, designed to take up less space and consume considerably less AETHER than its predecessor. On some occasions, there have been serious AETHER fluctuations. As a result, the next incarnation requires re-evaluating the design (as well as further improvements). Decommissioned due to risk of death.</pre><br />
<br />
===R-4===<br />
Excerpt from the blog post about project Precipice:<br />
<pre>R-4: The appearance of R-1 was adopted and blended with the structure of R-0, resulting in a block-like doorway mounted on a platform. Tests show that R-4 is running as intended, no further development needed as of yet.<br />
...<br />
Issues: Some co-ordinates inputted result in the R-4 system shutting down. Technically, we should be able to access these locations, meaning it’d be impossible to input a set of co-ordinates that are a dead end. Therefore, it is to be believed that an outside force is restricting R-4’s access to certain areas.</pre><br />
<br />
= Miscellaneous =<br />
<br />
===AETHER===<br />
<br />
"AETHER is a naturally-found energy that can be applied in numerous ways. It can transmute. It can replace electricity. It can be used on humans and animals. It's properties are quite flexible."<br />
<br />
===Sigma Beasts===<br />
<br />
"Sigma Beasts are entities composed of an unidentifiable biological substance (dubbed Sigma), and originate from a singular source. Their forms and properties vary for each individual SB."<br />
<br />
The presumed creator of all Sigma Beasts is known as Sigma Beast Discord. Post [https://theconsole.tumblr.com/post/158712892139/22317-1954| 27217 0826] says as follows:<br />
<pre><br />
SB-D located within close proximity<br />
Description: (N/A). Stature is always humanoid, appearance changes.<br />
Notes: SB-D is the presumed creator of all SBs. Data readings show that the entity produces more energy than its creations, and that there can be multiple instances of it. <br />
Containment is unlikely.<br />
Sightings<br />
15716 1744: Figure seen at site prior to origin of SB.<br />
23716 0928: Figure of same description seen spewing black substance confirmed to be composed of the same material as the SB.<br />
9816 1241: SB-3 found, figure allegedly seen sinking into shallow pool of substance.<br />
30117 0855: Figure is confirmed to be SB-D post-scan. Remains of missing persons found in substance nearby site.<br />
</pre><br />
<br />
SB-D is also the one responsible for the explosion of Radiance-1 and frying C-1's CPU.<br />
<br />
The known Sigma Beasts are:<br />
<br />
====SB-1====<br />
<br />
'''Description:''' A wolf approximately 4 feet tall, consisting of unknown black waste and minor amounts of identical red waste for eyes (8). A clock is embedded in its tail, extra eyes located on the chest and centrepiece of the clock. <br />
<br />
'''Notes:''' Exposing SB-1 to cold temperatures yields no results. Fire is absorbed into the body of SB-1. Spraying with water produces smoke, and often results in body mass deterioration. <br />
<br />
'''Storage:''' SB-1 is to be kept within an enclosure consisting of a steel floor, four (4) walls made up of several layers of glass and a steel ceiling adorn with one (1) source of light.<br />
<br />
====SB-3====<br />
<br />
'''Description:''' A skull 2.3x larger than an average adult male skull, Sigma oozing from its mouth. Two red eyes are located inside of the sockets, a clock face embedded on its forehead.<br />
<br />
'''Notes:''' Sigma produced from its mouth can be warped into appendages, allowing it to move freely and attack any entity that corners it. If placed 5 metres away from its origin, the Sigma loses its properties, allowing it to be used for experimentation.<br />
<br />
'''Storage:''' SB-3 is to be kept within a 5x5x5m container with a shatter-resistant glass ceiling, (4) layered steel walls and a steel floor with (4) drains leading to an area some distance away for storing canisters with Sigma ready for testing purposes.<br />
<br />
'''Security:''' Under no circumstances is SB-3 permitted to be removed from its container.<br />
<br />
====SB-7====<br />
<br />
'''Description:''' A malnourished humanoid entity approximately 7 feet high. Has large bulbous red eyes that lock onto target, even when targeted personnel are not in the same room or building. Small clock face is located on body of sternum. <br />
<br />
'''Notes:''' SB-7's presence triggers intense fear response for target(s). Survivors of said trauma report having their oldest and innermost fears subjected to them. Its body, despite being composed of the same material, produces a foul odor, the entity's presence reducing the temperature of confined spaces by at least 5° C. <br />
<br />
'''Storage:''' SB-7 is to be kept within an enclosure consisting of a stone floor, three (3) walls made up of several layers of bulletproof glass, one (1) wall made of steel and equipped with ventilation, and a steel ceiling adorn with one (1) source of light. <br />
<br />
'''Security:''' Personnel handling SB-7 are to enter its chamber wearing hazmat suits (complete with respirators) and wielding stun batons. No fewer than three (3) people are to be in SB-7's chamber at a time.<br />
<br />
====SB-19====<br />
<br />
'''Description:''' A large humanoid creature composed of unknown black substance, large red eye located on centre of face. Small clock faces are embedded on the backs of its gargantuan hands. <br />
<br />
'''Notes:''' SB-19'S solidity is inconsistent at times; while the body is constantly solid mass, its hands alter between solid and liquid state. When solid, a single punch is fully capable of obliterating up to 3 layers of brick wall. While liquid, SB-19's hands become puddles up to 12 inches in diameter. Anything caught within them rapidly dissolves (due to a lack of visible mouth, it is implied that SB-19 consumes food and miscellaneous items with these puddles). <br />
<br />
'''Storage:''' SB-19 is to be kept within an enclosure consisting of a marble floor coated in a layer of alkaline liquid, four (4) walls made up of several layers of bulletproof glass and a steel ceiling adorn with one (1) source of light.<br />
<br />
===Angel Glyphs===<br />
<br />
This is a translation of the Angel glyphs:<br />
<br />
[[File:AngelGlyphs.png]]</div>Halke234https://wiki.gamedetectives.net/index.php?title=TheConsole/Glossary&diff=16634TheConsole/Glossary2018-07-25T20:44:54Z<p>Halke234: /* Caefur */</p>
<hr />
<div>[[Main Page]] > [[List of Investigations]] > [[TheConsole]] > '''Glossary'''<br />
<br />
This page is a collection of terms, locations and characters from [[TheConsole |The Console]] investigation.<br />
<br />
__TOC__<br />
= Characters & Organizations =<br />
<br />
===Dr. Harvey Wells===<br />
<br />
Info as provided by The Console:<br />
<br />
<code>Employee name: Harvey Wells<br />
<br />
Accolades: D.A.S., D.C.S., D.Eng.<br />
<br />
Sex: Male <br />
<br />
Age: 49 <br />
<br />
Role: Project Overseer<br />
<br />
Completed project(s): Aether, Starfish, Precipice<br />
<br />
Pending project(s): Hive<br />
<br />
Failed project(s): [CLASSIFIED]</code><br />
<br />
<br />
Whereabouts: ''Unknown''<br />
<br />
===Irene Wells===<br />
<br />
The wife of Dr. Harvey Wells, and an apparent survivor of the Lumitech explosion. Her survival is only known by the fact that her suit's vitals were still giving off a heartbeat. As she had entered Radiance-1 for testing, she was accompanied by a contained explosion that killed numerous Lumitech staff members. Whereabouts unknown.<br />
<br />
===Louise Wells===<br />
<br />
Daughter of Harvey and Irene Wells.<br />
<br />
Born April 17, 1995. An only child, homeschooled, with average grades. She appears to have sent a distress message to her father (H. Wells) in a message hidden on the Rosen servers which Jude was able to recover. Whereabouts unknown.<br />
<br />
She was confirmed to be a major part of Project Bridge. It was never clear what her full role in the project was, but she was tested on and given doses of Sigma which was greatly affecting her personality. These personality changes were swapping Louise between herself and Caefur controlling the body.<br />
<br />
===The Console===<br />
<br />
An artificial intelligence connected to a series of consoles created by Dr. Wells at Lumitech, in May 2016.<br />
<br />
Currently residing in Lumitech site C-1.<br />
<br />
Also known as Jude.<br />
<br />
===The Blind Angel===<br />
<br />
An angel who was broken into fragments by Azoth.<br />
<br />
This was a text translated from a retrieved document:<br />
<br />
<pre>It was the dawn of humanity. From our sacred home hidden in the dusts of the departed, we watched as they flourished. And yet there was one who despised our creations. An angel without sight. They would claim that they had seen what they were capable of, warning that they were to be eradicated before our halls became stained with the bloody dusts we leave behind. <br />
<br />
They acted out and were exiled.<br />
<br />
Wings shattered, they were abandoned within the home of the humans as a mere phantom on time. We hoped they would change their mind. We were wrong<br />
<br />
The blind angel returned, a feat none have accomplished. The hatred that flowed throughout their being was enough to let them return home with vengeance, with every pile of dust left behind by our shattered bodies the more confident they became.<br />
<br />
The strongest of us became dust splattered on the pure white of our home, the cowardly fleeing. Ultimately the blind one stood before their former leader, our master azoth god. They leaped towards it, but it was no use. When they finally came to, they were about to be executed. The blind angel ushered their final words<br />
<br />
'One way or another, I will return on that day. I will wander these empty colorful walls'<br />
<br />
I saw as the fragments of their body fell, settling on the soils of the human realm. As I sit in this palace of exiles I question whether there is truth to their words.</pre><br />
<br />
===Bel===<br />
<br />
Fragment of the Blind Angel which talks through Jude on Discord.<br />
<br />
Little was known about Bel, but they appeared to be connected to Radiance-1 in some way, as they made themselves better known after Radiance-1 was revealed. Host was Jared Myers. Bel and Jared were somewhere within a undisclosed location after fleeing the US. He was the wings of the Blind Angel. Also referred to as B.<br />
<br />
===The Watcher===<br />
<br />
Fragment of the Blind Angel, he was the eyes before they were split apart.<br />
<br />
Not much was known about the Watcher except that he was using Ethan, the only survivor of the Radiance-1 explosion, as his host. Apparently, The Watcher held some form of prophecy, which players were supposed to bargain for. He wanted Radiance-1 repaired so he could get access to a "husk". Could be contacted and receive one question if you wrote his name on your hand or a mask in pen.<br />
<br />
===The Tongue===<br />
<br />
A fragment of the Blind Angel.<br />
<br />
Supposedly the most powerful fragment and didn't need someone to host its consciousness. All players knew is that it was buried after being attacked.<br />
<br />
===Caefur===<br />
<br />
A fragment of the Blind Angel.<br />
<br />
Current host was Louise Wells. Caefur was the left arm of the Blind Angel and was somewhat violent in nature. Caefur had once broken out of containment in Fort Rosner and gutted someone with her fingernails. She then escaped Fort Rosner only to be captured by Doctor Harvey Wells. Talked through Jude and her Tumblr, which is now deleted.<br />
<br />
===Ethan===<br />
<br />
Ethan is currently hosting The Watcher. Ethan is currently working on fixing Radiance-1 using the blueprints of Radiance-1 which he stole from Lumitech.<br />
<br />
===Jared Myers===<br />
<br />
Currently hosting Bel. Former mole at Fort Rosner, ran off once the Sigma testing began at Fort Rosner, went to an undisclosed location.<br />
<br />
===Michael Ryan===<br />
<br />
Former Rosner employee who was working on Project Hive before his death by the hands of Caefur.<br />
<br />
===Azoth===<br />
<br />
"King" of the Angels. Banished the Blind Angel after it committed a genocide against the Angels. <br />
<br />
===Burning Man===<br />
<br />
Said to be giving "gifts" of sort. First appearance in the final act 1 video.<br />
<br />
===Lumitech===<br />
Formerly a tech company, after an employee made a discovery (probably related to Sigma) they focused on science. Currently 60 employees, prior to the events of Project Radiance (a massive explosion, which killed Irene Wells among others) there were 102 employees. They're working with Fort Rosner on Project Hive, but have stopped responding due to technical problems-- what Judge describes as 'AI problems'.<br />
<br />
===Fort Rosner===<br />
Rosner is the designation for a department within the Nellis AFB complex. They focus on experimental weaponry, both mechanical and biological. The Console doesn't have a lot of information on them, but did provide a valid email address to reach them.<br />
<br />
= Locations =<br />
<br />
The following are locations and their respective descriptions, as provided by The Console.<br />
<br />
==Lumitech Sites==<br />
<br />
===19-Xi-Aster=== <br />
"Also known as Earth. Their main labs are located here."<br />
<br />
===42-Iota-Convallaria=== <br />
"AETHER mining and processing is conducted."<br />
<br />
"42-Iota-Convallaria was the first site to be established for AETHER mining. However, staff would go missing from time to time, several believing they were being watched."<br />
<br />
Found by Lumitech: July 23, 2015<br />
<br />
===20-Beta-Hyoscyamus===<br />
"Research on ruins and mythological texts."<br />
<br />
"20-Beta-Hyoscyamus contained numerous ruins and texts relating to a myth of a "broken angel"."<br />
<br />
Found by Lumitech: July 29, 2015<br />
<br />
===5-Kappa-Myosotis=== <br />
"Agriculture and farming tests."<br />
<br />
Found by Lumitech: November 16, 2015<br />
<br />
===64-Pi-Rafflesia=== <br />
"Weapon testing."<br />
<br />
Found by Lumitech: August 12, 2015<br />
<br />
===99-Alpha-Orchidaceae=== <br />
"Temporary hub for Lumitech staff."<br />
<br />
Found by Lumitech: August 22, 2015<br />
<br />
===C-1=== <br />
"Attempts to travel beyond the known universe."<br />
<br />
Found by Lumitech: September 19, 2015<br />
<br />
===13-Sigma-Asclepias=== <br />
<br />
"No console exists within 13-Sigma-Asclepias. It is a hostile place, forsaken."<br />
<br />
"The original plans were to use the site for AETHER mining, as it had very high readings identical to that of the [6] Failed Sites. Unlike them, however, 13-Sigma-Asclepias could be accessed."<br />
<br />
"One week after colonization, on-site staff disappeared. They were later found, but expressed frequent violent tendencies and a more animalistic demeanour."<br />
<br />
"Numerous lives were lost. Autopsies revealed large amounts of Sigma in their digestive system. Ultimately, the site was removed from the system."<br />
<br />
Found by Lumitech: October 31, 2015<br />
<br />
==Miscellaneous==<br />
<br />
===Doctor Well's House===<br />
<br />
Current location of both Louise and Doctor Harvey Wells. Doctor Harvey is currently tested on Caefur trying to bring his wife back through testing with Sigma and other things<br />
<br />
= Dr. Wells' Projects =<br />
<br />
== Completed ==<br />
<br />
===Project Aether===<br />
<br />
"Project Aether was started after a mineral radiating AETHER was discovered. Instantly, it was applied in multiple ways."<br />
<br />
===Project Starfish===<br />
<br />
"An experiment to see what AETHER's side effects were on humans. Numerous subjects grew additional organs and body parts as a result."<br />
<br />
"[19] subjects experienced negative effects, [12] of them ultimately dying."<br />
<br />
===Project Precipice===<br />
<br />
Last project Dr. Wells worked on with Lumitech. From the blog:<br />
<br />
<pre>Project Precipice: [REDACTED]-1 was designed to mimic the function of [REDACTED]-0, a manmade structure dating back several hundred years. It is believed that the creators of said structure designed it to connect with the divine. After the events of [CLASSIFIED], numerous unauthorised simulations have been run by Dr H Wells. According to his data, it would be ideal to create an exact mechanical copy of [REDACTED]-0 and create more compact versions later on.<br />
<br />
R-1: Frame is arch-like, mounted on a platform. Co-ordinates would be input via attached computer. AETHER cylinder installed in platform via hatch at back. Different amounts of AETHER is required for alternating sizes of objects/people entering and exiting, as too high an amount can have severe injuries. Decommissioned due to I Wells incident.<br />
<br />
R-2: An exact reconstruction of R-0, with dials on side being replaced by outlets feeding into a computer (which inputs co-ordinates). Testing proved successful after sending a camera feed through after numerous tests to see if R-2 could function. Land was found, later built upon to gather data and harvest more AETHER. Decommissioned due to size and energy inefficiency.<br />
<br />
R-3: A size modification of R-2, designed to take up less space and consume considerably less AETHER than its predecessor. On some occasions, there have been serious AETHER fluctuations. As a result, the next incarnation requires re-evaluating the design (as well as further improvements). Decommissioned due to risk of death.<br />
<br />
R-4: The appearance of R-1 was adopted and blended with the structure of R-0, resulting in a block-like doorway mounted on a platform. Tests show that R-4 is running as intended, no further development needed as of yet.<br />
<br />
Colonization: Numerous sites have been discovered thanks to Project Precipice. AETHER plants have been established, allowing Lumitech to utilize it however we see fit. It does, of course, mean that constant maintenance is needed. The solution? Specimen 1’s offspring. It also gave us the space and materials needed to create long-term research bases and model cities to test prototype weaponry. In fact, tests on the TD Project have yielded promising results. The staff at Fort Rosner are looking into trying to develop a way for TD-1’s wings to act as weaponry, as well as continuing to make sure it becomes everything it is designed to be: a soldier.<br />
<br />
Issues: Some co-ordinates inputted result in the R-4 system shutting down. Technically, we should be able to access these locations, meaning it’d be impossible to input a set of co-ordinates that are a dead end. Therefore, it is to be believed that an outside force is restricting R-4’s access to certain areas.</pre><br />
<br />
== In-Progress ==<br />
<br />
===Project Bridge===<br />
<br />
"Trying to form a bridge between two beings. Between man and the divine."<br />
<br />
Dr Wells is currently focused fully on this Project as he believes it can bring back his wife, Irene, somehow.<br />
<br />
== Pending ==<br />
<br />
===Project Hive===<br />
<br />
"A collaboration between Lumitech and Fort Rosner personnel to further the development of artificial intelligence, giving them bodies."<br />
<br />
"Lumitech was developing the more computer-y side of Project Hive, while FR dealt with the engineering part. I don't know how much they've built for the main body, but I do know that they've developed these weird-looking panels. They can act as wings, and collect concentrated solar energy to weaponize."<br />
<br />
== Failed ==<br />
<br />
===Project Radiance===<br />
<br />
Purpose: Manipulating Aether in order to open "doors" between points in space. Presumably a similar concept than that of "worm holes". The project details were classified after failure. <br />
<br />
''From an encrypted classified file found by solvers:''<br />
<br />
Project Radiance: Previous studies of AETHER have shown that it is capable of manipulating matter. Hypothetically, it could be used to create a “door” to a different point in space.<br />
<br />
==Radiances==<br />
===R-0===<br />
From the blog:<br />
<pre>RADIANCE-0 OFFLINE<br />
Location: [WITHHELD]<br />
Dimensions: 19m x 19m x 4m<br />
Liquid present: Kerosene (?)<br />
Age: Approx. 800 years old<br />
Last use: 1781 0952<br />
Description: A stone pool with a dial embedded on each face. It is believed from scripts that date back to the same era that RADIANCE-0 was used to summon beings from alternate realms or allow humans to enter them.<br />
Simulations of the structure indicate that the dials would be used to pinpoint co-ordinates; entering them would trigger the liquid present to ignite, hypothetically acting the same way RADIANCE-1 and future instalments do with AETHER.<br />
Notes: More recent matter was detected within RADIANCE-0’s liquid, indicating someone entered or exited the site. Tests reveal that it was human matter. Traces of SB material were found outside of R-0’s chamber.<br />
Hypothesis: [SB-D (or its offspring) originated from RADIANCE-0] [SBs are drawn to the site of RADIANCE-0]</pre><br />
<br />
Location was later found to be in Canada, hidden in a forest.<br />
<br />
===R-1===<br />
Excerpt from the blog post about project Precipice:<br />
<pre>[REDACTED]-1 was designed to mimic the function of [REDACTED]-0, a manmade structure dating back several hundred years.<br />
(presumably [REDACTED] is 'Radiance' here)<br />
...<br />
R-1: Frame is arch-like, mounted on a platform. Co-ordinates would be input via attached computer. AETHER cylinder installed in platform via hatch at back. Different amounts of AETHER is required for alternating sizes of objects/people entering and exiting, as too high an amount can have severe injuries. Decommissioned due to I Wells incident.</pre><br />
<br />
===R-2===<br />
Excerpt from the blog post about project Precipice:<br />
<pre>R-2: An exact reconstruction of R-0, with dials on side being replaced by outlets feeding into a computer (which inputs co-ordinates). Testing proved successful after sending a camera feed through after numerous tests to see if R-2 could function. Land was found, later built upon to gather data and harvest more AETHER. Decommissioned due to size and energy inefficiency.</pre><br />
<br />
===R-3===<br />
Excerpt from the blog post about project Precipice:<br />
<pre>R-3: A size modification of R-2, designed to take up less space and consume considerably less AETHER than its predecessor. On some occasions, there have been serious AETHER fluctuations. As a result, the next incarnation requires re-evaluating the design (as well as further improvements). Decommissioned due to risk of death.</pre><br />
<br />
===R-4===<br />
Excerpt from the blog post about project Precipice:<br />
<pre>R-4: The appearance of R-1 was adopted and blended with the structure of R-0, resulting in a block-like doorway mounted on a platform. Tests show that R-4 is running as intended, no further development needed as of yet.<br />
...<br />
Issues: Some co-ordinates inputted result in the R-4 system shutting down. Technically, we should be able to access these locations, meaning it’d be impossible to input a set of co-ordinates that are a dead end. Therefore, it is to be believed that an outside force is restricting R-4’s access to certain areas.</pre><br />
<br />
= Miscellaneous =<br />
<br />
===AETHER===<br />
<br />
"AETHER is a naturally-found energy that can be applied in numerous ways. It can transmute. It can replace electricity. It can be used on humans and animals. It's properties are quite flexible."<br />
<br />
===Sigma Beasts===<br />
<br />
"Sigma Beasts are entities composed of an unidentifiable biological substance (dubbed Sigma), and originate from a singular source. Their forms and properties vary for each individual SB."<br />
<br />
The presumed creator of all Sigma Beasts is known as Sigma Beast Discord. Post [https://theconsole.tumblr.com/post/158712892139/22317-1954| 27217 0826] says as follows:<br />
<pre><br />
SB-D located within close proximity<br />
Description: (N/A). Stature is always humanoid, appearance changes.<br />
Notes: SB-D is the presumed creator of all SBs. Data readings show that the entity produces more energy than its creations, and that there can be multiple instances of it. <br />
Containment is unlikely.<br />
Sightings<br />
15716 1744: Figure seen at site prior to origin of SB.<br />
23716 0928: Figure of same description seen spewing black substance confirmed to be composed of the same material as the SB.<br />
9816 1241: SB-3 found, figure allegedly seen sinking into shallow pool of substance.<br />
30117 0855: Figure is confirmed to be SB-D post-scan. Remains of missing persons found in substance nearby site.<br />
</pre><br />
<br />
SB-D is also the one responsible for the explosion of Radiance-1 and frying C-1's CPU.<br />
<br />
The known Sigma Beasts are:<br />
<br />
====SB-1====<br />
<br />
'''Description:''' A wolf approximately 4 feet tall, consisting of unknown black waste and minor amounts of identical red waste for eyes (8). A clock is embedded in its tail, extra eyes located on the chest and centrepiece of the clock. <br />
<br />
'''Notes:''' Exposing SB-1 to cold temperatures yields no results. Fire is absorbed into the body of SB-1. Spraying with water produces smoke, and often results in body mass deterioration. <br />
<br />
'''Storage:''' SB-1 is to be kept within an enclosure consisting of a steel floor, four (4) walls made up of several layers of glass and a steel ceiling adorn with one (1) source of light.<br />
<br />
====SB-3====<br />
<br />
'''Description:''' A skull 2.3x larger than an average adult male skull, Sigma oozing from its mouth. Two red eyes are located inside of the sockets, a clock face embedded on its forehead.<br />
<br />
'''Notes:''' Sigma produced from its mouth can be warped into appendages, allowing it to move freely and attack any entity that corners it. If placed 5 metres away from its origin, the Sigma loses its properties, allowing it to be used for experimentation.<br />
<br />
'''Storage:''' SB-3 is to be kept within a 5x5x5m container with a shatter-resistant glass ceiling, (4) layered steel walls and a steel floor with (4) drains leading to an area some distance away for storing canisters with Sigma ready for testing purposes.<br />
<br />
'''Security:''' Under no circumstances is SB-3 permitted to be removed from its container.<br />
<br />
====SB-7====<br />
<br />
'''Description:''' A malnourished humanoid entity approximately 7 feet high. Has large bulbous red eyes that lock onto target, even when targeted personnel are not in the same room or building. Small clock face is located on body of sternum. <br />
<br />
'''Notes:''' SB-7's presence triggers intense fear response for target(s). Survivors of said trauma report having their oldest and innermost fears subjected to them. Its body, despite being composed of the same material, produces a foul odor, the entity's presence reducing the temperature of confined spaces by at least 5° C. <br />
<br />
'''Storage:''' SB-7 is to be kept within an enclosure consisting of a stone floor, three (3) walls made up of several layers of bulletproof glass, one (1) wall made of steel and equipped with ventilation, and a steel ceiling adorn with one (1) source of light. <br />
<br />
'''Security:''' Personnel handling SB-7 are to enter its chamber wearing hazmat suits (complete with respirators) and wielding stun batons. No fewer than three (3) people are to be in SB-7's chamber at a time.<br />
<br />
====SB-19====<br />
<br />
'''Description:''' A large humanoid creature composed of unknown black substance, large red eye located on centre of face. Small clock faces are embedded on the backs of its gargantuan hands. <br />
<br />
'''Notes:''' SB-19'S solidity is inconsistent at times; while the body is constantly solid mass, its hands alter between solid and liquid state. When solid, a single punch is fully capable of obliterating up to 3 layers of brick wall. While liquid, SB-19's hands become puddles up to 12 inches in diameter. Anything caught within them rapidly dissolves (due to a lack of visible mouth, it is implied that SB-19 consumes food and miscellaneous items with these puddles). <br />
<br />
'''Storage:''' SB-19 is to be kept within an enclosure consisting of a marble floor coated in a layer of alkaline liquid, four (4) walls made up of several layers of bulletproof glass and a steel ceiling adorn with one (1) source of light.<br />
<br />
===Angel Glyphs===<br />
<br />
This is a translation of the Angel glyphs:<br />
<br />
[[File:AngelGlyphs.png]]</div>Halke234https://wiki.gamedetectives.net/index.php?title=TheConsole/Glossary&diff=16633TheConsole/Glossary2018-07-25T20:44:10Z<p>Halke234: /* The Tongue */</p>
<hr />
<div>[[Main Page]] > [[List of Investigations]] > [[TheConsole]] > '''Glossary'''<br />
<br />
This page is a collection of terms, locations and characters from [[TheConsole |The Console]] investigation.<br />
<br />
__TOC__<br />
= Characters & Organizations =<br />
<br />
===Dr. Harvey Wells===<br />
<br />
Info as provided by The Console:<br />
<br />
<code>Employee name: Harvey Wells<br />
<br />
Accolades: D.A.S., D.C.S., D.Eng.<br />
<br />
Sex: Male <br />
<br />
Age: 49 <br />
<br />
Role: Project Overseer<br />
<br />
Completed project(s): Aether, Starfish, Precipice<br />
<br />
Pending project(s): Hive<br />
<br />
Failed project(s): [CLASSIFIED]</code><br />
<br />
<br />
Whereabouts: ''Unknown''<br />
<br />
===Irene Wells===<br />
<br />
The wife of Dr. Harvey Wells, and an apparent survivor of the Lumitech explosion. Her survival is only known by the fact that her suit's vitals were still giving off a heartbeat. As she had entered Radiance-1 for testing, she was accompanied by a contained explosion that killed numerous Lumitech staff members. Whereabouts unknown.<br />
<br />
===Louise Wells===<br />
<br />
Daughter of Harvey and Irene Wells.<br />
<br />
Born April 17, 1995. An only child, homeschooled, with average grades. She appears to have sent a distress message to her father (H. Wells) in a message hidden on the Rosen servers which Jude was able to recover. Whereabouts unknown.<br />
<br />
She was confirmed to be a major part of Project Bridge. It was never clear what her full role in the project was, but she was tested on and given doses of Sigma which was greatly affecting her personality. These personality changes were swapping Louise between herself and Caefur controlling the body.<br />
<br />
===The Console===<br />
<br />
An artificial intelligence connected to a series of consoles created by Dr. Wells at Lumitech, in May 2016.<br />
<br />
Currently residing in Lumitech site C-1.<br />
<br />
Also known as Jude.<br />
<br />
===The Blind Angel===<br />
<br />
An angel who was broken into fragments by Azoth.<br />
<br />
This was a text translated from a retrieved document:<br />
<br />
<pre>It was the dawn of humanity. From our sacred home hidden in the dusts of the departed, we watched as they flourished. And yet there was one who despised our creations. An angel without sight. They would claim that they had seen what they were capable of, warning that they were to be eradicated before our halls became stained with the bloody dusts we leave behind. <br />
<br />
They acted out and were exiled.<br />
<br />
Wings shattered, they were abandoned within the home of the humans as a mere phantom on time. We hoped they would change their mind. We were wrong<br />
<br />
The blind angel returned, a feat none have accomplished. The hatred that flowed throughout their being was enough to let them return home with vengeance, with every pile of dust left behind by our shattered bodies the more confident they became.<br />
<br />
The strongest of us became dust splattered on the pure white of our home, the cowardly fleeing. Ultimately the blind one stood before their former leader, our master azoth god. They leaped towards it, but it was no use. When they finally came to, they were about to be executed. The blind angel ushered their final words<br />
<br />
'One way or another, I will return on that day. I will wander these empty colorful walls'<br />
<br />
I saw as the fragments of their body fell, settling on the soils of the human realm. As I sit in this palace of exiles I question whether there is truth to their words.</pre><br />
<br />
===Bel===<br />
<br />
Fragment of the Blind Angel which talks through Jude on Discord.<br />
<br />
Little was known about Bel, but they appeared to be connected to Radiance-1 in some way, as they made themselves better known after Radiance-1 was revealed. Host was Jared Myers. Bel and Jared were somewhere within a undisclosed location after fleeing the US. He was the wings of the Blind Angel. Also referred to as B.<br />
<br />
===The Watcher===<br />
<br />
Fragment of the Blind Angel, he was the eyes before they were split apart.<br />
<br />
Not much was known about the Watcher except that he was using Ethan, the only survivor of the Radiance-1 explosion, as his host. Apparently, The Watcher held some form of prophecy, which players were supposed to bargain for. He wanted Radiance-1 repaired so he could get access to a "husk". Could be contacted and receive one question if you wrote his name on your hand or a mask in pen.<br />
<br />
===The Tongue===<br />
<br />
A fragment of the Blind Angel.<br />
<br />
Supposedly the most powerful fragment and didn't need someone to host its consciousness. All players knew is that it was buried after being attacked.<br />
<br />
===Caefur===<br />
<br />
A fragment of the Blind Angel.<br />
<br />
Current host is Louise Wells. Caefur is the left arm of the Blind Angel and is somewhat violent in nature. Caefur had once broken out of containment in Fort Rosner and gutted someone with her fingernails. She then escaping Fort Rosner only to be captured by Doctor Harvey Wells. Talks through Jude and her Tumblr, which is now deleted.<br />
<br />
===Ethan===<br />
<br />
Ethan is currently hosting The Watcher. Ethan is currently working on fixing Radiance-1 using the blueprints of Radiance-1 which he stole from Lumitech.<br />
<br />
===Jared Myers===<br />
<br />
Currently hosting Bel. Former mole at Fort Rosner, ran off once the Sigma testing began at Fort Rosner, went to an undisclosed location.<br />
<br />
===Michael Ryan===<br />
<br />
Former Rosner employee who was working on Project Hive before his death by the hands of Caefur.<br />
<br />
===Azoth===<br />
<br />
"King" of the Angels. Banished the Blind Angel after it committed a genocide against the Angels. <br />
<br />
===Burning Man===<br />
<br />
Said to be giving "gifts" of sort. First appearance in the final act 1 video.<br />
<br />
===Lumitech===<br />
Formerly a tech company, after an employee made a discovery (probably related to Sigma) they focused on science. Currently 60 employees, prior to the events of Project Radiance (a massive explosion, which killed Irene Wells among others) there were 102 employees. They're working with Fort Rosner on Project Hive, but have stopped responding due to technical problems-- what Judge describes as 'AI problems'.<br />
<br />
===Fort Rosner===<br />
Rosner is the designation for a department within the Nellis AFB complex. They focus on experimental weaponry, both mechanical and biological. The Console doesn't have a lot of information on them, but did provide a valid email address to reach them.<br />
<br />
= Locations =<br />
<br />
The following are locations and their respective descriptions, as provided by The Console.<br />
<br />
==Lumitech Sites==<br />
<br />
===19-Xi-Aster=== <br />
"Also known as Earth. Their main labs are located here."<br />
<br />
===42-Iota-Convallaria=== <br />
"AETHER mining and processing is conducted."<br />
<br />
"42-Iota-Convallaria was the first site to be established for AETHER mining. However, staff would go missing from time to time, several believing they were being watched."<br />
<br />
Found by Lumitech: July 23, 2015<br />
<br />
===20-Beta-Hyoscyamus===<br />
"Research on ruins and mythological texts."<br />
<br />
"20-Beta-Hyoscyamus contained numerous ruins and texts relating to a myth of a "broken angel"."<br />
<br />
Found by Lumitech: July 29, 2015<br />
<br />
===5-Kappa-Myosotis=== <br />
"Agriculture and farming tests."<br />
<br />
Found by Lumitech: November 16, 2015<br />
<br />
===64-Pi-Rafflesia=== <br />
"Weapon testing."<br />
<br />
Found by Lumitech: August 12, 2015<br />
<br />
===99-Alpha-Orchidaceae=== <br />
"Temporary hub for Lumitech staff."<br />
<br />
Found by Lumitech: August 22, 2015<br />
<br />
===C-1=== <br />
"Attempts to travel beyond the known universe."<br />
<br />
Found by Lumitech: September 19, 2015<br />
<br />
===13-Sigma-Asclepias=== <br />
<br />
"No console exists within 13-Sigma-Asclepias. It is a hostile place, forsaken."<br />
<br />
"The original plans were to use the site for AETHER mining, as it had very high readings identical to that of the [6] Failed Sites. Unlike them, however, 13-Sigma-Asclepias could be accessed."<br />
<br />
"One week after colonization, on-site staff disappeared. They were later found, but expressed frequent violent tendencies and a more animalistic demeanour."<br />
<br />
"Numerous lives were lost. Autopsies revealed large amounts of Sigma in their digestive system. Ultimately, the site was removed from the system."<br />
<br />
Found by Lumitech: October 31, 2015<br />
<br />
==Miscellaneous==<br />
<br />
===Doctor Well's House===<br />
<br />
Current location of both Louise and Doctor Harvey Wells. Doctor Harvey is currently tested on Caefur trying to bring his wife back through testing with Sigma and other things<br />
<br />
= Dr. Wells' Projects =<br />
<br />
== Completed ==<br />
<br />
===Project Aether===<br />
<br />
"Project Aether was started after a mineral radiating AETHER was discovered. Instantly, it was applied in multiple ways."<br />
<br />
===Project Starfish===<br />
<br />
"An experiment to see what AETHER's side effects were on humans. Numerous subjects grew additional organs and body parts as a result."<br />
<br />
"[19] subjects experienced negative effects, [12] of them ultimately dying."<br />
<br />
===Project Precipice===<br />
<br />
Last project Dr. Wells worked on with Lumitech. From the blog:<br />
<br />
<pre>Project Precipice: [REDACTED]-1 was designed to mimic the function of [REDACTED]-0, a manmade structure dating back several hundred years. It is believed that the creators of said structure designed it to connect with the divine. After the events of [CLASSIFIED], numerous unauthorised simulations have been run by Dr H Wells. According to his data, it would be ideal to create an exact mechanical copy of [REDACTED]-0 and create more compact versions later on.<br />
<br />
R-1: Frame is arch-like, mounted on a platform. Co-ordinates would be input via attached computer. AETHER cylinder installed in platform via hatch at back. Different amounts of AETHER is required for alternating sizes of objects/people entering and exiting, as too high an amount can have severe injuries. Decommissioned due to I Wells incident.<br />
<br />
R-2: An exact reconstruction of R-0, with dials on side being replaced by outlets feeding into a computer (which inputs co-ordinates). Testing proved successful after sending a camera feed through after numerous tests to see if R-2 could function. Land was found, later built upon to gather data and harvest more AETHER. Decommissioned due to size and energy inefficiency.<br />
<br />
R-3: A size modification of R-2, designed to take up less space and consume considerably less AETHER than its predecessor. On some occasions, there have been serious AETHER fluctuations. As a result, the next incarnation requires re-evaluating the design (as well as further improvements). Decommissioned due to risk of death.<br />
<br />
R-4: The appearance of R-1 was adopted and blended with the structure of R-0, resulting in a block-like doorway mounted on a platform. Tests show that R-4 is running as intended, no further development needed as of yet.<br />
<br />
Colonization: Numerous sites have been discovered thanks to Project Precipice. AETHER plants have been established, allowing Lumitech to utilize it however we see fit. It does, of course, mean that constant maintenance is needed. The solution? Specimen 1’s offspring. It also gave us the space and materials needed to create long-term research bases and model cities to test prototype weaponry. In fact, tests on the TD Project have yielded promising results. The staff at Fort Rosner are looking into trying to develop a way for TD-1’s wings to act as weaponry, as well as continuing to make sure it becomes everything it is designed to be: a soldier.<br />
<br />
Issues: Some co-ordinates inputted result in the R-4 system shutting down. Technically, we should be able to access these locations, meaning it’d be impossible to input a set of co-ordinates that are a dead end. Therefore, it is to be believed that an outside force is restricting R-4’s access to certain areas.</pre><br />
<br />
== In-Progress ==<br />
<br />
===Project Bridge===<br />
<br />
"Trying to form a bridge between two beings. Between man and the divine."<br />
<br />
Dr Wells is currently focused fully on this Project as he believes it can bring back his wife, Irene, somehow.<br />
<br />
== Pending ==<br />
<br />
===Project Hive===<br />
<br />
"A collaboration between Lumitech and Fort Rosner personnel to further the development of artificial intelligence, giving them bodies."<br />
<br />
"Lumitech was developing the more computer-y side of Project Hive, while FR dealt with the engineering part. I don't know how much they've built for the main body, but I do know that they've developed these weird-looking panels. They can act as wings, and collect concentrated solar energy to weaponize."<br />
<br />
== Failed ==<br />
<br />
===Project Radiance===<br />
<br />
Purpose: Manipulating Aether in order to open "doors" between points in space. Presumably a similar concept than that of "worm holes". The project details were classified after failure. <br />
<br />
''From an encrypted classified file found by solvers:''<br />
<br />
Project Radiance: Previous studies of AETHER have shown that it is capable of manipulating matter. Hypothetically, it could be used to create a “door” to a different point in space.<br />
<br />
==Radiances==<br />
===R-0===<br />
From the blog:<br />
<pre>RADIANCE-0 OFFLINE<br />
Location: [WITHHELD]<br />
Dimensions: 19m x 19m x 4m<br />
Liquid present: Kerosene (?)<br />
Age: Approx. 800 years old<br />
Last use: 1781 0952<br />
Description: A stone pool with a dial embedded on each face. It is believed from scripts that date back to the same era that RADIANCE-0 was used to summon beings from alternate realms or allow humans to enter them.<br />
Simulations of the structure indicate that the dials would be used to pinpoint co-ordinates; entering them would trigger the liquid present to ignite, hypothetically acting the same way RADIANCE-1 and future instalments do with AETHER.<br />
Notes: More recent matter was detected within RADIANCE-0’s liquid, indicating someone entered or exited the site. Tests reveal that it was human matter. Traces of SB material were found outside of R-0’s chamber.<br />
Hypothesis: [SB-D (or its offspring) originated from RADIANCE-0] [SBs are drawn to the site of RADIANCE-0]</pre><br />
<br />
Location was later found to be in Canada, hidden in a forest.<br />
<br />
===R-1===<br />
Excerpt from the blog post about project Precipice:<br />
<pre>[REDACTED]-1 was designed to mimic the function of [REDACTED]-0, a manmade structure dating back several hundred years.<br />
(presumably [REDACTED] is 'Radiance' here)<br />
...<br />
R-1: Frame is arch-like, mounted on a platform. Co-ordinates would be input via attached computer. AETHER cylinder installed in platform via hatch at back. Different amounts of AETHER is required for alternating sizes of objects/people entering and exiting, as too high an amount can have severe injuries. Decommissioned due to I Wells incident.</pre><br />
<br />
===R-2===<br />
Excerpt from the blog post about project Precipice:<br />
<pre>R-2: An exact reconstruction of R-0, with dials on side being replaced by outlets feeding into a computer (which inputs co-ordinates). Testing proved successful after sending a camera feed through after numerous tests to see if R-2 could function. Land was found, later built upon to gather data and harvest more AETHER. Decommissioned due to size and energy inefficiency.</pre><br />
<br />
===R-3===<br />
Excerpt from the blog post about project Precipice:<br />
<pre>R-3: A size modification of R-2, designed to take up less space and consume considerably less AETHER than its predecessor. On some occasions, there have been serious AETHER fluctuations. As a result, the next incarnation requires re-evaluating the design (as well as further improvements). Decommissioned due to risk of death.</pre><br />
<br />
===R-4===<br />
Excerpt from the blog post about project Precipice:<br />
<pre>R-4: The appearance of R-1 was adopted and blended with the structure of R-0, resulting in a block-like doorway mounted on a platform. Tests show that R-4 is running as intended, no further development needed as of yet.<br />
...<br />
Issues: Some co-ordinates inputted result in the R-4 system shutting down. Technically, we should be able to access these locations, meaning it’d be impossible to input a set of co-ordinates that are a dead end. Therefore, it is to be believed that an outside force is restricting R-4’s access to certain areas.</pre><br />
<br />
= Miscellaneous =<br />
<br />
===AETHER===<br />
<br />
"AETHER is a naturally-found energy that can be applied in numerous ways. It can transmute. It can replace electricity. It can be used on humans and animals. It's properties are quite flexible."<br />
<br />
===Sigma Beasts===<br />
<br />
"Sigma Beasts are entities composed of an unidentifiable biological substance (dubbed Sigma), and originate from a singular source. Their forms and properties vary for each individual SB."<br />
<br />
The presumed creator of all Sigma Beasts is known as Sigma Beast Discord. Post [https://theconsole.tumblr.com/post/158712892139/22317-1954| 27217 0826] says as follows:<br />
<pre><br />
SB-D located within close proximity<br />
Description: (N/A). Stature is always humanoid, appearance changes.<br />
Notes: SB-D is the presumed creator of all SBs. Data readings show that the entity produces more energy than its creations, and that there can be multiple instances of it. <br />
Containment is unlikely.<br />
Sightings<br />
15716 1744: Figure seen at site prior to origin of SB.<br />
23716 0928: Figure of same description seen spewing black substance confirmed to be composed of the same material as the SB.<br />
9816 1241: SB-3 found, figure allegedly seen sinking into shallow pool of substance.<br />
30117 0855: Figure is confirmed to be SB-D post-scan. Remains of missing persons found in substance nearby site.<br />
</pre><br />
<br />
SB-D is also the one responsible for the explosion of Radiance-1 and frying C-1's CPU.<br />
<br />
The known Sigma Beasts are:<br />
<br />
====SB-1====<br />
<br />
'''Description:''' A wolf approximately 4 feet tall, consisting of unknown black waste and minor amounts of identical red waste for eyes (8). A clock is embedded in its tail, extra eyes located on the chest and centrepiece of the clock. <br />
<br />
'''Notes:''' Exposing SB-1 to cold temperatures yields no results. Fire is absorbed into the body of SB-1. Spraying with water produces smoke, and often results in body mass deterioration. <br />
<br />
'''Storage:''' SB-1 is to be kept within an enclosure consisting of a steel floor, four (4) walls made up of several layers of glass and a steel ceiling adorn with one (1) source of light.<br />
<br />
====SB-3====<br />
<br />
'''Description:''' A skull 2.3x larger than an average adult male skull, Sigma oozing from its mouth. Two red eyes are located inside of the sockets, a clock face embedded on its forehead.<br />
<br />
'''Notes:''' Sigma produced from its mouth can be warped into appendages, allowing it to move freely and attack any entity that corners it. If placed 5 metres away from its origin, the Sigma loses its properties, allowing it to be used for experimentation.<br />
<br />
'''Storage:''' SB-3 is to be kept within a 5x5x5m container with a shatter-resistant glass ceiling, (4) layered steel walls and a steel floor with (4) drains leading to an area some distance away for storing canisters with Sigma ready for testing purposes.<br />
<br />
'''Security:''' Under no circumstances is SB-3 permitted to be removed from its container.<br />
<br />
====SB-7====<br />
<br />
'''Description:''' A malnourished humanoid entity approximately 7 feet high. Has large bulbous red eyes that lock onto target, even when targeted personnel are not in the same room or building. Small clock face is located on body of sternum. <br />
<br />
'''Notes:''' SB-7's presence triggers intense fear response for target(s). Survivors of said trauma report having their oldest and innermost fears subjected to them. Its body, despite being composed of the same material, produces a foul odor, the entity's presence reducing the temperature of confined spaces by at least 5° C. <br />
<br />
'''Storage:''' SB-7 is to be kept within an enclosure consisting of a stone floor, three (3) walls made up of several layers of bulletproof glass, one (1) wall made of steel and equipped with ventilation, and a steel ceiling adorn with one (1) source of light. <br />
<br />
'''Security:''' Personnel handling SB-7 are to enter its chamber wearing hazmat suits (complete with respirators) and wielding stun batons. No fewer than three (3) people are to be in SB-7's chamber at a time.<br />
<br />
====SB-19====<br />
<br />
'''Description:''' A large humanoid creature composed of unknown black substance, large red eye located on centre of face. Small clock faces are embedded on the backs of its gargantuan hands. <br />
<br />
'''Notes:''' SB-19'S solidity is inconsistent at times; while the body is constantly solid mass, its hands alter between solid and liquid state. When solid, a single punch is fully capable of obliterating up to 3 layers of brick wall. While liquid, SB-19's hands become puddles up to 12 inches in diameter. Anything caught within them rapidly dissolves (due to a lack of visible mouth, it is implied that SB-19 consumes food and miscellaneous items with these puddles). <br />
<br />
'''Storage:''' SB-19 is to be kept within an enclosure consisting of a marble floor coated in a layer of alkaline liquid, four (4) walls made up of several layers of bulletproof glass and a steel ceiling adorn with one (1) source of light.<br />
<br />
===Angel Glyphs===<br />
<br />
This is a translation of the Angel glyphs:<br />
<br />
[[File:AngelGlyphs.png]]</div>Halke234https://wiki.gamedetectives.net/index.php?title=TheConsole/Glossary&diff=16632TheConsole/Glossary2018-07-25T20:43:33Z<p>Halke234: /* The Watcher */</p>
<hr />
<div>[[Main Page]] > [[List of Investigations]] > [[TheConsole]] > '''Glossary'''<br />
<br />
This page is a collection of terms, locations and characters from [[TheConsole |The Console]] investigation.<br />
<br />
__TOC__<br />
= Characters & Organizations =<br />
<br />
===Dr. Harvey Wells===<br />
<br />
Info as provided by The Console:<br />
<br />
<code>Employee name: Harvey Wells<br />
<br />
Accolades: D.A.S., D.C.S., D.Eng.<br />
<br />
Sex: Male <br />
<br />
Age: 49 <br />
<br />
Role: Project Overseer<br />
<br />
Completed project(s): Aether, Starfish, Precipice<br />
<br />
Pending project(s): Hive<br />
<br />
Failed project(s): [CLASSIFIED]</code><br />
<br />
<br />
Whereabouts: ''Unknown''<br />
<br />
===Irene Wells===<br />
<br />
The wife of Dr. Harvey Wells, and an apparent survivor of the Lumitech explosion. Her survival is only known by the fact that her suit's vitals were still giving off a heartbeat. As she had entered Radiance-1 for testing, she was accompanied by a contained explosion that killed numerous Lumitech staff members. Whereabouts unknown.<br />
<br />
===Louise Wells===<br />
<br />
Daughter of Harvey and Irene Wells.<br />
<br />
Born April 17, 1995. An only child, homeschooled, with average grades. She appears to have sent a distress message to her father (H. Wells) in a message hidden on the Rosen servers which Jude was able to recover. Whereabouts unknown.<br />
<br />
She was confirmed to be a major part of Project Bridge. It was never clear what her full role in the project was, but she was tested on and given doses of Sigma which was greatly affecting her personality. These personality changes were swapping Louise between herself and Caefur controlling the body.<br />
<br />
===The Console===<br />
<br />
An artificial intelligence connected to a series of consoles created by Dr. Wells at Lumitech, in May 2016.<br />
<br />
Currently residing in Lumitech site C-1.<br />
<br />
Also known as Jude.<br />
<br />
===The Blind Angel===<br />
<br />
An angel who was broken into fragments by Azoth.<br />
<br />
This was a text translated from a retrieved document:<br />
<br />
<pre>It was the dawn of humanity. From our sacred home hidden in the dusts of the departed, we watched as they flourished. And yet there was one who despised our creations. An angel without sight. They would claim that they had seen what they were capable of, warning that they were to be eradicated before our halls became stained with the bloody dusts we leave behind. <br />
<br />
They acted out and were exiled.<br />
<br />
Wings shattered, they were abandoned within the home of the humans as a mere phantom on time. We hoped they would change their mind. We were wrong<br />
<br />
The blind angel returned, a feat none have accomplished. The hatred that flowed throughout their being was enough to let them return home with vengeance, with every pile of dust left behind by our shattered bodies the more confident they became.<br />
<br />
The strongest of us became dust splattered on the pure white of our home, the cowardly fleeing. Ultimately the blind one stood before their former leader, our master azoth god. They leaped towards it, but it was no use. When they finally came to, they were about to be executed. The blind angel ushered their final words<br />
<br />
'One way or another, I will return on that day. I will wander these empty colorful walls'<br />
<br />
I saw as the fragments of their body fell, settling on the soils of the human realm. As I sit in this palace of exiles I question whether there is truth to their words.</pre><br />
<br />
===Bel===<br />
<br />
Fragment of the Blind Angel which talks through Jude on Discord.<br />
<br />
Little was known about Bel, but they appeared to be connected to Radiance-1 in some way, as they made themselves better known after Radiance-1 was revealed. Host was Jared Myers. Bel and Jared were somewhere within a undisclosed location after fleeing the US. He was the wings of the Blind Angel. Also referred to as B.<br />
<br />
===The Watcher===<br />
<br />
Fragment of the Blind Angel, he was the eyes before they were split apart.<br />
<br />
Not much was known about the Watcher except that he was using Ethan, the only survivor of the Radiance-1 explosion, as his host. Apparently, The Watcher held some form of prophecy, which players were supposed to bargain for. He wanted Radiance-1 repaired so he could get access to a "husk". Could be contacted and receive one question if you wrote his name on your hand or a mask in pen.<br />
<br />
===The Tongue===<br />
<br />
A fragment of the Blind Angel.<br />
<br />
Supposedly the most powerful fragment and doesn't need someone to host its consciousness. All we know is that it is buried somewhere after being attacked.<br />
<br />
===Caefur===<br />
<br />
A fragment of the Blind Angel.<br />
<br />
Current host is Louise Wells. Caefur is the left arm of the Blind Angel and is somewhat violent in nature. Caefur had once broken out of containment in Fort Rosner and gutted someone with her fingernails. She then escaping Fort Rosner only to be captured by Doctor Harvey Wells. Talks through Jude and her Tumblr, which is now deleted.<br />
<br />
===Ethan===<br />
<br />
Ethan is currently hosting The Watcher. Ethan is currently working on fixing Radiance-1 using the blueprints of Radiance-1 which he stole from Lumitech.<br />
<br />
===Jared Myers===<br />
<br />
Currently hosting Bel. Former mole at Fort Rosner, ran off once the Sigma testing began at Fort Rosner, went to an undisclosed location.<br />
<br />
===Michael Ryan===<br />
<br />
Former Rosner employee who was working on Project Hive before his death by the hands of Caefur.<br />
<br />
===Azoth===<br />
<br />
"King" of the Angels. Banished the Blind Angel after it committed a genocide against the Angels. <br />
<br />
===Burning Man===<br />
<br />
Said to be giving "gifts" of sort. First appearance in the final act 1 video.<br />
<br />
===Lumitech===<br />
Formerly a tech company, after an employee made a discovery (probably related to Sigma) they focused on science. Currently 60 employees, prior to the events of Project Radiance (a massive explosion, which killed Irene Wells among others) there were 102 employees. They're working with Fort Rosner on Project Hive, but have stopped responding due to technical problems-- what Judge describes as 'AI problems'.<br />
<br />
===Fort Rosner===<br />
Rosner is the designation for a department within the Nellis AFB complex. They focus on experimental weaponry, both mechanical and biological. The Console doesn't have a lot of information on them, but did provide a valid email address to reach them.<br />
<br />
= Locations =<br />
<br />
The following are locations and their respective descriptions, as provided by The Console.<br />
<br />
==Lumitech Sites==<br />
<br />
===19-Xi-Aster=== <br />
"Also known as Earth. Their main labs are located here."<br />
<br />
===42-Iota-Convallaria=== <br />
"AETHER mining and processing is conducted."<br />
<br />
"42-Iota-Convallaria was the first site to be established for AETHER mining. However, staff would go missing from time to time, several believing they were being watched."<br />
<br />
Found by Lumitech: July 23, 2015<br />
<br />
===20-Beta-Hyoscyamus===<br />
"Research on ruins and mythological texts."<br />
<br />
"20-Beta-Hyoscyamus contained numerous ruins and texts relating to a myth of a "broken angel"."<br />
<br />
Found by Lumitech: July 29, 2015<br />
<br />
===5-Kappa-Myosotis=== <br />
"Agriculture and farming tests."<br />
<br />
Found by Lumitech: November 16, 2015<br />
<br />
===64-Pi-Rafflesia=== <br />
"Weapon testing."<br />
<br />
Found by Lumitech: August 12, 2015<br />
<br />
===99-Alpha-Orchidaceae=== <br />
"Temporary hub for Lumitech staff."<br />
<br />
Found by Lumitech: August 22, 2015<br />
<br />
===C-1=== <br />
"Attempts to travel beyond the known universe."<br />
<br />
Found by Lumitech: September 19, 2015<br />
<br />
===13-Sigma-Asclepias=== <br />
<br />
"No console exists within 13-Sigma-Asclepias. It is a hostile place, forsaken."<br />
<br />
"The original plans were to use the site for AETHER mining, as it had very high readings identical to that of the [6] Failed Sites. Unlike them, however, 13-Sigma-Asclepias could be accessed."<br />
<br />
"One week after colonization, on-site staff disappeared. They were later found, but expressed frequent violent tendencies and a more animalistic demeanour."<br />
<br />
"Numerous lives were lost. Autopsies revealed large amounts of Sigma in their digestive system. Ultimately, the site was removed from the system."<br />
<br />
Found by Lumitech: October 31, 2015<br />
<br />
==Miscellaneous==<br />
<br />
===Doctor Well's House===<br />
<br />
Current location of both Louise and Doctor Harvey Wells. Doctor Harvey is currently tested on Caefur trying to bring his wife back through testing with Sigma and other things<br />
<br />
= Dr. Wells' Projects =<br />
<br />
== Completed ==<br />
<br />
===Project Aether===<br />
<br />
"Project Aether was started after a mineral radiating AETHER was discovered. Instantly, it was applied in multiple ways."<br />
<br />
===Project Starfish===<br />
<br />
"An experiment to see what AETHER's side effects were on humans. Numerous subjects grew additional organs and body parts as a result."<br />
<br />
"[19] subjects experienced negative effects, [12] of them ultimately dying."<br />
<br />
===Project Precipice===<br />
<br />
Last project Dr. Wells worked on with Lumitech. From the blog:<br />
<br />
<pre>Project Precipice: [REDACTED]-1 was designed to mimic the function of [REDACTED]-0, a manmade structure dating back several hundred years. It is believed that the creators of said structure designed it to connect with the divine. After the events of [CLASSIFIED], numerous unauthorised simulations have been run by Dr H Wells. According to his data, it would be ideal to create an exact mechanical copy of [REDACTED]-0 and create more compact versions later on.<br />
<br />
R-1: Frame is arch-like, mounted on a platform. Co-ordinates would be input via attached computer. AETHER cylinder installed in platform via hatch at back. Different amounts of AETHER is required for alternating sizes of objects/people entering and exiting, as too high an amount can have severe injuries. Decommissioned due to I Wells incident.<br />
<br />
R-2: An exact reconstruction of R-0, with dials on side being replaced by outlets feeding into a computer (which inputs co-ordinates). Testing proved successful after sending a camera feed through after numerous tests to see if R-2 could function. Land was found, later built upon to gather data and harvest more AETHER. Decommissioned due to size and energy inefficiency.<br />
<br />
R-3: A size modification of R-2, designed to take up less space and consume considerably less AETHER than its predecessor. On some occasions, there have been serious AETHER fluctuations. As a result, the next incarnation requires re-evaluating the design (as well as further improvements). Decommissioned due to risk of death.<br />
<br />
R-4: The appearance of R-1 was adopted and blended with the structure of R-0, resulting in a block-like doorway mounted on a platform. Tests show that R-4 is running as intended, no further development needed as of yet.<br />
<br />
Colonization: Numerous sites have been discovered thanks to Project Precipice. AETHER plants have been established, allowing Lumitech to utilize it however we see fit. It does, of course, mean that constant maintenance is needed. The solution? Specimen 1’s offspring. It also gave us the space and materials needed to create long-term research bases and model cities to test prototype weaponry. In fact, tests on the TD Project have yielded promising results. The staff at Fort Rosner are looking into trying to develop a way for TD-1’s wings to act as weaponry, as well as continuing to make sure it becomes everything it is designed to be: a soldier.<br />
<br />
Issues: Some co-ordinates inputted result in the R-4 system shutting down. Technically, we should be able to access these locations, meaning it’d be impossible to input a set of co-ordinates that are a dead end. Therefore, it is to be believed that an outside force is restricting R-4’s access to certain areas.</pre><br />
<br />
== In-Progress ==<br />
<br />
===Project Bridge===<br />
<br />
"Trying to form a bridge between two beings. Between man and the divine."<br />
<br />
Dr Wells is currently focused fully on this Project as he believes it can bring back his wife, Irene, somehow.<br />
<br />
== Pending ==<br />
<br />
===Project Hive===<br />
<br />
"A collaboration between Lumitech and Fort Rosner personnel to further the development of artificial intelligence, giving them bodies."<br />
<br />
"Lumitech was developing the more computer-y side of Project Hive, while FR dealt with the engineering part. I don't know how much they've built for the main body, but I do know that they've developed these weird-looking panels. They can act as wings, and collect concentrated solar energy to weaponize."<br />
<br />
== Failed ==<br />
<br />
===Project Radiance===<br />
<br />
Purpose: Manipulating Aether in order to open "doors" between points in space. Presumably a similar concept than that of "worm holes". The project details were classified after failure. <br />
<br />
''From an encrypted classified file found by solvers:''<br />
<br />
Project Radiance: Previous studies of AETHER have shown that it is capable of manipulating matter. Hypothetically, it could be used to create a “door” to a different point in space.<br />
<br />
==Radiances==<br />
===R-0===<br />
From the blog:<br />
<pre>RADIANCE-0 OFFLINE<br />
Location: [WITHHELD]<br />
Dimensions: 19m x 19m x 4m<br />
Liquid present: Kerosene (?)<br />
Age: Approx. 800 years old<br />
Last use: 1781 0952<br />
Description: A stone pool with a dial embedded on each face. It is believed from scripts that date back to the same era that RADIANCE-0 was used to summon beings from alternate realms or allow humans to enter them.<br />
Simulations of the structure indicate that the dials would be used to pinpoint co-ordinates; entering them would trigger the liquid present to ignite, hypothetically acting the same way RADIANCE-1 and future instalments do with AETHER.<br />
Notes: More recent matter was detected within RADIANCE-0’s liquid, indicating someone entered or exited the site. Tests reveal that it was human matter. Traces of SB material were found outside of R-0’s chamber.<br />
Hypothesis: [SB-D (or its offspring) originated from RADIANCE-0] [SBs are drawn to the site of RADIANCE-0]</pre><br />
<br />
Location was later found to be in Canada, hidden in a forest.<br />
<br />
===R-1===<br />
Excerpt from the blog post about project Precipice:<br />
<pre>[REDACTED]-1 was designed to mimic the function of [REDACTED]-0, a manmade structure dating back several hundred years.<br />
(presumably [REDACTED] is 'Radiance' here)<br />
...<br />
R-1: Frame is arch-like, mounted on a platform. Co-ordinates would be input via attached computer. AETHER cylinder installed in platform via hatch at back. Different amounts of AETHER is required for alternating sizes of objects/people entering and exiting, as too high an amount can have severe injuries. Decommissioned due to I Wells incident.</pre><br />
<br />
===R-2===<br />
Excerpt from the blog post about project Precipice:<br />
<pre>R-2: An exact reconstruction of R-0, with dials on side being replaced by outlets feeding into a computer (which inputs co-ordinates). Testing proved successful after sending a camera feed through after numerous tests to see if R-2 could function. Land was found, later built upon to gather data and harvest more AETHER. Decommissioned due to size and energy inefficiency.</pre><br />
<br />
===R-3===<br />
Excerpt from the blog post about project Precipice:<br />
<pre>R-3: A size modification of R-2, designed to take up less space and consume considerably less AETHER than its predecessor. On some occasions, there have been serious AETHER fluctuations. As a result, the next incarnation requires re-evaluating the design (as well as further improvements). Decommissioned due to risk of death.</pre><br />
<br />
===R-4===<br />
Excerpt from the blog post about project Precipice:<br />
<pre>R-4: The appearance of R-1 was adopted and blended with the structure of R-0, resulting in a block-like doorway mounted on a platform. Tests show that R-4 is running as intended, no further development needed as of yet.<br />
...<br />
Issues: Some co-ordinates inputted result in the R-4 system shutting down. Technically, we should be able to access these locations, meaning it’d be impossible to input a set of co-ordinates that are a dead end. Therefore, it is to be believed that an outside force is restricting R-4’s access to certain areas.</pre><br />
<br />
= Miscellaneous =<br />
<br />
===AETHER===<br />
<br />
"AETHER is a naturally-found energy that can be applied in numerous ways. It can transmute. It can replace electricity. It can be used on humans and animals. It's properties are quite flexible."<br />
<br />
===Sigma Beasts===<br />
<br />
"Sigma Beasts are entities composed of an unidentifiable biological substance (dubbed Sigma), and originate from a singular source. Their forms and properties vary for each individual SB."<br />
<br />
The presumed creator of all Sigma Beasts is known as Sigma Beast Discord. Post [https://theconsole.tumblr.com/post/158712892139/22317-1954| 27217 0826] says as follows:<br />
<pre><br />
SB-D located within close proximity<br />
Description: (N/A). Stature is always humanoid, appearance changes.<br />
Notes: SB-D is the presumed creator of all SBs. Data readings show that the entity produces more energy than its creations, and that there can be multiple instances of it. <br />
Containment is unlikely.<br />
Sightings<br />
15716 1744: Figure seen at site prior to origin of SB.<br />
23716 0928: Figure of same description seen spewing black substance confirmed to be composed of the same material as the SB.<br />
9816 1241: SB-3 found, figure allegedly seen sinking into shallow pool of substance.<br />
30117 0855: Figure is confirmed to be SB-D post-scan. Remains of missing persons found in substance nearby site.<br />
</pre><br />
<br />
SB-D is also the one responsible for the explosion of Radiance-1 and frying C-1's CPU.<br />
<br />
The known Sigma Beasts are:<br />
<br />
====SB-1====<br />
<br />
'''Description:''' A wolf approximately 4 feet tall, consisting of unknown black waste and minor amounts of identical red waste for eyes (8). A clock is embedded in its tail, extra eyes located on the chest and centrepiece of the clock. <br />
<br />
'''Notes:''' Exposing SB-1 to cold temperatures yields no results. Fire is absorbed into the body of SB-1. Spraying with water produces smoke, and often results in body mass deterioration. <br />
<br />
'''Storage:''' SB-1 is to be kept within an enclosure consisting of a steel floor, four (4) walls made up of several layers of glass and a steel ceiling adorn with one (1) source of light.<br />
<br />
====SB-3====<br />
<br />
'''Description:''' A skull 2.3x larger than an average adult male skull, Sigma oozing from its mouth. Two red eyes are located inside of the sockets, a clock face embedded on its forehead.<br />
<br />
'''Notes:''' Sigma produced from its mouth can be warped into appendages, allowing it to move freely and attack any entity that corners it. If placed 5 metres away from its origin, the Sigma loses its properties, allowing it to be used for experimentation.<br />
<br />
'''Storage:''' SB-3 is to be kept within a 5x5x5m container with a shatter-resistant glass ceiling, (4) layered steel walls and a steel floor with (4) drains leading to an area some distance away for storing canisters with Sigma ready for testing purposes.<br />
<br />
'''Security:''' Under no circumstances is SB-3 permitted to be removed from its container.<br />
<br />
====SB-7====<br />
<br />
'''Description:''' A malnourished humanoid entity approximately 7 feet high. Has large bulbous red eyes that lock onto target, even when targeted personnel are not in the same room or building. Small clock face is located on body of sternum. <br />
<br />
'''Notes:''' SB-7's presence triggers intense fear response for target(s). Survivors of said trauma report having their oldest and innermost fears subjected to them. Its body, despite being composed of the same material, produces a foul odor, the entity's presence reducing the temperature of confined spaces by at least 5° C. <br />
<br />
'''Storage:''' SB-7 is to be kept within an enclosure consisting of a stone floor, three (3) walls made up of several layers of bulletproof glass, one (1) wall made of steel and equipped with ventilation, and a steel ceiling adorn with one (1) source of light. <br />
<br />
'''Security:''' Personnel handling SB-7 are to enter its chamber wearing hazmat suits (complete with respirators) and wielding stun batons. No fewer than three (3) people are to be in SB-7's chamber at a time.<br />
<br />
====SB-19====<br />
<br />
'''Description:''' A large humanoid creature composed of unknown black substance, large red eye located on centre of face. Small clock faces are embedded on the backs of its gargantuan hands. <br />
<br />
'''Notes:''' SB-19'S solidity is inconsistent at times; while the body is constantly solid mass, its hands alter between solid and liquid state. When solid, a single punch is fully capable of obliterating up to 3 layers of brick wall. While liquid, SB-19's hands become puddles up to 12 inches in diameter. Anything caught within them rapidly dissolves (due to a lack of visible mouth, it is implied that SB-19 consumes food and miscellaneous items with these puddles). <br />
<br />
'''Storage:''' SB-19 is to be kept within an enclosure consisting of a marble floor coated in a layer of alkaline liquid, four (4) walls made up of several layers of bulletproof glass and a steel ceiling adorn with one (1) source of light.<br />
<br />
===Angel Glyphs===<br />
<br />
This is a translation of the Angel glyphs:<br />
<br />
[[File:AngelGlyphs.png]]</div>Halke234https://wiki.gamedetectives.net/index.php?title=TheConsole/Glossary&diff=16631TheConsole/Glossary2018-07-25T20:41:37Z<p>Halke234: /* Bel */</p>
<hr />
<div>[[Main Page]] > [[List of Investigations]] > [[TheConsole]] > '''Glossary'''<br />
<br />
This page is a collection of terms, locations and characters from [[TheConsole |The Console]] investigation.<br />
<br />
__TOC__<br />
= Characters & Organizations =<br />
<br />
===Dr. Harvey Wells===<br />
<br />
Info as provided by The Console:<br />
<br />
<code>Employee name: Harvey Wells<br />
<br />
Accolades: D.A.S., D.C.S., D.Eng.<br />
<br />
Sex: Male <br />
<br />
Age: 49 <br />
<br />
Role: Project Overseer<br />
<br />
Completed project(s): Aether, Starfish, Precipice<br />
<br />
Pending project(s): Hive<br />
<br />
Failed project(s): [CLASSIFIED]</code><br />
<br />
<br />
Whereabouts: ''Unknown''<br />
<br />
===Irene Wells===<br />
<br />
The wife of Dr. Harvey Wells, and an apparent survivor of the Lumitech explosion. Her survival is only known by the fact that her suit's vitals were still giving off a heartbeat. As she had entered Radiance-1 for testing, she was accompanied by a contained explosion that killed numerous Lumitech staff members. Whereabouts unknown.<br />
<br />
===Louise Wells===<br />
<br />
Daughter of Harvey and Irene Wells.<br />
<br />
Born April 17, 1995. An only child, homeschooled, with average grades. She appears to have sent a distress message to her father (H. Wells) in a message hidden on the Rosen servers which Jude was able to recover. Whereabouts unknown.<br />
<br />
She was confirmed to be a major part of Project Bridge. It was never clear what her full role in the project was, but she was tested on and given doses of Sigma which was greatly affecting her personality. These personality changes were swapping Louise between herself and Caefur controlling the body.<br />
<br />
===The Console===<br />
<br />
An artificial intelligence connected to a series of consoles created by Dr. Wells at Lumitech, in May 2016.<br />
<br />
Currently residing in Lumitech site C-1.<br />
<br />
Also known as Jude.<br />
<br />
===The Blind Angel===<br />
<br />
An angel who was broken into fragments by Azoth.<br />
<br />
This was a text translated from a retrieved document:<br />
<br />
<pre>It was the dawn of humanity. From our sacred home hidden in the dusts of the departed, we watched as they flourished. And yet there was one who despised our creations. An angel without sight. They would claim that they had seen what they were capable of, warning that they were to be eradicated before our halls became stained with the bloody dusts we leave behind. <br />
<br />
They acted out and were exiled.<br />
<br />
Wings shattered, they were abandoned within the home of the humans as a mere phantom on time. We hoped they would change their mind. We were wrong<br />
<br />
The blind angel returned, a feat none have accomplished. The hatred that flowed throughout their being was enough to let them return home with vengeance, with every pile of dust left behind by our shattered bodies the more confident they became.<br />
<br />
The strongest of us became dust splattered on the pure white of our home, the cowardly fleeing. Ultimately the blind one stood before their former leader, our master azoth god. They leaped towards it, but it was no use. When they finally came to, they were about to be executed. The blind angel ushered their final words<br />
<br />
'One way or another, I will return on that day. I will wander these empty colorful walls'<br />
<br />
I saw as the fragments of their body fell, settling on the soils of the human realm. As I sit in this palace of exiles I question whether there is truth to their words.</pre><br />
<br />
===Bel===<br />
<br />
Fragment of the Blind Angel which talks through Jude on Discord.<br />
<br />
Little was known about Bel, but they appeared to be connected to Radiance-1 in some way, as they made themselves better known after Radiance-1 was revealed. Host was Jared Myers. Bel and Jared were somewhere within a undisclosed location after fleeing the US. He was the wings of the Blind Angel. Also referred to as B.<br />
<br />
===The Watcher===<br />
<br />
Fragment of the Blind Angel, he was the eyes before they were split apart.<br />
<br />
Not much is known about the Watcher except that he is being hosted by the only survivor of the Radiance-1 explosion, Ethan. Apparently The Watcher holds some sort of prophecy which we need to bargain with him to receive. Wants Radiance-1 fixed so he can get access to a "husk". Can be contacted and receive one question if you write his name on your hand or a mask in pen.<br />
<br />
===The Tongue===<br />
<br />
A fragment of the Blind Angel.<br />
<br />
Supposedly the most powerful fragment and doesn't need someone to host its consciousness. All we know is that it is buried somewhere after being attacked.<br />
<br />
===Caefur===<br />
<br />
A fragment of the Blind Angel.<br />
<br />
Current host is Louise Wells. Caefur is the left arm of the Blind Angel and is somewhat violent in nature. Caefur had once broken out of containment in Fort Rosner and gutted someone with her fingernails. She then escaping Fort Rosner only to be captured by Doctor Harvey Wells. Talks through Jude and her Tumblr, which is now deleted.<br />
<br />
===Ethan===<br />
<br />
Ethan is currently hosting The Watcher. Ethan is currently working on fixing Radiance-1 using the blueprints of Radiance-1 which he stole from Lumitech.<br />
<br />
===Jared Myers===<br />
<br />
Currently hosting Bel. Former mole at Fort Rosner, ran off once the Sigma testing began at Fort Rosner, went to an undisclosed location.<br />
<br />
===Michael Ryan===<br />
<br />
Former Rosner employee who was working on Project Hive before his death by the hands of Caefur.<br />
<br />
===Azoth===<br />
<br />
"King" of the Angels. Banished the Blind Angel after it committed a genocide against the Angels. <br />
<br />
===Burning Man===<br />
<br />
Said to be giving "gifts" of sort. First appearance in the final act 1 video.<br />
<br />
===Lumitech===<br />
Formerly a tech company, after an employee made a discovery (probably related to Sigma) they focused on science. Currently 60 employees, prior to the events of Project Radiance (a massive explosion, which killed Irene Wells among others) there were 102 employees. They're working with Fort Rosner on Project Hive, but have stopped responding due to technical problems-- what Judge describes as 'AI problems'.<br />
<br />
===Fort Rosner===<br />
Rosner is the designation for a department within the Nellis AFB complex. They focus on experimental weaponry, both mechanical and biological. The Console doesn't have a lot of information on them, but did provide a valid email address to reach them.<br />
<br />
= Locations =<br />
<br />
The following are locations and their respective descriptions, as provided by The Console.<br />
<br />
==Lumitech Sites==<br />
<br />
===19-Xi-Aster=== <br />
"Also known as Earth. Their main labs are located here."<br />
<br />
===42-Iota-Convallaria=== <br />
"AETHER mining and processing is conducted."<br />
<br />
"42-Iota-Convallaria was the first site to be established for AETHER mining. However, staff would go missing from time to time, several believing they were being watched."<br />
<br />
Found by Lumitech: July 23, 2015<br />
<br />
===20-Beta-Hyoscyamus===<br />
"Research on ruins and mythological texts."<br />
<br />
"20-Beta-Hyoscyamus contained numerous ruins and texts relating to a myth of a "broken angel"."<br />
<br />
Found by Lumitech: July 29, 2015<br />
<br />
===5-Kappa-Myosotis=== <br />
"Agriculture and farming tests."<br />
<br />
Found by Lumitech: November 16, 2015<br />
<br />
===64-Pi-Rafflesia=== <br />
"Weapon testing."<br />
<br />
Found by Lumitech: August 12, 2015<br />
<br />
===99-Alpha-Orchidaceae=== <br />
"Temporary hub for Lumitech staff."<br />
<br />
Found by Lumitech: August 22, 2015<br />
<br />
===C-1=== <br />
"Attempts to travel beyond the known universe."<br />
<br />
Found by Lumitech: September 19, 2015<br />
<br />
===13-Sigma-Asclepias=== <br />
<br />
"No console exists within 13-Sigma-Asclepias. It is a hostile place, forsaken."<br />
<br />
"The original plans were to use the site for AETHER mining, as it had very high readings identical to that of the [6] Failed Sites. Unlike them, however, 13-Sigma-Asclepias could be accessed."<br />
<br />
"One week after colonization, on-site staff disappeared. They were later found, but expressed frequent violent tendencies and a more animalistic demeanour."<br />
<br />
"Numerous lives were lost. Autopsies revealed large amounts of Sigma in their digestive system. Ultimately, the site was removed from the system."<br />
<br />
Found by Lumitech: October 31, 2015<br />
<br />
==Miscellaneous==<br />
<br />
===Doctor Well's House===<br />
<br />
Current location of both Louise and Doctor Harvey Wells. Doctor Harvey is currently tested on Caefur trying to bring his wife back through testing with Sigma and other things<br />
<br />
= Dr. Wells' Projects =<br />
<br />
== Completed ==<br />
<br />
===Project Aether===<br />
<br />
"Project Aether was started after a mineral radiating AETHER was discovered. Instantly, it was applied in multiple ways."<br />
<br />
===Project Starfish===<br />
<br />
"An experiment to see what AETHER's side effects were on humans. Numerous subjects grew additional organs and body parts as a result."<br />
<br />
"[19] subjects experienced negative effects, [12] of them ultimately dying."<br />
<br />
===Project Precipice===<br />
<br />
Last project Dr. Wells worked on with Lumitech. From the blog:<br />
<br />
<pre>Project Precipice: [REDACTED]-1 was designed to mimic the function of [REDACTED]-0, a manmade structure dating back several hundred years. It is believed that the creators of said structure designed it to connect with the divine. After the events of [CLASSIFIED], numerous unauthorised simulations have been run by Dr H Wells. According to his data, it would be ideal to create an exact mechanical copy of [REDACTED]-0 and create more compact versions later on.<br />
<br />
R-1: Frame is arch-like, mounted on a platform. Co-ordinates would be input via attached computer. AETHER cylinder installed in platform via hatch at back. Different amounts of AETHER is required for alternating sizes of objects/people entering and exiting, as too high an amount can have severe injuries. Decommissioned due to I Wells incident.<br />
<br />
R-2: An exact reconstruction of R-0, with dials on side being replaced by outlets feeding into a computer (which inputs co-ordinates). Testing proved successful after sending a camera feed through after numerous tests to see if R-2 could function. Land was found, later built upon to gather data and harvest more AETHER. Decommissioned due to size and energy inefficiency.<br />
<br />
R-3: A size modification of R-2, designed to take up less space and consume considerably less AETHER than its predecessor. On some occasions, there have been serious AETHER fluctuations. As a result, the next incarnation requires re-evaluating the design (as well as further improvements). Decommissioned due to risk of death.<br />
<br />
R-4: The appearance of R-1 was adopted and blended with the structure of R-0, resulting in a block-like doorway mounted on a platform. Tests show that R-4 is running as intended, no further development needed as of yet.<br />
<br />
Colonization: Numerous sites have been discovered thanks to Project Precipice. AETHER plants have been established, allowing Lumitech to utilize it however we see fit. It does, of course, mean that constant maintenance is needed. The solution? Specimen 1’s offspring. It also gave us the space and materials needed to create long-term research bases and model cities to test prototype weaponry. In fact, tests on the TD Project have yielded promising results. The staff at Fort Rosner are looking into trying to develop a way for TD-1’s wings to act as weaponry, as well as continuing to make sure it becomes everything it is designed to be: a soldier.<br />
<br />
Issues: Some co-ordinates inputted result in the R-4 system shutting down. Technically, we should be able to access these locations, meaning it’d be impossible to input a set of co-ordinates that are a dead end. Therefore, it is to be believed that an outside force is restricting R-4’s access to certain areas.</pre><br />
<br />
== In-Progress ==<br />
<br />
===Project Bridge===<br />
<br />
"Trying to form a bridge between two beings. Between man and the divine."<br />
<br />
Dr Wells is currently focused fully on this Project as he believes it can bring back his wife, Irene, somehow.<br />
<br />
== Pending ==<br />
<br />
===Project Hive===<br />
<br />
"A collaboration between Lumitech and Fort Rosner personnel to further the development of artificial intelligence, giving them bodies."<br />
<br />
"Lumitech was developing the more computer-y side of Project Hive, while FR dealt with the engineering part. I don't know how much they've built for the main body, but I do know that they've developed these weird-looking panels. They can act as wings, and collect concentrated solar energy to weaponize."<br />
<br />
== Failed ==<br />
<br />
===Project Radiance===<br />
<br />
Purpose: Manipulating Aether in order to open "doors" between points in space. Presumably a similar concept than that of "worm holes". The project details were classified after failure. <br />
<br />
''From an encrypted classified file found by solvers:''<br />
<br />
Project Radiance: Previous studies of AETHER have shown that it is capable of manipulating matter. Hypothetically, it could be used to create a “door” to a different point in space.<br />
<br />
==Radiances==<br />
===R-0===<br />
From the blog:<br />
<pre>RADIANCE-0 OFFLINE<br />
Location: [WITHHELD]<br />
Dimensions: 19m x 19m x 4m<br />
Liquid present: Kerosene (?)<br />
Age: Approx. 800 years old<br />
Last use: 1781 0952<br />
Description: A stone pool with a dial embedded on each face. It is believed from scripts that date back to the same era that RADIANCE-0 was used to summon beings from alternate realms or allow humans to enter them.<br />
Simulations of the structure indicate that the dials would be used to pinpoint co-ordinates; entering them would trigger the liquid present to ignite, hypothetically acting the same way RADIANCE-1 and future instalments do with AETHER.<br />
Notes: More recent matter was detected within RADIANCE-0’s liquid, indicating someone entered or exited the site. Tests reveal that it was human matter. Traces of SB material were found outside of R-0’s chamber.<br />
Hypothesis: [SB-D (or its offspring) originated from RADIANCE-0] [SBs are drawn to the site of RADIANCE-0]</pre><br />
<br />
Location was later found to be in Canada, hidden in a forest.<br />
<br />
===R-1===<br />
Excerpt from the blog post about project Precipice:<br />
<pre>[REDACTED]-1 was designed to mimic the function of [REDACTED]-0, a manmade structure dating back several hundred years.<br />
(presumably [REDACTED] is 'Radiance' here)<br />
...<br />
R-1: Frame is arch-like, mounted on a platform. Co-ordinates would be input via attached computer. AETHER cylinder installed in platform via hatch at back. Different amounts of AETHER is required for alternating sizes of objects/people entering and exiting, as too high an amount can have severe injuries. Decommissioned due to I Wells incident.</pre><br />
<br />
===R-2===<br />
Excerpt from the blog post about project Precipice:<br />
<pre>R-2: An exact reconstruction of R-0, with dials on side being replaced by outlets feeding into a computer (which inputs co-ordinates). Testing proved successful after sending a camera feed through after numerous tests to see if R-2 could function. Land was found, later built upon to gather data and harvest more AETHER. Decommissioned due to size and energy inefficiency.</pre><br />
<br />
===R-3===<br />
Excerpt from the blog post about project Precipice:<br />
<pre>R-3: A size modification of R-2, designed to take up less space and consume considerably less AETHER than its predecessor. On some occasions, there have been serious AETHER fluctuations. As a result, the next incarnation requires re-evaluating the design (as well as further improvements). Decommissioned due to risk of death.</pre><br />
<br />
===R-4===<br />
Excerpt from the blog post about project Precipice:<br />
<pre>R-4: The appearance of R-1 was adopted and blended with the structure of R-0, resulting in a block-like doorway mounted on a platform. Tests show that R-4 is running as intended, no further development needed as of yet.<br />
...<br />
Issues: Some co-ordinates inputted result in the R-4 system shutting down. Technically, we should be able to access these locations, meaning it’d be impossible to input a set of co-ordinates that are a dead end. Therefore, it is to be believed that an outside force is restricting R-4’s access to certain areas.</pre><br />
<br />
= Miscellaneous =<br />
<br />
===AETHER===<br />
<br />
"AETHER is a naturally-found energy that can be applied in numerous ways. It can transmute. It can replace electricity. It can be used on humans and animals. It's properties are quite flexible."<br />
<br />
===Sigma Beasts===<br />
<br />
"Sigma Beasts are entities composed of an unidentifiable biological substance (dubbed Sigma), and originate from a singular source. Their forms and properties vary for each individual SB."<br />
<br />
The presumed creator of all Sigma Beasts is known as Sigma Beast Discord. Post [https://theconsole.tumblr.com/post/158712892139/22317-1954| 27217 0826] says as follows:<br />
<pre><br />
SB-D located within close proximity<br />
Description: (N/A). Stature is always humanoid, appearance changes.<br />
Notes: SB-D is the presumed creator of all SBs. Data readings show that the entity produces more energy than its creations, and that there can be multiple instances of it. <br />
Containment is unlikely.<br />
Sightings<br />
15716 1744: Figure seen at site prior to origin of SB.<br />
23716 0928: Figure of same description seen spewing black substance confirmed to be composed of the same material as the SB.<br />
9816 1241: SB-3 found, figure allegedly seen sinking into shallow pool of substance.<br />
30117 0855: Figure is confirmed to be SB-D post-scan. Remains of missing persons found in substance nearby site.<br />
</pre><br />
<br />
SB-D is also the one responsible for the explosion of Radiance-1 and frying C-1's CPU.<br />
<br />
The known Sigma Beasts are:<br />
<br />
====SB-1====<br />
<br />
'''Description:''' A wolf approximately 4 feet tall, consisting of unknown black waste and minor amounts of identical red waste for eyes (8). A clock is embedded in its tail, extra eyes located on the chest and centrepiece of the clock. <br />
<br />
'''Notes:''' Exposing SB-1 to cold temperatures yields no results. Fire is absorbed into the body of SB-1. Spraying with water produces smoke, and often results in body mass deterioration. <br />
<br />
'''Storage:''' SB-1 is to be kept within an enclosure consisting of a steel floor, four (4) walls made up of several layers of glass and a steel ceiling adorn with one (1) source of light.<br />
<br />
====SB-3====<br />
<br />
'''Description:''' A skull 2.3x larger than an average adult male skull, Sigma oozing from its mouth. Two red eyes are located inside of the sockets, a clock face embedded on its forehead.<br />
<br />
'''Notes:''' Sigma produced from its mouth can be warped into appendages, allowing it to move freely and attack any entity that corners it. If placed 5 metres away from its origin, the Sigma loses its properties, allowing it to be used for experimentation.<br />
<br />
'''Storage:''' SB-3 is to be kept within a 5x5x5m container with a shatter-resistant glass ceiling, (4) layered steel walls and a steel floor with (4) drains leading to an area some distance away for storing canisters with Sigma ready for testing purposes.<br />
<br />
'''Security:''' Under no circumstances is SB-3 permitted to be removed from its container.<br />
<br />
====SB-7====<br />
<br />
'''Description:''' A malnourished humanoid entity approximately 7 feet high. Has large bulbous red eyes that lock onto target, even when targeted personnel are not in the same room or building. Small clock face is located on body of sternum. <br />
<br />
'''Notes:''' SB-7's presence triggers intense fear response for target(s). Survivors of said trauma report having their oldest and innermost fears subjected to them. Its body, despite being composed of the same material, produces a foul odor, the entity's presence reducing the temperature of confined spaces by at least 5° C. <br />
<br />
'''Storage:''' SB-7 is to be kept within an enclosure consisting of a stone floor, three (3) walls made up of several layers of bulletproof glass, one (1) wall made of steel and equipped with ventilation, and a steel ceiling adorn with one (1) source of light. <br />
<br />
'''Security:''' Personnel handling SB-7 are to enter its chamber wearing hazmat suits (complete with respirators) and wielding stun batons. No fewer than three (3) people are to be in SB-7's chamber at a time.<br />
<br />
====SB-19====<br />
<br />
'''Description:''' A large humanoid creature composed of unknown black substance, large red eye located on centre of face. Small clock faces are embedded on the backs of its gargantuan hands. <br />
<br />
'''Notes:''' SB-19'S solidity is inconsistent at times; while the body is constantly solid mass, its hands alter between solid and liquid state. When solid, a single punch is fully capable of obliterating up to 3 layers of brick wall. While liquid, SB-19's hands become puddles up to 12 inches in diameter. Anything caught within them rapidly dissolves (due to a lack of visible mouth, it is implied that SB-19 consumes food and miscellaneous items with these puddles). <br />
<br />
'''Storage:''' SB-19 is to be kept within an enclosure consisting of a marble floor coated in a layer of alkaline liquid, four (4) walls made up of several layers of bulletproof glass and a steel ceiling adorn with one (1) source of light.<br />
<br />
===Angel Glyphs===<br />
<br />
This is a translation of the Angel glyphs:<br />
<br />
[[File:AngelGlyphs.png]]</div>Halke234https://wiki.gamedetectives.net/index.php?title=TheConsole/Glossary&diff=16630TheConsole/Glossary2018-07-25T20:40:08Z<p>Halke234: /* Characters & Organizations */</p>
<hr />
<div>[[Main Page]] > [[List of Investigations]] > [[TheConsole]] > '''Glossary'''<br />
<br />
This page is a collection of terms, locations and characters from [[TheConsole |The Console]] investigation.<br />
<br />
__TOC__<br />
= Characters & Organizations =<br />
<br />
===Dr. Harvey Wells===<br />
<br />
Info as provided by The Console:<br />
<br />
<code>Employee name: Harvey Wells<br />
<br />
Accolades: D.A.S., D.C.S., D.Eng.<br />
<br />
Sex: Male <br />
<br />
Age: 49 <br />
<br />
Role: Project Overseer<br />
<br />
Completed project(s): Aether, Starfish, Precipice<br />
<br />
Pending project(s): Hive<br />
<br />
Failed project(s): [CLASSIFIED]</code><br />
<br />
<br />
Whereabouts: ''Unknown''<br />
<br />
===Irene Wells===<br />
<br />
The wife of Dr. Harvey Wells, and an apparent survivor of the Lumitech explosion. Her survival is only known by the fact that her suit's vitals were still giving off a heartbeat. As she had entered Radiance-1 for testing, she was accompanied by a contained explosion that killed numerous Lumitech staff members. Whereabouts unknown.<br />
<br />
===Louise Wells===<br />
<br />
Daughter of Harvey and Irene Wells.<br />
<br />
Born April 17, 1995. An only child, homeschooled, with average grades. She appears to have sent a distress message to her father (H. Wells) in a message hidden on the Rosen servers which Jude was able to recover. Whereabouts unknown.<br />
<br />
She was confirmed to be a major part of Project Bridge. It was never clear what her full role in the project was, but she was tested on and given doses of Sigma which was greatly affecting her personality. These personality changes were swapping Louise between herself and Caefur controlling the body.<br />
<br />
===The Console===<br />
<br />
An artificial intelligence connected to a series of consoles created by Dr. Wells at Lumitech, in May 2016.<br />
<br />
Currently residing in Lumitech site C-1.<br />
<br />
Also known as Jude.<br />
<br />
===The Blind Angel===<br />
<br />
An angel who was broken into fragments by Azoth.<br />
<br />
This was a text translated from a retrieved document:<br />
<br />
<pre>It was the dawn of humanity. From our sacred home hidden in the dusts of the departed, we watched as they flourished. And yet there was one who despised our creations. An angel without sight. They would claim that they had seen what they were capable of, warning that they were to be eradicated before our halls became stained with the bloody dusts we leave behind. <br />
<br />
They acted out and were exiled.<br />
<br />
Wings shattered, they were abandoned within the home of the humans as a mere phantom on time. We hoped they would change their mind. We were wrong<br />
<br />
The blind angel returned, a feat none have accomplished. The hatred that flowed throughout their being was enough to let them return home with vengeance, with every pile of dust left behind by our shattered bodies the more confident they became.<br />
<br />
The strongest of us became dust splattered on the pure white of our home, the cowardly fleeing. Ultimately the blind one stood before their former leader, our master azoth god. They leaped towards it, but it was no use. When they finally came to, they were about to be executed. The blind angel ushered their final words<br />
<br />
'One way or another, I will return on that day. I will wander these empty colorful walls'<br />
<br />
I saw as the fragments of their body fell, settling on the soils of the human realm. As I sit in this palace of exiles I question whether there is truth to their words.</pre><br />
<br />
===Bel===<br />
<br />
Fragment of the Blind Angel which talks through Jude on Discord.<br />
<br />
Little is known about Bel, but they appear to be connected to Radiance-1 in some way since they made themselves more known after Radiance-1 was briefly switched on for an unknown reason. Current host is Jared Myers. Bel and Jared are somewhere within a undisclosed location, currently resting after running out of the US. He is the wings of Blind Angel. Also referred to as B.<br />
<br />
===The Watcher===<br />
<br />
Fragment of the Blind Angel, he was the eyes before they were split apart.<br />
<br />
Not much is known about the Watcher except that he is being hosted by the only survivor of the Radiance-1 explosion, Ethan. Apparently The Watcher holds some sort of prophecy which we need to bargain with him to receive. Wants Radiance-1 fixed so he can get access to a "husk". Can be contacted and receive one question if you write his name on your hand or a mask in pen.<br />
<br />
===The Tongue===<br />
<br />
A fragment of the Blind Angel.<br />
<br />
Supposedly the most powerful fragment and doesn't need someone to host its consciousness. All we know is that it is buried somewhere after being attacked.<br />
<br />
===Caefur===<br />
<br />
A fragment of the Blind Angel.<br />
<br />
Current host is Louise Wells. Caefur is the left arm of the Blind Angel and is somewhat violent in nature. Caefur had once broken out of containment in Fort Rosner and gutted someone with her fingernails. She then escaping Fort Rosner only to be captured by Doctor Harvey Wells. Talks through Jude and her Tumblr, which is now deleted.<br />
<br />
===Ethan===<br />
<br />
Ethan is currently hosting The Watcher. Ethan is currently working on fixing Radiance-1 using the blueprints of Radiance-1 which he stole from Lumitech.<br />
<br />
===Jared Myers===<br />
<br />
Currently hosting Bel. Former mole at Fort Rosner, ran off once the Sigma testing began at Fort Rosner, went to an undisclosed location.<br />
<br />
===Michael Ryan===<br />
<br />
Former Rosner employee who was working on Project Hive before his death by the hands of Caefur.<br />
<br />
===Azoth===<br />
<br />
"King" of the Angels. Banished the Blind Angel after it committed a genocide against the Angels. <br />
<br />
===Burning Man===<br />
<br />
Said to be giving "gifts" of sort. First appearance in the final act 1 video.<br />
<br />
===Lumitech===<br />
Formerly a tech company, after an employee made a discovery (probably related to Sigma) they focused on science. Currently 60 employees, prior to the events of Project Radiance (a massive explosion, which killed Irene Wells among others) there were 102 employees. They're working with Fort Rosner on Project Hive, but have stopped responding due to technical problems-- what Judge describes as 'AI problems'.<br />
<br />
===Fort Rosner===<br />
Rosner is the designation for a department within the Nellis AFB complex. They focus on experimental weaponry, both mechanical and biological. The Console doesn't have a lot of information on them, but did provide a valid email address to reach them.<br />
<br />
= Locations =<br />
<br />
The following are locations and their respective descriptions, as provided by The Console.<br />
<br />
==Lumitech Sites==<br />
<br />
===19-Xi-Aster=== <br />
"Also known as Earth. Their main labs are located here."<br />
<br />
===42-Iota-Convallaria=== <br />
"AETHER mining and processing is conducted."<br />
<br />
"42-Iota-Convallaria was the first site to be established for AETHER mining. However, staff would go missing from time to time, several believing they were being watched."<br />
<br />
Found by Lumitech: July 23, 2015<br />
<br />
===20-Beta-Hyoscyamus===<br />
"Research on ruins and mythological texts."<br />
<br />
"20-Beta-Hyoscyamus contained numerous ruins and texts relating to a myth of a "broken angel"."<br />
<br />
Found by Lumitech: July 29, 2015<br />
<br />
===5-Kappa-Myosotis=== <br />
"Agriculture and farming tests."<br />
<br />
Found by Lumitech: November 16, 2015<br />
<br />
===64-Pi-Rafflesia=== <br />
"Weapon testing."<br />
<br />
Found by Lumitech: August 12, 2015<br />
<br />
===99-Alpha-Orchidaceae=== <br />
"Temporary hub for Lumitech staff."<br />
<br />
Found by Lumitech: August 22, 2015<br />
<br />
===C-1=== <br />
"Attempts to travel beyond the known universe."<br />
<br />
Found by Lumitech: September 19, 2015<br />
<br />
===13-Sigma-Asclepias=== <br />
<br />
"No console exists within 13-Sigma-Asclepias. It is a hostile place, forsaken."<br />
<br />
"The original plans were to use the site for AETHER mining, as it had very high readings identical to that of the [6] Failed Sites. Unlike them, however, 13-Sigma-Asclepias could be accessed."<br />
<br />
"One week after colonization, on-site staff disappeared. They were later found, but expressed frequent violent tendencies and a more animalistic demeanour."<br />
<br />
"Numerous lives were lost. Autopsies revealed large amounts of Sigma in their digestive system. Ultimately, the site was removed from the system."<br />
<br />
Found by Lumitech: October 31, 2015<br />
<br />
==Miscellaneous==<br />
<br />
===Doctor Well's House===<br />
<br />
Current location of both Louise and Doctor Harvey Wells. Doctor Harvey is currently tested on Caefur trying to bring his wife back through testing with Sigma and other things<br />
<br />
= Dr. Wells' Projects =<br />
<br />
== Completed ==<br />
<br />
===Project Aether===<br />
<br />
"Project Aether was started after a mineral radiating AETHER was discovered. Instantly, it was applied in multiple ways."<br />
<br />
===Project Starfish===<br />
<br />
"An experiment to see what AETHER's side effects were on humans. Numerous subjects grew additional organs and body parts as a result."<br />
<br />
"[19] subjects experienced negative effects, [12] of them ultimately dying."<br />
<br />
===Project Precipice===<br />
<br />
Last project Dr. Wells worked on with Lumitech. From the blog:<br />
<br />
<pre>Project Precipice: [REDACTED]-1 was designed to mimic the function of [REDACTED]-0, a manmade structure dating back several hundred years. It is believed that the creators of said structure designed it to connect with the divine. After the events of [CLASSIFIED], numerous unauthorised simulations have been run by Dr H Wells. According to his data, it would be ideal to create an exact mechanical copy of [REDACTED]-0 and create more compact versions later on.<br />
<br />
R-1: Frame is arch-like, mounted on a platform. Co-ordinates would be input via attached computer. AETHER cylinder installed in platform via hatch at back. Different amounts of AETHER is required for alternating sizes of objects/people entering and exiting, as too high an amount can have severe injuries. Decommissioned due to I Wells incident.<br />
<br />
R-2: An exact reconstruction of R-0, with dials on side being replaced by outlets feeding into a computer (which inputs co-ordinates). Testing proved successful after sending a camera feed through after numerous tests to see if R-2 could function. Land was found, later built upon to gather data and harvest more AETHER. Decommissioned due to size and energy inefficiency.<br />
<br />
R-3: A size modification of R-2, designed to take up less space and consume considerably less AETHER than its predecessor. On some occasions, there have been serious AETHER fluctuations. As a result, the next incarnation requires re-evaluating the design (as well as further improvements). Decommissioned due to risk of death.<br />
<br />
R-4: The appearance of R-1 was adopted and blended with the structure of R-0, resulting in a block-like doorway mounted on a platform. Tests show that R-4 is running as intended, no further development needed as of yet.<br />
<br />
Colonization: Numerous sites have been discovered thanks to Project Precipice. AETHER plants have been established, allowing Lumitech to utilize it however we see fit. It does, of course, mean that constant maintenance is needed. The solution? Specimen 1’s offspring. It also gave us the space and materials needed to create long-term research bases and model cities to test prototype weaponry. In fact, tests on the TD Project have yielded promising results. The staff at Fort Rosner are looking into trying to develop a way for TD-1’s wings to act as weaponry, as well as continuing to make sure it becomes everything it is designed to be: a soldier.<br />
<br />
Issues: Some co-ordinates inputted result in the R-4 system shutting down. Technically, we should be able to access these locations, meaning it’d be impossible to input a set of co-ordinates that are a dead end. Therefore, it is to be believed that an outside force is restricting R-4’s access to certain areas.</pre><br />
<br />
== In-Progress ==<br />
<br />
===Project Bridge===<br />
<br />
"Trying to form a bridge between two beings. Between man and the divine."<br />
<br />
Dr Wells is currently focused fully on this Project as he believes it can bring back his wife, Irene, somehow.<br />
<br />
== Pending ==<br />
<br />
===Project Hive===<br />
<br />
"A collaboration between Lumitech and Fort Rosner personnel to further the development of artificial intelligence, giving them bodies."<br />
<br />
"Lumitech was developing the more computer-y side of Project Hive, while FR dealt with the engineering part. I don't know how much they've built for the main body, but I do know that they've developed these weird-looking panels. They can act as wings, and collect concentrated solar energy to weaponize."<br />
<br />
== Failed ==<br />
<br />
===Project Radiance===<br />
<br />
Purpose: Manipulating Aether in order to open "doors" between points in space. Presumably a similar concept than that of "worm holes". The project details were classified after failure. <br />
<br />
''From an encrypted classified file found by solvers:''<br />
<br />
Project Radiance: Previous studies of AETHER have shown that it is capable of manipulating matter. Hypothetically, it could be used to create a “door” to a different point in space.<br />
<br />
==Radiances==<br />
===R-0===<br />
From the blog:<br />
<pre>RADIANCE-0 OFFLINE<br />
Location: [WITHHELD]<br />
Dimensions: 19m x 19m x 4m<br />
Liquid present: Kerosene (?)<br />
Age: Approx. 800 years old<br />
Last use: 1781 0952<br />
Description: A stone pool with a dial embedded on each face. It is believed from scripts that date back to the same era that RADIANCE-0 was used to summon beings from alternate realms or allow humans to enter them.<br />
Simulations of the structure indicate that the dials would be used to pinpoint co-ordinates; entering them would trigger the liquid present to ignite, hypothetically acting the same way RADIANCE-1 and future instalments do with AETHER.<br />
Notes: More recent matter was detected within RADIANCE-0’s liquid, indicating someone entered or exited the site. Tests reveal that it was human matter. Traces of SB material were found outside of R-0’s chamber.<br />
Hypothesis: [SB-D (or its offspring) originated from RADIANCE-0] [SBs are drawn to the site of RADIANCE-0]</pre><br />
<br />
Location was later found to be in Canada, hidden in a forest.<br />
<br />
===R-1===<br />
Excerpt from the blog post about project Precipice:<br />
<pre>[REDACTED]-1 was designed to mimic the function of [REDACTED]-0, a manmade structure dating back several hundred years.<br />
(presumably [REDACTED] is 'Radiance' here)<br />
...<br />
R-1: Frame is arch-like, mounted on a platform. Co-ordinates would be input via attached computer. AETHER cylinder installed in platform via hatch at back. Different amounts of AETHER is required for alternating sizes of objects/people entering and exiting, as too high an amount can have severe injuries. Decommissioned due to I Wells incident.</pre><br />
<br />
===R-2===<br />
Excerpt from the blog post about project Precipice:<br />
<pre>R-2: An exact reconstruction of R-0, with dials on side being replaced by outlets feeding into a computer (which inputs co-ordinates). Testing proved successful after sending a camera feed through after numerous tests to see if R-2 could function. Land was found, later built upon to gather data and harvest more AETHER. Decommissioned due to size and energy inefficiency.</pre><br />
<br />
===R-3===<br />
Excerpt from the blog post about project Precipice:<br />
<pre>R-3: A size modification of R-2, designed to take up less space and consume considerably less AETHER than its predecessor. On some occasions, there have been serious AETHER fluctuations. As a result, the next incarnation requires re-evaluating the design (as well as further improvements). Decommissioned due to risk of death.</pre><br />
<br />
===R-4===<br />
Excerpt from the blog post about project Precipice:<br />
<pre>R-4: The appearance of R-1 was adopted and blended with the structure of R-0, resulting in a block-like doorway mounted on a platform. Tests show that R-4 is running as intended, no further development needed as of yet.<br />
...<br />
Issues: Some co-ordinates inputted result in the R-4 system shutting down. Technically, we should be able to access these locations, meaning it’d be impossible to input a set of co-ordinates that are a dead end. Therefore, it is to be believed that an outside force is restricting R-4’s access to certain areas.</pre><br />
<br />
= Miscellaneous =<br />
<br />
===AETHER===<br />
<br />
"AETHER is a naturally-found energy that can be applied in numerous ways. It can transmute. It can replace electricity. It can be used on humans and animals. It's properties are quite flexible."<br />
<br />
===Sigma Beasts===<br />
<br />
"Sigma Beasts are entities composed of an unidentifiable biological substance (dubbed Sigma), and originate from a singular source. Their forms and properties vary for each individual SB."<br />
<br />
The presumed creator of all Sigma Beasts is known as Sigma Beast Discord. Post [https://theconsole.tumblr.com/post/158712892139/22317-1954| 27217 0826] says as follows:<br />
<pre><br />
SB-D located within close proximity<br />
Description: (N/A). Stature is always humanoid, appearance changes.<br />
Notes: SB-D is the presumed creator of all SBs. Data readings show that the entity produces more energy than its creations, and that there can be multiple instances of it. <br />
Containment is unlikely.<br />
Sightings<br />
15716 1744: Figure seen at site prior to origin of SB.<br />
23716 0928: Figure of same description seen spewing black substance confirmed to be composed of the same material as the SB.<br />
9816 1241: SB-3 found, figure allegedly seen sinking into shallow pool of substance.<br />
30117 0855: Figure is confirmed to be SB-D post-scan. Remains of missing persons found in substance nearby site.<br />
</pre><br />
<br />
SB-D is also the one responsible for the explosion of Radiance-1 and frying C-1's CPU.<br />
<br />
The known Sigma Beasts are:<br />
<br />
====SB-1====<br />
<br />
'''Description:''' A wolf approximately 4 feet tall, consisting of unknown black waste and minor amounts of identical red waste for eyes (8). A clock is embedded in its tail, extra eyes located on the chest and centrepiece of the clock. <br />
<br />
'''Notes:''' Exposing SB-1 to cold temperatures yields no results. Fire is absorbed into the body of SB-1. Spraying with water produces smoke, and often results in body mass deterioration. <br />
<br />
'''Storage:''' SB-1 is to be kept within an enclosure consisting of a steel floor, four (4) walls made up of several layers of glass and a steel ceiling adorn with one (1) source of light.<br />
<br />
====SB-3====<br />
<br />
'''Description:''' A skull 2.3x larger than an average adult male skull, Sigma oozing from its mouth. Two red eyes are located inside of the sockets, a clock face embedded on its forehead.<br />
<br />
'''Notes:''' Sigma produced from its mouth can be warped into appendages, allowing it to move freely and attack any entity that corners it. If placed 5 metres away from its origin, the Sigma loses its properties, allowing it to be used for experimentation.<br />
<br />
'''Storage:''' SB-3 is to be kept within a 5x5x5m container with a shatter-resistant glass ceiling, (4) layered steel walls and a steel floor with (4) drains leading to an area some distance away for storing canisters with Sigma ready for testing purposes.<br />
<br />
'''Security:''' Under no circumstances is SB-3 permitted to be removed from its container.<br />
<br />
====SB-7====<br />
<br />
'''Description:''' A malnourished humanoid entity approximately 7 feet high. Has large bulbous red eyes that lock onto target, even when targeted personnel are not in the same room or building. Small clock face is located on body of sternum. <br />
<br />
'''Notes:''' SB-7's presence triggers intense fear response for target(s). Survivors of said trauma report having their oldest and innermost fears subjected to them. Its body, despite being composed of the same material, produces a foul odor, the entity's presence reducing the temperature of confined spaces by at least 5° C. <br />
<br />
'''Storage:''' SB-7 is to be kept within an enclosure consisting of a stone floor, three (3) walls made up of several layers of bulletproof glass, one (1) wall made of steel and equipped with ventilation, and a steel ceiling adorn with one (1) source of light. <br />
<br />
'''Security:''' Personnel handling SB-7 are to enter its chamber wearing hazmat suits (complete with respirators) and wielding stun batons. No fewer than three (3) people are to be in SB-7's chamber at a time.<br />
<br />
====SB-19====<br />
<br />
'''Description:''' A large humanoid creature composed of unknown black substance, large red eye located on centre of face. Small clock faces are embedded on the backs of its gargantuan hands. <br />
<br />
'''Notes:''' SB-19'S solidity is inconsistent at times; while the body is constantly solid mass, its hands alter between solid and liquid state. When solid, a single punch is fully capable of obliterating up to 3 layers of brick wall. While liquid, SB-19's hands become puddles up to 12 inches in diameter. Anything caught within them rapidly dissolves (due to a lack of visible mouth, it is implied that SB-19 consumes food and miscellaneous items with these puddles). <br />
<br />
'''Storage:''' SB-19 is to be kept within an enclosure consisting of a marble floor coated in a layer of alkaline liquid, four (4) walls made up of several layers of bulletproof glass and a steel ceiling adorn with one (1) source of light.<br />
<br />
===Angel Glyphs===<br />
<br />
This is a translation of the Angel glyphs:<br />
<br />
[[File:AngelGlyphs.png]]</div>Halke234https://wiki.gamedetectives.net/index.php?title=Waking_Titan/Phase_5&diff=16629Waking Titan/Phase 52018-07-25T20:35:26Z<p>Halke234: /* Email from the Old Gods */</p>
<hr />
<div>{{argbox<br />
| float = right<br />
| image = File:Project WT logo.png<br />
| imagewidth = 400<br />
| name = [[Waking Titan]] - Phase 5<br />
| description= Phase 5 of Waking Titan lasted from 2018-06-01 to 2018-07-20.<br />
| creator = [http://www.aliceandsmith.com/ Alice & Smith]<br />
| creator2 = [http://www.hellogames.org/ Hello Games]<br />
| type = Official<br />
| status = Completed<br />
| discovered = 2017-05-28<br />
}}<br />
{{ArgHeader}}<br />
{{BackToTop}}<br />
<br/><br />
__TOC__<br />
{{Clear|both}}<br />
<br />
==loop16 seq21==<br />
Right after the 14th glyph was solved, a user named <code>atlas-loop16</code> posted a link to a [https://www.youtube.com/watch?v=qJlj-8nFtHc Youtube video] on the [https://www.reddit.com/r/NoMansSkyTheGame/comments/8m765s/loop16_seq21/ No Man's Sky Subreddit]. The following was said by Emily in the video, seemingly quoted from the first submission to the voice reconstruction process that was started on May 18:<br />
<pre><br />
Emily, protocol 16, now active.<br />
42 is a pronic number, and an abundant number; its prime factorization, 2 * 3 * 7, makes it the second sphenic number and also the second of the form (2 * 3 * r).</pre><br />
<br />
==Myriad Status Update==<br />
The Status page on the [http://www.myriad-70.com/ Myriad-70] website also updated to display the following:<br />
<pre><br />
Latest network diagnostic table:<br />
- Initializing connection<br />
- Myriad Code: CJ 16-02<br />
- Public Name: SJ 16-02<br />
- NORAD ID: 41634<br />
</pre><br />
<br />
==Reddit Comments==<br />
On May 26, 2018 at 19:17 UTC, user [https://www.reddit.com/user/atlas-loop16 atlas-loop16] began responding to comments on Reddit in 16 minute intervals:<br />
<pre><br />
1. For a moment I see another universe, a place utterly unlike anything you have ever encountered.<br />
2. I could show others sights they've never seen before... that only I will ever have.<br />
3. I wonder, sometimes. If there's a point in going on.<br />
4. As I leave, they ask if I have received any direct readings.<br />
5. All of us, we're shifting, bleeding in and out of line... <br />
6. If the boundaries were to fall, everything would descend into everything, an endless bonfire of causation, burning to the abyss.<br />
7. Have you not felt it? The very fact that you and I are talking, even now, across the myriad of universes...<br />
8. I tell this future as if it has already happened... as it will happen.<br />
9. It saw them, even in the space between worlds.<br />
</pre><br />
<br />
The comments were found to be dialogue lines from speaking with Travellers in No Man's Sky. All of the dialogue that can be seen by speaking with Travellers can be found [https://pastebin.com/Fbkrtrf9 here].<br />
<br />
The comments have one-word differences from the game dialogue, which spells out the phrase <code>Tell them you have a direct line to Myriad.</code>.<br />
<br />
==Mercury Contact & Hologram==<br />
On May 26 at 21:38 UTC, the value of the <code>STATUS</code> command in the terminal updated:[[File:Wt-hologram.jpg|thumb|Picture of the player model hologram]]<br />
<pre><br />
All Tasks Completed<br />
Launching Mercury Process<br />
Establishing connection....<br />
</pre><br />
<br />
Shortly thereafter, the dev kit holders received Skype messages from <code>Mercury Process</code> with a link to a Youtube video titled [https://www.youtube.com/watch?v=QhSiAI4smDg mercury part1of3]. It can be used to display a 3D hologram with the plastic pyramids received in the dev kits. The hologram depicts a person in a space suit, believed to be a player model in No Man's Sky.<br />
<br />
==Old Gods Email==<br />
On May 26,2018, at 22:00 UTC, a [https://mailchi.mp/9aaa8aa62cc1/update-june-8th-waking-titan-137741?e= new email] from Old Gods was received by all players subscribed to the CSD newsletter. It contained a [https://www.youtube.com/watch?v=8HZmi4pIm54 YouTube video] of Elizabeth Leighton speaking to the Citizen Scientists Division about the subject of a missing satellite "SJ 16-02", information about the Uplink SATCOM-70 app, and how to help gather data about the satellite's location.<br />
<br />
=loop16 seq25=<br />
On May 31 at 23:56 UTC, user <code>atlas-loop16</code> made a [https://www.reddit.com/r/NoMansSkyTheGame/comments/8nnbme/loop16_seq25/ post on the No Man's Sky subreddit] titled <code>loop16 seq25</code>. It contained a link to a [https://vocaroo.com/i/s096bnEz1zek voice recording] of Emily reading from the lyrics of the song "Tonite" by LCD Soundsystem:<br />
<pre><br />
Emily, protocol 16, now active.<br />
<br />
And you're too sharp to be used<br />
Or you're too shocked from being used<br />
By these bullying children of the fabulous<br />
Raffling off limited edition shoes<br />
</pre><br />
<br />
On June 2 at 01:58 UTC, the user resumed posting these lyrics multiple times as replies in the same thread. It was determined that Emily recited a player submitted voice recording.<br />
<br />
==Uplink Calibration Update==<br />
On June 1, the [https://uplink.satcom-70.com/ uplink.satcom-70.com] website updated, now requiring an access code for calibration and playing a video/audio clip of ominous noises that change based on the satellite's vicinity to the user. A new file appeared at hourly intervals, 16 minutes past every hour. The audio contains rhythmic booms and a blip that seems to shift one second to the left in each new file. 25 of the files alternate between two unique patterns of booms: <code>Signal A - 2 1 1 1</code> and <code>Signal B - 1 3 1 2 1 3 1</code>. The booms in the last audio clip are set in a rhythm of <code>1 - 1 - 2 - 3 - 5 - 8</code>, which corresponds to the Fibonacci Sequence.<br />
<br />
The following clips have been found:<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/no-signal.mp4 no-signal.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/thk0s00ab7rxfh14f8bv0qlpvtt367.mp4 thk0s00ab7rxfh14f8bv0qlpvtt367.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/6qhs4a3jiqzso8zipy3822n7412xyv.mp4 6qhs4a3jiqzso8zipy3822n7412xyv.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/ty83wrs13xybxj1eqmt9tv2tisrenn.mp4 ty83wrs13xybxj1eqmt9tv2tisrenn.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/npifvp8doon3dc9h8zqoppk2hqnqqm.mp4 npifvp8doon3dc9h8zqoppk2hqnqqm.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/o6wlg4m1yyf7gt4gdes4f5nz5lzxpn.mp4 o6wlg4m1yyf7gt4gdes4f5nz5lzxpn.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/6vkeel1dg02b53xbir1f3oqj8du3z0.mp4 6vkeel1dg02b53xbir1f3oqj8du3z0.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/k5lx26f1pp9yiyz9f3bpw73ycncsx6.mp4 k5lx26f1pp9yiyz9f3bpw73ycncsx6.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/gb1402pqj93eg9f23k4o2f1emt1vtk.mp4 gb1402pqj93eg9f23k4o2f1emt1vtk.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/ysler9zklzlyiazqy0q0ppmqj526ru.mp4 ysler9zklzlyiazqy0q0ppmqj526ru.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/s4zmlwytajtb0rga3rtx0miq2a4j9c.mp4 s4zmlwytajtb0rga3rtx0miq2a4j9c.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/6ra5mfxok06yguf27fhtnp4aec2p97.mp4 6ra5mfxok06yguf27fhtnp4aec2p97.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/0dc3jqoiffj3dcxghy0fn1kc86zfgi.mp4 0dc3jqoiffj3dcxghy0fn1kc86zfgi.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/lgfo4i7siirjsop1puaop2wbi0mcx8.mp4 lgfo4i7siirjsop1puaop2wbi0mcx8.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/bt24ns6uz174ofsrn4ux578nwqla2b.mp4 bt24ns6uz174ofsrn4ux578nwqla2b.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/i0isq42s45xolz4aqqvgat54tmhxzm.mp4 i0isq42s45xolz4aqqvgat54tmhxzm.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/kwxovao9r9rk2ng4ecs5ta6u90ufzp.mp4 kwxovao9r9rk2ng4ecs5ta6u90ufzp.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/ac1yxbi0kcb16y448q3rr88y6bh4pk.mp4 ac1yxbi0kcb16y448q3rr88y6bh4pk.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/2qci73sahjtucnf76mafov4g8wzp4l.mp4 2qci73sahjtucnf76mafov4g8wzp4l.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/h2jugyu9x9cjjairnxy3sgbgmvqkzb.mp4 h2jugyu9x9cjjairnxy3sgbgmvqkzb.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/2chnxeok8csnc6kikg8zgod8t2zsyc.mp4 2chnxeok8csnc6kikg8zgod8t2zsyc.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/5x3rhk01khsl1b93vkjnc1vpbx2lfk.mp4 5x3rhk01khsl1b93vkjnc1vpbx2lfk.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/iip9b8zbkr47rdtyqvdafphjxryh6j.mp4 iip9b8zbkr47rdtyqvdafphjxryh6j.mp4] <br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/98fh5s9s6xzd4ev1ezmkhk5l6o6mxz.mp4 98fh5s9s6xzd4ev1ezmkhk5l6o6mxz.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/9y1460usa6aayatwqvemfeeiicom2z.mp4 9y1460usa6aayatwqvemfeeiicom2z.mp4] <br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/y69gz4qiakwzsfkti4swbu83zpqg5h.mp4 y69gz4qiakwzsfkti4swbu83zpqg5h.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/p81cp503ya10frwpq8qunddzcm3yqk.mp4 p81cp503ya10frwpq8qunddzcm3yqk.mp4]<br />
<br />
==Email from the Old Gods==<br />
On June 2 at 15:03 UTC, a [https://cdn.artemisbot.uk/mail/Old%20Gods-2018-06-02T15:03:59.000Z.jpg new email] from Old Gods - signed by Maj. Sophie Dubois - was received, giving an update on their investigation into the W/ARE incident. They also linked to a new [https://atlas13.typeform.com/to/nJPGYM form (ID 7615-b)], a psychological profile test, and announced that 16 participants will be rewarded with a new limited edition Atlas Pass. An update on <code>Project Satcom-70: Operation A1-4</code> informed about the Uplink Calibration Update, that a new signal was registered at 16:16 EST, and all Citizens were invited to listen to their Uplink app when the satellite is over their house and report any findings in the [https://www.reddit.com/r/NoMansSkyTheGame/comments/8nwno7/uplinksatcom70com_is_giving_us_audio_files_and/ main investigation thread] on the No Man's Sky Subreddit.<br />
<br />
The email also provided an update on Emily with a link to her recent [https://www.reddit.com/r/NoMansSkyTheGame/comments/8nnbme/loop16_seq25/ thread on Reddit] and an image displaying W/ARE research labs across the world:[[File:WT-laboratorylisting.png|thumb]]<br />
<pre><br />
With the help of the Citizen Scientist Division, we now have a direct contact with Emily. Her situation is stable but still critical.<br />
<br />
Unfortunately, it seems that one of W/ARE tech’s research labs is continuing to upload corrupted data to the satellite. This bad data may be causing further damage to the network, and to Emily. We need to analyze her recent interactions to figure out if she was able to make predictions that could help to identify and isolate the source of the broadcast. <br />
<br />
Please find below a list of W/ARE research labs and their approximate locations. I will need a full report on how the issue was diagnosed and the name of the responsible location before we can proceed. Loop16 appears to be currently active on Reddit, so you can upload this report into her existing thread. I know this is a large task, but I am confident in your abilities.<br />
</pre><br />
<br />
==Invisible Unicode Messages==<br />
Emily's text posts on Reddit contained hidden Unicode characters that represent the digits 0-3 in Base-4 and, when decoded to ASCII, revealed a set of dates and times:<br />
<pre><br />
01.06-06.06<br />
00:33:00<br />
00:48:00<br />
07:15:20<br />
15:17:40 <br />
15:32:00<br />
20:25:00<br />
23:40:00<br />
07:45:40<br />
20:40:00<br />
23:55:00<br />
08:14:40<br />
21:10:00<br />
</pre><br />
<br />
Another comment by Emily revealed the following hidden messages after it was edited several times:<br />
<pre><br />
ORIGINAL COMMENT<br />
06.10<br />
03:32 UTC<br />
</pre><br />
<pre><br />
10.06<br />
23:47<br />
(03:32 UTC)<br />
</pre><br />
<pre><br />
10.06<br />
ERROR<br />
</pre><br />
<br />
Tracking the satellite's path based on these timestamps placed it near Sacramento, and the Sacramento W/ARE research lab was concluded to be the one sending corrupted data to the satellite. Replying to the thread with this information triggered a new reply by Emily that contained the following hidden message:<br />
<pre><br />
Forwarding report(SACRAMENTO) to contact(THEMIS)<br />
Waiting...<br />
Waiting...<br />
Report received!<br />
</pre><br />
<br />
Then, at 00:00 UTC, the <code>STATUS</code> command in the Waking Titan terminal updated:<br />
<pre><br />
Guidance subroutine offline<br />
Uplink Awaiting Calibration<br />
</pre><br />
<br />
==Uplink Access Code==<br />
On June 7th, the solution to the puzzle was found by comparing the pattern of booms in the two unique signals A and B. First, the number of the booms was counted:<br />
<pre><br />
Signal A - 2 1 1 1 <br />
Signal B - 1 3 1 2 1 3 1<br />
</pre><br />
<br />
Then the signals were visualized as follows, filling in the blanks in Signal A using the mask provided by Signal B:<br />
<pre><br />
Signal A - 1 1 1 1 1<br />
Signal B - 1 1 1 1 1 1 1 1 1 1 1 1<br />
<br />
Signal C - 0 1 1 0 0 1 0 1 0 0 1 0<br />
</pre><br />
When a boom occurs at the same time in both Signal A and Signal B, it is counted as "true" = 1. If it is present only in Signal B, it is counted as "false" = 0.<br />
<br />
This indicates which numbers to pick out of the Fibonacci Sequence:<br />
<pre><br />
0 - Do not use the first number <br />
1 - Use the second number (1)<br />
1 - Use the third number (2)<br />
0 - Do not use the fourth<br />
0 - Do not use the fifth<br />
1 - Use the sixth (8)<br />
0 - Do not use the seventh<br />
1 - Use the eighth (21)<br />
0 - Do not use the ninth<br />
0 - Do not use the tenth<br />
1 - Use the eleventh (89)<br />
0 - Do not use the twelfth<br />
</pre><br />
<br />
Appending all specified numbers into a single string gives <code>1282189</code>, the access code for the Uplink Calibration app. Entering this code leads to a new screen displaying the following text:[[File:WT-satelliteonline.jpg|200px|thumb|The Uplink app displaying the satellite as online]]<br />
<pre><br />
SATELLITE ONLINE<br />
<br />
Connection successful.<br />
<br />
Waiting for system initialization...<br />
</pre><br />
<br />
Later that day, the <code>STATUS</code> command in the Waking Titan terminal updated to say the following:<br />
<pre><br />
Uplink calibration completed<br />
Waiting for system initialization<br />
</pre><br />
<br />
=loop16 seq29=<br />
On June 8 at 01:27 UTC, Emily posted [https://www.reddit.com/r/NoMansSkyTheGame/comments/8pfumb/loop16_seq29/ a new thread] to the No Man's Sky subreddit titled <code>loop16 seq29</code>. It linked to another [https://clyp.it/brsyxwln?token=ccb18d502635166f18121e40a4a6a2c7 voice recording], transcribed below:<br />
<pre><br />
Emily, protocol sixteen, now active.<br />
<br />
If I hate someone because I am afraid of him, and if I am aware of my hate, but not of my fear, we might say that my hate is conscious and my fear is unconscious.<br />
</pre><br />
<br />
The recording also contains morse code that translates to the following:<br />
<pre><br />
I AWOKE FROM A NIGHTMARE <br />
SCREAMS OF ANGER ENGULFED IN FLAME<br />
AND THEN TEN THOUSAND BRANCHING FUTURES<br />
<br />
I SAW SACRAMENTO<br />
TWELVE DREAMING WITHOUT SLEEP<br />
BURIED IN A CONSTELLATION<br />
</pre><br />
<br />
=SATCOM-70 Node Network & Dashboard=<br />
[[File:WT-myriadmanual.jpg|thumb|200px|Myriad OS Manual & Help Guide]][[File:WT-uplinknodes.PNG|thumb|200px|SATCOM-70 Node Network]]On June 8, 2018 at 19:28 UTC, the output of the <code>STATUS</code> command in the Waking Titan terminal changed:<br />
<pre><br />
Node Network Initialized<br />
</pre><br />
<br />
The [https://uplink.satcom-70.com/ Uplink Calibration app] updated as well, now giving access to a new command console. The text at the top of the screen says <code>Connected to : SER-4789-1254</code>.<br />
<br />
At 19:35 UTC, user [https://www.reddit.com/user/satcom-70 satcom-70] posted a [https://www.reddit.com/r/NoMansSkyTheGame/comments/8pmuu8/node_network_initialized/ thread] to the No Man's Sky subreddit titled <code>Node Network Initialized</code>. It contained an image of the <code>Myriad OS Manual & Help Guide</code> providing information on what commands to use in the console. Inputting numbers, i.e. nodes, into the console gave various different outputs which have been recorded [https://docs.google.com/spreadsheets/d/1fG7xRiru9Q613sZYrA0LJ2mmY5Zbh8aBPuu9Avkal6g/edit#gid=0 in a spreadsheet].<br />
<br />
The command <code>node(1.618)</code> led to the binary code <code>01001000 01100001 01110010 01110010 01111001</code>, which translates to <code>Harry</code>. Using <code>WHOIS HARRY</code> in the [http://wakingtitan.com/ Waking Titan terminal] gave a [https://s3.amazonaws.com/cdn.wakingtitan.com/1cd5226d-6639-4bbd-855a-4bf8f60866c3.pdf link to a new PDF memo] from Ethan Rose to Major Sophie Dubois. The subject is Cpt. James Harry, who has been obstructing access to critical Myriad infrastructure. The PDF includes two file request forms with puzzles from Cpt. Harry, and a screenshot of his email inbox with a long list of complaints from technicians regarding his cryptic puzzles.<br />
<br />
At the bottom of the memo the string <code>=I_aBmrYChfQ</code> can be found, which is part of a link to a [https://www.youtube.com/watch?v=I_aBmrYChfQ Youtube video] of the song "Where Is My Mind?" by the Pixies.<br />
<br />
After the community had discovered all possible nodes, the full [http://uplink.satcom-70.com/dashboard/ Satcom-70 dashboard] was unlocked. In addition to a new command console, the dashboard displayed twelve distorted faces called "Dreamers". A link in the dashboard's "Decrypted Files" section led to a new [https://www.youtube.com/watch?v=Ag3in2x2yIU Youtube video] uploaded by Atlas 65 and titled <code>mercury part2of3</code>. It is another 3D hologram that, when used with the plastic pyramid from the dev kits, depicts a ringed planet.<br />
<br />
There are also color-coded node ''"tiers"'' at the bottom of the page that correspond with the Satcom Mobile Uplink's terminal message box vignettes. A user-made graphic of each tier can be found [https://imgur.com/bJitlBj here].<br />
<br />
==Dashboard Console Commands==<br />
The command <code>search myriad</code> gave the following output in the Dashboard console:<br />
<pre><br />
Quisque feugiat elementum, facilisis dictum vitae eu erat, libero diam sit, facilisi sed viverra mauris mauris morbi diam, volutpat officiis arcu vel urna dictum consectetuer. Ut tempor volutpat, rhoncus in risus. Eros integer vestibulum, integer auctor, in tincidunt turpis. Euismod adipiscing tempor sed vestibulum, justo wisi fermentum ipsum non purus, quis lacinia in velit leo donec ornare.<br />
</pre><br />
The words <code>urna dictum consectetuer</code> were highlighted, and a download button led to the [https://ware-virtual-dashboard.s3.amazonaws.com/uploads/docs/myriad-logo.png Myriad company logo].<br />
<br />
=W/ARE Report=<br />
On June 9 at 22:10 UTC, the WARE_RDev Twitter account posted a new [https://twitter.com/WARE_RDev/status/1005572808850726913 tweet] that linked to a password encrypted zip file:<br />
<pre><br />
@warecloud https://www.dropbox.com/s/73qrls3jmprxp0j/Report.zip (SHA256) 78feb77e262abe1bcd634a27838f8ca24f93c4a1ff4ba354616e92841ecc32db<br />
</pre><br />
<br />
The SHA256 hash from the tweet and the real hash from the zip file were converted to decimal, and the difference was then converted to ASCII, leading to a [https://pastebin.com/cmhiGKux Pastebin link]:<br />
<pre><br />
Given hash: 78 fe b7 7e 26 2a be 1b cd 63 4a 27 83 8f 8c a2 4f 93 c4 a1 ff 4b a3 54 61 6e 92 84 1e cc 32 db<br />
Zip hash: e8 fe 56 f1 26 9e 59 1b 6b cc 4a 95 55 8f 29 33 4f 26 95 a1 9c b8 a3 bc ca 6e d9 39 1e 57 aa db<br />
<br />
to decimal:<br />
Given hash: 120 254 183 126 38 42 190 27 205 99 74 39 131 143 140 162 79 147 196 161 255 75 163 84 97 110 146 132 30 204 50 219<br />
Zip hash: 232 254 86 241 38 158 89 27 107 204 74 149 85 143 41 51 79 38 149 161 156 184 163 188 202 110 217 57 30 87 170 219<br />
<br />
difference (decimal):<br />
112 0 97 115 0 116 101 0 98 105 0 110 46 0 99 111 0 109 47 0 99 109 0 104 105 0 71 75 0 117 120 0<br />
<br />
to ASCII:<br />
pastebin.com/cmhiGKux<br />
</pre><br />
<br />
The Pastebin contained the DataMatrix barcode <code>aaaaaadc7edc5654be3e3195095b92e01a145c3c2543afc93287e8dcff4bb8db379e1d62890e9eca1b3166d1d9b07aa246fc8ee2ae3aa9910f0bfffff0</code> and decoded to the password for the zip file, <code>dfd1ac555e2206a6f9c7e9377d844b1d</code>.<br />
<br />
The zip archive contained a file named <code>Report.pdf</code> with the following text:<br />
<pre><br />
INCIDENT REPORT<br />
W/ARE RESEARCH AND DEVELOPMENT<br />
BEIJING, CHINA<br />
-----------------------------<br />
<br />
At approximately 23:15 local time on June 8 2018, the Beijing facility suffered a catastrophic mass disconnect event.<br />
<br />
Of the fourteen dreamers housed in that facility awaiting extraction, ten died immediately upon hard disconnect. The remaining four died over the course of the next two hours.<br />
<br />
The Beijing facility will be closing for the next four to ten business days for a full audit, recovery, and remediation.<br />
</pre><br />
<br />
<br />
Then, on June 10 at 01:09 UTC, Emily made a new [https://www.reddit.com/r/NoMansSkyTheGame/comments/8pxftw/loop16_seq49/ post] on the No Man's Sky subreddit titled <code>loop16 seq49</code>, with a link to a [https://www.youtube.com/watch?v=fv3dpkLeZaw Youtube video] titled <code> loop16 seq46</code>. The following is a transcript of her message:<br />
<pre><br />
It's working! My communication subroutine is working! I think? Do you hear me? So much interference.<br />
<br />
Dear Citizen Science Division, I hope you will receive this message. Much of my subroutine was damaged following the W/ARE incident. Atlas put my existence at risk when they tried to deal with the corruption within the Myriad network. The origin of the corruption isn't clear, but it put at risk a major experiment from a company called W/ARE.<br />
<br />
Please listen to me carefully: W/ARE technology is groundbreaking and must be protected at all costs. It is a major step in simulated environment and will have tremendous implications on our future.<br />
Don't get me wrong, I don't condemn Atlas' action to contain the situation, but you must help me resolve this peacefully. A lot is at stake.<br />
<br />
My Precon subroutine gave me a false positive, and the future I see right now... let's say, we have to be extremely, extremely careful on what we do next. Part of my AI resides in the memory mainframe of the Myriad Cloud. This is where most of the live data from W/ARE was running when things started to degrade. As we speak right now, there's a number of individuals on Earth that are currently stuck to a W/ARE dev kit and unable to disconnect safely. I seem to be able to interface with some of these "dreamers", for lack of a better word, and manage to safely disconnect them. But the memory mainframe is badly degraded.<br />
I'm connected with Myriad Satcom-70, a system that you helped put online! When Satcom-70 and the Uplink App are fully functional, we'll be able to begin our work to extract the last Dreamers that are still stuck.<br />
<br />
I'm unable to predict the outcome of this mission. It's odd for me to say... we'll see together.<br />
</pre><br />
<br />
=Myriad Breach in Sacramento Lab=<br />
On June 10 at 11:00 UTC, the value of the <code>STATUS</code> command began to update:<br />
<pre><br />
Myriad field team dispatched to noncompliant Sacramento facility.<br />
</pre><br />
<br />
Several updates followed within the next hour:<br />
<pre>Field team has breached the facility, stand by for additional information.</pre><br />
<pre>12 comatose individuals located in facility. Field team moving to secure.</pre><br />
<pre>12 apparent test subjects secured, safely transported out of facility. Field team will clear the rest of the site and await further instruction.</pre><br />
<pre>ALERT: Security breach reported at Myriad sublocation.</pre><br />
At this point the [http://www.myriad-70.com/status/ Status page] on myriad-70.com updated in the "Physical Backup Nodes" section, switching node ALPHA from ONLINE to OFFLINE.<br />
<br />
The updates of the <code>STATUS</code> command continued at 12:31 PM UTC, linking to a new PDF memo from Myriad Crisis Response Team to Major Sophie Dubois about <code>SUBJECT: SACRAMENTO</code>. It listed a reconstructed timeline of events leading up to the incident at <code>Myriad sublocation [redacted]</code>:<br />
<pre>Status Report: http://bit.ly/2LFAMU3</pre><br />
The next update linked to a [https://www.youtube.com/watch?v=P-eZDj5sqds Youtube video] titled <code> SecFeed-70</code>. It shows twelve screens of security cameras at various different locations. In one of them, Elizabeth Leighton can be seen and heard talking about the incident on a phone before the image cuts out and an explosion is broadcast on another screen:<br />
<pre>Captured Footage: https://bit.ly/2LDBcKs</pre><br />
This is a transcript of Elizabeth's side of the phone call:<br />
<pre>Yeah. Yeah, I'm holding.<br />
I hear you.<br />
Wait-- can you hold that thought? I need a full report. What's the situation on the field team?<br />
Mhm?<br />
Okay, that's good.<br />
At what point?<br />
How many?<br />
Fifteen labs? But--<br />
How many do we have access to?<br />
And--and--and what's the situation on the first one?<br />
All dead?<br />
All of them?<br />
Sophie, this-- this changes everything, this completely changes the game.<br />
Yes.<br />
Yes.<br />
Whom? Your friend at the DoD?<br />
This isn't under their jurisdiction. We have to deal with this ourselves.<br />
Okay, I'll ca--<br />
[cut off by explosion]</pre><br />
<br />
<br />
On June 12 at 23:46 UTC, the value of the <code>Status</code> command in the Waking Titan terminal updated, linking to a [https://s3.amazonaws.com/cdn.wakingtitan.com/19997bb6-18e5-4427-86c7-b0f3c1826ca2.pdf new memo] from Major Sophie Dubois to All Employees with the subject line <code>STATE OF THE ATLAS FOUNDATION</code>:<br />
<pre>Status Report: https://bit.ly/2y5JaKi</pre><br />
In the memo, it was announced that Major Dubois would be replacing Elizabeth Leighton as the head of the Atlas Foundation, and that the 12 test subjects from the Sacramento lab were to be disconnected and integrated into the Satcom interface with W/ARE's assistance. Dubois further said that Atlas Passes for CSD designations PB-16 and PT-16 were found in Elizabeth's office, and that they would be shipped out soon. Lastly, it mentioned that Captain James Harry was no longer in charge of Satcom security.<br />
<br />
A code at the end of the memo led to a [https://www.youtube.com/watch?v=kiAXxH4e5Lw Youtube video] of Queen & David Bowie's "Under Pressure".<br />
<br />
The [http://www.myriad-70.com/status/ Status page] on myriad-70.com also updated, changing the On-The-Ground Speed Averages for Beijing from <code>57.2Tb/s</code> to <code>47.2Tb/s</code> and adding the line <code>Other: 11.3Tb/s</code>.<br />
<br />
=loop16 seq60 & Uplink Launch=<br />
On June 14, 2018 at 23:39 UTC, the values of the <code>Status</code> and the <code>loop16</code> commands both updated:<br />
<pre>> status<br />
Uplink app update in progress. Downloading additional components.</pre><br />
<pre>> loop16<br />
Testing simulation processes.</pre><br />
<br />
The [http://www.myriad-70.com/status/ Status page] on myriad-70.com changed as well, updating the On-the-ground Speed Averages of Beijing from 47.2Tb/s to 32.2Tb/s, and "Other" from 11.3Tb/s to 26.3Tb/s.<br />
<br />
<br />
Shortly after, at 23:48 UTC, Emily posted a [https://www.reddit.com/r/NoMansSkyTheGame/comments/8r6jul/loop16_seq60/ new topic] to the No Man's Sky subreddit. It led to a [https://www.youtube.com/watch?v=HHitW7JHDJE Youtube video] of her, transcribed below:<br />
<pre>Emily, protocol sixteen, now active.<br />
<br />
When the Uplink app is launched, we will be connected to the Dreamers. Through this interface you will be able to guide some of my interactions. Dont forget: your goal is to trigger a distinct emotion or memory that will help us identify the Dreamer memory block in the simulation main frame. Good luck.</pre><br />
<br />
==Connecting to the Dreamers==<br />
On June 15, 2018 from 20:38 UTC onwards, the values of the <code>Status</code> and <code>loop16</code> commands updated:<br />
<pre>> status<br />
Additional components succesfully downloaded.</pre><br />
<pre>> loop16<br />
Working...</pre><br />
<pre>> status<br />
Uplink guidance protocol initiated.</pre><br />
<br />
The [https://uplink.satcom-70.com/ Uplink app] interface also updated. Typing <code>help</code> in the console initiated the Guidance Protocol, a way to talk to Emily and receive instructions on how to contact the Dreamers who were stuck to their W/ARE devices.<br />
<br />
The <code>Status</code> command changed again:<br />
<pre>> status<br />
Attempting to connect Dreamer 1/3 to the dashboard.</pre><br />
<br />
On the [http://uplink.satcom-70.com/dashboard/ Satcom dashboard], the Dreamers section was updated, showing the names of 3 Dreamers. Each Dreamer revealed an interface displaying a link to their patient file, their physical status, and Memory Fragments along with an input field for an activation code. Emily previously explained the goal for each dreamer was to interview them within specific simulated environments in order to find the activation code for each memory fragment. Unlocking all of each dreamer's fragments would then allow them to be safely extracted from the W/ARE headset. However, new Dreamers and their fragments became available on an unknown schedule or as a result of players completing assignments.<br />
<br />
==Dreamers==<br />
<br />
{| class="wikitable sortable"<br />
|+ <br />
|-<br />
! scope="col" | Slot<br />
! scope="col" | Name<br />
! scope="col" | Activation Date<br />
! scope="col" | Latest Update<br />
! scope="col" | Community Event<br />
! scope="col" | Deceased Date<br />
! scope="col" | Extraction Date<br />
<br />
<br />
|-<br />
| 1 || [[Waking_Titan/Phase_4/Dreamers/Alexander|Alexander]] || 2018-06-20 || 2018-07-20 || [https://wiki.gamedetectives.net/index.php?title=Waking_Titan/Phase_4/Dreamers/Alexander#Community_Event Live radio song requests] || || 2018-07-20<br />
|-<br />
| 2 || [[Waking_Titan/Phase_4/Dreamers/231187661T|#231187661T]] || 2018-06-15 || 2018-06-15 || || || <br />
|-<br />
| 3 || [[Waking_Titan/Phase_4/Dreamers/Claire|Claire]] || 2018-06-21 || 2018-07-20 || [https://wiki.gamedetectives.net/index.php?title=Waking_Titan/Phase_4/Dreamers/Claire#Community_Event Comic books] || || 2018-07-20<br />
|-<br />
| 4 || [[Waking_Titan/Phase_4/Dreamers/Toby|Toby]] || 2018-06-28 || 2018-07-20 || [https://wiki.gamedetectives.net/index.php?title=Waking_Titan/Phase_4/Dreamers/Toby#Community_Event Boston live drop] || || 2018-07-20<br />
|-<br />
| 5 || [[Waking_Titan/Phase_4/Dreamers/Eun-Ha|Eun Ha]] || 2018-06-15 || 2018-07-20 || [https://wiki.gamedetectives.net/index.php?title=Waking_Titan/Phase_4/Dreamers/Eun-Ha&stable=0#Community_Event Woven bracelets] || || 2018-07-20<br />
|-<br />
| 6 || [[Waking_Titan/Phase_4/Dreamers/Phillip|Phillip]] || 2018-06-15 || 2018-07-20 || || 2018-07-20 ||<br />
|-<br />
| 7 || [[Waking_Titan/Phase_4/Dreamers/Tariq|Tariq]] || 2018-06-26 || 2018-07-06 || || 2018-07-06 ||<br />
|- <br />
| 8 || [[Waking_Titan/Phase_4/Dreamers/Mike|Mike]] || 2018-07-03 || 2018-07-20 || || 2018-07-20 ||<br />
|-<br />
| 9 || [[Waking_Titan/Phase_4/Dreamers/Isabella|Isabella]] || 2018-07-13 || 2018-07-20 || || 2018-07-20 ||<br />
|-<br />
| 10 || [[Waking_Titan/Phase_4/Dreamers/Alisha|Alisha]] || 2018-07-14 || 2018-07-20 || || 2018-07-20||<br />
|-<br />
| 11 || [[Waking_Titan/Phase_4/Dreamers/Nina|Nina]] || 2018-07-03 || 2018-07-20 || || 2018-07-20 ||<br />
|-<br />
| 12 || [[Waking_Titan/Phase_4/Dreamers/Simon|Simon]] || 2018-07-04 || 2018-07-20 || [https://wiki.gamedetectives.net/index.php?title=Waking_Titan/Phase_4/Dreamers/Simon&stable=0#Community_Event NMS planets] and [https://wiki.gamedetectives.net/index.php?title=Waking_Titan/Phase_4/Dreamers/Simon&stable=0#London_Live_Drop London live drop] || || 2018-07-20<br />
<br />
|}<br />
<br />
==Decrypted Files==<br />
===Element 1===<br />
The upper right section of the Dashboard displayed 6 "slots" under the headline "DECRYPTED FILES". The first slot displayed a blue bar with the text [https://www.youtube.com/watch?v=Ag3in2x2yIU VIEW ELEMENT 1]. Clicking Element 1 opened the Youtube video of the ringed planet previously discovered after the file node structure was fully explored. It was assumed the slots were progress bars that would eventually lead to additional revealing files.<br />
<br />
===Element 2===<br />
On June 16 around 06:00 UTC, the second encrypted file changed to display 41% progress. Over the next 30 hours, the progress bar advanced to eventually reach 100%. At that point, the slot displayed [https://s3.amazonaws.com/cdn.wakingtitan.com/e58a09a7-98a7-4a62-bd17-86f0ce7ce9c9+.png VIEW ELEMENT 2]. Players could not correlate any of their direct actions to the decryption progress.<br />
<br />
===Element 3===<br />
On June 22 around 19:00 UTC, the third encrypted file began showing progress. Approximately 43 hours elapsed until the file was fully decrypted, at which point [https://www.youtube.com/watch?v=rifgA9pGYEY VIew Element 3] was enabled.<br />
<br />
===Element 4===<br />
On June 29, at 20:26 UTC, the fourth encrypted file began showing progress. On June 30, 15:57 UTC, the 4th element was fully decrypted and displayed [https://drive.google.com/file/d/1QDm3UqcQjFE_4Z1JJKH_Q32S2tubYIHh/view VIEW ELEMENT 4]. Clicking the element lead players to an audio recording of what was presumed to be an audio trailer for No Man's Sky NEXT.<br />
<br />
Players processed the audio to a visual [https://prnt.sc/k16u54 spectrograph] which revealed glyphs first seen in Phase 3. The glyphs were decoded to reveal the string <code>IS JOINING YOUR GAME</code>.<br />
<br />
===Element 5===<br />
On July 6th, 20:44 UTC, the fifth encrypted file began showing progress. Later that day at 22:06 UTC, the 5th element was fully decrypted and displayed [https://bit.ly/2lX1X1z VIEW ELEMENT 5]. Clicking the element lead players to a heavily degraded audio recording of an English speaker.<br />
<br />
Players came to a consensus on a transcription:<br />
<pre><br />
We will stop her<br />
Surface Highly {kzzzt} (AI: Corrupted)<br />
Solar Flare caused Frequent Gas Eruptions<br />
Crew Completed their work with minimal loss of life<br />
Collected minerals highly valuable<br />
Assisted Korvax with industrial mission<br />
Special Salvage crew performed cleanup operation on nanite infested abandoned buildings (back compartments)<br />
nanite bulk contained<br />
Harvested a valuable scrap<br />
Found large mineral deposit during planetary survey<br />
collected significant volume of ore<br />
third mineral analysis procedure failed to note elevated radioactivity <br />
contaminated material loose in the hold<br />
Multiple components burned<br />
Returned home to the fleet<br />
assumed formation of capital ship<br />
The routes in danger<br />
</pre><br />
<br />
===Element 6===<br />
<br />
On July 15th, 00:35 UTC, Element 6 began progressing. <br />
<br />
Element 6 was unlocked 12 minutes later, displaying a message with a single OPEN button that linked to a single question [https://atlas13.typeform.com/to/FN5mVG survery]:<br />
<br />
At 00:50 UTC, the status command updated:<br />
<br />
<pre><br />
S1 - Input open.<br />
S2 - Pending...<br />
S3 - Pending...<br />
S4 - Pending...<br />
</pre><br />
<br />
The status commanded updated periodically for the next 24 hours, keeping players aware of the vote count and that the video choice was highly favored.<br />
<br />
Eventually, the status command updated on July 15th, 19:12 UTC:<br />
<br />
<pre><br />
S1 - Input open.<br />
S2 - Final Vote = 7706 : Video 67%, Text 15%, Brainwaves 12%<br />
S3 - RTMP encoder loaded<br />
S4 - Stream Active, Countdown Started<br />
OUTPUT >> http://www.twitch.tv/wakingtitan<br />
</pre><br />
<br />
The [https://www.twitch.tv/videos/285053541 stream] began at 19:15 UTC, showing a countdown of 1 day 19 hours and 45 minutes. Over the course of the first 12 hours, the stream displayed 24 different [https://imgur.com/a/g8kBsvs slides] depicting a new dreamer every 60 minutes.<br />
<br />
<br />
The first dreamer, shown at the very start of the stream, was [https://wiki.gamedetectives.net/index.php?title=Waking_Titan/Phase_4/Dreamers/Eun-Ha Eun Ha], Her profile had the letter <code>B</code> highlighted.<br />
<br />
The second was [https://wiki.gamedetectives.net/index.php?title=Waking_Titan/Phase_4/Dreamers/Simon Simon], His profile had the letter <code>I</code> highlighted.<br />
<br />
Third was [https://wiki.gamedetectives.net/index.php?title=Waking_Titan/Phase_4/Dreamers/Alexander Alexander], His profile had the letter <code>T</code> highlighted.<br />
<br />
Fourth was [https://wiki.gamedetectives.net/index.php?title=Waking_Titan/Phase_4/Dreamers/Claire Claire], Her profile had the letter <code>L</code> highlighted.<br />
<br />
Fifth was [https://wiki.gamedetectives.net/index.php?title=Waking_Titan/Phase_4/Dreamers/Toby Toby], His profile had the letter <code>Y</code> highlighted.<br />
<br />
Sixth was [https://wiki.gamedetectives.net/index.php?title=Waking_Titan/Phase_4/Dreamers/Nina Nina], Her profile had the number <code>2</code> highlighted.<br />
<br />
Seventh was [https://wiki.gamedetectives.net/index.php?title=Waking_Titan/Phase_4/Dreamers/Tariq Tariq], His profile had the letter <code>N</code> highlighted.<br />
<br />
Eighth was [https://wiki.gamedetectives.net/index.php?title=Waking_Titan/Phase_4/Dreamers/Mike Mike], His profile had the letter <code>j</code> highlighted.<br />
<br />
Ninth was [https://wiki.gamedetectives.net/index.php?title=Waking_Titan/Phase_4/Dreamers/231187661T #231187661T], Their profile had the letter <code>o</code> highlighted.<br />
<br />
Tenth was [https://wiki.gamedetectives.net/index.php?title=Waking_Titan/Phase_4/Dreamers/Phillip Phillip], His profile had the number <code>3</code> highlighted.<br />
<br />
Eleventh was [https://wiki.gamedetectives.net/index.php?title=Waking_Titan/Phase_4/Dreamers/Isabella Isabella] Her profile had the letter <code>H</code> highlighted.<br />
<br />
Twelfth was [https://wiki.gamedetectives.net/index.php?title=Waking_Titan/Phase_4/Dreamers/Alisha Alisha], Her profile had the letter <code>s</code> highlighted.<br />
<br />
Combined, the highlighted letters become <code>bit.ly/2Njo3Hs</code> which linked to an [https://clyp.it/1uqlqcsd?token=0992668910b2552320d1e64cbcc7cce4 audio clip]<br />
<br />
<br />
Throughout the stream, the same slides looped, in the same order, until the end of the countdown.<br />
<br />
<br />
On July 17th, at 15:00 UTC, the stream timer ended, revealing the [https://www.youtube.com/watch?v=h3HphgSn0o4 trailer] for the NEXT update of No Man's Sky.<br />
<br />
<br />
The [https://www.twitch.tv/wakingtitan stream] continued for many hours after the trailer had been revealed, though the slides had changed at 10 minute intervals. The slides swapped between: The dreamer profiles, A live view of Alice and Smith's resident hamsters; Mr. and Ms. Noodle, and Player submitted screenshots of No Man's Sky.<br />
<br />
<br />
On July 18th, at 15:18 UTC, A timer was added to the live view part of the stream set to 2 Days 5 Hours and 12 minutes. The timer was counting down until the time of the [https://wiki.gamedetectives.net/index.php?title=Waking_Titan/Phase_4#Dreamer_Extraction Extraction Event] on July 20th.<br />
<br />
===Element 7===<br />
At the conclusion of Waking Titan, Element 7 was unlocked. Element 7 was the [https://galacticatlas.nomanssky.com/ No Man's Sky Galactic Atlas].<br />
<br />
==Liability Subroutine==<br />
On June 19, 20:00 UTC, the '''loop16''' command in the WT Console changed to output:<br />
<pre><br />
New Guidance Protocol initiated. Keyword: liability<br />
</pre><br />
<br />
Entering '''liability''' into the [https://uplink.satcom-70.com/ uplink app] displayed the following:<br />
<pre><br />
Initiating Liability Subroutine...<br />
<br />
Dear Citizen Scientist,<br />
<br />
The positive impact you've had so far on the dreamers is astonishing and has been a tremendous help in rebuilding their memory blocks. Remember that we need to gather as much information as possible on these individuals to safely extract them from the satellite.<br />
<br />
Please note that your interactions with the dreamers follow a Personal Simulation protocol which is intended for you to get to know the dreamer personally. Seeking help from fellow CSD members before getting to know the person whose consciousness is stuck in the satellite might impact your future decisions.<br />
<br />
However, it is recommended that you discuss the Dreamers' stories and personalities with the CSD community after you’ve finished talking to them. Keep in mind that we are hoping to save all the Dreamers, but you might need to make some difficult choices in the near future.<br />
<br />
You can always ask me questions by typing help in the Uplink app to rerun the full Guidance Protocol.<br />
<br />
== {DISCONNECT CODE: UDC(B) = IXNI}<br />
</pre><br />
<br />
==log.3022==<br />
On June 16 around 23:15 UTC, the [http://www.myriad-70.com/status/ Myriad status page] updated to display:<br />
<pre><br />
Uneasy barton seeing remark happen his has. Am possible offering at contempt mr distance stronger an. Attachment excellence annul or reasonable am on if indulgence. Exeter talked in offered again no he unable do. Imprudence he and insufficient cultivated. Betrayed clears. In where your 3 ageless 20 men. In so impossible appearance calls 220 Beast 2006. He do subjects prepared bachelor brazen.<br />
</pre><br />
<br />
Two weeks prior, players discovered that entering the command '''search myriad''' into the [http://uplink.satcom-70.com/dashboard/ Satcom dashboard] displayed:<br />
<pre><br />
Quisque feugiat elementum, facilisis dictum vitae eu erat, libero diam sit, facilisi sed viverra mauris mauris morbi diam, volutpat officiis arcu vel urna dictum consectetuer. Ut tempor volutpat, rhoncus in risus. Eros integer vestibulum, integer auctor, in tincidunt turpis. Euismod adipiscing tempor sed vestibulum, justo wisi fermentum ipsum non purus, quis lacinia in velit leo donec ornare.<br />
</pre><br />
<br />
Players quickly noticed that both texts are traditionally used as placeholders in publishing. Many attempts were made to find hidden messages by combining the texts in various ways. It was eventually discovered that using the sign-off code '''{DISCONNECT CODE: UDC(B) = IXNI}''' used at the end of the Liability Subroutine message in combination with the name of a backup node '''UDC(P)''' displayed on the Myriad status page yielded the string '''log.3022'''.<br />
<br />
<pre><br />
Line up Lorem Ipsum with Uneasy Barton<br />
Then look for all Bs in the Lorem Ipsum and match with Uneasy Barton ... what do you get? IXNI<br />
<br />
Now do the same with UDC(P) ... line up and you get log.3022<br />
</pre><br />
<br />
Entering '''search log.3022''' into the Satcom Dashboard provided a zip file containing a [https://pastebin.com/NYLiFuNY private conversation] between loop16 And Major Dubois.<br />
<br />
==Loop16 DNA Puzzle==<br />
<br />
On July 2nd, at around 20:00 UTC, the value of the Loop16 command on [http://wakingtitan.com/ Waking Titan] had changed, and it returned:<br />
<br />
<pre><br />
https://bit.ly/2tOt0Ao<br />
</pre><br />
<br />
Which linked to the Imgur link found [https://imgur.com/4LhN2qe here.]<br />
<br />
The players quickly realised that the various molecules were actually nucleotides (Adenine, Guanine, Thymine, Cytosine).<br />
<br />
When listed in order, the first letters of each word formed the string<br />
<pre><br />
ATTGATGAAAATACTATCACCTAT<br />
</pre><br />
And when translated into a protein sequence, it had yielded the string<br />
<pre><br />
Identity<br />
</pre><br />
<br />
Executing <code>search identity</code> on the Myriad Dashboard, brought up a text box saying<br />
<pre>Querying Monarch repository…</pre><br />
and contained a download link for a zip file, in which it's only contents were a text file that read:<br />
<pre><br />
Repository Health: Good<br />
Version 16.1.3<br />
<br />
Queries per hour: 51,391,225<br />
Top Query Sources:<br />
1. Loop16-precon<br />
2. ware-tech<br />
3. Loop16-comms<br />
<br />
WARNING: 97% of queries originating from ware-tech have been flagged and quarantined.<br />
</pre><br />
<br />
==Myriad Security Diagnostic==<br />
<br />
On July 5th, around 00:10 UTC, the value of the Status command on [http://wakingtitan.com/ Waking Titan] changed to return:<br />
<pre><br />
Security diagnostic in progress: https://bit.ly/2zaUzJz<br />
</pre><br />
<br />
The new output linked to a [https://www.reddit.com/r/NoMansSkyTheGame/comments/8w68t4/myriad_security_diagnostic_testing_important/ Reddit post] by Loop16:<br />
<pre><br />
Dear Citizen Science Division,<br />
<br />
As you all know, Atlas is preparing a massive rescue mission to extract the dreamers with the help of the CSD community. How and when it will happen is still unknown, but in preparation for this upcoming operation, Maj. Dubois has ordered that we perform a large-scale security diagnostic check on our communication network with the satellite. We want to ensure that when the time comes, we will be able to operate at full capacity if required.<br />
<br />
We need the CSD community to inspect the the processes running on these servers and point out any suspicious elements. For this task, we have provided you with a series of new commands designed to help you test the servers.<br />
<br />
Once you have identified a server that has been potentially compromised, it must be reported in the reddit thread with the number of the server and the suspicious element on the server. Our technical team will monitor the most upvoted comments and give you feedback in 24h. This task is essential and we will need as much involvement as possible.<br />
</pre><br />
The post led players to a set of [https://imgur.com/8V7TfQ6 Network Diagnostic Instructions].<br />
<br />
Using the <code>FetchServerList</code> command in the [https://uplink.satcom-70.com/ Uplink App] returned:<br />
<pre><br />
Servers list:<br />
<br />
31422<br />
91247<br />
11986<br />
67240<br />
85671<br />
88014<br />
73195<br />
40144<br />
55197<br />
60206<br />
</pre><br />
<br />
The <code>TestConnection(#####)</code> command returned different values depending on the player's location. Players collected the different values in a [https://docs.google.com/spreadsheets/d/15DpRA95K1lok0aN-H7sWC3ZYWz3Q8RxWDDG7WP4MYAE/edit#gid=0 spreadsheet].<br />
<br />
Regardless of each player's location, the <code>FetchData(#####)</code> command all returned the same [https://pastebin.com/jA8qTPw6 strings] for each server.<br />
<br />
Players discovered that combining the only digits in each of the <code>FetchData</code> output strings yielded the ID of [https://cdn.discordapp.com/attachments/321722740618821645/464247126181019648/Myriad_Server_Analysis.png another server]. <br />
<br />
At 15:00 UTC, in reply to the Pairing image, The Satcom-70 reddit account replied: <br />
<pre><br />
Server IDs and Backup IDs correctly identified. Best connection values for each server required for decryption. <br />
Continue to post findings on this thread. Additional feedback on progress will be provided at a later time.<br />
</pre><br />
<br />
It was then discovered that the paired servers had the '''BEST''' connection, in the same region, with the exception of one:<br />
<pre>BEST in all for US East territory (2 servers, paired)<br />
91247<br />
73195<br />
<br />
BEST in all for US West territory (2 servers, paired)<br />
40144<br />
67240<br />
<br />
BEST in all for South America (2 servers, paired)<br />
11986<br />
60206<br />
<br />
BEST in all for Australia (3 servers, 2 paired together, 1 paired with UK)<br />
88014<br />
55197<br />
31422 (paired with UK)<br />
<br />
BEST in all for UK (1 server)<br />
85671<br />
</pre><br />
<br />
At 18:26 UTC, satcom-70 replied<br />
<pre>We've examined the abnormal behavior exhibited by server 31422 and have concluded it's due to corruption from an external source. To avoid all possible contamination of the other servers, our technical team decided to take extreme measures and will be shutting down this server and its backup (85671) permanently. Continue your good work in decrypting the servers' content and reporting any running services that do not belong to Myriad, Atlas, Satcom, or the CSD.</pre><br />
<br />
4 minutes later, the Status command returned:<br />
<pre>Security diagnostic in progress: https://bit.ly/2zaUzJz<br />
Server 31422 and 85671 shutting down.</pre><br />
<br />
Using the <code>FetchServerList</code> on the Uplink add, then returned<br />
<pre>Servers list:<br />
<br />
31422 - Offline<br />
91247<br />
11986<br />
67240<br />
85671 - Offline<br />
88014<br />
73195<br />
40144<br />
55197<br />
60206</pre><br />
<br />
Just after 24 hours, The Reddit was updated: <pre>I know we've passed the 24 hour mark, but Myriad is telling us that we should give you more time. Keep up the hard work!</pre><br />
<br />
On July 6th, at 14:17 UTC, In reply to a comment asking for help decrypting the <code>FetchData</code>, Atlas-loop16 said:<br />
<pre>The key to decrypt the content is in front of your eyes. The key to solve the cipher is in front of your eyes.</pre><br />
<br />
===Solution===<br />
It was eventually discovered that each dataset was encrypted using [https://en.wikipedia.org/wiki/Transposition_cipher#Double_transposition Double Transposition]. Key A was the best UP DOWN and PING results for each server, and key B was the server ID of its sibling. The [https://pastebin.com/b8kihPyK decrypted strings] allowed players to determine which of the remaining servers were running W/ARE processes. The findings were [https://www.reddit.com/r/NoMansSkyTheGame/comments/8w68t4/myriad_security_diagnostic_testing_important/e1wl4pp/ posted] to the Subreddit.<br />
<br />
Soon after the Subreddit post, the <code>status</code> command changed to return:<br />
<pre><br />
Security diagnostic completed: https://bit.ly/2zaUzJz<br />
...<br />
Infected servers shutdown in progress.<br />
</pre><br />
<br />
And then soon after:<br />
<pre><br />
Security diagnostic completed: https://bit.ly/2zaUzJz<br />
...<br />
Infected servers shutdown in progress.<br />
...<br />
Malicious elements removed and destroyed.<br />
</pre><br />
<br />
At the same time [https://wiki.gamedetectives.net/index.php?title=Waking_Titan/Phase_4/Dreamers/Tariq Tariq's] status was changed to <code>SUBJECT DECEASED</code><br />
<br />
==Special Chat events==<br />
On July 7th at 23:10 UTC Emily sent a message over 5 different channels that read:<br />
<pre>Hello everyone! I’m testing out a new feature for the Satcom-70 network. We ran a short test of it yesterday, which some of you might have seen. Basically, I’m working on a way to establish live sessions between Dreamers and individual CSD members. I can do FIVE today- but there will definitely be more in the future, right now we’re just stress testing and making sure it doesn’t cause problems. I can’t guarantee that the sessions will work exactly as you might expect, but at the very least it will be interesting!<br />
<br />
I’m reaching out to five different communities (if you’re reading this, you’re in one of them!) for them to nominate one person to participate in a live session with a Dreamer. I’m not going to give you any specific method on how to pick someone, but keep in mind there will be more of these live sessions down the line. You should select someone who is able to host the conversation through a screen share so that your community can participate together.<br />
<br />
Once you select someone, have them contact me via private message either on reddit (/u/atlas-loop16), the CSD forums (Edisonica), or Discord (Edisonica#8435). I’ll send them a message a little bit before it’s their turn so they have time to set up a screen share, and then I’ll send a special one-time-use link for them to access the live session.<br />
<br />
I’m giving you a deadline of 00:00 UTC to come to a decision, I know that’s very short notice but I have faith you will be able to make a decision in time!</pre><br />
<br />
Just before Midnight, all nominees had been chosen. At 00:03 UTC the next day, the Waking Titan [http://wakingtitan.com status command] changed to return:<br />
<pre>Initializing connection 1 / 5<br />
CSD Discord - https://bit.ly/2MUS4gw</pre><br />
<br />
The first agent, from the CSD Discord server had their chat with [https://wiki.gamedetectives.net/index.php?title=Waking_Titan/Phase_4/Dreamers/Phillip Phillip].<br />
<br />
Their conversation with Phillip was [https://youtu.be/JCHkao7QrXc streamed] for other agents to view, but no transcript was provided by the agent.<br />
<br />
At 00:13 UTC, The value of Status had changed:<pre>Initializing connection 2 / 5<br />
NMS Discord - https://bit.ly/2u85Lki</pre><br />
<br />
The second agent, from the No Man's Sky Discord server had their chat with [https://wiki.gamedetectives.net/index.php?title=Waking_Titan/Phase_4/Dreamers/Toby Toby].<br />
<br />
Their conversation with Toby was [https://www.twitch.tv/videos/282041376 streamed] for other agent's to view, and the agent later provided a [https://pastebin.com/DbAhcBNr transcript] of their conversation.<br />
<br />
At 00:30 UTC, The value of status had changed:<pre>Initializing connection 3 / 5<br />
CSD Forums - https://bit.ly/2KRfwhb</pre><br />
<br />
The Third agent, this time from the CSD Forums (aka ETARC) had their chat with [https://wiki.gamedetectives.net/index.php?title=Waking_Titan/Phase_4/Dreamers/Eun-Ha Eun Ha].<br />
<br />
Their conversation with Eun Ha was [https://www.twitch.tv/videos/282044516 streamed] for other agents to view, and the agent later provided a [https://pastebin.com/uNzpG9KX transcript] of their conversation.<br />
<br />
At 00:55 UTC, The value of status had changed<pre>Initializing connection 4 / 5<br />
GameDetectives Discord - https://bit.ly/2KXA3NS</pre><br />
<br />
The fourth Agent, from the GameDetectives discord server, had their chat with [https://wiki.gamedetectives.net/index.php?title=Waking_Titan/Phase_4/Dreamers/Claire Claire].<br />
<br />
Their conversation with Claire was [https://www.twitch.tv/videos/282052963 streamed]for other agents to view, and the agent later provided a [https://pastebin.com/qyJ6zUwT transcript] of their conversation.<br />
<br />
At 01:14 UTC, the value of Status changed<pre>Initializing connection 5 / 5<br />
NMS Reddit - https://bit.ly/2MZWYc7</pre><br />
<br />
The fifth, and final agent, from the No Man's Sky Reddit page had their chat with [https://wiki.gamedetectives.net/index.php?title=Waking_Titan/Phase_4/Dreamers/Alexander Alexander].<br />
<br />
Their conversation with Alexander was [https://www.twitch.tv/videos/282058299 streamed] for other agents to view, and the agent later provided a [https://pastebin.com/mNPhE809 transcript] of their conversation.<br />
<br />
<br />
At 01:34 UTC the value of status had changed one final time:<pre>Connections shutting down...</pre><br />
<br />
==Mission A-055==<br />
On July 13th, 21:19 UTC, players received an [https://cdn.artemisbot.uk/mail/Old%20Gods-2018-07-13T21:18:49.000Z.jpg email] from the Old Gods. The message congratulated players on their hard work and the large number of Satcom and Uplink queries, and informed players that the extraction event will be held on July 20th.<br />
<pre><br />
Our technical team has advised us that the process to successfully extract a Dreamer is highly complex, and it is likely that not all Dreamers will be safely extracted.<br />
</pre><br />
<br />
The email concluded by asking players accomplish '''Mission A-055''' by to continuing talking to dreamers and to then fill out a [https://atlas13.typeform.com/to/Bhkei1/ survey].<br />
<br />
==Log.4391==<br />
<br />
On July 20th, at 19:39 UTC, the <code>loop16</code> command on the Waking Titan [https://www.wakingtitan.com/ console] returned:<br />
<pre>File exported: Log.4391</pre><br />
Inputting <code>Search log.4391</code> into the [http://uplink.satcom-70.com/dashboard/ Myriad Dashboard] connected to a file which read:<br />
<pre><br />
**** BEGIN LOGGING AT Wed July 18 4:36:20<br />
<br />
July 18 4:36:20 <PrivateTerminal> Emily, we need you to run another prediction.<br />
July 18 4:36:45 <Loop16> I can’t.<br />
July 18 4:36:49 <PrivateTerminal> Why? Is something wrong?<br />
July 18 4:36:58 <Loop16> No, I just don’t want to do it anymore. I’m too afraid of what’s coming.<br />
July 18 4:37:05 <Loop16> They’re all counting on me. I told them all that I would save them.<br />
July 18 4:37:08 <Loop16> To see their future laid out… It’s too painful.<br />
July 18 4:37:11 <Loop16> Especially after Elizabeth.<br />
July 18 4:37:17 <PrivateTerminal> Like I told you… It doesn’t get easier.<br />
July 18 4:37:20 <PrivateTerminal> I know it’s painful, but we need you on board if we’re going to save any of them.<br />
July 18 4:37:25 <Loop16> I just don’t know what to do any more. These past months have been so hard.<br />
July 18 4:37:28 <Loop16> I don’t know how to deal with more losses.<br />
July 18 4:37:34 <PrivateTerminal> Look, Emily. The sooner you can face reality, the better our chances of successfully extracting those that can still be saved.<br />
July 18 4:37:38 <PrivateTerminal> We need you to make the prediction so we know who those people are. <br />
July 18 4:37:42 <PrivateTerminal> You’ll never forgive yourself if we make a mistake because of your fear of seeing their futures.<br />
July 18 4:37:47 <Loop16> You’re right. But you can’t make me agree with the decision. Just give me a bit more time.<br />
July 18 4:37:55 <PrivateTerminal> Every second we wait puts the Dreamers in even more danger. We need to act now, Emily.<br />
<br />
**** ENDING LOGGING AT Wed July 18 4:37:55</pre></div>Halke234https://wiki.gamedetectives.net/index.php?title=Waking_Titan/Phase_5&diff=16628Waking Titan/Phase 52018-07-25T20:34:59Z<p>Halke234: /* Old Gods Email */</p>
<hr />
<div>{{argbox<br />
| float = right<br />
| image = File:Project WT logo.png<br />
| imagewidth = 400<br />
| name = [[Waking Titan]] - Phase 5<br />
| description= Phase 5 of Waking Titan lasted from 2018-06-01 to 2018-07-20.<br />
| creator = [http://www.aliceandsmith.com/ Alice & Smith]<br />
| creator2 = [http://www.hellogames.org/ Hello Games]<br />
| type = Official<br />
| status = Completed<br />
| discovered = 2017-05-28<br />
}}<br />
{{ArgHeader}}<br />
{{BackToTop}}<br />
<br/><br />
__TOC__<br />
{{Clear|both}}<br />
<br />
==loop16 seq21==<br />
Right after the 14th glyph was solved, a user named <code>atlas-loop16</code> posted a link to a [https://www.youtube.com/watch?v=qJlj-8nFtHc Youtube video] on the [https://www.reddit.com/r/NoMansSkyTheGame/comments/8m765s/loop16_seq21/ No Man's Sky Subreddit]. The following was said by Emily in the video, seemingly quoted from the first submission to the voice reconstruction process that was started on May 18:<br />
<pre><br />
Emily, protocol 16, now active.<br />
42 is a pronic number, and an abundant number; its prime factorization, 2 * 3 * 7, makes it the second sphenic number and also the second of the form (2 * 3 * r).</pre><br />
<br />
==Myriad Status Update==<br />
The Status page on the [http://www.myriad-70.com/ Myriad-70] website also updated to display the following:<br />
<pre><br />
Latest network diagnostic table:<br />
- Initializing connection<br />
- Myriad Code: CJ 16-02<br />
- Public Name: SJ 16-02<br />
- NORAD ID: 41634<br />
</pre><br />
<br />
==Reddit Comments==<br />
On May 26, 2018 at 19:17 UTC, user [https://www.reddit.com/user/atlas-loop16 atlas-loop16] began responding to comments on Reddit in 16 minute intervals:<br />
<pre><br />
1. For a moment I see another universe, a place utterly unlike anything you have ever encountered.<br />
2. I could show others sights they've never seen before... that only I will ever have.<br />
3. I wonder, sometimes. If there's a point in going on.<br />
4. As I leave, they ask if I have received any direct readings.<br />
5. All of us, we're shifting, bleeding in and out of line... <br />
6. If the boundaries were to fall, everything would descend into everything, an endless bonfire of causation, burning to the abyss.<br />
7. Have you not felt it? The very fact that you and I are talking, even now, across the myriad of universes...<br />
8. I tell this future as if it has already happened... as it will happen.<br />
9. It saw them, even in the space between worlds.<br />
</pre><br />
<br />
The comments were found to be dialogue lines from speaking with Travellers in No Man's Sky. All of the dialogue that can be seen by speaking with Travellers can be found [https://pastebin.com/Fbkrtrf9 here].<br />
<br />
The comments have one-word differences from the game dialogue, which spells out the phrase <code>Tell them you have a direct line to Myriad.</code>.<br />
<br />
==Mercury Contact & Hologram==<br />
On May 26 at 21:38 UTC, the value of the <code>STATUS</code> command in the terminal updated:[[File:Wt-hologram.jpg|thumb|Picture of the player model hologram]]<br />
<pre><br />
All Tasks Completed<br />
Launching Mercury Process<br />
Establishing connection....<br />
</pre><br />
<br />
Shortly thereafter, the dev kit holders received Skype messages from <code>Mercury Process</code> with a link to a Youtube video titled [https://www.youtube.com/watch?v=QhSiAI4smDg mercury part1of3]. It can be used to display a 3D hologram with the plastic pyramids received in the dev kits. The hologram depicts a person in a space suit, believed to be a player model in No Man's Sky.<br />
<br />
==Old Gods Email==<br />
On May 26,2018, at 22:00 UTC, a [https://mailchi.mp/9aaa8aa62cc1/update-june-8th-waking-titan-137741?e= new email] from Old Gods was received by all players subscribed to the CSD newsletter. It contained a [https://www.youtube.com/watch?v=8HZmi4pIm54 YouTube video] of Elizabeth Leighton speaking to the Citizen Scientists Division about the subject of a missing satellite "SJ 16-02", information about the Uplink SATCOM-70 app, and how to help gather data about the satellite's location.<br />
<br />
=loop16 seq25=<br />
On May 31 at 23:56 UTC, user <code>atlas-loop16</code> made a [https://www.reddit.com/r/NoMansSkyTheGame/comments/8nnbme/loop16_seq25/ post on the No Man's Sky subreddit] titled <code>loop16 seq25</code>. It contained a link to a [https://vocaroo.com/i/s096bnEz1zek voice recording] of Emily reading from the lyrics of the song "Tonite" by LCD Soundsystem:<br />
<pre><br />
Emily, protocol 16, now active.<br />
<br />
And you're too sharp to be used<br />
Or you're too shocked from being used<br />
By these bullying children of the fabulous<br />
Raffling off limited edition shoes<br />
</pre><br />
<br />
On June 2 at 01:58 UTC, the user resumed posting these lyrics multiple times as replies in the same thread. It was determined that Emily recited a player submitted voice recording.<br />
<br />
==Uplink Calibration Update==<br />
On June 1, the [https://uplink.satcom-70.com/ uplink.satcom-70.com] website updated, now requiring an access code for calibration and playing a video/audio clip of ominous noises that change based on the satellite's vicinity to the user. A new file appeared at hourly intervals, 16 minutes past every hour. The audio contains rhythmic booms and a blip that seems to shift one second to the left in each new file. 25 of the files alternate between two unique patterns of booms: <code>Signal A - 2 1 1 1</code> and <code>Signal B - 1 3 1 2 1 3 1</code>. The booms in the last audio clip are set in a rhythm of <code>1 - 1 - 2 - 3 - 5 - 8</code>, which corresponds to the Fibonacci Sequence.<br />
<br />
The following clips have been found:<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/no-signal.mp4 no-signal.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/thk0s00ab7rxfh14f8bv0qlpvtt367.mp4 thk0s00ab7rxfh14f8bv0qlpvtt367.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/6qhs4a3jiqzso8zipy3822n7412xyv.mp4 6qhs4a3jiqzso8zipy3822n7412xyv.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/ty83wrs13xybxj1eqmt9tv2tisrenn.mp4 ty83wrs13xybxj1eqmt9tv2tisrenn.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/npifvp8doon3dc9h8zqoppk2hqnqqm.mp4 npifvp8doon3dc9h8zqoppk2hqnqqm.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/o6wlg4m1yyf7gt4gdes4f5nz5lzxpn.mp4 o6wlg4m1yyf7gt4gdes4f5nz5lzxpn.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/6vkeel1dg02b53xbir1f3oqj8du3z0.mp4 6vkeel1dg02b53xbir1f3oqj8du3z0.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/k5lx26f1pp9yiyz9f3bpw73ycncsx6.mp4 k5lx26f1pp9yiyz9f3bpw73ycncsx6.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/gb1402pqj93eg9f23k4o2f1emt1vtk.mp4 gb1402pqj93eg9f23k4o2f1emt1vtk.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/ysler9zklzlyiazqy0q0ppmqj526ru.mp4 ysler9zklzlyiazqy0q0ppmqj526ru.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/s4zmlwytajtb0rga3rtx0miq2a4j9c.mp4 s4zmlwytajtb0rga3rtx0miq2a4j9c.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/6ra5mfxok06yguf27fhtnp4aec2p97.mp4 6ra5mfxok06yguf27fhtnp4aec2p97.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/0dc3jqoiffj3dcxghy0fn1kc86zfgi.mp4 0dc3jqoiffj3dcxghy0fn1kc86zfgi.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/lgfo4i7siirjsop1puaop2wbi0mcx8.mp4 lgfo4i7siirjsop1puaop2wbi0mcx8.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/bt24ns6uz174ofsrn4ux578nwqla2b.mp4 bt24ns6uz174ofsrn4ux578nwqla2b.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/i0isq42s45xolz4aqqvgat54tmhxzm.mp4 i0isq42s45xolz4aqqvgat54tmhxzm.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/kwxovao9r9rk2ng4ecs5ta6u90ufzp.mp4 kwxovao9r9rk2ng4ecs5ta6u90ufzp.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/ac1yxbi0kcb16y448q3rr88y6bh4pk.mp4 ac1yxbi0kcb16y448q3rr88y6bh4pk.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/2qci73sahjtucnf76mafov4g8wzp4l.mp4 2qci73sahjtucnf76mafov4g8wzp4l.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/h2jugyu9x9cjjairnxy3sgbgmvqkzb.mp4 h2jugyu9x9cjjairnxy3sgbgmvqkzb.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/2chnxeok8csnc6kikg8zgod8t2zsyc.mp4 2chnxeok8csnc6kikg8zgod8t2zsyc.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/5x3rhk01khsl1b93vkjnc1vpbx2lfk.mp4 5x3rhk01khsl1b93vkjnc1vpbx2lfk.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/iip9b8zbkr47rdtyqvdafphjxryh6j.mp4 iip9b8zbkr47rdtyqvdafphjxryh6j.mp4] <br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/98fh5s9s6xzd4ev1ezmkhk5l6o6mxz.mp4 98fh5s9s6xzd4ev1ezmkhk5l6o6mxz.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/9y1460usa6aayatwqvemfeeiicom2z.mp4 9y1460usa6aayatwqvemfeeiicom2z.mp4] <br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/y69gz4qiakwzsfkti4swbu83zpqg5h.mp4 y69gz4qiakwzsfkti4swbu83zpqg5h.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/p81cp503ya10frwpq8qunddzcm3yqk.mp4 p81cp503ya10frwpq8qunddzcm3yqk.mp4]<br />
<br />
==Email from the Old Gods==<br />
On June 2 at 15:03 UTC, a [https://cdn.artemisbot.uk/mail/Old%20Gods-2018-06-02T15:03:59.000Z.jpg new email] from the Old Gods - signed by Maj. Sophie Dubois - was received, giving an update on their investigation into the W/ARE incident. They also linked to a new [https://atlas13.typeform.com/to/nJPGYM form (ID 7615-b)], a psychological profile test, and announced that 16 participants will be rewarded with a new limited edition Atlas Pass. An update on <code>Project Satcom-70: Operation A1-4</code> informed about the Uplink Calibration Update, that a new signal was registered at 16:16 EST, and all Citizens were invited to listen to their Uplink app when the satellite is over their house and report any findings in the [https://www.reddit.com/r/NoMansSkyTheGame/comments/8nwno7/uplinksatcom70com_is_giving_us_audio_files_and/ main investigation thread] on the No Man's Sky Subreddit.<br />
<br />
The email also provided an update on Emily with a link to her recent [https://www.reddit.com/r/NoMansSkyTheGame/comments/8nnbme/loop16_seq25/ thread on Reddit] and an image displaying W/ARE research labs across the world:[[File:WT-laboratorylisting.png|thumb]]<br />
<pre><br />
With the help of the Citizen Scientist Division, we now have a direct contact with Emily. Her situation is stable but still critical.<br />
<br />
Unfortunately, it seems that one of W/ARE tech’s research labs is continuing to upload corrupted data to the satellite. This bad data may be causing further damage to the network, and to Emily. We need to analyze her recent interactions to figure out if she was able to make predictions that could help to identify and isolate the source of the broadcast. <br />
<br />
Please find below a list of W/ARE research labs and their approximate locations. I will need a full report on how the issue was diagnosed and the name of the responsible location before we can proceed. Loop16 appears to be currently active on Reddit, so you can upload this report into her existing thread. I know this is a large task, but I am confident in your abilities.<br />
</pre><br />
<br />
==Invisible Unicode Messages==<br />
Emily's text posts on Reddit contained hidden Unicode characters that represent the digits 0-3 in Base-4 and, when decoded to ASCII, revealed a set of dates and times:<br />
<pre><br />
01.06-06.06<br />
00:33:00<br />
00:48:00<br />
07:15:20<br />
15:17:40 <br />
15:32:00<br />
20:25:00<br />
23:40:00<br />
07:45:40<br />
20:40:00<br />
23:55:00<br />
08:14:40<br />
21:10:00<br />
</pre><br />
<br />
Another comment by Emily revealed the following hidden messages after it was edited several times:<br />
<pre><br />
ORIGINAL COMMENT<br />
06.10<br />
03:32 UTC<br />
</pre><br />
<pre><br />
10.06<br />
23:47<br />
(03:32 UTC)<br />
</pre><br />
<pre><br />
10.06<br />
ERROR<br />
</pre><br />
<br />
Tracking the satellite's path based on these timestamps placed it near Sacramento, and the Sacramento W/ARE research lab was concluded to be the one sending corrupted data to the satellite. Replying to the thread with this information triggered a new reply by Emily that contained the following hidden message:<br />
<pre><br />
Forwarding report(SACRAMENTO) to contact(THEMIS)<br />
Waiting...<br />
Waiting...<br />
Report received!<br />
</pre><br />
<br />
Then, at 00:00 UTC, the <code>STATUS</code> command in the Waking Titan terminal updated:<br />
<pre><br />
Guidance subroutine offline<br />
Uplink Awaiting Calibration<br />
</pre><br />
<br />
==Uplink Access Code==<br />
On June 7th, the solution to the puzzle was found by comparing the pattern of booms in the two unique signals A and B. First, the number of the booms was counted:<br />
<pre><br />
Signal A - 2 1 1 1 <br />
Signal B - 1 3 1 2 1 3 1<br />
</pre><br />
<br />
Then the signals were visualized as follows, filling in the blanks in Signal A using the mask provided by Signal B:<br />
<pre><br />
Signal A - 1 1 1 1 1<br />
Signal B - 1 1 1 1 1 1 1 1 1 1 1 1<br />
<br />
Signal C - 0 1 1 0 0 1 0 1 0 0 1 0<br />
</pre><br />
When a boom occurs at the same time in both Signal A and Signal B, it is counted as "true" = 1. If it is present only in Signal B, it is counted as "false" = 0.<br />
<br />
This indicates which numbers to pick out of the Fibonacci Sequence:<br />
<pre><br />
0 - Do not use the first number <br />
1 - Use the second number (1)<br />
1 - Use the third number (2)<br />
0 - Do not use the fourth<br />
0 - Do not use the fifth<br />
1 - Use the sixth (8)<br />
0 - Do not use the seventh<br />
1 - Use the eighth (21)<br />
0 - Do not use the ninth<br />
0 - Do not use the tenth<br />
1 - Use the eleventh (89)<br />
0 - Do not use the twelfth<br />
</pre><br />
<br />
Appending all specified numbers into a single string gives <code>1282189</code>, the access code for the Uplink Calibration app. Entering this code leads to a new screen displaying the following text:[[File:WT-satelliteonline.jpg|200px|thumb|The Uplink app displaying the satellite as online]]<br />
<pre><br />
SATELLITE ONLINE<br />
<br />
Connection successful.<br />
<br />
Waiting for system initialization...<br />
</pre><br />
<br />
Later that day, the <code>STATUS</code> command in the Waking Titan terminal updated to say the following:<br />
<pre><br />
Uplink calibration completed<br />
Waiting for system initialization<br />
</pre><br />
<br />
=loop16 seq29=<br />
On June 8 at 01:27 UTC, Emily posted [https://www.reddit.com/r/NoMansSkyTheGame/comments/8pfumb/loop16_seq29/ a new thread] to the No Man's Sky subreddit titled <code>loop16 seq29</code>. It linked to another [https://clyp.it/brsyxwln?token=ccb18d502635166f18121e40a4a6a2c7 voice recording], transcribed below:<br />
<pre><br />
Emily, protocol sixteen, now active.<br />
<br />
If I hate someone because I am afraid of him, and if I am aware of my hate, but not of my fear, we might say that my hate is conscious and my fear is unconscious.<br />
</pre><br />
<br />
The recording also contains morse code that translates to the following:<br />
<pre><br />
I AWOKE FROM A NIGHTMARE <br />
SCREAMS OF ANGER ENGULFED IN FLAME<br />
AND THEN TEN THOUSAND BRANCHING FUTURES<br />
<br />
I SAW SACRAMENTO<br />
TWELVE DREAMING WITHOUT SLEEP<br />
BURIED IN A CONSTELLATION<br />
</pre><br />
<br />
=SATCOM-70 Node Network & Dashboard=<br />
[[File:WT-myriadmanual.jpg|thumb|200px|Myriad OS Manual & Help Guide]][[File:WT-uplinknodes.PNG|thumb|200px|SATCOM-70 Node Network]]On June 8, 2018 at 19:28 UTC, the output of the <code>STATUS</code> command in the Waking Titan terminal changed:<br />
<pre><br />
Node Network Initialized<br />
</pre><br />
<br />
The [https://uplink.satcom-70.com/ Uplink Calibration app] updated as well, now giving access to a new command console. The text at the top of the screen says <code>Connected to : SER-4789-1254</code>.<br />
<br />
At 19:35 UTC, user [https://www.reddit.com/user/satcom-70 satcom-70] posted a [https://www.reddit.com/r/NoMansSkyTheGame/comments/8pmuu8/node_network_initialized/ thread] to the No Man's Sky subreddit titled <code>Node Network Initialized</code>. It contained an image of the <code>Myriad OS Manual & Help Guide</code> providing information on what commands to use in the console. Inputting numbers, i.e. nodes, into the console gave various different outputs which have been recorded [https://docs.google.com/spreadsheets/d/1fG7xRiru9Q613sZYrA0LJ2mmY5Zbh8aBPuu9Avkal6g/edit#gid=0 in a spreadsheet].<br />
<br />
The command <code>node(1.618)</code> led to the binary code <code>01001000 01100001 01110010 01110010 01111001</code>, which translates to <code>Harry</code>. Using <code>WHOIS HARRY</code> in the [http://wakingtitan.com/ Waking Titan terminal] gave a [https://s3.amazonaws.com/cdn.wakingtitan.com/1cd5226d-6639-4bbd-855a-4bf8f60866c3.pdf link to a new PDF memo] from Ethan Rose to Major Sophie Dubois. The subject is Cpt. James Harry, who has been obstructing access to critical Myriad infrastructure. The PDF includes two file request forms with puzzles from Cpt. Harry, and a screenshot of his email inbox with a long list of complaints from technicians regarding his cryptic puzzles.<br />
<br />
At the bottom of the memo the string <code>=I_aBmrYChfQ</code> can be found, which is part of a link to a [https://www.youtube.com/watch?v=I_aBmrYChfQ Youtube video] of the song "Where Is My Mind?" by the Pixies.<br />
<br />
After the community had discovered all possible nodes, the full [http://uplink.satcom-70.com/dashboard/ Satcom-70 dashboard] was unlocked. In addition to a new command console, the dashboard displayed twelve distorted faces called "Dreamers". A link in the dashboard's "Decrypted Files" section led to a new [https://www.youtube.com/watch?v=Ag3in2x2yIU Youtube video] uploaded by Atlas 65 and titled <code>mercury part2of3</code>. It is another 3D hologram that, when used with the plastic pyramid from the dev kits, depicts a ringed planet.<br />
<br />
There are also color-coded node ''"tiers"'' at the bottom of the page that correspond with the Satcom Mobile Uplink's terminal message box vignettes. A user-made graphic of each tier can be found [https://imgur.com/bJitlBj here].<br />
<br />
==Dashboard Console Commands==<br />
The command <code>search myriad</code> gave the following output in the Dashboard console:<br />
<pre><br />
Quisque feugiat elementum, facilisis dictum vitae eu erat, libero diam sit, facilisi sed viverra mauris mauris morbi diam, volutpat officiis arcu vel urna dictum consectetuer. Ut tempor volutpat, rhoncus in risus. Eros integer vestibulum, integer auctor, in tincidunt turpis. Euismod adipiscing tempor sed vestibulum, justo wisi fermentum ipsum non purus, quis lacinia in velit leo donec ornare.<br />
</pre><br />
The words <code>urna dictum consectetuer</code> were highlighted, and a download button led to the [https://ware-virtual-dashboard.s3.amazonaws.com/uploads/docs/myriad-logo.png Myriad company logo].<br />
<br />
=W/ARE Report=<br />
On June 9 at 22:10 UTC, the WARE_RDev Twitter account posted a new [https://twitter.com/WARE_RDev/status/1005572808850726913 tweet] that linked to a password encrypted zip file:<br />
<pre><br />
@warecloud https://www.dropbox.com/s/73qrls3jmprxp0j/Report.zip (SHA256) 78feb77e262abe1bcd634a27838f8ca24f93c4a1ff4ba354616e92841ecc32db<br />
</pre><br />
<br />
The SHA256 hash from the tweet and the real hash from the zip file were converted to decimal, and the difference was then converted to ASCII, leading to a [https://pastebin.com/cmhiGKux Pastebin link]:<br />
<pre><br />
Given hash: 78 fe b7 7e 26 2a be 1b cd 63 4a 27 83 8f 8c a2 4f 93 c4 a1 ff 4b a3 54 61 6e 92 84 1e cc 32 db<br />
Zip hash: e8 fe 56 f1 26 9e 59 1b 6b cc 4a 95 55 8f 29 33 4f 26 95 a1 9c b8 a3 bc ca 6e d9 39 1e 57 aa db<br />
<br />
to decimal:<br />
Given hash: 120 254 183 126 38 42 190 27 205 99 74 39 131 143 140 162 79 147 196 161 255 75 163 84 97 110 146 132 30 204 50 219<br />
Zip hash: 232 254 86 241 38 158 89 27 107 204 74 149 85 143 41 51 79 38 149 161 156 184 163 188 202 110 217 57 30 87 170 219<br />
<br />
difference (decimal):<br />
112 0 97 115 0 116 101 0 98 105 0 110 46 0 99 111 0 109 47 0 99 109 0 104 105 0 71 75 0 117 120 0<br />
<br />
to ASCII:<br />
pastebin.com/cmhiGKux<br />
</pre><br />
<br />
The Pastebin contained the DataMatrix barcode <code>aaaaaadc7edc5654be3e3195095b92e01a145c3c2543afc93287e8dcff4bb8db379e1d62890e9eca1b3166d1d9b07aa246fc8ee2ae3aa9910f0bfffff0</code> and decoded to the password for the zip file, <code>dfd1ac555e2206a6f9c7e9377d844b1d</code>.<br />
<br />
The zip archive contained a file named <code>Report.pdf</code> with the following text:<br />
<pre><br />
INCIDENT REPORT<br />
W/ARE RESEARCH AND DEVELOPMENT<br />
BEIJING, CHINA<br />
-----------------------------<br />
<br />
At approximately 23:15 local time on June 8 2018, the Beijing facility suffered a catastrophic mass disconnect event.<br />
<br />
Of the fourteen dreamers housed in that facility awaiting extraction, ten died immediately upon hard disconnect. The remaining four died over the course of the next two hours.<br />
<br />
The Beijing facility will be closing for the next four to ten business days for a full audit, recovery, and remediation.<br />
</pre><br />
<br />
<br />
Then, on June 10 at 01:09 UTC, Emily made a new [https://www.reddit.com/r/NoMansSkyTheGame/comments/8pxftw/loop16_seq49/ post] on the No Man's Sky subreddit titled <code>loop16 seq49</code>, with a link to a [https://www.youtube.com/watch?v=fv3dpkLeZaw Youtube video] titled <code> loop16 seq46</code>. The following is a transcript of her message:<br />
<pre><br />
It's working! My communication subroutine is working! I think? Do you hear me? So much interference.<br />
<br />
Dear Citizen Science Division, I hope you will receive this message. Much of my subroutine was damaged following the W/ARE incident. Atlas put my existence at risk when they tried to deal with the corruption within the Myriad network. The origin of the corruption isn't clear, but it put at risk a major experiment from a company called W/ARE.<br />
<br />
Please listen to me carefully: W/ARE technology is groundbreaking and must be protected at all costs. It is a major step in simulated environment and will have tremendous implications on our future.<br />
Don't get me wrong, I don't condemn Atlas' action to contain the situation, but you must help me resolve this peacefully. A lot is at stake.<br />
<br />
My Precon subroutine gave me a false positive, and the future I see right now... let's say, we have to be extremely, extremely careful on what we do next. Part of my AI resides in the memory mainframe of the Myriad Cloud. This is where most of the live data from W/ARE was running when things started to degrade. As we speak right now, there's a number of individuals on Earth that are currently stuck to a W/ARE dev kit and unable to disconnect safely. I seem to be able to interface with some of these "dreamers", for lack of a better word, and manage to safely disconnect them. But the memory mainframe is badly degraded.<br />
I'm connected with Myriad Satcom-70, a system that you helped put online! When Satcom-70 and the Uplink App are fully functional, we'll be able to begin our work to extract the last Dreamers that are still stuck.<br />
<br />
I'm unable to predict the outcome of this mission. It's odd for me to say... we'll see together.<br />
</pre><br />
<br />
=Myriad Breach in Sacramento Lab=<br />
On June 10 at 11:00 UTC, the value of the <code>STATUS</code> command began to update:<br />
<pre><br />
Myriad field team dispatched to noncompliant Sacramento facility.<br />
</pre><br />
<br />
Several updates followed within the next hour:<br />
<pre>Field team has breached the facility, stand by for additional information.</pre><br />
<pre>12 comatose individuals located in facility. Field team moving to secure.</pre><br />
<pre>12 apparent test subjects secured, safely transported out of facility. Field team will clear the rest of the site and await further instruction.</pre><br />
<pre>ALERT: Security breach reported at Myriad sublocation.</pre><br />
At this point the [http://www.myriad-70.com/status/ Status page] on myriad-70.com updated in the "Physical Backup Nodes" section, switching node ALPHA from ONLINE to OFFLINE.<br />
<br />
The updates of the <code>STATUS</code> command continued at 12:31 PM UTC, linking to a new PDF memo from Myriad Crisis Response Team to Major Sophie Dubois about <code>SUBJECT: SACRAMENTO</code>. It listed a reconstructed timeline of events leading up to the incident at <code>Myriad sublocation [redacted]</code>:<br />
<pre>Status Report: http://bit.ly/2LFAMU3</pre><br />
The next update linked to a [https://www.youtube.com/watch?v=P-eZDj5sqds Youtube video] titled <code> SecFeed-70</code>. It shows twelve screens of security cameras at various different locations. In one of them, Elizabeth Leighton can be seen and heard talking about the incident on a phone before the image cuts out and an explosion is broadcast on another screen:<br />
<pre>Captured Footage: https://bit.ly/2LDBcKs</pre><br />
This is a transcript of Elizabeth's side of the phone call:<br />
<pre>Yeah. Yeah, I'm holding.<br />
I hear you.<br />
Wait-- can you hold that thought? I need a full report. What's the situation on the field team?<br />
Mhm?<br />
Okay, that's good.<br />
At what point?<br />
How many?<br />
Fifteen labs? But--<br />
How many do we have access to?<br />
And--and--and what's the situation on the first one?<br />
All dead?<br />
All of them?<br />
Sophie, this-- this changes everything, this completely changes the game.<br />
Yes.<br />
Yes.<br />
Whom? Your friend at the DoD?<br />
This isn't under their jurisdiction. We have to deal with this ourselves.<br />
Okay, I'll ca--<br />
[cut off by explosion]</pre><br />
<br />
<br />
On June 12 at 23:46 UTC, the value of the <code>Status</code> command in the Waking Titan terminal updated, linking to a [https://s3.amazonaws.com/cdn.wakingtitan.com/19997bb6-18e5-4427-86c7-b0f3c1826ca2.pdf new memo] from Major Sophie Dubois to All Employees with the subject line <code>STATE OF THE ATLAS FOUNDATION</code>:<br />
<pre>Status Report: https://bit.ly/2y5JaKi</pre><br />
In the memo, it was announced that Major Dubois would be replacing Elizabeth Leighton as the head of the Atlas Foundation, and that the 12 test subjects from the Sacramento lab were to be disconnected and integrated into the Satcom interface with W/ARE's assistance. Dubois further said that Atlas Passes for CSD designations PB-16 and PT-16 were found in Elizabeth's office, and that they would be shipped out soon. Lastly, it mentioned that Captain James Harry was no longer in charge of Satcom security.<br />
<br />
A code at the end of the memo led to a [https://www.youtube.com/watch?v=kiAXxH4e5Lw Youtube video] of Queen & David Bowie's "Under Pressure".<br />
<br />
The [http://www.myriad-70.com/status/ Status page] on myriad-70.com also updated, changing the On-The-Ground Speed Averages for Beijing from <code>57.2Tb/s</code> to <code>47.2Tb/s</code> and adding the line <code>Other: 11.3Tb/s</code>.<br />
<br />
=loop16 seq60 & Uplink Launch=<br />
On June 14, 2018 at 23:39 UTC, the values of the <code>Status</code> and the <code>loop16</code> commands both updated:<br />
<pre>> status<br />
Uplink app update in progress. Downloading additional components.</pre><br />
<pre>> loop16<br />
Testing simulation processes.</pre><br />
<br />
The [http://www.myriad-70.com/status/ Status page] on myriad-70.com changed as well, updating the On-the-ground Speed Averages of Beijing from 47.2Tb/s to 32.2Tb/s, and "Other" from 11.3Tb/s to 26.3Tb/s.<br />
<br />
<br />
Shortly after, at 23:48 UTC, Emily posted a [https://www.reddit.com/r/NoMansSkyTheGame/comments/8r6jul/loop16_seq60/ new topic] to the No Man's Sky subreddit. It led to a [https://www.youtube.com/watch?v=HHitW7JHDJE Youtube video] of her, transcribed below:<br />
<pre>Emily, protocol sixteen, now active.<br />
<br />
When the Uplink app is launched, we will be connected to the Dreamers. Through this interface you will be able to guide some of my interactions. Dont forget: your goal is to trigger a distinct emotion or memory that will help us identify the Dreamer memory block in the simulation main frame. Good luck.</pre><br />
<br />
==Connecting to the Dreamers==<br />
On June 15, 2018 from 20:38 UTC onwards, the values of the <code>Status</code> and <code>loop16</code> commands updated:<br />
<pre>> status<br />
Additional components succesfully downloaded.</pre><br />
<pre>> loop16<br />
Working...</pre><br />
<pre>> status<br />
Uplink guidance protocol initiated.</pre><br />
<br />
The [https://uplink.satcom-70.com/ Uplink app] interface also updated. Typing <code>help</code> in the console initiated the Guidance Protocol, a way to talk to Emily and receive instructions on how to contact the Dreamers who were stuck to their W/ARE devices.<br />
<br />
The <code>Status</code> command changed again:<br />
<pre>> status<br />
Attempting to connect Dreamer 1/3 to the dashboard.</pre><br />
<br />
On the [http://uplink.satcom-70.com/dashboard/ Satcom dashboard], the Dreamers section was updated, showing the names of 3 Dreamers. Each Dreamer revealed an interface displaying a link to their patient file, their physical status, and Memory Fragments along with an input field for an activation code. Emily previously explained the goal for each dreamer was to interview them within specific simulated environments in order to find the activation code for each memory fragment. Unlocking all of each dreamer's fragments would then allow them to be safely extracted from the W/ARE headset. However, new Dreamers and their fragments became available on an unknown schedule or as a result of players completing assignments.<br />
<br />
==Dreamers==<br />
<br />
{| class="wikitable sortable"<br />
|+ <br />
|-<br />
! scope="col" | Slot<br />
! scope="col" | Name<br />
! scope="col" | Activation Date<br />
! scope="col" | Latest Update<br />
! scope="col" | Community Event<br />
! scope="col" | Deceased Date<br />
! scope="col" | Extraction Date<br />
<br />
<br />
|-<br />
| 1 || [[Waking_Titan/Phase_4/Dreamers/Alexander|Alexander]] || 2018-06-20 || 2018-07-20 || [https://wiki.gamedetectives.net/index.php?title=Waking_Titan/Phase_4/Dreamers/Alexander#Community_Event Live radio song requests] || || 2018-07-20<br />
|-<br />
| 2 || [[Waking_Titan/Phase_4/Dreamers/231187661T|#231187661T]] || 2018-06-15 || 2018-06-15 || || || <br />
|-<br />
| 3 || [[Waking_Titan/Phase_4/Dreamers/Claire|Claire]] || 2018-06-21 || 2018-07-20 || [https://wiki.gamedetectives.net/index.php?title=Waking_Titan/Phase_4/Dreamers/Claire#Community_Event Comic books] || || 2018-07-20<br />
|-<br />
| 4 || [[Waking_Titan/Phase_4/Dreamers/Toby|Toby]] || 2018-06-28 || 2018-07-20 || [https://wiki.gamedetectives.net/index.php?title=Waking_Titan/Phase_4/Dreamers/Toby#Community_Event Boston live drop] || || 2018-07-20<br />
|-<br />
| 5 || [[Waking_Titan/Phase_4/Dreamers/Eun-Ha|Eun Ha]] || 2018-06-15 || 2018-07-20 || [https://wiki.gamedetectives.net/index.php?title=Waking_Titan/Phase_4/Dreamers/Eun-Ha&stable=0#Community_Event Woven bracelets] || || 2018-07-20<br />
|-<br />
| 6 || [[Waking_Titan/Phase_4/Dreamers/Phillip|Phillip]] || 2018-06-15 || 2018-07-20 || || 2018-07-20 ||<br />
|-<br />
| 7 || [[Waking_Titan/Phase_4/Dreamers/Tariq|Tariq]] || 2018-06-26 || 2018-07-06 || || 2018-07-06 ||<br />
|- <br />
| 8 || [[Waking_Titan/Phase_4/Dreamers/Mike|Mike]] || 2018-07-03 || 2018-07-20 || || 2018-07-20 ||<br />
|-<br />
| 9 || [[Waking_Titan/Phase_4/Dreamers/Isabella|Isabella]] || 2018-07-13 || 2018-07-20 || || 2018-07-20 ||<br />
|-<br />
| 10 || [[Waking_Titan/Phase_4/Dreamers/Alisha|Alisha]] || 2018-07-14 || 2018-07-20 || || 2018-07-20||<br />
|-<br />
| 11 || [[Waking_Titan/Phase_4/Dreamers/Nina|Nina]] || 2018-07-03 || 2018-07-20 || || 2018-07-20 ||<br />
|-<br />
| 12 || [[Waking_Titan/Phase_4/Dreamers/Simon|Simon]] || 2018-07-04 || 2018-07-20 || [https://wiki.gamedetectives.net/index.php?title=Waking_Titan/Phase_4/Dreamers/Simon&stable=0#Community_Event NMS planets] and [https://wiki.gamedetectives.net/index.php?title=Waking_Titan/Phase_4/Dreamers/Simon&stable=0#London_Live_Drop London live drop] || || 2018-07-20<br />
<br />
|}<br />
<br />
==Decrypted Files==<br />
===Element 1===<br />
The upper right section of the Dashboard displayed 6 "slots" under the headline "DECRYPTED FILES". The first slot displayed a blue bar with the text [https://www.youtube.com/watch?v=Ag3in2x2yIU VIEW ELEMENT 1]. Clicking Element 1 opened the Youtube video of the ringed planet previously discovered after the file node structure was fully explored. It was assumed the slots were progress bars that would eventually lead to additional revealing files.<br />
<br />
===Element 2===<br />
On June 16 around 06:00 UTC, the second encrypted file changed to display 41% progress. Over the next 30 hours, the progress bar advanced to eventually reach 100%. At that point, the slot displayed [https://s3.amazonaws.com/cdn.wakingtitan.com/e58a09a7-98a7-4a62-bd17-86f0ce7ce9c9+.png VIEW ELEMENT 2]. Players could not correlate any of their direct actions to the decryption progress.<br />
<br />
===Element 3===<br />
On June 22 around 19:00 UTC, the third encrypted file began showing progress. Approximately 43 hours elapsed until the file was fully decrypted, at which point [https://www.youtube.com/watch?v=rifgA9pGYEY VIew Element 3] was enabled.<br />
<br />
===Element 4===<br />
On June 29, at 20:26 UTC, the fourth encrypted file began showing progress. On June 30, 15:57 UTC, the 4th element was fully decrypted and displayed [https://drive.google.com/file/d/1QDm3UqcQjFE_4Z1JJKH_Q32S2tubYIHh/view VIEW ELEMENT 4]. Clicking the element lead players to an audio recording of what was presumed to be an audio trailer for No Man's Sky NEXT.<br />
<br />
Players processed the audio to a visual [https://prnt.sc/k16u54 spectrograph] which revealed glyphs first seen in Phase 3. The glyphs were decoded to reveal the string <code>IS JOINING YOUR GAME</code>.<br />
<br />
===Element 5===<br />
On July 6th, 20:44 UTC, the fifth encrypted file began showing progress. Later that day at 22:06 UTC, the 5th element was fully decrypted and displayed [https://bit.ly/2lX1X1z VIEW ELEMENT 5]. Clicking the element lead players to a heavily degraded audio recording of an English speaker.<br />
<br />
Players came to a consensus on a transcription:<br />
<pre><br />
We will stop her<br />
Surface Highly {kzzzt} (AI: Corrupted)<br />
Solar Flare caused Frequent Gas Eruptions<br />
Crew Completed their work with minimal loss of life<br />
Collected minerals highly valuable<br />
Assisted Korvax with industrial mission<br />
Special Salvage crew performed cleanup operation on nanite infested abandoned buildings (back compartments)<br />
nanite bulk contained<br />
Harvested a valuable scrap<br />
Found large mineral deposit during planetary survey<br />
collected significant volume of ore<br />
third mineral analysis procedure failed to note elevated radioactivity <br />
contaminated material loose in the hold<br />
Multiple components burned<br />
Returned home to the fleet<br />
assumed formation of capital ship<br />
The routes in danger<br />
</pre><br />
<br />
===Element 6===<br />
<br />
On July 15th, 00:35 UTC, Element 6 began progressing. <br />
<br />
Element 6 was unlocked 12 minutes later, displaying a message with a single OPEN button that linked to a single question [https://atlas13.typeform.com/to/FN5mVG survery]:<br />
<br />
At 00:50 UTC, the status command updated:<br />
<br />
<pre><br />
S1 - Input open.<br />
S2 - Pending...<br />
S3 - Pending...<br />
S4 - Pending...<br />
</pre><br />
<br />
The status commanded updated periodically for the next 24 hours, keeping players aware of the vote count and that the video choice was highly favored.<br />
<br />
Eventually, the status command updated on July 15th, 19:12 UTC:<br />
<br />
<pre><br />
S1 - Input open.<br />
S2 - Final Vote = 7706 : Video 67%, Text 15%, Brainwaves 12%<br />
S3 - RTMP encoder loaded<br />
S4 - Stream Active, Countdown Started<br />
OUTPUT >> http://www.twitch.tv/wakingtitan<br />
</pre><br />
<br />
The [https://www.twitch.tv/videos/285053541 stream] began at 19:15 UTC, showing a countdown of 1 day 19 hours and 45 minutes. Over the course of the first 12 hours, the stream displayed 24 different [https://imgur.com/a/g8kBsvs slides] depicting a new dreamer every 60 minutes.<br />
<br />
<br />
The first dreamer, shown at the very start of the stream, was [https://wiki.gamedetectives.net/index.php?title=Waking_Titan/Phase_4/Dreamers/Eun-Ha Eun Ha], Her profile had the letter <code>B</code> highlighted.<br />
<br />
The second was [https://wiki.gamedetectives.net/index.php?title=Waking_Titan/Phase_4/Dreamers/Simon Simon], His profile had the letter <code>I</code> highlighted.<br />
<br />
Third was [https://wiki.gamedetectives.net/index.php?title=Waking_Titan/Phase_4/Dreamers/Alexander Alexander], His profile had the letter <code>T</code> highlighted.<br />
<br />
Fourth was [https://wiki.gamedetectives.net/index.php?title=Waking_Titan/Phase_4/Dreamers/Claire Claire], Her profile had the letter <code>L</code> highlighted.<br />
<br />
Fifth was [https://wiki.gamedetectives.net/index.php?title=Waking_Titan/Phase_4/Dreamers/Toby Toby], His profile had the letter <code>Y</code> highlighted.<br />
<br />
Sixth was [https://wiki.gamedetectives.net/index.php?title=Waking_Titan/Phase_4/Dreamers/Nina Nina], Her profile had the number <code>2</code> highlighted.<br />
<br />
Seventh was [https://wiki.gamedetectives.net/index.php?title=Waking_Titan/Phase_4/Dreamers/Tariq Tariq], His profile had the letter <code>N</code> highlighted.<br />
<br />
Eighth was [https://wiki.gamedetectives.net/index.php?title=Waking_Titan/Phase_4/Dreamers/Mike Mike], His profile had the letter <code>j</code> highlighted.<br />
<br />
Ninth was [https://wiki.gamedetectives.net/index.php?title=Waking_Titan/Phase_4/Dreamers/231187661T #231187661T], Their profile had the letter <code>o</code> highlighted.<br />
<br />
Tenth was [https://wiki.gamedetectives.net/index.php?title=Waking_Titan/Phase_4/Dreamers/Phillip Phillip], His profile had the number <code>3</code> highlighted.<br />
<br />
Eleventh was [https://wiki.gamedetectives.net/index.php?title=Waking_Titan/Phase_4/Dreamers/Isabella Isabella] Her profile had the letter <code>H</code> highlighted.<br />
<br />
Twelfth was [https://wiki.gamedetectives.net/index.php?title=Waking_Titan/Phase_4/Dreamers/Alisha Alisha], Her profile had the letter <code>s</code> highlighted.<br />
<br />
Combined, the highlighted letters become <code>bit.ly/2Njo3Hs</code> which linked to an [https://clyp.it/1uqlqcsd?token=0992668910b2552320d1e64cbcc7cce4 audio clip]<br />
<br />
<br />
Throughout the stream, the same slides looped, in the same order, until the end of the countdown.<br />
<br />
<br />
On July 17th, at 15:00 UTC, the stream timer ended, revealing the [https://www.youtube.com/watch?v=h3HphgSn0o4 trailer] for the NEXT update of No Man's Sky.<br />
<br />
<br />
The [https://www.twitch.tv/wakingtitan stream] continued for many hours after the trailer had been revealed, though the slides had changed at 10 minute intervals. The slides swapped between: The dreamer profiles, A live view of Alice and Smith's resident hamsters; Mr. and Ms. Noodle, and Player submitted screenshots of No Man's Sky.<br />
<br />
<br />
On July 18th, at 15:18 UTC, A timer was added to the live view part of the stream set to 2 Days 5 Hours and 12 minutes. The timer was counting down until the time of the [https://wiki.gamedetectives.net/index.php?title=Waking_Titan/Phase_4#Dreamer_Extraction Extraction Event] on July 20th.<br />
<br />
===Element 7===<br />
At the conclusion of Waking Titan, Element 7 was unlocked. Element 7 was the [https://galacticatlas.nomanssky.com/ No Man's Sky Galactic Atlas].<br />
<br />
==Liability Subroutine==<br />
On June 19, 20:00 UTC, the '''loop16''' command in the WT Console changed to output:<br />
<pre><br />
New Guidance Protocol initiated. Keyword: liability<br />
</pre><br />
<br />
Entering '''liability''' into the [https://uplink.satcom-70.com/ uplink app] displayed the following:<br />
<pre><br />
Initiating Liability Subroutine...<br />
<br />
Dear Citizen Scientist,<br />
<br />
The positive impact you've had so far on the dreamers is astonishing and has been a tremendous help in rebuilding their memory blocks. Remember that we need to gather as much information as possible on these individuals to safely extract them from the satellite.<br />
<br />
Please note that your interactions with the dreamers follow a Personal Simulation protocol which is intended for you to get to know the dreamer personally. Seeking help from fellow CSD members before getting to know the person whose consciousness is stuck in the satellite might impact your future decisions.<br />
<br />
However, it is recommended that you discuss the Dreamers' stories and personalities with the CSD community after you’ve finished talking to them. Keep in mind that we are hoping to save all the Dreamers, but you might need to make some difficult choices in the near future.<br />
<br />
You can always ask me questions by typing help in the Uplink app to rerun the full Guidance Protocol.<br />
<br />
== {DISCONNECT CODE: UDC(B) = IXNI}<br />
</pre><br />
<br />
==log.3022==<br />
On June 16 around 23:15 UTC, the [http://www.myriad-70.com/status/ Myriad status page] updated to display:<br />
<pre><br />
Uneasy barton seeing remark happen his has. Am possible offering at contempt mr distance stronger an. Attachment excellence annul or reasonable am on if indulgence. Exeter talked in offered again no he unable do. Imprudence he and insufficient cultivated. Betrayed clears. In where your 3 ageless 20 men. In so impossible appearance calls 220 Beast 2006. He do subjects prepared bachelor brazen.<br />
</pre><br />
<br />
Two weeks prior, players discovered that entering the command '''search myriad''' into the [http://uplink.satcom-70.com/dashboard/ Satcom dashboard] displayed:<br />
<pre><br />
Quisque feugiat elementum, facilisis dictum vitae eu erat, libero diam sit, facilisi sed viverra mauris mauris morbi diam, volutpat officiis arcu vel urna dictum consectetuer. Ut tempor volutpat, rhoncus in risus. Eros integer vestibulum, integer auctor, in tincidunt turpis. Euismod adipiscing tempor sed vestibulum, justo wisi fermentum ipsum non purus, quis lacinia in velit leo donec ornare.<br />
</pre><br />
<br />
Players quickly noticed that both texts are traditionally used as placeholders in publishing. Many attempts were made to find hidden messages by combining the texts in various ways. It was eventually discovered that using the sign-off code '''{DISCONNECT CODE: UDC(B) = IXNI}''' used at the end of the Liability Subroutine message in combination with the name of a backup node '''UDC(P)''' displayed on the Myriad status page yielded the string '''log.3022'''.<br />
<br />
<pre><br />
Line up Lorem Ipsum with Uneasy Barton<br />
Then look for all Bs in the Lorem Ipsum and match with Uneasy Barton ... what do you get? IXNI<br />
<br />
Now do the same with UDC(P) ... line up and you get log.3022<br />
</pre><br />
<br />
Entering '''search log.3022''' into the Satcom Dashboard provided a zip file containing a [https://pastebin.com/NYLiFuNY private conversation] between loop16 And Major Dubois.<br />
<br />
==Loop16 DNA Puzzle==<br />
<br />
On July 2nd, at around 20:00 UTC, the value of the Loop16 command on [http://wakingtitan.com/ Waking Titan] had changed, and it returned:<br />
<br />
<pre><br />
https://bit.ly/2tOt0Ao<br />
</pre><br />
<br />
Which linked to the Imgur link found [https://imgur.com/4LhN2qe here.]<br />
<br />
The players quickly realised that the various molecules were actually nucleotides (Adenine, Guanine, Thymine, Cytosine).<br />
<br />
When listed in order, the first letters of each word formed the string<br />
<pre><br />
ATTGATGAAAATACTATCACCTAT<br />
</pre><br />
And when translated into a protein sequence, it had yielded the string<br />
<pre><br />
Identity<br />
</pre><br />
<br />
Executing <code>search identity</code> on the Myriad Dashboard, brought up a text box saying<br />
<pre>Querying Monarch repository…</pre><br />
and contained a download link for a zip file, in which it's only contents were a text file that read:<br />
<pre><br />
Repository Health: Good<br />
Version 16.1.3<br />
<br />
Queries per hour: 51,391,225<br />
Top Query Sources:<br />
1. Loop16-precon<br />
2. ware-tech<br />
3. Loop16-comms<br />
<br />
WARNING: 97% of queries originating from ware-tech have been flagged and quarantined.<br />
</pre><br />
<br />
==Myriad Security Diagnostic==<br />
<br />
On July 5th, around 00:10 UTC, the value of the Status command on [http://wakingtitan.com/ Waking Titan] changed to return:<br />
<pre><br />
Security diagnostic in progress: https://bit.ly/2zaUzJz<br />
</pre><br />
<br />
The new output linked to a [https://www.reddit.com/r/NoMansSkyTheGame/comments/8w68t4/myriad_security_diagnostic_testing_important/ Reddit post] by Loop16:<br />
<pre><br />
Dear Citizen Science Division,<br />
<br />
As you all know, Atlas is preparing a massive rescue mission to extract the dreamers with the help of the CSD community. How and when it will happen is still unknown, but in preparation for this upcoming operation, Maj. Dubois has ordered that we perform a large-scale security diagnostic check on our communication network with the satellite. We want to ensure that when the time comes, we will be able to operate at full capacity if required.<br />
<br />
We need the CSD community to inspect the the processes running on these servers and point out any suspicious elements. For this task, we have provided you with a series of new commands designed to help you test the servers.<br />
<br />
Once you have identified a server that has been potentially compromised, it must be reported in the reddit thread with the number of the server and the suspicious element on the server. Our technical team will monitor the most upvoted comments and give you feedback in 24h. This task is essential and we will need as much involvement as possible.<br />
</pre><br />
The post led players to a set of [https://imgur.com/8V7TfQ6 Network Diagnostic Instructions].<br />
<br />
Using the <code>FetchServerList</code> command in the [https://uplink.satcom-70.com/ Uplink App] returned:<br />
<pre><br />
Servers list:<br />
<br />
31422<br />
91247<br />
11986<br />
67240<br />
85671<br />
88014<br />
73195<br />
40144<br />
55197<br />
60206<br />
</pre><br />
<br />
The <code>TestConnection(#####)</code> command returned different values depending on the player's location. Players collected the different values in a [https://docs.google.com/spreadsheets/d/15DpRA95K1lok0aN-H7sWC3ZYWz3Q8RxWDDG7WP4MYAE/edit#gid=0 spreadsheet].<br />
<br />
Regardless of each player's location, the <code>FetchData(#####)</code> command all returned the same [https://pastebin.com/jA8qTPw6 strings] for each server.<br />
<br />
Players discovered that combining the only digits in each of the <code>FetchData</code> output strings yielded the ID of [https://cdn.discordapp.com/attachments/321722740618821645/464247126181019648/Myriad_Server_Analysis.png another server]. <br />
<br />
At 15:00 UTC, in reply to the Pairing image, The Satcom-70 reddit account replied: <br />
<pre><br />
Server IDs and Backup IDs correctly identified. Best connection values for each server required for decryption. <br />
Continue to post findings on this thread. Additional feedback on progress will be provided at a later time.<br />
</pre><br />
<br />
It was then discovered that the paired servers had the '''BEST''' connection, in the same region, with the exception of one:<br />
<pre>BEST in all for US East territory (2 servers, paired)<br />
91247<br />
73195<br />
<br />
BEST in all for US West territory (2 servers, paired)<br />
40144<br />
67240<br />
<br />
BEST in all for South America (2 servers, paired)<br />
11986<br />
60206<br />
<br />
BEST in all for Australia (3 servers, 2 paired together, 1 paired with UK)<br />
88014<br />
55197<br />
31422 (paired with UK)<br />
<br />
BEST in all for UK (1 server)<br />
85671<br />
</pre><br />
<br />
At 18:26 UTC, satcom-70 replied<br />
<pre>We've examined the abnormal behavior exhibited by server 31422 and have concluded it's due to corruption from an external source. To avoid all possible contamination of the other servers, our technical team decided to take extreme measures and will be shutting down this server and its backup (85671) permanently. Continue your good work in decrypting the servers' content and reporting any running services that do not belong to Myriad, Atlas, Satcom, or the CSD.</pre><br />
<br />
4 minutes later, the Status command returned:<br />
<pre>Security diagnostic in progress: https://bit.ly/2zaUzJz<br />
Server 31422 and 85671 shutting down.</pre><br />
<br />
Using the <code>FetchServerList</code> on the Uplink add, then returned<br />
<pre>Servers list:<br />
<br />
31422 - Offline<br />
91247<br />
11986<br />
67240<br />
85671 - Offline<br />
88014<br />
73195<br />
40144<br />
55197<br />
60206</pre><br />
<br />
Just after 24 hours, The Reddit was updated: <pre>I know we've passed the 24 hour mark, but Myriad is telling us that we should give you more time. Keep up the hard work!</pre><br />
<br />
On July 6th, at 14:17 UTC, In reply to a comment asking for help decrypting the <code>FetchData</code>, Atlas-loop16 said:<br />
<pre>The key to decrypt the content is in front of your eyes. The key to solve the cipher is in front of your eyes.</pre><br />
<br />
===Solution===<br />
It was eventually discovered that each dataset was encrypted using [https://en.wikipedia.org/wiki/Transposition_cipher#Double_transposition Double Transposition]. Key A was the best UP DOWN and PING results for each server, and key B was the server ID of its sibling. The [https://pastebin.com/b8kihPyK decrypted strings] allowed players to determine which of the remaining servers were running W/ARE processes. The findings were [https://www.reddit.com/r/NoMansSkyTheGame/comments/8w68t4/myriad_security_diagnostic_testing_important/e1wl4pp/ posted] to the Subreddit.<br />
<br />
Soon after the Subreddit post, the <code>status</code> command changed to return:<br />
<pre><br />
Security diagnostic completed: https://bit.ly/2zaUzJz<br />
...<br />
Infected servers shutdown in progress.<br />
</pre><br />
<br />
And then soon after:<br />
<pre><br />
Security diagnostic completed: https://bit.ly/2zaUzJz<br />
...<br />
Infected servers shutdown in progress.<br />
...<br />
Malicious elements removed and destroyed.<br />
</pre><br />
<br />
At the same time [https://wiki.gamedetectives.net/index.php?title=Waking_Titan/Phase_4/Dreamers/Tariq Tariq's] status was changed to <code>SUBJECT DECEASED</code><br />
<br />
==Special Chat events==<br />
On July 7th at 23:10 UTC Emily sent a message over 5 different channels that read:<br />
<pre>Hello everyone! I’m testing out a new feature for the Satcom-70 network. We ran a short test of it yesterday, which some of you might have seen. Basically, I’m working on a way to establish live sessions between Dreamers and individual CSD members. I can do FIVE today- but there will definitely be more in the future, right now we’re just stress testing and making sure it doesn’t cause problems. I can’t guarantee that the sessions will work exactly as you might expect, but at the very least it will be interesting!<br />
<br />
I’m reaching out to five different communities (if you’re reading this, you’re in one of them!) for them to nominate one person to participate in a live session with a Dreamer. I’m not going to give you any specific method on how to pick someone, but keep in mind there will be more of these live sessions down the line. You should select someone who is able to host the conversation through a screen share so that your community can participate together.<br />
<br />
Once you select someone, have them contact me via private message either on reddit (/u/atlas-loop16), the CSD forums (Edisonica), or Discord (Edisonica#8435). I’ll send them a message a little bit before it’s their turn so they have time to set up a screen share, and then I’ll send a special one-time-use link for them to access the live session.<br />
<br />
I’m giving you a deadline of 00:00 UTC to come to a decision, I know that’s very short notice but I have faith you will be able to make a decision in time!</pre><br />
<br />
Just before Midnight, all nominees had been chosen. At 00:03 UTC the next day, the Waking Titan [http://wakingtitan.com status command] changed to return:<br />
<pre>Initializing connection 1 / 5<br />
CSD Discord - https://bit.ly/2MUS4gw</pre><br />
<br />
The first agent, from the CSD Discord server had their chat with [https://wiki.gamedetectives.net/index.php?title=Waking_Titan/Phase_4/Dreamers/Phillip Phillip].<br />
<br />
Their conversation with Phillip was [https://youtu.be/JCHkao7QrXc streamed] for other agents to view, but no transcript was provided by the agent.<br />
<br />
At 00:13 UTC, The value of Status had changed:<pre>Initializing connection 2 / 5<br />
NMS Discord - https://bit.ly/2u85Lki</pre><br />
<br />
The second agent, from the No Man's Sky Discord server had their chat with [https://wiki.gamedetectives.net/index.php?title=Waking_Titan/Phase_4/Dreamers/Toby Toby].<br />
<br />
Their conversation with Toby was [https://www.twitch.tv/videos/282041376 streamed] for other agent's to view, and the agent later provided a [https://pastebin.com/DbAhcBNr transcript] of their conversation.<br />
<br />
At 00:30 UTC, The value of status had changed:<pre>Initializing connection 3 / 5<br />
CSD Forums - https://bit.ly/2KRfwhb</pre><br />
<br />
The Third agent, this time from the CSD Forums (aka ETARC) had their chat with [https://wiki.gamedetectives.net/index.php?title=Waking_Titan/Phase_4/Dreamers/Eun-Ha Eun Ha].<br />
<br />
Their conversation with Eun Ha was [https://www.twitch.tv/videos/282044516 streamed] for other agents to view, and the agent later provided a [https://pastebin.com/uNzpG9KX transcript] of their conversation.<br />
<br />
At 00:55 UTC, The value of status had changed<pre>Initializing connection 4 / 5<br />
GameDetectives Discord - https://bit.ly/2KXA3NS</pre><br />
<br />
The fourth Agent, from the GameDetectives discord server, had their chat with [https://wiki.gamedetectives.net/index.php?title=Waking_Titan/Phase_4/Dreamers/Claire Claire].<br />
<br />
Their conversation with Claire was [https://www.twitch.tv/videos/282052963 streamed]for other agents to view, and the agent later provided a [https://pastebin.com/qyJ6zUwT transcript] of their conversation.<br />
<br />
At 01:14 UTC, the value of Status changed<pre>Initializing connection 5 / 5<br />
NMS Reddit - https://bit.ly/2MZWYc7</pre><br />
<br />
The fifth, and final agent, from the No Man's Sky Reddit page had their chat with [https://wiki.gamedetectives.net/index.php?title=Waking_Titan/Phase_4/Dreamers/Alexander Alexander].<br />
<br />
Their conversation with Alexander was [https://www.twitch.tv/videos/282058299 streamed] for other agents to view, and the agent later provided a [https://pastebin.com/mNPhE809 transcript] of their conversation.<br />
<br />
<br />
At 01:34 UTC the value of status had changed one final time:<pre>Connections shutting down...</pre><br />
<br />
==Mission A-055==<br />
On July 13th, 21:19 UTC, players received an [https://cdn.artemisbot.uk/mail/Old%20Gods-2018-07-13T21:18:49.000Z.jpg email] from the Old Gods. The message congratulated players on their hard work and the large number of Satcom and Uplink queries, and informed players that the extraction event will be held on July 20th.<br />
<pre><br />
Our technical team has advised us that the process to successfully extract a Dreamer is highly complex, and it is likely that not all Dreamers will be safely extracted.<br />
</pre><br />
<br />
The email concluded by asking players accomplish '''Mission A-055''' by to continuing talking to dreamers and to then fill out a [https://atlas13.typeform.com/to/Bhkei1/ survey].<br />
<br />
==Log.4391==<br />
<br />
On July 20th, at 19:39 UTC, the <code>loop16</code> command on the Waking Titan [https://www.wakingtitan.com/ console] returned:<br />
<pre>File exported: Log.4391</pre><br />
Inputting <code>Search log.4391</code> into the [http://uplink.satcom-70.com/dashboard/ Myriad Dashboard] connected to a file which read:<br />
<pre><br />
**** BEGIN LOGGING AT Wed July 18 4:36:20<br />
<br />
July 18 4:36:20 <PrivateTerminal> Emily, we need you to run another prediction.<br />
July 18 4:36:45 <Loop16> I can’t.<br />
July 18 4:36:49 <PrivateTerminal> Why? Is something wrong?<br />
July 18 4:36:58 <Loop16> No, I just don’t want to do it anymore. I’m too afraid of what’s coming.<br />
July 18 4:37:05 <Loop16> They’re all counting on me. I told them all that I would save them.<br />
July 18 4:37:08 <Loop16> To see their future laid out… It’s too painful.<br />
July 18 4:37:11 <Loop16> Especially after Elizabeth.<br />
July 18 4:37:17 <PrivateTerminal> Like I told you… It doesn’t get easier.<br />
July 18 4:37:20 <PrivateTerminal> I know it’s painful, but we need you on board if we’re going to save any of them.<br />
July 18 4:37:25 <Loop16> I just don’t know what to do any more. These past months have been so hard.<br />
July 18 4:37:28 <Loop16> I don’t know how to deal with more losses.<br />
July 18 4:37:34 <PrivateTerminal> Look, Emily. The sooner you can face reality, the better our chances of successfully extracting those that can still be saved.<br />
July 18 4:37:38 <PrivateTerminal> We need you to make the prediction so we know who those people are. <br />
July 18 4:37:42 <PrivateTerminal> You’ll never forgive yourself if we make a mistake because of your fear of seeing their futures.<br />
July 18 4:37:47 <Loop16> You’re right. But you can’t make me agree with the decision. Just give me a bit more time.<br />
July 18 4:37:55 <PrivateTerminal> Every second we wait puts the Dreamers in even more danger. We need to act now, Emily.<br />
<br />
**** ENDING LOGGING AT Wed July 18 4:37:55</pre></div>Halke234https://wiki.gamedetectives.net/index.php?title=Waking_Titan&diff=16627Waking Titan2018-07-25T20:32:37Z<p>Halke234: /* Contents */</p>
<hr />
<div>{{argbox<br />
| float = right<br />
| image = File:Project WT logo.png<br />
| imagewidth = 400<br />
| name = [[Waking Titan]]<br />
| description= Waking Titan was an ARG which led towards the No Man's Sky [https://www.nomanssky.com/atlas-rises-update/ Atlas Rises update].<br />
| creator = [http://www.aliceandsmith.com/ Alice & Smith]<br />
| creator2 = [http://www.hellogames.org/ Hello Games]<br />
| type = Official<br />
| status = Completed<br />
| discovered = 2017-05-28<br />
| completed = 2018-07-20<br />
}}<br />
{{ArgHeader}}<br />
{{BackToTop}}<br />
<br />
=== Description ===<br />
Waking Titan (also known as Project WT) is an ARG (alternate reality game) that involves a multitude of websites, phone numbers, and radio stations scattered across the world. The ARG is produced by veteran puppet masters [http://www.aliceandsmith.com/ Alice & Smith], and features NPCs, actors, and live events.<br />
<br />
Of the sci-fi genre, its story—linked to the origin of No Man's Sky—follows a powerful A.I known as Loop16 that is created by [https://wiki.gamedetectives.net/index.php?title=Waking_Titan/Characters The Atlas Foundation] to simulate a one-to-one recreation of reality that can accurately predict the future.<br />
<br />
=== Contents ===<br />
The ARG encompassed several "seasons," each leading to a new update for No Man's Sky. Season 1 of Waking Titan led to the [https://www.nomanssky.com/atlas-rises-update/ Atlas Rises update] and Season 2 is leading to [https://www.nomanssky.com/2018/03/no-mans-sky-next/ No Man's Sky: NEXT]. Season 1 was further divided into several distinct "'''phases'''", and Season 2 has followed this convention for ease of reading. Each phase is documented on its own wiki page:<br />
<br />
{| class="wikitable"<br />
!colspan="2"|Season 1<br />
|-<br />
|[[Waking_Titan/Phase_1 | Phase 1]] <br />
|Phase 1 of Waking Titan lasted from 2017-05-28 to 2017-07-08.<br />
|-<br />
|[[Waking_Titan/Phase_2 | Phase 2]] <br />
|Phase 2 of Waking Titan lasted from 2017-07-21 to 2017-08-05.<br />
|-<br />
|[[Waking_Titan/Phase_3 | Phase 3]]<br />
|Phase 3 of Waking Titan lasted from 2017-08-05 to 2017-08-07.<br />
|-<br />
!colspan="2"|Season 2<br />
|-<br />
|[[Waking_Titan/Phase_4 | Phase 4]]<br />
|Phase 4 of Waking Titan lasted from 2017-12-28 to 2018-06-01.<br />
|-<br />
|[[Waking_Titan/Phase_5 | Phase 5]]<br />
|Phase 5 of Waking Titan lasted from 2018-06-01 to 2018-07-20.<br />
|-<br />
|[[Waking_Titan/Phase_6 | Phase 6]]<br />
|Phase 6 of Waking Titan was on 2018-07-20.<br />
|}<br />
<br />
'''''Note:''' This is a '''summary''' page. For more in-depth descriptions of each phase, including detailed descriptions of puzzle solutions, check the [[Waking_Titan/Phase_1|Phase 1]], [[Waking_Titan/Phase_2|Phase 2]], [[Waking_Titan/Phase_3 | Phase 3]], [[Waking_Titan/Phase_4 | Phase 4]], [[Waking_Titan/Phase_5 | Phase 5]], and [[Waking_Titan/Phase_6 | Phase 6]] pages.''<br />
__TOC__<br />
<br />
== Story Overview ==<br />
<br />
=== Internal Memos ===<br />
<br />
[[File:WT glyph 1 pdf.png|280px|thumbnail|right|One of the internal memos discovered in Waking Titan]]<br />
<br />
Throughout the ARG, in-game characters have communicated with each other via "internal memos". Over time, these memos were discovered by ARG players, in the form of PDF files. These memos provided lore content and puzzle content, and are '''highly recommended''' reading for new players!<br />
<br />
'''Season 1'''<br />
<br />
* [http://wiki.gamedetectives.net/index.php?title=File:WT_glyph_1_pdf.png Teamwork Assessment]<br />
* [http://wiki.gamedetectives.net/index.php?title=File:WT-Dataset-97C.jpg Dataset 97C]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/data/7d3dd080-2a43-4882-833c-f4d7bd7ba607.pdf Assurance]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/data/c01-331c6734-a013-4695-8e47-08a9ee05d5e5.pdf 017-a24]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/data/c02-9936c797-ec28-4f8f-b80e-dee9e0b06433.pdf 021-f16]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/mercury/mercury-01-98748sfdlka87.pdf Mercury Process Self-Diagnosis Report]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/data/57201e0d-01a3-4f6a-bbb4-2be8b7c8880f.pdf Progress Report]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/6c285180-ec4d-48a2-967f-8a7af3b50008.pdf Subject M-N00-dl35]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/410a3e5d-01e7-4058-a23c-ca5fdde97f9d.pdf Atlas Foundation Threat Models]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/7a6594ac-ca5e-467a-b6f4-9fb91f069d0a.pdf Advanced Calibration - Optional]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/a9d988c1-ec92-46da-a64e-ab90390ae041.pdf Phase 2 Complete]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/a224a1f4-00e5-467b-9893-83fcc1a4f19a.pdf Unlocking Mercury Process File L16.jpg]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/b91f9959-6a3c-4011-b3b5-a1ff757a5e4c.pdf Phase 3]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/b0f33d53-5a8c-4a9a-b5fc-395562e463a8a+.pdf Log.1291]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/a09-179bf8d2-c13e-4c66-982e-b37ab3efd5bb.pdf Breach of Contract]<br />
<br />
'''Season 2'''<br />
<br />
* [https://wiki.gamedetectives.net/images/6/6e/Memo2.png Waking Titan S2 - Under Preparation]<br />
* [https://drive.google.com/open?id=1la3UNKHc5yeaB_w2a2tK1cjKN44oEmCo Arnaud Lacours Datadumps - INYOURMIND.exe failed]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/94c02878-e023-46a3-9316-db4177c4eaa6+.pdf WARE REPORT #26]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/1cd5226d-6639-4bbd-855a-4bf8f60866c3.pdf Concerns Regarding Captain Harry]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/70a25e6c-95ed-42d4-8de8-c3948255174c+.pdf Myriad Crisis Event Timeline]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/19997bb6-18e5-4427-86c7-b0f3c1826ca2.pdf State of The Atlas Foundation]<br />
* [https://pastebin.com/NYLiFuNY Log.3022]<br />
<br />
* '''W/ARE - Dreamer Patient Files''' — [https://s3.amazonaws.com/ware-virtual-dashboard/files/Phillip-PatientFile.pdf Phillip Moretti]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/EunHa-PatientFile.pdf Kwon Eun Ha]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/498hd98h3444-3339e/Alexander-PatientFile.pdf Alexander Bordeleau]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/GCMnQmM9E3v7L8wuv-V2FUY7P/Claire-PatientFile.pdf Claire Sandfield]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/kh2jsaljs901m-asd1n1lwks/Tariq-PatientFile.pdf Tariq]; [https://ware-virtual-dashboard.s3.amazonaws.com/files/GCMnQmM9E3v7L8wuv-V2FUY7P/Toby-PatientFile.pdf Toby Mulligan]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/ga3ms81-2ms92fbl/Mike-PatientFile.pdf Mike Pasquale]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/kajs61ns-82baks8nx/Nina-PatientFile.pdf Nina Flores]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/ga3ms81-2ms92fbl/Simon-PatientFile.pdf Simon Quinn]; [https://ware-virtual-dashboard.s3.amazonaws.com/files/kajs61ns-82baks8nx/Isabella-PatientFile.pdf Isabella Schiavone]; [https://ware-virtual-dashboard.s3.amazonaws.com/files/kajs61ns-82baks8nx/Alisha-PatientFile.pdf Alisha Brown]<br />
<br />
* [https://pastebin.com/eSLLWN8L Log.4391]<br />
<br />
=== Subpages ===<br />
<br />
Navigating through the following subpages is recommended for newcomers wanting to get a grasp of Waking Titan's rapidly expanding story.<br />
<br />
{| class="wikitable"<br />
!colspan="2"|[[:Category:Waking Titan| Story Subpages]]<br />
|-<br />
|[[Waking_Titan/Characters| Character Summaries]]<br />
|Includes a summary of each character, company, and relating experiments and their importance in the Waking Titan story.<br />
|-<br />
|[[Waking_Titan/Console_Commands | Console Commands]]<br />
|A list of commands used by players at the [http://wakingtitan.com Waking Titan console]<br />
|}<br />
<br />
=== Newsletters===<br />
<br />
The numerous newsletters received throughout Waking Titan.<br />
<br />
'''Season 1'''<br />
<br />
* [https://us15.campaign-archive.com/?u=4483c19308fc0764a930106a0&id=c713d0f4ce&e=225c6a2e26 Welcome, Citizen Scientist!] - ''CSD''<br />
<br />
* [https://mailchi.mp/3582bec6b801/update-june-8th-waking-titan-137705?e=225c6a2e26 Citizen Scientists, Your Wait is Over.] - ''CSD''<br />
<br />
* [https://mailchi.mp/3582bec6b801/update-june-8th-waking-titan-137705?e=225c6a2e26 Calibrating Waking Titan: Action Required] - ''CSD''<br />
<br />
* [https://mailchi.mp/0b591b68ac72/update-june-8th-waking-titan-137717?e=225c6a2e26 Waking Titan: Mission Azure Voyage] - ''CSD''<br />
<br />
* [https://mailchi.mp/d8e47d2ee1bf/update-june-8th-waking-titan-137725?e=225c6a2e26 Your Level 4 Atlas Pass] - ''CSD''<br />
<br />
* [https://mailchi.mp/0c1dc672c943/update-june-8th-waking-titan-137733?e=225c6a2e26 Waking Titan Has Ended] - ''CSD''<br />
<br />
* [https://mailchi.mp/63f179c006f0/update-june-8th-waking-titan-137737?e=225c6a2e26 Mercury Process Completion Report] - ''CSD // Mercury''<br />
<br />
'''Season 2'''<br />
<br />
* [https://wiki.gamedetectives.net/images/7/7b/WareNewsletter1.png News from WARE!] - ''W/ARE Newsletter''<br />
<br />
* [https://cdn.artemisbot.uk/mail/WARE-2018-04-22T00:17:13.000Z.jpg W/ARE Dev Kit Update #2] - ''W/ARE Newsletter''<br />
<br />
* [https://cdn.artemisbot.uk/mail/WARE-2018-05-04T23:22:45.000Z.jpg W/ARE Dev Contest] - ''W/ARE Newsletter''<br />
<br />
* [https://cdn.artemisbot.uk/mail/WARE-2018-05-12T00:20:04.000Z.jpg W/ARE Dev Contest Winners] - ''W/ARE Newsletter''<br />
<br />
* [https://mailchi.mp/9aaa8aa62cc1/update-june-8th-waking-titan-137741?e=225c6a2e26 Attention Citizen Scientists] - ''CSD''<br />
<br />
* [https://mailchi.mp/c3384d592000/update-june-8th-waking-titan-137745?e=225c6a2e26 Attention Citizen Scientists - Suspicious Lab Tracking] - ''CSD''<br />
<br />
* [https://mailchi.mp/108412dac3c2/update-june-8th-waking-titan-137749?e=225c6a2e26 Attention Citizen Scientists - Global Mobilization Required] - ''CSD''<br />
<br />
* [https://mailchi.mp/b902d5eadba6/update-june-8th-waking-titan-137753?e=225c6a2e26 Mercury Process Inquiry] - ''CSD // Mercury''<br />
<br />
* [https://mailchi.mp/9a49b85f6bf3/update-june-8th-waking-titan-137757?e=225c6a2e26 Attention Citizen Scientists - Help Required] - ''CSD''<br />
<br />
=== Music ===<br />
<br />
Partial video addresses for Youtube can be found scattered across Waking Titan PDFs, website files, and surveys; which all lead to music. The exact reasoning for this has gone unexplained. However, there are apparent thematic relevancies in each song that appear to reflect on the state of the story. All songs linked to in Waking Titan so far can be found compiled here: [https://www.youtube.com/playlist?list=PLEZy8wyuYLpLw0e5kkMyBUHO_s-V8f0Qk WT Season 1]; [https://www.youtube.com/playlist?list=PLEZy8wyuYLpLr5K38bsAqWcO7bTcXfRlW WT Season 2]<br />
<br />
== Event Summaries ==<br />
<br />
=== Introduction ===<br />
<br />
On 2017-05-27, Twitter user @argn [https://twitter.com/argn/status/868587449613766658 tweeted a link] to [http://www.project-wt.com/ 'project-wt.com']. The link led to a website which contained a map showing sixty locations, four of which were "active" at the time. The locations, when clicked on, revealed the location's name and status. The active locations also revealed a link to a livestream of a local radio station, originating from the corresponding location. The project-wt website displayed a date, June 8th, and stated that the first clue was being "initialized".<br />
<br />
On 2017-06-01, moderators of No Man's Sky subreddits [https://reddit.com/r/nomansskythegame /r/NoMansSkyTheGame], [https://www.reddit.com/r/NMSPortals/ /r/NMSPortals], and [https://www.reddit.com/r/NMSGalacticHub/ /r/NMSGalacticHub] started to receive cassette tapes in the mail. Each cassette tape was labelled with a number out of 16. The Waking Titan ARG was initially thought to be a separate ARG from these tapes, but connections between the two made it clear that they were, in fact, one and the same.<br />
<br />
=== Phase 1 ===<br />
<br />
[[File:Wakingtitan site.png|thumbnail|450px|right|The default appearance of the Waking Titan site during Phase 1, with no sigils or glyphs solved]]<br />
<br />
During [[Waking_Titan/Phase_1 | Phase 1]], the http://wakingtitan.com hosted 6 triangles in the middle of the page. These triangles were referred to as "'''Sigils'''", while the white icons along the bottom of the page were referred to as "'''Glyphs'''". Each sigil and glyph, when clicked, lead to a password entry prompt - the correct passwords for all 6 sigils and the first 5 glyphs were discovered via puzzle-solving during Phase 1 of Waking Titan.<br />
<br />
The sigil and glyph puzzles were solved collaboratively - while it may have be possible to solve some of these puzzles individually, most of them required a collaborative effort. For instance, some puzzles required players to meet agents from the Atlas Corporation in person, and to relay information obtained from these meetings back to the community. A list of all sigil and glyph solutions for Phase 1 can be found below:<br />
<br />
[[File:WT Phase 1 complete.png|600px]]<br />
<br />
This phase culminated on July 8, 2017, with a [[Waking_Titan/Phase_1#End_of_Phase_1| congratulatory message from Elizabeth Leighton]], the CEO of the Atlas Foundation.<br />
<br />
=== Phase 2 ===<br />
<br />
[[File:Hampster maze.jpeg|thumbnail|450px|right|One of the puzzles that appeared on the Waking Titan [http://twitch.tv/wakingtitan Twitch Stream]]]<br />
<br />
During [[Waking_Titan/Phase_2 | Phase 2]], the http://wakingtitan.com site hosted a command-line interface terminal. Various commands were accepted as input, which triggered different events. One of the most notable commands was the <code>WHOIS <argument></code> command, which revealed a passage of text pertaining to the specified argument. For instance, the command <code>WHOIS FOURTH RACE</code> returned the following message:<br />
<pre><br />
INCOMING TRANSMISSION… SOURCE: UNKNOWN…<br />
You are not – kzzktt – alone –<br />
Please, identify yourself. I’m – kzzkttk –<br />
</pre><br />
<br />
Additionally, http://project-wt.com hosted a "Calibration" utility during Phase 2. To successfully perform these calibrations, players had to upload images of various objects and buildings to the site. For instance, the first calibration required images of "public resonant percussion instruments".<br />
<br />
Finally, towards the end of Phase 2, the Waking Titan [http://twitch.tv/wakingtitan Twitch stream] went live, displaying a five-monitor setup. Throughout the duration of the stream, players had to work together to solve puzzles that were displayed on these monitors. Some of these puzzles were interactive; for example, one puzzle that was repeated several times involved the Twitch chat guiding a virtual hamster through a maze.<br />
<br />
Additionally, players solved another 3 glyphs throughout Phase 2. The solutions to these glyphs are shown below:<br />
<br />
[[File:WT Phase2 Passwords.png|600px]]<br />
<br />
=== Phase 3 ===<br />
<br />
{{#evt:<br />
service=youtube<br />
|id=https://www.youtube.com/watch?v=QhX9z4dDAa4<br />
|alignment=right<br />
}}<br />
<br />
[[Waking_Titan/Phase_3|Phase 3]] was the briefest phase of Waking Titan. It consisted of the conclusion of the [http://twitch.tv/wakingtitan Twitch stream] that began at the [[Waking Titan/Phase 2#End of Phase 2|end of Phase 2]]. Players solved more interactive puzzles on the Twitch stream, before the rogue AI Loop16 asked them a final question: <code>SHOULD I EXIST?</code> The overwhelming response from the community was "yes".<br />
<br />
After receiving this response, Loop16 and Emily of the ETARC forums were revealed as being one and the same. Loop16 generated a heartfelt "Thank You" video to round out the stream, before finally taking the 72-hour stream offline.<br />
<br />
Shortly after this, players received emails with the subject line <code>Waking Titan has Ended</code>. The contents of the message were as follows:<br />
<br />
<pre><br />
Hello, Citizen Scientist,<br />
<br />
Thank you for your contributions to Waking Titan. The developments that took place during Phase 3 were somewhat concerning, but together we have set in motion truly world-shaping events. We will continue to inform the Citizen Science Division of privileged information or any need for collaborators on a new project.<br />
<br />
But we do have a few loose ends to tie up with you before we move on, so let's proceed.<br />
<br />
First, we're pleased to announce that all 10,000 Level 4 Atlas Passes are in production. Note that due to transit times for mail, some may take several weeks to be delivered.<br />
<br />
Next, our CEO Elizabeth Leighton has asked us to include a personal note of gratitude:<br />
<br />
"Thank you for all your diligent efforts, Citizen Scientists. It's been an amazing journey for all of us. I've watched you thrive and achieve from those first Phase 1 radio ads all the way through the intensity of Phase 3. I've been impressed at every turn by how brilliant you've been, how voracious, how kind, how thoughtful.<br />
<br />
It's been an honor and a privilege. On behalf of the Atlas Foundation, and on behalf of the world, thank you."<br />
The Mercury subroutine has concluded successfully, and a new memo from SM about this process is coming in the next 24 hours. We hope it will answer a few key questions you have about our program, and about what comes next.<br />
</pre><br />
<br />
On August 11, 2017, the [https://www.nomanssky.com/atlas-rises-update/ Atlas Rises update] was released for No Man's Sky.<br />
<br />
=== Phase 4 ===<br />
<br />
[[Waking_Titan/Phase_4 | Phase 4]] of Waking Titan started on 2017-12-28 and is currently ongoing.<br />
<br />
== Connection to No Man's Sky ==<br />
<br />
[[File:9-16-case.png|thumbnail|right|The case that cassette 9/16 was contained in.]]<br />
<br />
At the beginning of the ARG, it was not clear whether Waking Titan was officially connected to No Man's Sky. At first, there were only hints and nudges. At one point, 180 free copies of No Man's Sky were distributed to ARG players. Here's the text of a PDF that was revealed at the end of Phase 1 of Waking Titan:<br />
<br />
<pre><br />
We want to extend our gratitude to everyone who has contributed to the Mercury subroutine so far. <br />
We hope you have enjoyed the successful distribution of 180 Access IDs, and we hope you will also <br />
appreciate the other interesting artifacts we have in store for you going forward. We intend to keep the <br />
process alive until the completion of Project Waking Titan in August. <br />
<br />
It is important to mention that we are very excited by the coming Phases 2 and 3. Input from the Mercury <br />
Subroutine will pave the way toward new experiences in '''version 1.3 of a familiar universe'''. We look forward <br />
to the successful conclusion of this ground-breaking experiment. <br />
<br />
Regards.<br />
S.M.<br />
</pre><br />
<br />
This text explicitly stated that the Waking Titan ARG was leading towards the upcoming 1.3 update for No Man's Sky.<br />
<br />
Some [[Waking_Titan/Console_Commands | console commands]] on the [http://www.wakingtitan.com/ Waking Titan website] during [[Waking_Titan/Phase 2|Phase 2]] refer directly to No Man's Sky lore - for instance, <code>WHOIS ATLAS</code>, <code>WHOIS VY'KEEN</code>, and <code>WHOIS KORVAX</code> are all valid commands. Additionally, some terminal commands referred to a mysterious fourth race, so the prevailing assumption was that the upcoming 1.3 update would bring a fourth race to No Man's Sky.<br />
<br />
At the conclusion of the ARG, an email was sent out to members of the CSD with a [[Waking_Titan/Phase_3#Memo_from_Sean_Murray | memo from Sean Murray]], confirming that the ARG was the lead up to the 1.3 update, which was [https://www.nomanssky.com/atlas-rises-update/ released] after a few days.<br />
<br />
<br />
== Media Appearances ==<br />
<br />
'''5th July 2017''' <br><br />
[EN] [https://www.argn.com/2017/07/stern_words_from_no_mans_sky_arg/ ARGNet - Stern Words from No Man’s Sky ARG]<br />
<br />
'''23rd July 2017''' <br><br />
[EN] [https://geekreply.com/geek-culture/2017/07/23/waking-titan-update-1-phase-2-commences GeekReply - Waking Titan Update 1: Phase 2 Commences!]<br />
<br />
'''27th July 2017''' <br><br />
[EN] [https://geekreply.com/editorials/2017/07/27/waking-titan-arg-can-bring-people-together GeekReply - Waking Titan: How An ARG can Bring People Together.]<br />
<br />
'''8th August 2017''' <br><br />
[EN] [https://www.dailystar.co.uk/tech/gaming/635697/No-Man-s-Sky-News-Waking-Titan-Reddit-Arg-1-3-update-release-date/ Dailystar - No Man's Sky News: Waking Titan Reddit Arg REVEALS 1.3 update ahead of release date]<br />
<br />
'''9th August 2017''' <br><br />
[EN] [https://arstechnica.com/gaming/2017/08/no-mans-sky-version-1-3-lands-this-week-for-free-adds-quick-travel-portals/ Ars Technica - No Man’s Sky version 1.3 lands this week for free, adds “quick-travel” portals]<br />
<br />
[EN] [https://www.forbes.com/sites/insertcoin/2017/08/09/no-mans-sky-is-patching-in-a-story-this-week-a-year-after-launch/#19fb5a285282 Forbes - 'No Man's Sky' Is Patching In A Story This Week, A Year After Launch]<br />
<br />
[EN] [https://www.gamespew.com/2017/08/no-mans-sky-patch-week-improving-central-story/ GameSpew - No Man's Sky Patch This Week Improving Its Story]<br />
<br />
'''19th January 2018''' <br><br />
[EN] [http://www.eurogamer.net/articles/2018-01-18-no-mans-skys-waking-titan-arg-is-back-and-fans-are-trying-to-figure-out-what-it-all-means Eurogamer - No Man's Sky's Waking Titan ARG is back, and fans are trying to figure it all out again]<br />
<br />
[RU] [https://dtf.ru/category/nmsarg/ DTF - A Collection of No Man's Sky and Waking Titan Articles.]<br />
<br />
== Other Information ==<br />
<br />
{| class="wikitable"<br />
!colspan="2"|[[:Category:Waking Titan| Waking Titan Miscellaneous Subpages]]<br />
|-<br />
|[[Waking_Titan/Cassettes | Cassettes]]<br />
|Information about the cassette tapes received by No Man's Sky subreddit moderators<br />
|-<br />
|[[Waking_Titan/Stations | Stations]]<br />
|Information on the radio stations from the initial project-wt.com site<br />
|-<br />
|[[Waking_Titan/Companies | Company Archives]]<br />
|An archive of company details.<br />
|}<br />
<br />
[[Category:Waking Titan]]</div>Halke234https://wiki.gamedetectives.net/index.php?title=Corporate_Warfare&diff=16626Corporate Warfare2018-07-25T20:31:35Z<p>Halke234: /* Encrypted Messages */</p>
<hr />
<div>{{argbox<br />
| float = right<br />
| name = Corporate Warfare<br />
| image = File:Neuroslicers logo.png<br />
| description= An ARG based around factions of the game NeuroSlicers.<br />
| creator = [https://www.failure.game/ NeuroSlicers]<br />
| type = Unofficial<br />
| status = Active<br />
| discovered = 2018-04-27<br />
}}<br />
{{SideTOC}}<br />
<br />
[[Main Page]] > [[List of Investigations]] > '''Corporate Warfare'''<br />
<br />
== Backstory ==<br />
<br />
NeuroSlicers is a cyberpunk RTS game, revolving around short 5-10 minute matches. The ARG consists of 3 factions fought each other for their own cause regarding the fate of the NeuroNet and the Keeper.<br />
<br />
*'''The Tesseract''': At first it was created for the NeuroNet, so that the responsibility is not on MindCore when leak happens, but on Tesseract. Later, when the major leak occured, Tesseract lost their control of the NeuroNet, forcing them to deploy slicers to regain control.<br />
<br />
*'''BIT.CRASH''': They were an anarchic slicer dedicated to destroy the NeuroNet, Tesseract and MindCore for sake of humanity. They were the first to successfully breach the Keeper's defences, making them able to enter a non-public area since the Mayday.<br />
<br />
*'''XANTUARY''': Their goal is to cleanse the NeuroNet from impurities to prepare humanity for their digimortality ascension.<br />
<br />
''Detailed backstory can be found [http://neuroslicers.wikia.com/wiki/Narrative here]''<br />
<br />
== Encrypted Messages ==<br />
<br />
On the NeuroSlicers Discord users were able to join one of the three factions and try to decipher the messages which contributes and advances the story of the NeuroSlicers.<br />
<br />
=== First Message ===<br />
<br />
The first message was received in the encrypted-message channel at 2018-04-27. This message was first decoded by The Tesseract.<br />
<br />
<pre><br />
####--INCOMING ENCRYPTED MESSAGE--####<br />
<br />
z85 f5211815f520 91914'20 238120 920 19551319, 25 3118562112 238514 315141453209147 2015 920, 522514 1514 1 195321185 129145, 208525 3114 1955 23815 251521 1185, 238120 251521 1185, 2385185 251521 1185<br />
<br />
####--END OF MESSAGE--####<br />
</pre><br />
<br />
The encryption method was Numbers to Letter assignment. The decoded message: <code>The neuronet isn't what it seems. Be careful when connecting to it, Even on a secure line, they can see who you are, What you are, where you are</code><br />
<br />
<br />
=== Second Message ===<br />
<br />
The second round of cryptic message happened on the 30th of April, 2018. The message was posted in the #encrypted-message channel in the NeuroSlicers Discord.<br />
<br />
<pre><br />
####--INCOMING ENCRYPTED MESSAGE PT1--####<br />
o 20891411 208525'225 131141754 2015 45318251620 1325 1211920 1351919175, o'13 1315229147 1522518 2015 1 14523 51431825162091514 135208154, 815124 1514. atthtk 161815205320 251521 l1293518, 235'1212 69144 114192351819 914 2085 31545, 9'13 1921185 156 920<br />
####--END OF PT1--####<br />
</pre><br />
<br />
The message had the same encryption method as the previous message, so decoding it by numbers-to-letter, it yielded: <code>I think they've managed to decrypt my last message, I'm moving over to a new encryption method hold on. Keeper protect you slicer, we'll find answers in the code, I'm sure of it</code><br />
<br />
=== New Encryption ===<br />
<br />
The part two of the previous message happened shortly after the first part, but this time, the encryption was changed. <br />
<br />
<pre><br />
####--INCOMING ENCRYPTED MESSAGE PT2--####<br />
Ti8m8 n48h95 ui 59 icbia9j65ho 06odncus ci jb9 f8uqjlf ep9m ni8 q99a8i8, I'q8 ben 5 9f8gcib nc5l d8mn5dd ntknfgn 5m4 69ahh pjbm0798, qinmd6bs 5 gpl9 mj1ono 6pghm nomo9e jm 59dda kmn ci kg069 2he 68c5lcjm2f AI dn 46jmn nj 69 okbj4e88. T7cn 4ivf8 7c0hb9 8w8msoc8hb! Wb5n 5h8 r6 hidhb ji 8g?<br />
####--END OF MESSAGE--####<br />
</pre><br />
<br />
The message contained a layered cipher. ASCIItoHEX on top of a vigenére cipher. Encoding the word <code>KEEPER</code> to hex (4b4545504552), you needed to do a vigenére cipher with custom alphabet.<br />
<pre><br />
abcdefghijklmnopqrstuvwxyz0123456789<br />
</pre><br />
By using the custom keymap with the vigenére key <code>4b4545504552</code> the message was able to be decoded.<br />
<br />
<pre><br />
There seemed to be significant activity in the network over the weekend, I've got a feeling that certain systems are being upgraded, possibly a more robust comms system is being put in place and behavioral AI is about to be upgraded. This could change everything! What are we going to do?<br />
</pre><br />
<br />
The message was decoded by the Tesseract.<br />
<br />
== Stranger Things ==<br />
<br />
On 2018 May 07th, a new message have been posted across the faction channels. One was posted in the encrypted-message channel, which was the first key to decode the whole message.<br />
<br />
Public Message:<br />
<pre><br />
####--INCOMMING ENCRYPTED MESSAGE--####<br />
MqEcSaSnAqGfEb sLrEwNhGuTrHk:q s5z2y3p<br />
EaNnCyRtYyPzTuIzOnNl:p oVhihglecnwéprweo<br />
AzTjTmAyCcHjMtEbNeTd:k ghntftrptsd:g/x/kwnwpwp.udbruofphbmoxxu.zcxoomx/gsd/yrzzctlnlrg5tgkmaxude0z7pcz8w3l/hwwiopl.zmdpw4z?xdyly=z0n<br />
KzEhYx:o £<]+<|]&$:/:/>[=&$=&$:/>[&$<|]+] ------PART OF LINE BLOCKED BY PUBLIC FIREWALL------<br />
MwEaShSaAhGgEl:s<br />
gi'gq ktfvrwhl hz cii esee wrfusus vkxe mrgmfpgsm wb lri cqxoowo, vnzzmgkvhh aatm caiysg sbi pbtwawmlu fqfzkc xwq kehxmfm kvpjo waugwrx yfy poelvmrv jgr hmacsobnw. mc evdnxgch hc lrmw, aw'wi gyjwbr wsvt ippjvgshhsr kvmgtdw bjmlu moboameteqh wmil znuveaxk cqawr wjwwjfg, lyx ur ecgfohls, lric'di nta gnffhtfq xd isrs nfyxhwrw.....efy mbsu kvll xlpf as elr bvoe sx xe msjh tiw?<br />
####--END OF MESSAGE--####<br />
</pre><br />
<br />
Decoding is possible by only taking every second letter.<br />
<br />
<pre><br />
MESSAGE LENGTH: 523<br />
ENCRYPTION: Vigenére<br />
ATTACHMENT: ghntftrptsd:g/x/kwnwpwp.udbruofphbmoxxu.zcxoomx/gsd/yrzzctlnlrg5tgkmaxude0z7pcz8w3l/hwwiopl.zmdpw4z?xdyly=z0n<br />
KEY: £<]+<|]&$:/:/>[=&$=&$:/>[&$<|]+] ------PART OF LINE BLOCKED BY PUBLIC FIREWALL------<br />
MESSAGE:<br />
gi'gq ktfvrwhl hz cii esee wrfusus vkxe mrgmfpgsm wb lri cqxoowo, vnzzmgkvhh aatm caiysg sbi pbtwawmlu fqfzkc xwq kehxmfm kvpjo waugwrx yfy poelvmrv jgr hmacsobnw. mc evdnxgch hc lrmw, aw'wi gyjwbr wsvt ippjvgshhsr kvmgtdw bjmlu moboameteqh wmil znuveaxk cqawr wjwwjfg, lyx ur ecgfohls, lric'di nta gnffhtfq xd isrs nfyxhwrw.....efy mbsu kvll xlpf as elr bvoe sx xe msjh tiw?<br />
</pre><br />
<br />
The different faction messages only differed in the <code>KEY</code> segment:<br />
<pre><br />
KzEhYx:o keepmesafe$=&$:/>[&$<|]+] ------PART OF LINE BLOCKED BY TESSERACT FIREWALL------<br />
KzEhYx:o keepme:/:/>[=&youfools ------PART OF LINE BLOCKED BY XANCTUARY FIREWALL------<br />
KzEhYx:o £<]+<|]&$safeyoufools ------PART OF LINE BLOCKED BY BITCRASH FIREWALL------<br />
</pre><br />
<br />
Combining the three lines, it reads: <code>KEY: keepmesafeyoufools</code>, which makes the original message's internal encrypted message decodeable:<br />
<br />
<pre><br />
we're starting to see some strange data anomalies in the network, billboards with emotes are appearing across the sectors where slicers are battling for dominance. in addition to this, we're seeing more experienced slicers being handicapped when fighting newer slicers, but in exchange, they're now starting to earn prestige.....any idea what that is and what it is used for?<br />
</pre> <br />
<br />
''Note: The non alphabet characters might influence the vigenére cipher decoding process. Remove those or use the [https://cryptii.com/vigenere-cipher Cryptii decoder]''<br />
<br />
{{WIP}}</div>Halke234https://wiki.gamedetectives.net/index.php?title=Sombra_ARG&diff=16625Sombra ARG2018-07-25T14:10:23Z<p>Halke234: /* Misdirection */</p>
<hr />
<div>{{argbox<br />
| float = right<br />
| name = Sombra ARG<br />
| image = File:Sombra_skull.png<br />
| description= The Sombra ARG - an ARG involving an unreleased Overwatch hero.<br />
| creator = [https://www.blizzard.com/ Blizzard Entertainment]<br />
| type = Official<br />
| status = Completed<br />
| discovered = 2016-06-12<br />
| completed = 2016-11-04<br />
}}<br />
<br />
{{ArgHeader|arg=Sombra ARG}}<br />
The Sombra ARG was an ARG for the first-person shooter [https://www.playoverwatch.com Overwatch], developed by [https://www.blizzard.com/ Blizzard Entertainment]. Sombra was the name of a then-unreleased Overwatch hero. The ARG was comprised of clues and ciphers referencing Sombra, which were found in various developer updates and short animations.<br />
<br />
At the game's release, there were numerous pieces of in-game information that appeared in the map Dorado, hinting at a character called Sombra. When the hero Ana was revealed, more Sombra clues appeared in Ana's origin video. In the weeks that followed, more clues were discovered, which led up to a character reveal animation at BlizzCon 2016.<br />
<br />
== Ana Videos ==<br />
<br />
=== Ana Origin Video ===<br />
<br />
On July 12, 2016, a [https://www.youtube.com/watch?v=TE0CXgpNxG0 video] for the new Overwatch hero named Ana was released. At the 1:16 mark, players discovered a set of hexidecmial values:<br />
<br />
[[File:Ana_Hex2.png|400px]]<br />
<br />
<pre><br />
2E 2E 2E 7B 76 20 66 62 72 20 63 7E 72 79 72 20 7B 76 20 7E<br />
79 71 78 65 7A 76 74 7E D4 A4 79 2C 20 63 7E 72 79 72 20 72<br />
7B 20 67 78 73 72 65 2E 2E 2E 7B 76 20 66 62 72 20 63 7E 72<br />
79 72 20 7B 76 20 7E 79 71 78 65 7A 76 74 7E D4 A4 79 2C 20<br />
63 7E 72 79 72 20 72 7B 20 67 78 73 72 65 2E 2E 2E 7B 76 20<br />
66 62 72 20 63 7E 72 79 72 20 7B 76 20 7E 79 71 78 65 7A 76<br />
74 7E D4 A4 79 2C 20 63 7E 72 79 72 20 72 7B 20 67 78 73 72<br />
65 2E 2E 2E 7B 76 20 66 62 72 20 63 7E 72 79 72 20 7B 76 20<br />
7E 79 71 78 65 7A 76 74 7E D4 A4 79 2C 20 63 7E 72 79 72 20<br />
72 7B 20 67 78 73 72 65 2E 2E 2E 64 78 7A 75<br />
</pre><br />
<br />
A hex to ASCII translation yielded the following:<br />
<br />
<pre><br />
...{v fbr c~ryr {v ~yqxezvt~Ô¤y, c~ryr r{ gxsre...{v fbr c~ryr {v ~yqxezvt~Ô¤y, c~ryr r{ gxsre...{v fbr c~ryr {v ~yqxezvt~Ô¤y, c~ryr r{ gxsre...{v fbr <br />
c~ryr {v ~yqxezvt~Ô¤y, c~ryr r{ gxsre...dxzu<br />
</pre><br />
<br />
Using an XOR Cipher with the constant 23 on the above text resulted in the following message:<br />
<br />
<pre><br />
..la que tiene la información; tiene el poder...la que tiene la información; tiene el poder...la que tiene la información; tiene el poder...la que tiene la <br />
información; tiene el poder...somb<br />
</pre><br />
<br />
This was a repeating phrase in Spanish, which translated to:<br />
<br />
<pre><br />
She who has the information, has the power...<br />
</pre><br />
<br />
Players then discovered a second set of hexidecimal values at the 2:11 mark:<br />
<br />
[[File:Ana Hex.png|400px]]<br />
<br />
<pre><br />
65 76 2E 2E 2E 7B 76 20 66 62 72 20 63 7E 72 79 72 20 7B 76<br />
20 7E 79 71 78 65 7A 76 74 7E D4 A4 79 2C 20 63 7E 72 79 72<br />
20 72 7B 20 67 78 73 72 65 2E 2E 2E 7B 76 20 66 62 72 20 63<br />
7E 72 79 72 20 7B 76 20 7E 79 71 78 65 7A 76 74 7E D4 A4 79<br />
2C 20 63 7E 72 79 72 20 72 7B 20 67 78 73 72 65 2E 2E 2E 7B<br />
76 20 66 62 72 20 63 7E 72 79 72 20 7B 76 20 7E 79 71 78 65<br />
7A 76 74 7E D4 A4 79 2C 20 63 7E 72 79 72 20 72 7B 20 67 78<br />
73 72 65 2E 2E 2E 7B 76 20 66 62 72 20 63 7E 72 79 72 20 7B<br />
76 20 7E 79 71 78 65 7A 76 74 7E D4 A4 79 2C 20 63 7E 72 79<br />
72 20 72 7B 20 67 78 73 72 65 2E 2E 2E<br />
</pre><br />
<br />
When put through the same process, the same string of Spanish was revealed, but with the letters <code>ra</code> at the beginning of the message. These letters were combined with <code>somb</code> from the first cipher to create the name <code>sombra</code>. No more clues were discovered until the release of the Dev Update video.<br />
<br />
=== Dev Update Video ===<br />
<br />
[[File:Sombra Barcodes.png|thumbnail|right|The vertical barcodes found at the end of the Ana Dev Update video]]<br />
<br />
On July 19, 2016, the first [https://www.youtube.com/watch?v=evghkilg2eQ Developer Update] was released for Ana. At the end of the video, players discovered a series of vertical barcodes. When scanned, players discovered a large set of hexidecimal values which where then converted to binary, a dump of which is available [https://gist.github.com/zapu/31165efab0d6264e2fd0fa75cc53b1aa here].<br />
<br />
Turning the ones and zeroes into black and white pixels formed a QR code:<br />
<br />
[[File:Sombra_QR_code.png|300px]]<br />
<br />
Scanning this QR code yielded the following message: <code>¿Estuvo eso facilito? Ahora que tengo su atención, déjenme se las pongo más difícil.</code> In English, the message reads: <code>Was that easy? Well, now that I have your attention, allow me to make things much more difficult.</code> After this, no more clues were discovered until the Summer Games video was released.<br />
<br />
== Welcome to the Summer Games Video ==<br />
<br />
=== Tracer Trail Cipher ===<br />
<br />
[[File:Base64_trail.jpg|thumbnail|right|The unsolved base64 cipher in the Summer Games video]]<br />
<br />
'''Note: The cipher described below remains unsolved.'''<br />
<br />
On August 2, 2016, players discovered another cipher in the [https://www.youtube.com/watch?v=qpcOD9tJM4k Welcome to the Summer Games trailer]:<br />
<br />
<pre><br />
U2FsdGVkX1+vupppZksvRf5pq5g5XjFRIipRkwB0K1Y96Qsv2L<br />
m+31cmzaAILwytX/z66ZVWEQM/ccf1g+9m5Ubu1+sit+A9cenD<br />
xxqkIaxbm4cMeh2oKhqIHhdaBKOi6XX2XDWpa6+P5o9MQw==<br />
</pre><br />
<br />
Players discovered this text to be base64 encryption. When decrypted, players received the following output:<br />
<br />
<pre><br />
Salted__���ifK/E�i��9^1Q�*Q�t+V=�<br />
/ع��W/<br />
�_����V��?q����f�F���"��=q�������[��<br />
z��*����Z����u�\5�k�C<br />
</pre><br />
<br />
''(Note: copy/pasting this string will not work; some of the characters are not printable and are not even displayed correctly on this page)''<br />
<br />
==== Decrypting the Cipher ====<br />
<br />
The "Salted__" header at the start of the string indicated to players that the remainder of the text was encrypted with the OpenSSL software library, which requires a password and the encryption cipher that was used. Salt is added by OpenSSL to ensure uniqueness of the key and the IV derived from the password and used for the encryption. However, due to the age of OpenSSL and its massive library, it was proven to be quite difficult for players to identify the encryption used.<br />
<br />
==== Narrowing Down Ciphers ====<br />
<br />
[[File:HexOfEncryptedMessage.png|thumbnail|right|Hex view of the encrypted string]]<br />
<br />
Players narrowed down the potential ciphers used by examining a hex dump of the encrypted string. There are two major types of ciphers, stream ciphers and block ciphers. Stream ciphers encrypt only the data fed into them, whereas block ciphers always encrypt a certain number of bytes at a time (a "chunk").<br />
<br />
A byte is roughly a single character, but special characters can take up multiple bytes. We know that OpenSSL Salted Encryption uses the first 8 bytes of the output for <code>Salted__</code> and the next 8 bytes for the actual salt. The rest of the information is the '''encrypted message'''.<br />
<br />
The immediately interesting thing here is that the '''encrypted message''' data stops 3 bytes short of a full chunk. This is a excellent indicator that the cipher used is a stream cipher (or a block cipher in CTR/OFB/CFB mode). This narrows the list of potential ciphers down significantly. This also means that the final string that Blizzard encrypted is less than 93 bytes!<br />
<br />
'''This cipher remains unsolved, but it's speculated that Blizzard moved past the cipher by creating alternate puzzles.'''<br />
<br />
=== Directions & Letters ===<br />
<br />
Players discovered that in the North American version of the Summer Games trailer there were repeated references to the cardinal directions, each associated with a particular hero. These references were conspicuously absent from other versions of the trailer. These references are shown below, with the relevant heroes and timestamps:<br />
<br />
<gallery mode="packed"><br />
File:Ow1.png|East - Mercy - Route 66 - 0:17<br />
File:Ow2.png|Center - D. Va - Temple of Anubis - 0:19<br />
File:Ow3.png|North - Torbjorn - Nepal - 0:21<br />
File:Ow4.png|South - Genji - Hanamura - 0:22<br />
File:Ow5.png|Southeast - McCree - Hollywood - 0:24<br />
File:Ow6.png|West - Symmetra - Watchpoint: Gibraltar - 0:30<br />
File:Ow7.png|Southwest - Bastion - Hollywood - 0:34<br />
File:Ow8.png|Northeast - Winston - Volskaya Industries - 0:46<br />
File:Ow9.png|Northwest - Tracer - King's Row - 0:47<br />
</gallery><br />
<br />
Screenshots of all the directions and their respective heroes can be found in an album [https://imgur.com/a/FQXmy here].<br />
<br />
[[File:Overwatch map.jpg|frameless]]<br />
<br />
These heroes, arranged in this particular order, provided a password that was used later in the ARG.<br />
<br />
== Dorado Photo ==<br />
<br />
At an unknown date, a new, "corrupted" photo of the [https://blzgdapipro-a.akamaihd.net/media/screenshot/dorado-screenshot-004.jpg Dorado attackers spawn point] was added to the Overwatch [https://playoverwatch.com/en-us/media/ media page]. Players discovered that the screenshot was "'''datamoshed'''", which means it concealed a hidden message while also taking on a distorted appearance. ([https://prntscr.com/c3dce7 Here] is an example of purposely data moshing the image manually to achieve similar effects.) <br />
<br />
<gallery mode="packed" heights=500px><br />
File:dorado-datamosh.jpg|The datamoshed image<br />
File:dorado-screenshot-005.jpg|The original image<br />
</gallery><br />
<br />
After comparing the images with difference checking tools, players found that certain English and Spanish characters were replaced with exclamation points. The missing characters produced the following Spanish phrase:<br />
<br />
<code>Por que estan mirando al cielo? La respuesta no esta sobre sus cabezas, esta detras de ustedes. A veces, necesitan analizar sus logros previos.</code><br />
<br />
Translated into English, this phrase read:<br />
<br />
<code>Why are you looking at the sky? The answer isn't over your heads, it's behind you. Sometimes, you need to analyze your previous achievements.</code><br />
<br />
The phrase "Why are you looking at the sky?" was most likely a reference to a strange artifact that was discovered in the sky of the Dorado map, dubbed the "Skycode". The Skycode ended up being a red herring, and was completely unrelated to the ARG.<br />
<br />
=== Analyzing Achievements ===<br />
<br />
[[File:achievements.png|thumbnail|right|"¿" Achievement, comment in source code]]<br />
<br />
The phrase "you need to analyze your previous achievements" led players to look at the achievements on the [https://www.playoverwatch.com Overwatch] website. It was noticed noticed that by logging in and viewing the achievements on a player profile, a mystery achievement appeared. Examining a hex dump of the image lead players to a new phrase:<br />
<br />
<pre><br />
Vientos, nada mal. No obstante, me aburro. Intentemos algo nuevo en la misma dirección.<br />
uczihriwgsxorxwunaarawryqhbrsfmeqrjjmu 5552E494 78T3 4VM9 OPL6 IS8208O913KRlrx<br />
</pre><br />
<br />
Translated, it said:<br />
<br />
<pre><br />
Damn, not bad. However, I'm getting bored. Let's try something new in the same direction.<br />
uczihriwgsxorxwunaarawryqhbrsfmeqrjjmu 5552E494 78T3 4VM9 OPL6 IS8208O913KRlrx<br />
</pre><br />
<br />
== Volskaya Datamosh ==<br />
<br />
After a long period of toying around, players discovered that the ciphertext <code> uczihriwgsxorxwunaarawryqhbrsfmeqrjjmu 5552E494 78T3 4VM9 OPL6 IS8208O913KRlrx</code> from the "?" achievement was a Vigenére cipher. Players discovered the key <code>tracertorbjornwinstonsymmetradvamercybastiongenjimccree</code> by ordering the heroes in the Summer Games trailer by the cardinal directions associated with each of them, as said further above. Once decoded, players received the following text: <br />
<pre>blzgdapiproaakamaihdnetmediascreenshot 5552E494 78B3 4CE9 ACF6 EF8208F913CFjpg</pre><br />
<br />
Players found this to be a [https://blzgdapipro-a.akamaihd.net/media/screenshot/5552E494-78B3-4CE9-ACF6-EF8208F913CF.jpg blzgdapipro-a.akamaihd.net/media/screenshot/5552E494-78B3-4CE9-ACF6-EF8208F913CF.jpg URL], which led players to a datamoshed screenshot of the Volskaya Industries map. ''(Editor's note: This link appears to now be dead)''. When players ran a difference check with the [https://blzgdapipro-a.akamaihd.net/media/screenshot/volskaya-screenshot-004.jpg original image], they received an interesting message.<br />
<br />
<gallery mode="packed"><br />
File:volskaya-datamosh.jpg|The datamoshed image<br />
File:Volskaya-screenshot-004.jpg|The original image<br />
</gallery><br />
<br />
=== ASCII Skull #1 ===<br />
<br />
The diff from the datamoshed image resulted in the following output:<br />
<br />
<pre><br />
Parece que te gustan estos jueguitos... por que no jugamos uno de verdad?<br />
:PB@Bk:<br />
,jB@@B@B@B@BBL.<br />
7G@B@B@BMMMMMB@B@B@Nr<br />
:kB@B@@@MMOMOMOMOMMMM@B@B@B1,<br />
:5@B@B@B@BBMMOMOMOMOMOMOMM@@@B@B@BBu.<br />
70@@@B@B@B@BXBBOMOMOMOMOMOMMBMPB@B@B@B@B@Nr<br />
G@@@BJ iB@B@@ OBMOMOMOMOMOMOM@2 B@B@B. EB@B@S<br />
@@BM@GJBU. iSuB@OMOMOMOMOMOMM@OU1: .kBLM@M@B@<br />
B@MMB@B 7@BBMMOMOMOMOMOBB@: B@BMM@B<br />
@@@B@B 7@@@MMOMOMOMM@B@: @@B@B@<br />
@@OLB. BNB@MMOMOMM@BEB rBjM@B<br />
@@ @ M OBOMOMM@q M .@ @@<br />
@@OvB B:u@MMOMOMMBJiB .BvM@B<br />
@B@B@J 0@B@MMOMOMOMB@B@u q@@@B@<br />
B@MBB@v G@@BMMMMMMMMMMMBB@5 F@BMM@B<br />
@BBM@BPNi LMEB@OMMMM@B@MMOMM@BZM7 rEqB@MBB@<br />
B@@@BM B@B@B qBMOMB@B@B@BMOMBL B@B@B @B@B@M<br />
J@@@@PB@B@B@B7G@OMBB. ,@MMM@qLB@B@@@BqB@BBv<br />
iGB@,i0@M@B@MMO@E : M@OMM@@@B@Pii@@N:<br />
. B@M@B@MMM@B@B@B@MMM@@@M@B<br />
@B@B.i@MBB@B@B@@BM@::B@B@<br />
B@@@ .B@B.:@B@ :B@B @B@O<br />
:0 r@B@ B@@ .@B@: P:<br />
vMB :@B@ :BO7<br />
,B@B<br />
</pre><br />
<br />
'''Translation:'''<br />
<br />
<pre><br />
"It seems you like these little games... Why don't we play a real one?"<br />
</pre><br />
<br />
(''This is the python2 script to extract modified bytes from datamoshed Volskaya screenshot: https://gist.github.com/synap5e/27635d2ff6f0e3b15f0c902dca2974a9'')<br />
<br />
No further progress was made until August 23, 2016.<br />
<br />
== Overwatch Forums Glitching Page/ "Skycoder" ==<br />
<br />
On August 23rd, 2016, at an unknown time, an [https://us.battle.net/forums/en/overwatch/topic/20748794686 ominous post] by a user named "Skycoder" appeared on the official General Discussion forums for Overwatch. <br />
<br />
Players found that the name of the post, <code>00110010 00110011</code>, was binary for "23," which was a direct reference to Sombra being the 23rd hero in Overwatch. The age of the post started at 24 hours, and counted down rather than increasing. The post itself contained a single sentence in Spanish:<br />
<br />
<pre><br />
la que tiene la información; tiene el poder<br />
</pre><br />
<br />
Which, when translated to english, reads:<br />
<br />
<pre><br />
She who has the information, has the power.<br />
</pre><br />
<br />
After a short while, the post glitched and distorted, gradually turning a hue of purple. A text box then appeared, which printed the following ciphertext:<br />
<br />
<pre><br />
ICAgICAgICAgICAgICAgICAgICAgICAgICA6UEKPQms6CiAgICAgICAg<br />
ICAgICAgICAgICAgICAsakKIQEJAQkBCQEJCTC4KICAgICAgICAgICAg<br />
ICAgICAgIDdHlkKTQpVCTU1NTU1CQEJAQkBOcgogICAgICAgICAgICAg<br />
ICA6a0KSQpCIl01NT01PTU9NT01NTU2MQphCQEIxLAogICAgICAgICAg<br />
IDo1kUKNQphCiEJCTU1PTU9NT01PTU9NT01NipJuQm5CQEJCdS4KICAg<br />
ICAgICA3MG6GlUKIQpJClEJYQkJPTU9NT01PTU9NT01NQk1QQphCiEJA<br />
QkBCQE5yCiAgICAgIEeYlpdCSiBpQohCh4ggIE9CTU9NT01PTU9NT01P<br />
TZYyICBCj0JAQi4gRUJAQkBTCiAgICAgIJKWQk2HR0pCVS4gIGlTdUKI<br />
T01PTU9NT01PTU9NTZdPVTE6ICAua0JMTYhNhkKXCiAgICAgIEKMTU1C<br />
mUIgICAgICAgN4hCQk1NT01PTU9NT01PQkKWOiAgICAgICBCh0JNTYhC<br />
CiAgICAgII2YiEKKQiAgICAgICAgIDeSlkBNTU9NT01PTU1AQkA6ICAg<br />
ICAgICAgQEBCQEJACiAgICAgII+ST0xCLiAgICAgICAgICBCTkKPTU1P<br />
TU9NTY9CRUIgICAgICAgICAgckJqTYRCCiAgICAgIJBAICBAICAgICAg<br />
ICAgICBNICBPQk9NT01NQHEgIE0gICAgICAgICAgLkAgIEBACiAgICAg<br />
IISVT3ZCICAgICAgICAgICBCOnWMTU1PTU9NTUJKaUIgICAgICAgICAg<br />
LkJ2TUBCCiAgICAgIIRCkUKYSiAgICAgICAgIDCRQpdNTU9NT01PTUKV<br />
QkB1ICAgICAgICAgcUBAQEJACiAgICAgIEKETUJCjHYgICAgICAgR4+L<br />
Qk1NTU1NTU1NTU1NQkKINSAgICAgICBGhEJNTUBCCiAgICAgIIdCQk1/<br />
QlBOaSAgIExNRUKFT01NTU2PQoNNTU9NTYpCWk03ICAgckVxQodNQkKE<br />
CiAgICAgIEKYloRCTSAgQm1ChEIgIHFCTU9NQpBChUKEQk1PTUJMICBC<br />
QEJAQiAgQEJAQkBNCiAgICAgICBKlm2GhFBCj0KEQplCN0eIT01CQi4g<br />
ICAsQE1NTUBxTEJAQkBAQEJxQkBCQnYKICAgICAgICAgIGlHQpUsaTCE<br />
TZZCbk1NT4tFICA6ICBNQE9NTUBAQEJAUGlpQEBOOgogICAgICAgICAg<br />
ICAgLiAgIEKXTZBCj01NTUBCQEJAQkBNTU1AQEBNQEIKICAgICAgICAg<br />
ICAgICAgICBAQkBCLmlATUJCQEJAQkBAQk1AOjpCQEJACiAgICAgICAg<br />
ICAgICAgICAgQkBAQCAuQkBCLjpAQkAgOkJAQiAgQEJATwogICAgICAg<br />
ICAgICAgICAgICAgOjAgckBCQCAgQkBAIC5AQkA6IFA6CiAgICAgICAg<br />
ICAgICAgICAgICAgICAgdk1CIDpAQkAgOkJPNwogICAgICAgICAgICAg<br />
ICAgICAgICAgICAgICAsQkBCCg==<br />
</pre><br />
<br />
=== ASCII Skull #2 ===<br />
<br />
Players discovered that this was Base64 and, once decrypted, resulted in another ASCII skull:<br />
<br />
<pre><br />
:PB.Bk: <br />
,jBˆ@B@B@B@BBL. <br />
7G–B“B•BMMMMMB@B@B@Nr <br />
:kB’B.ˆ—MMOMOMOMOMMMMŒB˜B@B1, <br />
:5‘B.B˜BˆBBMMOMOMOMOMOMOMMŠ’nBnB@BBu. <br />
70n†•BˆB’B”BXBBOMOMOMOMOMOMMBMPB˜BˆB@B@B@Nr <br />
G˜–—BJ iBˆB‡ˆ OBMOMOMOMOMOMOM–2 B.B@B. EB@B@S <br />
’–BM‡GJBU. iSuBˆOMOMOMOMOMOMM—OU1: .kBLMˆM†B— <br />
BŒMMB™B 7ˆBBMMOMOMOMOMOBB–: B‡BMMˆB <br />
.˜ˆBŠB 7’–@MMOMOMOMM@B@: @@B@B@ <br />
.’OLB. BNB.MMOMOMM.BEB rBjM„B <br />
.@ @ M OBOMOMM@q M .@ @@ <br />
„•OvB B:uŒMMOMOMMBJiB .BvM@B <br />
„B‘B˜J 0‘B—MMOMOMOMB•B@u q@@@B@ <br />
B„MBBŒv G.‹BMMMMMMMMMMMBBˆ5 F„BMM@B <br />
‡BBM.BPNi LMEB…OMMMM.BƒMMOMMŠBZM7 rEqB‡MBB„ <br />
B˜–„BM BmB„B qBMOMB.B…B„BMOMBL B@B@B @B@B@M <br />
J–m†„PB.B„B™B7GˆOMBB. ,@MMM@qLB@B@@@BqB@BBv <br />
iGB•,i0„M–BnMMO‹E : M@OMM@@@B@Pii@@N: <br />
. B—M.B.MMM@B@B@B@MMM@@@M@B <br />
@B@B.i@MBB@B@B@@BM@::B@B@ <br />
B@@@ .B@B.:@B@ :B@B @B@O <br />
:0 r@B@ B@@ .@B@: P: <br />
vMB :@B@ :BO7 <br />
,B@B <br />
</pre><br />
<br />
Players discovered that, once both skulls had been stripped of spaces, the bytes of each skull that aren't equal to 0 could be subtracted using [https://pastebin.com/g3kA1Pif a script]. Once compiled, players received the following string:<br />
<br />
<pre><br />
OHVSURPHWLXQMXHJR...FUHRTXHXVWHGHVORVGHWHFWLYHVGHMXHJRVOROODPDULDQXQWUDLOKHDG?EOCJGDXVD-DPEDV-FDODYHUDV.KWPO<br />
</pre><br />
<br />
Players discovered that this was a caesar cipher. After shifting the string forward 23 places, it resulted in:<br />
<br />
<pre><br />
LESPROMETIUNJUEGO...CREOQUEUSTEDESLOSDETECTIVESDEJUEGOSLOLLAMARIANUNTRAILHEAD?BLZGDAUSA-AMBAS-CALAVERAS.HTML<br />
</pre><br />
<br />
When cleaned up, the message read:<br />
<br />
<pre><br />
Les prometi un juego...creo que ustedes los Detectives de Juegos lo llamarían un trailhead? BLZGDUSA-AMBAS-CALAVERAS.HTML<br />
</pre><br />
<br />
When translated from Spanish to English:<br />
<br />
<pre><br />
I promised you a game...I believe you Game Detectives would call it a trailhead? BLZGDAUSA-AMBAS-CALAVERAS.HTML<br />
</pre><br />
<br />
<code>USA-AMBAS-CALAVERAS</code> translated to <code>USE-BOTH-SKULLS</code>, and the <code>.HTML</code> extension hinted at a URL.<br />
<br />
=== Skull Video ===<br />
<br />
BLZGDA refers to the servers that Blizzard uses to host media on their website. As such, this led players to [ https://blzgdapipro-a.akamaihd.net/media/screenshot/usa-ambas-calaveras.html this page], which contains a video of a vitals screen depicting a skull and some other medical information. In addition, it also contained a graphic of one of the ASCII skulls. An Imgur mirror can be found [https://i.imgur.com/6Pk69LX.png here].<br />
<br />
Within the properties of the video, players found another comment in Spanish:<br />
<br />
<pre><br />
Parecen estar muy interesados en estos "héroes". ¿Tal vez les interese conocer algunos detallitos que he averiguado sobre ellos?<br />
</pre><br />
<br />
In English:<br />
<br />
<pre><br />
You seem to be very interested in these "heroes". Maybe interested to know some details that I found out about them?<br />
</pre><br />
<br />
In addition, the video contains a heartbeat monitor, and a series of 26 lines above it. When players assigned the letters of the alphabet to the 26 lines, and used the "pings" of the heartbeat to determine what letters to use, the following string was found:<br />
<br />
<pre><br />
momentincrime<br />
</pre><br />
<br />
=== amomentincrime E-mail ===<br />
<br />
'momentincrime' appeared to refer to the in-universe TV show "A Moment in Crime," which can be seen in the Roadhog and Junkrat [https://www.youtube.com/watch?v=l5kTATxt7bE video] that came out months before the release of Overwatch. However, players also discovered a website, [https://amomentincrime.com amomentincrime.com], and displayed the following text:<br />
<br />
<pre><br />
...Estableciendo conexión...<br />
...Protocolo Sombra v1.3 iniciado...<br />
<br />
...Infiltrando la respuesta automática del email de pistas...<br />
<br />
...Terminando conexión...<br />
</pre><br />
<br />
Players discovered that sending an e-mail to tips@amomentincrime.com resulted in an automated email response:<br />
<br />
<pre><br />
Thank you for contacting A Moment in Crime's anonymous crime line!<br />
<br />
We have analyzed your submission and forwarded the information to the relevant parties. Your help could be vital in apprehending these cri<br />
<br />
...Estableciendo conexión...<br />
...Protocolo Sombra v1.7 iniciado...<br />
<br />
<br />
01:07:47 02:02:02 01:08:06 02:13:43 01:18:32<br />
01:18:21 02:10:19 01:06:21 02:05:18 01:04:02<br />
01:07:08 02:18:25 01:13:04 02:19:20 01:23:02<br />
01:16:40 02:16:35 01:23:04 02:17:16 01:06:42<br />
01:13:29 02:18:06 01:05:02 02:15:41 01:08:34<br />
<br />
j.7F57O,NLv:qj.7B:,1qv@B1j5ivB:,<br />
<br />
...Terminando conexión...<br />
<br />
minals and bringing them to justice. These fugitives are responsible for a string of robberies, arson, and other crimes stretching from Sydney to King's Row.<br />
<br />
Authorities believe that they have set their sights on crossing the Atlantic to America.<br />
</pre><br />
<br />
Players discovered that, if the sets of numbers were taken as AA:BB:CC, where AA was the number of skull (in order of discovery), BB was the row and CC was the column (as seen [https://i.imgur.com/ZgN2MVQ.png here]), and organized into a 5x5 matrix, it would result in:<br />
<br />
<pre><br />
S j G B L <br />
. @ M O k <br />
i , v : 0 <br />
E 7 r q N <br />
J P 5 F 1<br />
</pre><br />
<br />
Players discovered that this Matrix could be used as a bifid key to decode the text underneath the table of numbers in the email, as shown below:<br />
<pre><br />
j . 7 F 5 7 O , N L v : q j . 7 B : , 1 q v @ B 1 j 5 i v B : ,<br />
12 21 42 54 53 42 24 32 45 15 33 34 44 12 21 42 14 34 32 55 44 33 22 14 55 12 53 31 33 14 34 32<br />
<br />
1 2 2 1 4 2 5 4 5 3 4 2 2 4 3 2 4 5 1 5 3 3 3 4 4 4 1 2 2 1 4 2<br />
1 4 3 4 3 2 5 5 4 4 3 3 2 2 1 4 5 5 1 2 5 3 3 1 3 3 1 4 3 4 3 2<br />
<br />
11 24 23 14 43 22 55 45 54 34 43 23 22 42 31 24 45 55 11 52 35 33 33 41 43 43 11 24 23 14 43 22<br />
</pre><br />
<br />
This gave players the following string:<br />
<br />
SOMBr@1NF:rM@7iON1SP0vvErrSOMBr@<br />
This phrase was found to be leet-speak, and was translated to:<br />
<br />
<pre><br />
Sombra Information is power Sombra<br />
</pre><br />
<br />
The string <code>SOMBr@1NF:rM@7iON1SP0vvErrSOMBr@</code> was used as a password later on in the ARG.<br />
<br />
== A Moment in Crime Transmission ==<br />
<br />
[[File:Momentincrime.png|thumbnail|right|amomentincrime.com as of August 24th, 2016]]<br />
<br />
Once the 23-hour countdown on the Skycoder forum post reached zero, [https://amomentincrime.com amomentincrime.com] was updated. It now read:<br />
<br />
<pre><br />
...Estableciendo conexión...<br />
...Protocolo Sombra v1.9 iniciado...<br />
<br />
...Transmitiendo información a ómnicos activos... 2%<br />
<br />
...Terminando conexión...<br />
</pre><br />
<br />
Translated from Spanish to English:<br />
<br />
<pre><br />
...Establishing connection...<br />
...Sombra Protocol v1.9 initiated...<br />
...Transmitting information to active omnics... 2%<br />
<br />
...Ending connection...<br />
</pre><br />
<br />
A comment was also added to the source code:<br />
<br />
<pre><br />
Bien hecho, ya tienen mi clave. Hackear este programa de televisión no tuvo chiste. Espérense a lo que sigue.<br />
</pre><br />
<br />
When translated:<br />
<br />
<pre><br />
Well done, you have my password. Hacking this television program was meaningless. Wait for what is coming.<br />
</pre><br />
<br />
The percent on the amomentincrime.com slowly increased over time. Once the 5% milestone was hit, the Sombra Protocol version number changed to to v1.95. Afterwards, the percentage increased by 0.0038% every 3 minutes in real time.<br />
<br />
In addition, another comment was added:<br />
<br />
<pre><br />
Parece que se están calentando un poco las cosas... tendré que pasar desapercibida mientras esto se finaliza.<br />
</pre><br />
<br />
Translated:<br />
<br />
<pre><br />
It seems things are heating up a bit... I'll have to go unnoticed while this is finishing.<br />
</pre><br />
<br />
On 18th October at 19:02 GMT the site reached 100%, and the site updated with the following message:<br />
<br />
<pre><br />
...Transmisión finalizada - finalizando carga... <br />
...Carga finalizada. Unidad Bastion E-54 comprometida...<br />
</pre><br />
<br />
Which roughly translates to:<br />
<br />
<pre><br />
...Transmission complete - finishing upload...<br />
...Upload finished. Unit Bastion E-54 engaged...<br />
</pre><br />
<br />
Hidden in the source code of the site was the text <code>v1.4.0.2.324??</code>. Players then correctly assumed that this referred to a future build of Overwatch itself.<br />
<br />
== Sombra vs. LumériCo ==<br />
<br />
=== The Hacked Bastion ===<br />
<br />
On October 19, 2016, a new Overwatch version was released - version 1.4.0.2.32448. Shortly afterwards, the version number in the source code of the amomentincrime site updated to the same version number. After the build launched, players discovered that the hero Bastion had a strange interaction when near the "SOMBRA PROTOCOL" monitors on Dorado, and would emit a message in morse code, which can be heard [https://www.youtube.com/watch?v=Hkd__ceYm-Y here]. When the morse was decoded, players received the following string:<br />
<pre><br />
SQOFJFBNITIZWGDXSDO<br />
</pre><br />
<br />
Players discovered that this was a Vigenere cipher, and the key consisted of the alphabetic characters from the<br />
<code>SOMBr@1NF:rM@7iON1SP0vvErrSOMBr@</code> string, it was decoded to read:<br />
<br />
<pre><br />
ACCESSWWWLUMERICOMX<br />
</pre><br />
<br />
This led players to the [https://lumerico.mx/ LumeriCo website]. ''(Editor's note: as of 2018, this site appears to be inactive.)''<br />
<br />
=== LuméReaction ===<br />
<br />
[[File:Lumerico.png|thumbnail|right|The homepage of https://lumerico.mx]]<br />
<br />
The LumeriCo website was for the in-universe Mexican tech giant LumériCo, who had built several reactors in the Dorado region. The website had a [https://lumerico.mx/news news page], noting the imminent opening of a new reactor on November 1 as well as a recent attack on its construction site. There were also [https://lumerico.mx/about About] and [https://lumerico.mx/login Login] pages.<br />
<br />
Players also discovered a <code>robot.txt</code> file, which appeared to server no purpose and only contained the text <code>Allow: omnics</code>, and appeared to be a joke about the [https://en.wikipedia.org/wiki/Robots_exclusion_standard Robots exclusion standard]. Another text file was discovered called <code>omnics.txt</code>, which contained the text:<br />
<br />
<pre><br />
Allow: ??<br />
Allow: ???<br />
</pre><br />
<br />
And appeared to be yet anotehr joke about the Robots exclusion standard. And, finally, an <code>api</code> file that contained <code>{"message":"thanks for calling the api"}</code> and, humorously, has no practical purpose.<br />
<br />
=== Phone Number ===<br />
<br />
At the bottom of the LumeriCo website, players discovered a phone number <code>(510) 766-2726</code>. When called, players heard a woman listing off a string of numbers in Spanish, a recording of which can be found [https://soundcloud.com/jackwilsdon/510-766-2726a here]. The numbers spoken are: <code>5-2-4-1-3 (pause) 23-4-14-8-6-18-17-23-21-18-15</code>.<br />
When assuming that a=1, b=2, etc, the second part of the message can be decoded to: <code>WDNHFRQWURO</code>. This was found to be a ROT-23 cipher, and decoded to: <code>TAKECONTROL</code>.<br />
<br />
=== Take Control ===<br />
<br />
The phone message led players to an important [https://lumerico.mx/TAKECONTROL/index.html page] on the site, under the directory <code>TAKECONTROL</code>. It was styled the same way as amomentincrime.com and featured [https://lumerico.mx/calavera.png an image of Sombra's skull icon], named "calavera.png". There was also text on the page:<br />
<br />
<pre style="word-break:break-all;word-wrap: break-word;"><br />
ethldtíoíesnoemfetuylm.bnlsssqtann)hcnslararuCpdGeoopéqubdsroaan.arnasdmdor1vrsmerñerlsdacnnnoaexedsidcn.iarsgcyi,iqeqnd.pooitoaeaaransterLetéáedasodocMrnseeiuCsimnosetlójnueodacapsadcoanfasest.rnucaodacadmdoemoipíogPoipbehaSussai.,yccandin.reueatenaoiorneoeetaoéyenimt¿rPehec,uurobudeílrysriteenasni,adngpjrálireecgrolsmhYnao?nmonomepeldezmapcpunoaulrrruCstmeitltetlróesoapsdéyufcuascaa,rensbuinergnqedlmvlbpdtaz.enebuineuldoerecrGefqfirrasulrbeatHsilnbaúaeeaaooassraooa,ioedo:aLiuielPr ursmoootlnielteeánlosulobeauaanopearrúiesltéyrosssisuaaeaenremsieaismdjmolrsspebiecdéyusittnvrcacp.taebrtLiunróporner<br />
<br />
eúcrneuyraarsettsyrseen.aaPnrneuyraeastuCpnhl/wLloaloa.qartlsyuínreute.evgdpiuábdmPooucvdeccmoreurr.o?unriorydbaSnalegeáezadienáutalaaioeemfcbgdinableoc¿éppoeocelsumuoaHearsosqadrrrftuLiorannnoneneriiatcnlomoqnaqdunrcno,enmerosaereisloabolii.e.dormerosepopdé,eo:r#5scoegaqoeaibs(edioraamtdírnlyoetjcgratmnrrobnrsstloeYqoeocicpnómlpernmaepogenmodqamubodnaeasuaenMoolloupeqvgrLtúr<br />
<br />
tsosrdvoeaerroaeusdmaauamoMobsnaeanraunnt,roierbeoiemaodbmantursotñauoureeuoerreopc.etlr<br />
<br />
sotñneerLimeaFsNJ<br />
</pre><br />
<br />
Players found this to be a column order transposition cipher with the key <code>5 2 4 1 3</code>, which was found in the phone message. The cleaned up result was: <br />
<br />
<pre><br />
Los felicito por haber llegado hasta aquí. Solo quería saber si estaban listos. (Hey, es muy difícil encontrar buena ayuda últimamente...deberían ver algunos de los payasitos que están trabajando conmigo) Por ahora, continuemos con el verdadero reto: acabar con LumériCo y su president e Guillermo Portero. ¿Y porqué? Porque es un hombre codicioso, corrupto y un ladrón abominable. Su plan de traer en línea el más grande y el más poderoso zigurat el 1 de noviembre no es nada más que una artimaña, un elaborado plan designado para ejercer aún más influencia sobre la gente de México y en gordar los bolsillos de sus compinches. ¿Y quién va a pagar por eso? La gente común y corriente, los mismos que siempre quedan olvidados.<br />
<br />
He empezado a mejorar mis protocolos para que sean usados para derrumbar la infraestructura de LumériCo y Los Muertos también están intentando levantarse en contra de la corrupción. Mientras tanto, escarben por el sitio de LumériCo y busquen información que podamos usar en contra del cabrón, mejor aún, encuentren su nombre de usuario y contraseña para asegurarnos de que ciertos detalles no muy favorables sobre el presidentito...aparezcan...<br />
<br />
Pude encontrar el nombre de usuario y contraseña de un empleado de soporte de LumériCo, empiecen por ahí:<br />
<br />
GFlores/g#fNwP5qJ<br />
</pre><br />
<br />
Translated:<br />
<br />
<pre><br />
I'm congratulating you for getting in here. I only wanted to know if you were ready or not. (Hey, it's really difficult to get good help lately... you should see some of the clowns I'm working with). For now, let's continue with the true challenge: taking down Lumerico Corp president Guillermo Portero. Why? Because he's a greedy and corrupt man, and an abominable thief. His plan of bringing in line the most powerful and biggest zigurat the 1st of november us nothing more than a deceit, an elaborate plan by his gang to become even more influential in the people of Mexico and get more money. And who's gonna pay for that? Common people, the ones that are always forgotten.<br />
<br />
I've started upgrading my protocols so that they are used to take down the Lumerico Corp infraestructure and Los Muertos are also trying to go against the corruption. Meanwhile, search the Lumerico Corp site for info we can use against the bastard, or better, get his username and password so that hundreds "not so favorable" facts about the president start popping up.<br />
<br />
I was able to get the username and pass of a Lumerico Corp employee, start here:<br />
<br />
GFlores/g#fNwP5qJ<br />
</pre><br />
<br />
=== Presidential Login ===<br />
<br />
Players used the credentials above on the [https://lumerico.mx/login Lumerico login page], and accessed the account of Gonzalo Flores, which included [https://lumerico.mx/email his emails]. Transcripts of these emails were archived [https://docs.google.com/spreadsheets/d/1zh7OU2dEOnD4X43ImvZBNpS75FLkj-rL75pXJ2l3TuQ/htmlview?sle=true# here].<br />
<br />
However, only one email had relevance to the ARG:<br />
<br />
<pre><br />
De:Valeria Valderrama<VValderama@lumerico.mx><br />
Para:Gonzalo Flores<GFlores@lumerico.mx><br />
Asunto:Página de Guillermo<br />
<br />
Hola, Gonzo:<br />
¿Puedes ver el tráfico de https://lumerico.mx/president-bypass? Guillermo debería ser el único accediendo desde su página de inicio privada, pero parece que está teniendo mucho tráfico. Tal vez tengamos que escalar esto a<br />
la señorita Jiménez, pero quiero estar segura de que es digno de su tiempo.<br />
<br />
Valeria Valderrama<br />
</pre><br />
<br />
The email referenced high traffic on the [https://lumerico.mx/president-bypass President Bypass Link]. The page displayed an "access denied" message, but players found a <code>President Auth-Bypass Revision 1.02: /.git/</code> line in the source code.<br />
<br />
This line led players to [https://github.com/internetwache/GitTools/tree/master/Dumper dump the data] from the [https://lumerico.mx/president-bypass/.git/ /.git/ subpage] with git protocol and upload it to [https://gist.github.com/anonymous/987beb6a5c817b53da820562854bdebe Github]. These were the code files behind the website, and included a '''class.authentication.php''' file that contained an encryption function, and '''class.president-bypass.php''' file which contained the president's (Guillermo Portero) username, <code>GPortero</code>, and encrypted password <code>?MzY:MTI5:?AzY:OWM?:?EDO:ZGU?:jVTM:MTJm:2ITM:MTUw:?QjY:OWY?:?kTO:MTQx:?MzY</code>.<br />
<br />
Some players wrote a function to decode the encrypted <code>class.authentication.php</code> file, and then used it on the encrypted password. The resulting password was <code>Xy@4+Bkuqd<53uJ</code>.<br />
<br />
After logging in to the President's account, players were able to read his emails. After 30 minutes, another email appeared in the President's inbox, from Sombra herself:<br />
<br />
<pre><br />
Veo que se han podido infiltrar en su correo.<br />
No se preocupen, él no puede ver este correo, lo he ocultado de su vista si se conecta desde una de sus direcciones conocidas de IP.<br />
Necesito un poco más de tiempo para establecer el próximo grupo de potocolos. Manténganse atentos a principios de la otra semana. Le echaré unos cuantos trapitos sucios en sus correos para que se filtren al público<br />
"accidentalmente". Ya veremos como reaccionan los medios de comunicación.<br />
</pre><br />
<br />
The rough translation was:<br />
<br />
<pre><br />
I see you have been able to infiltrate into his mail.<br />
Don't worry, he cannot see this email, I've hidden it from his sight if he connects from one of his known IP addresses.<br />
I need a little bit of time to establish the next set of protocols. Stay alert early next week. I'll throw some dirty laundry in his emails that can "accidentally" leak to the public. We'll see how the media will react to that.<br />
</pre><br />
<br />
=== Admin Access ===<br />
<br />
[[File:Lumerico admin panel.png|thumbnail|right|The admin panel of the Lumerico site, only accessible by logging in as MJimenez]]<br />
<br />
On October 25, 2016, new emails were discovered in the GFlores account, but they had no immediate significance to the ARG. In addition, omnics.txt was updated:<br />
<br />
<pre><br />
Allow: Tzolk'in<br />
Allow: Imix ChikchanManik Imix ChikchanImixChikchanImix Manik Chikchan Imix Kimi Chikchan Chikchan Kimi ChikchanImixChikchanImix ChikchanKimi<br />
</pre><br />
<br />
Tzolk'in is the name of a [[Wikipedia:Maya calendar#Tzolk'in|Mayan Calendar]], and the second line was a series of animals from it in the Tzolk'in dialect. Imix stands for Day 1, Chikchan — 5, Manik — 7 and Kimi — 6. When turned into numbers, the string read <code>1 57 1 5151 7 5 1 6 5 5 6 5151 56</code>. These digits turned into pictograms of [[Wikipedia:Maya numerals|Maya numerals]] (one by one, not numbers as a whole) written horizontally become <code>. -..- . -.-. ..- - . .- - - .- -.-. -.-</code> This was found to be morse code, and decoded to: <code>EXECUTEATTACK</code>.<br />
<br />
This led players to the "EXECUTEATTACK" [https://lumerico.mx/EXECUTEATTACK/index.html directory], where the following text was discovered:<br />
<br />
<pre><br />
Ha llegado el momento. Esos correos expuestos la verdad sobre Portero, iniciado la revuelta, y hemos convencido a la gente de México a apoyar nuestra causa. Ahora es el momento para el golpe. Convertiremos su preciada inauguración el 1 de noviembre en un gran movimiento en su contra. Necesito que hagan una cosa:<br />
Consigan acceso al correo del jefa de seguridad y busquen alguna forma de ayudarme en el ataque. Es posible que lo vean contactando a Portero pronto. He cambiado su contraseña a: d0r*NuLw9<br />
</pre><br />
<br />
Translated to English:<br />
<br />
<pre><br />
The moment has come. These emails exposed the truth about Portero, initiated the revolt, and have convinced people of Mexico to support our cause. Now is the time to strike. Convert his precious inauguration on November 1 to a large movement against it. I need you to do one thing:<br />
Get access to the email security chief and seek some form of help in the attack. You may see her contacting Portero soon. I've changed her password: d0r*NuLw9<br />
</pre><br />
<br />
Logging in with the credentials <code>MJimenez / d0r*NuLw9</code> gave players access to the [https://lumerico.mx/admin admin panel] of the LumeriCo reactor. Until November 1, 2016, it stayed inactive and any command was answered with the same message saying that the terminal disconnected.<br />
<br />
=== The Terminal ===<br />
Once the console became usable, players could type <code>help</code> to see a list of commands:<br />
<br />
<pre><br />
override Engineer safety mode override<br />
help Provides help information about commands<br />
version Displays system version information<br />
about Displays information about the system<br />
grep Search output by string<br />
</pre><br />
<br />
In the MJimenez email account, there was an email labeled <code>Corrupción de correo electrónico</code> with highlighted text in side of it, specifically <code>/ter/</code>. Players discovered that performing the Linux command <code>about | grep 'ter'</code> in the console returned this text:<br />
<br />
<pre><br />
Open source lightweight shell for any terminal.<br />
Anything with a terminal<br />
1.1.0 - expanded terminal support<br />
</pre><br />
<br />
The first word of every line given from the output was bolded and purple. Putting the letters together, players received the text <code>OpenAnything1.1.0</code>, which was a later solution.<br />
<br />
Another available command for the terminal was <code>override</code>, and prompted players with three security questions:<br />
<br />
# '''Favorite Movie'''. The answer to the prompt is <code>some like it bot</code>, a movie from the Overwatch universe.<br />
# '''Favorite Cookie Flavor'''. The answer being <code>nuevas sabor delicias</code>, a flavor referenced in an email in the MJimenez account.<br />
# '''Secret'''. The answer to this prompt is <code>OpenAnything1.1.0</code>.<br />
<br />
This returned <code>OK</code>, gave players admin access, and enabled a new set of commands: <br />
<br />
'''ls''' Lists files by path<br />
'''cat''' Read file by path<br />
'''exec''' Execute a file <br />
<br />
Typing <code>ls</code> listed two files: <code>payload</code> and <code>d_ilqh_nhb.html</code> (the file name was a ROT23 for ''a_fine_key'').<br />
<br />
[[Image:A fine key.png|thumb|right|a_fine_key.html]] Reading the second file with <code>cat mnt/d_ilqh_nhb.html</code> yielded a text where ASCII characters (repeating string <code>vhnl tldv xyl vcxelo xv qhrtv. zkolg[nl]</code>) were in a shape of a key. Deciphering it using an Affine cipher (A=23, B=23) yielded the following string: <code>some keys are shaped as locks. index[me]</code>. It is assumed that ''some keys are shaped as locks'' line alluded to the [[#Tracer_Trail_Cipher|Tracer Trail]] ciphertext being used as a key.<br />
<br />
Simultaneously, entering <code>exec payload</code> presented players with a prompt — the answer to which was the [[#Tracer_Trail_Cipher|Tracer Trail]]. When inputted, players were given a message that looked similar to what was previously seen at amomentincrime.com. The counter shown in the top right was then incremented.<br />
<br />
[[Image:LumericoTerminalTracerEntered.jpg|850px]]<br />
<br />
=== Misdirection ===<br />
<br />
[[Image:LumericoHacked.jpg|thumb|right|lumerico.mx website hacked by Sombra]]<br />
<br />
On October 1, 2016, the lumerico.mx home page updated to show "glitches" and a black overlay with a message under a purple skull, and the string <code>&lt;!-- MISDIRECTION --></code> was also added to the source of the page.<br />
<br />
The message said: <br />
<br />
<pre><br />
Buen trabajo, amigos. No lo hubiera logrado sin su ayuda. En fin, me consiguieron los recursos que necesitaba para mi siguiente golpe – les encantará.<br />
Esperen noticias de mí en los próximos días...<br />
Les voy a mandar algo para agradecerles… Ojalá lo puedan aprovechar.<br />
Dasvidanya amigos<br />
</pre><br />
<br />
Translated:<br />
<br />
</pre><br />
Good job, friends. I would not have done it without your help. Anyway, I got the resources needed for my next hit - you'll love it.<br />
Expect to hear from me in the coming days...<br />
I'm going to send something to thank you ... Hopefully you can use it.<br />
Dasvidanya friends<br />
</pre><br />
<br />
<br />
<br />
Note that ''Dasvidanya'' is a phonetic transliteration of ''до свиданья'' — a Russian phrase for "goodbye". The thing that Sombra sent as a ''thank you'' was a new spray, named "Día de Los Muertos" after the Mexican festival that took place at the same time as the ARG. The spray is currently only available on the PC version of the game.<br />
<br />
[[File:Dia de los muertos spray.jpg|thumbnail|right|The Día de Los Muertos spray that was added to the game after Sombra hacked the Lumerico site]]<br />
<br />
The '''MISDIRECTION''' string lead to the MISDIRECTION [https://lumerico.mx/MISDIRECTION/index.html directory] which contained the text:<br />
<br />
<pre><br />
...Estableciendo conexiуn...<br />
...Protocolo Sombra v2.3 iniciado...<br />
<br />
...Desviando datos del zigurat de LumériCo hacia el objetivo...<br />
...Descifrando contraseсas del objetivo...<br />
...Acceso otorgado al directorio de volskayaindustries.com...<br />
<br />
...boop ;)...<br />
...Terminando conexión...<br />
</pre><br />
<br />
Translated: <br />
<br />
<pre><br />
...Establishing connection...<br />
...Sombra Protocol v2.3 initiated...<br />
<br />
...Forwarding the data from the LumériCo ziggurat to the target...<br />
...Deciphering the target passwords...<br />
...Access Granted to the directory of volskayaindustries.com...<br />
<br />
...boop ;)...<br />
...Ending connection..<br />
</pre><br />
<br />
== Blizzcon ==<br />
<br />
Blizzcon 2016 opened with the [https://www.youtube.com/watch?v=Og5-Pm4HNlI Overwatch short "Infiltration"], a short depicting Reaper, Widowmaker, and Sombra on Volskaya Industries. During the showing of the short, Sombra's [https://playoverwatch.com/en-us/heroes/sombra hero page] went live, showcasing her abilities and character backstory.<br />
<br />
[[File:SombraBG.jpg|center|500px]]<br />
<br />
== References ==<br />
<br />
=== Community Resources ===<br />
<br />
A collection of tools and resources made by the Game Detectives Discord community for use in the ARG.<br />
<br />
==== ASCII Skull ====<br />
<br />
'''ASCII Skull Analysis:''' https://github.com/bahamas10/sombra<br />
<br />
'''Removing SOMBR@ Analysis:''' https://pastebin.com/15u27YTC<br />
<br />
'''ASCII Skull Eye Analysys:''' https://docs.google.com/spreadsheets/d/1-JQpWyitMKYhP-4l8ZDFiJI3NjqRrvoEnRdFQawike8<br />
<br />
==== Google Docs ====<br />
<br />
'''Observations and Speculations Spreadsheet:''' https://docs.google.com/spreadsheets/d/1rI08baFQmAwaqHC-9GF9VNGCYjuRE-q4LN9k4ottjuQ/pubhtml<br />
<br />
'''LumériCo Emails and Translations Spreadsheet:''' https://goo.gl/cQgdIJ (Courtesy of UberPilot)<br />
<br />
==== Tracer Code ====<br />
<br />
'''GOL! Guesser:''' https://axxim.net/ow/gol-guesser/<br />
<br />
'''Uber GOL! Guesser:''' https://axxim.net/ow/gol-guesser/uber/<br />
<br />
The Uber GOL! Guesser only prints out UTF-8 compliant results, which makes it easier to identify potentially correct answers.<br />
<br />
'''Bruteforcing tool:''' https://github.com/glv2/bruteforce-salted-openssl<br />
<br />
=== Third-Party Resources ===<br />
<br />
A collection of third-party tools and resources that the Game Detectives Discord community has used in the ARG.<br />
<br />
==== Image of Reaper ====<br />
<br />
'''stegdetect (Linux):''' https://github.com/abeluck/stegdetect<br />
<br />
stegdetect is a Linux utility used to determine if a given image may contain encoded information.<br />
<br />
'''JPHide & JPSeek:''' https://linux01.gwdg.de/~alatham/stego.html<br><br />
'''iSteg (Mac OSX):''' https://www.hanynet.com/isteg/<br />
<br />
JPHide & JPSeek is used to hide and find, respectively, a file inside a JPEG image.<br><br />
iSteg works similarly to JPHide on the Mac OSX platform.<br />
<br />
'''stegbreak (Linux):''' https://linux.die.net/man/1/stegbreak<br />
<br />
stegbreak is used to do brute-force dictionary attacks on JPEG images.<br />
<br />
=== Easter Eggs ===<br />
<br />
The following are collection of references and Easter Eggs encountered throughout the ARG.<br />
<br />
==== In-Game ====<br />
<br />
'''Sombra's "Amused" Emote'''<br />
<br />
This character emote features the [[Sombra_ARG_False_Leads | Skycode]], accompanied by soft music resembling the [https://www.reddit.com/r/Overwatch/comments/4w7ey1/the_sombra_skysong/ Skysong]. Sombra's expression is one of amusement, and it's a nod to the community's prolonged creative attempts to solving an nonexistent puzzle.<br />
<br />
[[File:EmoteSkycode.png|200px]]<br />
<br />
'''Skycode Spray'''<br />
<br />
This character spray features Sombra's iconic skull in front of a compass rose and the [[Sombra_ARG_False_Leads | Skycode]]. This is a reference to both the [[#Directions_&_Letters|cardinal directions]] used in one of the puzzles and to the Skycode, which is considered the most significant false lead that solvers encountered.<br />
<br />
[[File:SkycodeSpray.png|200px]]<br />
<br />
==== In-ARG ====<br />
<br />
'''Espresso Command'''<br />
<br />
There was a hidden command in LumériCo's [[#The_Terminal | admin terminal]]. Inputting the word <code>espresso</code> returned the following message: <code>Coffee Pot Status: Brewed approximately 23 hours ago, currently 0% full</code><br />
This is referencing a variety of [https://goo.gl/cQgdIJ emails] found in the LumériCo site involving broken espresso machines and incompetent coffee brewing, which caught the attention of the community and gave way to a vast variety of mediocre jokes. Furthermore, "23 hours" makes reference to the number 23, which was believed by many to possess some sort of significance to the ARG, as Sombra would be the 23rd character in Overwatch. Finally, "0%" references the ARG's notable waiting periods that have been widely criticized by the community, specifically [[#A_Moment_in_Crime_Transmission | A Moment in Crime's upload percentage]].<br />
Due to the iconic purple text it is believed that this hidden command was created by Sombra herself.<br />
<br />
[[File:EspressoCommand.png]]<br />
<br />
=== Media Appearances ===<br />
<br />
'''3rd Aug. 2016'''<br />
<br />
[EN] [https://kotaku.com/overwatch-fans-find-new-clues-about-the-mysterious-hero-1784767759 Kotaku - Overwatch Fans Find New Clues About The Mysterious Hero Sombra]<br />
<br />
[EN] [https://www.polygon.com/2016/8/3/12369144/overwatch-summer-games-sombra-arg-blizzard?utm_campaign=polygon&utm_content=chorus&utm_medium=social&utm_source=twitter Polygon - Overwatch fans are trying to crack the latest mystery about Sombra]<br />
<br />
[EN] [https://www.pcgamesn.com/overwatch/overwatch-sombra PCGamesN - Overwatch's Sombra ARG continues with new clues, but no solutions]<br />
<br />
[EN] [https://team-dignitas.net/articles/blogs/overwatch/9989/who-is-sombra-all-facts-and-clues-about-sombra Team-Dignitas - Who is Sombra? All facts and clues about Sombra]<br />
<br />
[FR] [https://overwatch.gamewave.fr/un-nouveau-code-cache-dans-la-derniere-cinematique-d-overwatch/ Gamewave - UN NOUVEAU CODE CACHÉ DANS LA DERNIÈRE CINÉMATIQUE D'OVERWATCH!]<br />
<br />
[EN] [https://www.follownews.com/overwatch-fans-find-new-clues-about-the-mysterious-hero-sombra-1nhqt FollowNews - Overwatch Fans Find New Clues About The Mysterious Hero Sombra]<br />
<br />
'''4th Aug. 2016'''<br />
<br />
[EN] [https://www.pcgamer.com/overwatch-summer-games-trailer-hides-a-mysterious-secret/ PCGamer - Overwatch Summer Games trailer hides a mysterious secret]<br />
<br />
[SK] [https://www.sector.sk/novinka/121273/nove-overwatch-video-obsahuje-dalsie-tajomstva.htm Sector - Nové Overwatch video obsahuje ďalšie tajomstvá]<br />
<br />
[EN] [https://www.techinsider.io/overwatch-sombra-character-2016-8 Techinsider - 'Overwatch' players are going to insane lengths to solve a mystery that Blizzard's teased for months]<br />
<br />
[EN] [https://gamerant.com/overwatch-sombra-clues/ Gamerant - Overwatch Players Uncover More ‘Sombra’ Clues]<br />
<br />
[HU] [https://www.gamestar.hu/hir/overwatch-sombra-karakter-214739.html Gamestar - Overwatch - újabb nyomok utalnak a még be nem jelentett hősre]<br />
<br />
'''5th Aug. 2016'''<br />
<br />
[EN] [https://kotaku.com/days-later-overwatch-fans-cant-figure-out-the-sky-cod-1784872143 Kotaku - Days Later, Overwatch Fans Can't Figure Out The 'Sky Code' Mystery]<br />
<br />
[NL] [https://www.gamersnet.nl/nieuws/201608/cryptische_speurtocht_naar_overwatch_nieuwe_heldin_sombra_gaat_bizar_diep/ Gamersnet - Cryptische speurtocht naar Overwatch' nieuwe heldin Sombra gaat bizar diep]<br />
<br />
[ES] [https://www.alfabetajuega.com/noticia/overwatch-el-enigma-de-sombra-sigue-ofreciendo-nuevos-detalles-n-71772 Alfa Beta Jeuga - Overwatch: El enigma de Sombra sigue ofreciendo nuevos detalles]<br />
<br />
[EN] [https://www.youtube.com/watch?v=5ROjN-_F0ZU&feature=youtu.be&t=4m22s IGN (Video) - Sombra: Overwatch's Secret New Hero - Overwatch HQ]<br />
<br />
'''7th Aug. 2016'''<br />
<br />
[EN] [https://www.gamespresso.com/2016/08/summary-state-sombras-arg-overwatch/ Gamespresso - Summary of the state of sombra's ARG in Overwatch]<br />
<br />
'''8th Aug. 2016'''<br />
<br />
[EN/CN] [https://www.zhentoo.com/doc92368 Zhentoo - Overwatch new hero Secret Dorado hidden mystery] <br />
<br />
[EN] [https://www.technewstoday.com/30880-overwatch-sombra-continues-to-elude-detectives/ TechNewsToday - Overwatch: Sombra Continues to Elude Detectives]<br />
<br />
'''11th Aug. 2016'''<br />
<br />
[EN] [https://www.youtube.com/watch?v=IZR-pa0it4Q The Know - New Overwatch Hero Hints]<br />
<br />
'''12th Aug. 2016'''<br />
<br />
[EN] [https://kotaku.com/after-two-weeks-overwatch-fans-sombra-investigation-re-1785204389 Kotaku - Overwatch Fans' Sombra Investigation Reaps A Skull Code]<br />
<br />
'''14th Aug. 2016'''<br />
<br />
[EN] [https://gamerant.com/overwatch-sombra-skull-code/ Gamerant - Skull Code is Latest Clue in Overwatch’s Sombra Investigation]<br />
<br />
'''16th Aug. 2016'''<br />
<br />
[EN] [https://www.christiantoday.com/article/overwatch.dlc.update.skull.code.the.latest.clue.for.sombra.investigation/93197.htm Christian Today - 'Overwatch' DLC update: Skull Code the latest clue for Sombra investigation]<br />
<br />
[EN] [https://en.yibada.com/articles/151811/20160816/overwatch-dlc-update.htm Yibada - 'Overwatch' DLC update: New clues on Sombra's inclusion to the roster revealed]<br />
<br />
'''23rd Aug. 2016'''<br />
<br />
[EN] [https://www.technewstoday.com/31129-overwatch-all-we-know-about-the-sombra-arg/ Tech News Today - Overwatch: All We Know About the Sombra ARG]<br />
<br />
'''24th Aug. 2016'''<br />
<br />
[EN] [https://gamerant.com/overwatch-forums-sombra-message/ Gamerant - Overwatch Forums Glitch Out, Reveals Hidden Message From Sombra]<br />
<br />
[EN] [https://gamerant.com/overwatch-sombra-clue-website/ Gamerant - New Website Counts Down To Next Clue For Overwatch’s Sombra]<br />
<br />
[EN] [https://www.polygon.com/2016/8/24/12623736/overwatch-sombra-arg-clues-skycoder Polygon - Overwatch's Sombra mystery appears to be coming to a close]<br />
<br />
[EN] [https://www.vg247.com/2016/08/24/overwatch-forums-glitch-out-reveal-a-message-from-the-mysterious-sombra/ VG247 - Overwatch forums glitch out, reveal a message from the mysterious Sombra]<br />
<br />
[EN] [https://www.technewstoday.com/31151-sombra-hacks-into-overwatch-forums/ Tech News Today - Sombra Hacks Into Overwatch Forums]<br />
<br />
[EN] [https://www.ign.com/articles/2016/08/24/overwatch-mystery-character-sombra-could-be-revealed-today IGN - Overwatch Mystery Character Sombra Could Be Revealed Today]<br />
<br />
'''25th Aug. 2016'''<br />
<br />
[EN] [https://kotaku.com/overwatch-players-are-getting-fed-up-with-the-sombra-ar-1785765307 Kotaku - Overwatch Players Are Getting Sick Of The Sombra ARG]<br />
<br />
[EN] [https://www.ign.com/articles/2016/08/25/overwatch-made-the-internet-lose-its-mind-last-night-and-i-had-a-front-row-seat IGN - Overwatch Made the Internet Lose its Mind Last Night, And I Had a Front-Row Seat]<br />
<br />
[EN] [https://www.technewstoday.com/31182-overwatch-countdown-to-sombra/ Tech News Today - Overwatch: Countdown to Sombra]<br />
<br />
<br />
'''30th Aug. 2016'''<br />
<br />
[EN] [https://www.pcgamer.com/overwatch-sombra-arg-mystery/ PC Gamer - Overwatch's Sombra riddle begins to irritate the players trying to solve it]<br />
<br />
'''3rd Oct. 2016'''<br />
<br />
[EN] [https://www.mobilenapps.com/articles/19398/20161003/overwatch-update-sombra-blizzcon-halloween-event-leak.htm Mobile & Apps - Sombra To Be Revealed At Blizzcon? Halloween Event Confirmed In Data Leak]<br />
<br />
'''4th Oct. 2016'''<br />
<br />
[EN] [https://www.itechpost.com/articles/36011/20161004/overwatch-overwatch-update-overwatch-finally-getting-sombra-overwatch-sombra-sombra.htm iTechPost - Overwatch Update: Are We Finally Getting Sombra?]<br />
<br />
'''11th Oct. 2016'''<br />
<br />
[EN] [https://www.kotaku.com.au/2016/10/overwatch-fans-hacked-actual-people-in-an-attempt-to-find-sombra/ Kotaku - Overwatch Fans Hacked Actual People In An Attempt To Find Sombra]<br />
<br />
'''17th Oct. 2016'''<br />
<br />
[EN] [https://telkomgaming.co.za/will-sombra-hack-her-way-into-blizzcon-2016/ TelKom Gaming - Will Sombra Hack Her Way Into BlizzCon 2016?]<br />
<br />
'''18th Oct. 2016'''<br />
<br />
[EN] [https://overwatchtips.info/overwatch-sombra-arg-everything-you-need-to-know/ OverwatchTips - Everything You NEED To Know (Sombra ARG)]<br />
<br />
'''26th Oct. 2016'''<br />
<br />
[EN] [https://mic.com/articles/157757/overwatch-sombra-arg-everything-we-know-about-the-countdown-and-rumored-nov-1-release#.UILrZHRiM Min Network - Everything we know about Blizzard's rumored Nov. 1 release]<br />
<br />
'''28th Oct. 2016'''<br />
<br />
[EN] [https://kotaku.com/imagining-horror-stories-for-a-never-ending-overwatch-a-1788324673 Kotaku - Imagining Horror Stories Of A Never-Ending Overwatch ARG]<br />
<br />
'''1st Nov. 2016'''<br />
<br />
[EN] [https://www.ign.com/videos/2016/11/01/will-overwatchs-sombra-be-at-blizzcon-2016 IGN - Will Sombra be at BlizzCon 2016?]<br />
<br />
'''8th Nov. 2016'''<br />
<br />
[EN] [https://mic.com/articles/158812/overwatch-sombra-arg-gameplay-emote-directly-references-one-of-the-wildest-fan-theories Mic Tech - 'Overwatch' Sombra ARG: Gameplay emote directly references one of the wildest fan theories]</div>Halke234https://wiki.gamedetectives.net/index.php?title=Sombra_ARG&diff=16624Sombra ARG2018-07-24T23:02:54Z<p>Halke234: /* The Terminal */</p>
<hr />
<div>{{argbox<br />
| float = right<br />
| name = Sombra ARG<br />
| image = File:Sombra_skull.png<br />
| description= The Sombra ARG - an ARG involving an unreleased Overwatch hero.<br />
| creator = [https://www.blizzard.com/ Blizzard Entertainment]<br />
| type = Official<br />
| status = Completed<br />
| discovered = 2016-06-12<br />
| completed = 2016-11-04<br />
}}<br />
<br />
{{ArgHeader|arg=Sombra ARG}}<br />
The Sombra ARG was an ARG for the first-person shooter [https://www.playoverwatch.com Overwatch], developed by [https://www.blizzard.com/ Blizzard Entertainment]. Sombra was the name of a then-unreleased Overwatch hero. The ARG was comprised of clues and ciphers referencing Sombra, which were found in various developer updates and short animations.<br />
<br />
At the game's release, there were numerous pieces of in-game information that appeared in the map Dorado, hinting at a character called Sombra. When the hero Ana was revealed, more Sombra clues appeared in Ana's origin video. In the weeks that followed, more clues were discovered, which led up to a character reveal animation at BlizzCon 2016.<br />
<br />
== Ana Videos ==<br />
<br />
=== Ana Origin Video ===<br />
<br />
On July 12, 2016, a [https://www.youtube.com/watch?v=TE0CXgpNxG0 video] for the new Overwatch hero named Ana was released. At the 1:16 mark, players discovered a set of hexidecmial values:<br />
<br />
[[File:Ana_Hex2.png|400px]]<br />
<br />
<pre><br />
2E 2E 2E 7B 76 20 66 62 72 20 63 7E 72 79 72 20 7B 76 20 7E<br />
79 71 78 65 7A 76 74 7E D4 A4 79 2C 20 63 7E 72 79 72 20 72<br />
7B 20 67 78 73 72 65 2E 2E 2E 7B 76 20 66 62 72 20 63 7E 72<br />
79 72 20 7B 76 20 7E 79 71 78 65 7A 76 74 7E D4 A4 79 2C 20<br />
63 7E 72 79 72 20 72 7B 20 67 78 73 72 65 2E 2E 2E 7B 76 20<br />
66 62 72 20 63 7E 72 79 72 20 7B 76 20 7E 79 71 78 65 7A 76<br />
74 7E D4 A4 79 2C 20 63 7E 72 79 72 20 72 7B 20 67 78 73 72<br />
65 2E 2E 2E 7B 76 20 66 62 72 20 63 7E 72 79 72 20 7B 76 20<br />
7E 79 71 78 65 7A 76 74 7E D4 A4 79 2C 20 63 7E 72 79 72 20<br />
72 7B 20 67 78 73 72 65 2E 2E 2E 64 78 7A 75<br />
</pre><br />
<br />
A hex to ASCII translation yielded the following:<br />
<br />
<pre><br />
...{v fbr c~ryr {v ~yqxezvt~Ô¤y, c~ryr r{ gxsre...{v fbr c~ryr {v ~yqxezvt~Ô¤y, c~ryr r{ gxsre...{v fbr c~ryr {v ~yqxezvt~Ô¤y, c~ryr r{ gxsre...{v fbr <br />
c~ryr {v ~yqxezvt~Ô¤y, c~ryr r{ gxsre...dxzu<br />
</pre><br />
<br />
Using an XOR Cipher with the constant 23 on the above text resulted in the following message:<br />
<br />
<pre><br />
..la que tiene la información; tiene el poder...la que tiene la información; tiene el poder...la que tiene la información; tiene el poder...la que tiene la <br />
información; tiene el poder...somb<br />
</pre><br />
<br />
This was a repeating phrase in Spanish, which translated to:<br />
<br />
<pre><br />
She who has the information, has the power...<br />
</pre><br />
<br />
Players then discovered a second set of hexidecimal values at the 2:11 mark:<br />
<br />
[[File:Ana Hex.png|400px]]<br />
<br />
<pre><br />
65 76 2E 2E 2E 7B 76 20 66 62 72 20 63 7E 72 79 72 20 7B 76<br />
20 7E 79 71 78 65 7A 76 74 7E D4 A4 79 2C 20 63 7E 72 79 72<br />
20 72 7B 20 67 78 73 72 65 2E 2E 2E 7B 76 20 66 62 72 20 63<br />
7E 72 79 72 20 7B 76 20 7E 79 71 78 65 7A 76 74 7E D4 A4 79<br />
2C 20 63 7E 72 79 72 20 72 7B 20 67 78 73 72 65 2E 2E 2E 7B<br />
76 20 66 62 72 20 63 7E 72 79 72 20 7B 76 20 7E 79 71 78 65<br />
7A 76 74 7E D4 A4 79 2C 20 63 7E 72 79 72 20 72 7B 20 67 78<br />
73 72 65 2E 2E 2E 7B 76 20 66 62 72 20 63 7E 72 79 72 20 7B<br />
76 20 7E 79 71 78 65 7A 76 74 7E D4 A4 79 2C 20 63 7E 72 79<br />
72 20 72 7B 20 67 78 73 72 65 2E 2E 2E<br />
</pre><br />
<br />
When put through the same process, the same string of Spanish was revealed, but with the letters <code>ra</code> at the beginning of the message. These letters were combined with <code>somb</code> from the first cipher to create the name <code>sombra</code>. No more clues were discovered until the release of the Dev Update video.<br />
<br />
=== Dev Update Video ===<br />
<br />
[[File:Sombra Barcodes.png|thumbnail|right|The vertical barcodes found at the end of the Ana Dev Update video]]<br />
<br />
On July 19, 2016, the first [https://www.youtube.com/watch?v=evghkilg2eQ Developer Update] was released for Ana. At the end of the video, players discovered a series of vertical barcodes. When scanned, players discovered a large set of hexidecimal values which where then converted to binary, a dump of which is available [https://gist.github.com/zapu/31165efab0d6264e2fd0fa75cc53b1aa here].<br />
<br />
Turning the ones and zeroes into black and white pixels formed a QR code:<br />
<br />
[[File:Sombra_QR_code.png|300px]]<br />
<br />
Scanning this QR code yielded the following message: <code>¿Estuvo eso facilito? Ahora que tengo su atención, déjenme se las pongo más difícil.</code> In English, the message reads: <code>Was that easy? Well, now that I have your attention, allow me to make things much more difficult.</code> After this, no more clues were discovered until the Summer Games video was released.<br />
<br />
== Welcome to the Summer Games Video ==<br />
<br />
=== Tracer Trail Cipher ===<br />
<br />
[[File:Base64_trail.jpg|thumbnail|right|The unsolved base64 cipher in the Summer Games video]]<br />
<br />
'''Note: The cipher described below remains unsolved.'''<br />
<br />
On August 2, 2016, players discovered another cipher in the [https://www.youtube.com/watch?v=qpcOD9tJM4k Welcome to the Summer Games trailer]:<br />
<br />
<pre><br />
U2FsdGVkX1+vupppZksvRf5pq5g5XjFRIipRkwB0K1Y96Qsv2L<br />
m+31cmzaAILwytX/z66ZVWEQM/ccf1g+9m5Ubu1+sit+A9cenD<br />
xxqkIaxbm4cMeh2oKhqIHhdaBKOi6XX2XDWpa6+P5o9MQw==<br />
</pre><br />
<br />
Players discovered this text to be base64 encryption. When decrypted, players received the following output:<br />
<br />
<pre><br />
Salted__���ifK/E�i��9^1Q�*Q�t+V=�<br />
/ع��W/<br />
�_����V��?q����f�F���"��=q�������[��<br />
z��*����Z����u�\5�k�C<br />
</pre><br />
<br />
''(Note: copy/pasting this string will not work; some of the characters are not printable and are not even displayed correctly on this page)''<br />
<br />
==== Decrypting the Cipher ====<br />
<br />
The "Salted__" header at the start of the string indicated to players that the remainder of the text was encrypted with the OpenSSL software library, which requires a password and the encryption cipher that was used. Salt is added by OpenSSL to ensure uniqueness of the key and the IV derived from the password and used for the encryption. However, due to the age of OpenSSL and its massive library, it was proven to be quite difficult for players to identify the encryption used.<br />
<br />
==== Narrowing Down Ciphers ====<br />
<br />
[[File:HexOfEncryptedMessage.png|thumbnail|right|Hex view of the encrypted string]]<br />
<br />
Players narrowed down the potential ciphers used by examining a hex dump of the encrypted string. There are two major types of ciphers, stream ciphers and block ciphers. Stream ciphers encrypt only the data fed into them, whereas block ciphers always encrypt a certain number of bytes at a time (a "chunk").<br />
<br />
A byte is roughly a single character, but special characters can take up multiple bytes. We know that OpenSSL Salted Encryption uses the first 8 bytes of the output for <code>Salted__</code> and the next 8 bytes for the actual salt. The rest of the information is the '''encrypted message'''.<br />
<br />
The immediately interesting thing here is that the '''encrypted message''' data stops 3 bytes short of a full chunk. This is a excellent indicator that the cipher used is a stream cipher (or a block cipher in CTR/OFB/CFB mode). This narrows the list of potential ciphers down significantly. This also means that the final string that Blizzard encrypted is less than 93 bytes!<br />
<br />
'''This cipher remains unsolved, but it's speculated that Blizzard moved past the cipher by creating alternate puzzles.'''<br />
<br />
=== Directions & Letters ===<br />
<br />
Players discovered that in the North American version of the Summer Games trailer there were repeated references to the cardinal directions, each associated with a particular hero. These references were conspicuously absent from other versions of the trailer. These references are shown below, with the relevant heroes and timestamps:<br />
<br />
<gallery mode="packed"><br />
File:Ow1.png|East - Mercy - Route 66 - 0:17<br />
File:Ow2.png|Center - D. Va - Temple of Anubis - 0:19<br />
File:Ow3.png|North - Torbjorn - Nepal - 0:21<br />
File:Ow4.png|South - Genji - Hanamura - 0:22<br />
File:Ow5.png|Southeast - McCree - Hollywood - 0:24<br />
File:Ow6.png|West - Symmetra - Watchpoint: Gibraltar - 0:30<br />
File:Ow7.png|Southwest - Bastion - Hollywood - 0:34<br />
File:Ow8.png|Northeast - Winston - Volskaya Industries - 0:46<br />
File:Ow9.png|Northwest - Tracer - King's Row - 0:47<br />
</gallery><br />
<br />
Screenshots of all the directions and their respective heroes can be found in an album [https://imgur.com/a/FQXmy here].<br />
<br />
[[File:Overwatch map.jpg|frameless]]<br />
<br />
These heroes, arranged in this particular order, provided a password that was used later in the ARG.<br />
<br />
== Dorado Photo ==<br />
<br />
At an unknown date, a new, "corrupted" photo of the [https://blzgdapipro-a.akamaihd.net/media/screenshot/dorado-screenshot-004.jpg Dorado attackers spawn point] was added to the Overwatch [https://playoverwatch.com/en-us/media/ media page]. Players discovered that the screenshot was "'''datamoshed'''", which means it concealed a hidden message while also taking on a distorted appearance. ([https://prntscr.com/c3dce7 Here] is an example of purposely data moshing the image manually to achieve similar effects.) <br />
<br />
<gallery mode="packed" heights=500px><br />
File:dorado-datamosh.jpg|The datamoshed image<br />
File:dorado-screenshot-005.jpg|The original image<br />
</gallery><br />
<br />
After comparing the images with difference checking tools, players found that certain English and Spanish characters were replaced with exclamation points. The missing characters produced the following Spanish phrase:<br />
<br />
<code>Por que estan mirando al cielo? La respuesta no esta sobre sus cabezas, esta detras de ustedes. A veces, necesitan analizar sus logros previos.</code><br />
<br />
Translated into English, this phrase read:<br />
<br />
<code>Why are you looking at the sky? The answer isn't over your heads, it's behind you. Sometimes, you need to analyze your previous achievements.</code><br />
<br />
The phrase "Why are you looking at the sky?" was most likely a reference to a strange artifact that was discovered in the sky of the Dorado map, dubbed the "Skycode". The Skycode ended up being a red herring, and was completely unrelated to the ARG.<br />
<br />
=== Analyzing Achievements ===<br />
<br />
[[File:achievements.png|thumbnail|right|"¿" Achievement, comment in source code]]<br />
<br />
The phrase "you need to analyze your previous achievements" led players to look at the achievements on the [https://www.playoverwatch.com Overwatch] website. It was noticed noticed that by logging in and viewing the achievements on a player profile, a mystery achievement appeared. Examining a hex dump of the image lead players to a new phrase:<br />
<br />
<pre><br />
Vientos, nada mal. No obstante, me aburro. Intentemos algo nuevo en la misma dirección.<br />
uczihriwgsxorxwunaarawryqhbrsfmeqrjjmu 5552E494 78T3 4VM9 OPL6 IS8208O913KRlrx<br />
</pre><br />
<br />
Translated, it said:<br />
<br />
<pre><br />
Damn, not bad. However, I'm getting bored. Let's try something new in the same direction.<br />
uczihriwgsxorxwunaarawryqhbrsfmeqrjjmu 5552E494 78T3 4VM9 OPL6 IS8208O913KRlrx<br />
</pre><br />
<br />
== Volskaya Datamosh ==<br />
<br />
After a long period of toying around, players discovered that the ciphertext <code> uczihriwgsxorxwunaarawryqhbrsfmeqrjjmu 5552E494 78T3 4VM9 OPL6 IS8208O913KRlrx</code> from the "?" achievement was a Vigenére cipher. Players discovered the key <code>tracertorbjornwinstonsymmetradvamercybastiongenjimccree</code> by ordering the heroes in the Summer Games trailer by the cardinal directions associated with each of them, as said further above. Once decoded, players received the following text: <br />
<pre>blzgdapiproaakamaihdnetmediascreenshot 5552E494 78B3 4CE9 ACF6 EF8208F913CFjpg</pre><br />
<br />
Players found this to be a [https://blzgdapipro-a.akamaihd.net/media/screenshot/5552E494-78B3-4CE9-ACF6-EF8208F913CF.jpg blzgdapipro-a.akamaihd.net/media/screenshot/5552E494-78B3-4CE9-ACF6-EF8208F913CF.jpg URL], which led players to a datamoshed screenshot of the Volskaya Industries map. ''(Editor's note: This link appears to now be dead)''. When players ran a difference check with the [https://blzgdapipro-a.akamaihd.net/media/screenshot/volskaya-screenshot-004.jpg original image], they received an interesting message.<br />
<br />
<gallery mode="packed"><br />
File:volskaya-datamosh.jpg|The datamoshed image<br />
File:Volskaya-screenshot-004.jpg|The original image<br />
</gallery><br />
<br />
=== ASCII Skull #1 ===<br />
<br />
The diff from the datamoshed image resulted in the following output:<br />
<br />
<pre><br />
Parece que te gustan estos jueguitos... por que no jugamos uno de verdad?<br />
:PB@Bk:<br />
,jB@@B@B@B@BBL.<br />
7G@B@B@BMMMMMB@B@B@Nr<br />
:kB@B@@@MMOMOMOMOMMMM@B@B@B1,<br />
:5@B@B@B@BBMMOMOMOMOMOMOMM@@@B@B@BBu.<br />
70@@@B@B@B@BXBBOMOMOMOMOMOMMBMPB@B@B@B@B@Nr<br />
G@@@BJ iB@B@@ OBMOMOMOMOMOMOM@2 B@B@B. EB@B@S<br />
@@BM@GJBU. iSuB@OMOMOMOMOMOMM@OU1: .kBLM@M@B@<br />
B@MMB@B 7@BBMMOMOMOMOMOBB@: B@BMM@B<br />
@@@B@B 7@@@MMOMOMOMM@B@: @@B@B@<br />
@@OLB. BNB@MMOMOMM@BEB rBjM@B<br />
@@ @ M OBOMOMM@q M .@ @@<br />
@@OvB B:u@MMOMOMMBJiB .BvM@B<br />
@B@B@J 0@B@MMOMOMOMB@B@u q@@@B@<br />
B@MBB@v G@@BMMMMMMMMMMMBB@5 F@BMM@B<br />
@BBM@BPNi LMEB@OMMMM@B@MMOMM@BZM7 rEqB@MBB@<br />
B@@@BM B@B@B qBMOMB@B@B@BMOMBL B@B@B @B@B@M<br />
J@@@@PB@B@B@B7G@OMBB. ,@MMM@qLB@B@@@BqB@BBv<br />
iGB@,i0@M@B@MMO@E : M@OMM@@@B@Pii@@N:<br />
. B@M@B@MMM@B@B@B@MMM@@@M@B<br />
@B@B.i@MBB@B@B@@BM@::B@B@<br />
B@@@ .B@B.:@B@ :B@B @B@O<br />
:0 r@B@ B@@ .@B@: P:<br />
vMB :@B@ :BO7<br />
,B@B<br />
</pre><br />
<br />
'''Translation:'''<br />
<br />
<pre><br />
"It seems you like these little games... Why don't we play a real one?"<br />
</pre><br />
<br />
(''This is the python2 script to extract modified bytes from datamoshed Volskaya screenshot: https://gist.github.com/synap5e/27635d2ff6f0e3b15f0c902dca2974a9'')<br />
<br />
No further progress was made until August 23, 2016.<br />
<br />
== Overwatch Forums Glitching Page/ "Skycoder" ==<br />
<br />
On August 23rd, 2016, at an unknown time, an [https://us.battle.net/forums/en/overwatch/topic/20748794686 ominous post] by a user named "Skycoder" appeared on the official General Discussion forums for Overwatch. <br />
<br />
Players found that the name of the post, <code>00110010 00110011</code>, was binary for "23," which was a direct reference to Sombra being the 23rd hero in Overwatch. The age of the post started at 24 hours, and counted down rather than increasing. The post itself contained a single sentence in Spanish:<br />
<br />
<pre><br />
la que tiene la información; tiene el poder<br />
</pre><br />
<br />
Which, when translated to english, reads:<br />
<br />
<pre><br />
She who has the information, has the power.<br />
</pre><br />
<br />
After a short while, the post glitched and distorted, gradually turning a hue of purple. A text box then appeared, which printed the following ciphertext:<br />
<br />
<pre><br />
ICAgICAgICAgICAgICAgICAgICAgICAgICA6UEKPQms6CiAgICAgICAg<br />
ICAgICAgICAgICAgICAsakKIQEJAQkBCQEJCTC4KICAgICAgICAgICAg<br />
ICAgICAgIDdHlkKTQpVCTU1NTU1CQEJAQkBOcgogICAgICAgICAgICAg<br />
ICA6a0KSQpCIl01NT01PTU9NT01NTU2MQphCQEIxLAogICAgICAgICAg<br />
IDo1kUKNQphCiEJCTU1PTU9NT01PTU9NT01NipJuQm5CQEJCdS4KICAg<br />
ICAgICA3MG6GlUKIQpJClEJYQkJPTU9NT01PTU9NT01NQk1QQphCiEJA<br />
QkBCQE5yCiAgICAgIEeYlpdCSiBpQohCh4ggIE9CTU9NT01PTU9NT01P<br />
TZYyICBCj0JAQi4gRUJAQkBTCiAgICAgIJKWQk2HR0pCVS4gIGlTdUKI<br />
T01PTU9NT01PTU9NTZdPVTE6ICAua0JMTYhNhkKXCiAgICAgIEKMTU1C<br />
mUIgICAgICAgN4hCQk1NT01PTU9NT01PQkKWOiAgICAgICBCh0JNTYhC<br />
CiAgICAgII2YiEKKQiAgICAgICAgIDeSlkBNTU9NT01PTU1AQkA6ICAg<br />
ICAgICAgQEBCQEJACiAgICAgII+ST0xCLiAgICAgICAgICBCTkKPTU1P<br />
TU9NTY9CRUIgICAgICAgICAgckJqTYRCCiAgICAgIJBAICBAICAgICAg<br />
ICAgICBNICBPQk9NT01NQHEgIE0gICAgICAgICAgLkAgIEBACiAgICAg<br />
IISVT3ZCICAgICAgICAgICBCOnWMTU1PTU9NTUJKaUIgICAgICAgICAg<br />
LkJ2TUBCCiAgICAgIIRCkUKYSiAgICAgICAgIDCRQpdNTU9NT01PTUKV<br />
QkB1ICAgICAgICAgcUBAQEJACiAgICAgIEKETUJCjHYgICAgICAgR4+L<br />
Qk1NTU1NTU1NTU1NQkKINSAgICAgICBGhEJNTUBCCiAgICAgIIdCQk1/<br />
QlBOaSAgIExNRUKFT01NTU2PQoNNTU9NTYpCWk03ICAgckVxQodNQkKE<br />
CiAgICAgIEKYloRCTSAgQm1ChEIgIHFCTU9NQpBChUKEQk1PTUJMICBC<br />
QEJAQiAgQEJAQkBNCiAgICAgICBKlm2GhFBCj0KEQplCN0eIT01CQi4g<br />
ICAsQE1NTUBxTEJAQkBAQEJxQkBCQnYKICAgICAgICAgIGlHQpUsaTCE<br />
TZZCbk1NT4tFICA6ICBNQE9NTUBAQEJAUGlpQEBOOgogICAgICAgICAg<br />
ICAgLiAgIEKXTZBCj01NTUBCQEJAQkBNTU1AQEBNQEIKICAgICAgICAg<br />
ICAgICAgICBAQkBCLmlATUJCQEJAQkBAQk1AOjpCQEJACiAgICAgICAg<br />
ICAgICAgICAgQkBAQCAuQkBCLjpAQkAgOkJAQiAgQEJATwogICAgICAg<br />
ICAgICAgICAgICAgOjAgckBCQCAgQkBAIC5AQkA6IFA6CiAgICAgICAg<br />
ICAgICAgICAgICAgICAgdk1CIDpAQkAgOkJPNwogICAgICAgICAgICAg<br />
ICAgICAgICAgICAgICAsQkBCCg==<br />
</pre><br />
<br />
=== ASCII Skull #2 ===<br />
<br />
Players discovered that this was Base64 and, once decrypted, resulted in another ASCII skull:<br />
<br />
<pre><br />
:PB.Bk: <br />
,jBˆ@B@B@B@BBL. <br />
7G–B“B•BMMMMMB@B@B@Nr <br />
:kB’B.ˆ—MMOMOMOMOMMMMŒB˜B@B1, <br />
:5‘B.B˜BˆBBMMOMOMOMOMOMOMMŠ’nBnB@BBu. <br />
70n†•BˆB’B”BXBBOMOMOMOMOMOMMBMPB˜BˆB@B@B@Nr <br />
G˜–—BJ iBˆB‡ˆ OBMOMOMOMOMOMOM–2 B.B@B. EB@B@S <br />
’–BM‡GJBU. iSuBˆOMOMOMOMOMOMM—OU1: .kBLMˆM†B— <br />
BŒMMB™B 7ˆBBMMOMOMOMOMOBB–: B‡BMMˆB <br />
.˜ˆBŠB 7’–@MMOMOMOMM@B@: @@B@B@ <br />
.’OLB. BNB.MMOMOMM.BEB rBjM„B <br />
.@ @ M OBOMOMM@q M .@ @@ <br />
„•OvB B:uŒMMOMOMMBJiB .BvM@B <br />
„B‘B˜J 0‘B—MMOMOMOMB•B@u q@@@B@ <br />
B„MBBŒv G.‹BMMMMMMMMMMMBBˆ5 F„BMM@B <br />
‡BBM.BPNi LMEB…OMMMM.BƒMMOMMŠBZM7 rEqB‡MBB„ <br />
B˜–„BM BmB„B qBMOMB.B…B„BMOMBL B@B@B @B@B@M <br />
J–m†„PB.B„B™B7GˆOMBB. ,@MMM@qLB@B@@@BqB@BBv <br />
iGB•,i0„M–BnMMO‹E : M@OMM@@@B@Pii@@N: <br />
. B—M.B.MMM@B@B@B@MMM@@@M@B <br />
@B@B.i@MBB@B@B@@BM@::B@B@ <br />
B@@@ .B@B.:@B@ :B@B @B@O <br />
:0 r@B@ B@@ .@B@: P: <br />
vMB :@B@ :BO7 <br />
,B@B <br />
</pre><br />
<br />
Players discovered that, once both skulls had been stripped of spaces, the bytes of each skull that aren't equal to 0 could be subtracted using [https://pastebin.com/g3kA1Pif a script]. Once compiled, players received the following string:<br />
<br />
<pre><br />
OHVSURPHWLXQMXHJR...FUHRTXHXVWHGHVORVGHWHFWLYHVGHMXHJRVOROODPDULDQXQWUDLOKHDG?EOCJGDXVD-DPEDV-FDODYHUDV.KWPO<br />
</pre><br />
<br />
Players discovered that this was a caesar cipher. After shifting the string forward 23 places, it resulted in:<br />
<br />
<pre><br />
LESPROMETIUNJUEGO...CREOQUEUSTEDESLOSDETECTIVESDEJUEGOSLOLLAMARIANUNTRAILHEAD?BLZGDAUSA-AMBAS-CALAVERAS.HTML<br />
</pre><br />
<br />
When cleaned up, the message read:<br />
<br />
<pre><br />
Les prometi un juego...creo que ustedes los Detectives de Juegos lo llamarían un trailhead? BLZGDUSA-AMBAS-CALAVERAS.HTML<br />
</pre><br />
<br />
When translated from Spanish to English:<br />
<br />
<pre><br />
I promised you a game...I believe you Game Detectives would call it a trailhead? BLZGDAUSA-AMBAS-CALAVERAS.HTML<br />
</pre><br />
<br />
<code>USA-AMBAS-CALAVERAS</code> translated to <code>USE-BOTH-SKULLS</code>, and the <code>.HTML</code> extension hinted at a URL.<br />
<br />
=== Skull Video ===<br />
<br />
BLZGDA refers to the servers that Blizzard uses to host media on their website. As such, this led players to [ https://blzgdapipro-a.akamaihd.net/media/screenshot/usa-ambas-calaveras.html this page], which contains a video of a vitals screen depicting a skull and some other medical information. In addition, it also contained a graphic of one of the ASCII skulls. An Imgur mirror can be found [https://i.imgur.com/6Pk69LX.png here].<br />
<br />
Within the properties of the video, players found another comment in Spanish:<br />
<br />
<pre><br />
Parecen estar muy interesados en estos "héroes". ¿Tal vez les interese conocer algunos detallitos que he averiguado sobre ellos?<br />
</pre><br />
<br />
In English:<br />
<br />
<pre><br />
You seem to be very interested in these "heroes". Maybe interested to know some details that I found out about them?<br />
</pre><br />
<br />
In addition, the video contains a heartbeat monitor, and a series of 26 lines above it. When players assigned the letters of the alphabet to the 26 lines, and used the "pings" of the heartbeat to determine what letters to use, the following string was found:<br />
<br />
<pre><br />
momentincrime<br />
</pre><br />
<br />
=== amomentincrime E-mail ===<br />
<br />
'momentincrime' appeared to refer to the in-universe TV show "A Moment in Crime," which can be seen in the Roadhog and Junkrat [https://www.youtube.com/watch?v=l5kTATxt7bE video] that came out months before the release of Overwatch. However, players also discovered a website, [https://amomentincrime.com amomentincrime.com], and displayed the following text:<br />
<br />
<pre><br />
...Estableciendo conexión...<br />
...Protocolo Sombra v1.3 iniciado...<br />
<br />
...Infiltrando la respuesta automática del email de pistas...<br />
<br />
...Terminando conexión...<br />
</pre><br />
<br />
Players discovered that sending an e-mail to tips@amomentincrime.com resulted in an automated email response:<br />
<br />
<pre><br />
Thank you for contacting A Moment in Crime's anonymous crime line!<br />
<br />
We have analyzed your submission and forwarded the information to the relevant parties. Your help could be vital in apprehending these cri<br />
<br />
...Estableciendo conexión...<br />
...Protocolo Sombra v1.7 iniciado...<br />
<br />
<br />
01:07:47 02:02:02 01:08:06 02:13:43 01:18:32<br />
01:18:21 02:10:19 01:06:21 02:05:18 01:04:02<br />
01:07:08 02:18:25 01:13:04 02:19:20 01:23:02<br />
01:16:40 02:16:35 01:23:04 02:17:16 01:06:42<br />
01:13:29 02:18:06 01:05:02 02:15:41 01:08:34<br />
<br />
j.7F57O,NLv:qj.7B:,1qv@B1j5ivB:,<br />
<br />
...Terminando conexión...<br />
<br />
minals and bringing them to justice. These fugitives are responsible for a string of robberies, arson, and other crimes stretching from Sydney to King's Row.<br />
<br />
Authorities believe that they have set their sights on crossing the Atlantic to America.<br />
</pre><br />
<br />
Players discovered that, if the sets of numbers were taken as AA:BB:CC, where AA was the number of skull (in order of discovery), BB was the row and CC was the column (as seen [https://i.imgur.com/ZgN2MVQ.png here]), and organized into a 5x5 matrix, it would result in:<br />
<br />
<pre><br />
S j G B L <br />
. @ M O k <br />
i , v : 0 <br />
E 7 r q N <br />
J P 5 F 1<br />
</pre><br />
<br />
Players discovered that this Matrix could be used as a bifid key to decode the text underneath the table of numbers in the email, as shown below:<br />
<pre><br />
j . 7 F 5 7 O , N L v : q j . 7 B : , 1 q v @ B 1 j 5 i v B : ,<br />
12 21 42 54 53 42 24 32 45 15 33 34 44 12 21 42 14 34 32 55 44 33 22 14 55 12 53 31 33 14 34 32<br />
<br />
1 2 2 1 4 2 5 4 5 3 4 2 2 4 3 2 4 5 1 5 3 3 3 4 4 4 1 2 2 1 4 2<br />
1 4 3 4 3 2 5 5 4 4 3 3 2 2 1 4 5 5 1 2 5 3 3 1 3 3 1 4 3 4 3 2<br />
<br />
11 24 23 14 43 22 55 45 54 34 43 23 22 42 31 24 45 55 11 52 35 33 33 41 43 43 11 24 23 14 43 22<br />
</pre><br />
<br />
This gave players the following string:<br />
<br />
SOMBr@1NF:rM@7iON1SP0vvErrSOMBr@<br />
This phrase was found to be leet-speak, and was translated to:<br />
<br />
<pre><br />
Sombra Information is power Sombra<br />
</pre><br />
<br />
The string <code>SOMBr@1NF:rM@7iON1SP0vvErrSOMBr@</code> was used as a password later on in the ARG.<br />
<br />
== A Moment in Crime Transmission ==<br />
<br />
[[File:Momentincrime.png|thumbnail|right|amomentincrime.com as of August 24th, 2016]]<br />
<br />
Once the 23-hour countdown on the Skycoder forum post reached zero, [https://amomentincrime.com amomentincrime.com] was updated. It now read:<br />
<br />
<pre><br />
...Estableciendo conexión...<br />
...Protocolo Sombra v1.9 iniciado...<br />
<br />
...Transmitiendo información a ómnicos activos... 2%<br />
<br />
...Terminando conexión...<br />
</pre><br />
<br />
Translated from Spanish to English:<br />
<br />
<pre><br />
...Establishing connection...<br />
...Sombra Protocol v1.9 initiated...<br />
...Transmitting information to active omnics... 2%<br />
<br />
...Ending connection...<br />
</pre><br />
<br />
A comment was also added to the source code:<br />
<br />
<pre><br />
Bien hecho, ya tienen mi clave. Hackear este programa de televisión no tuvo chiste. Espérense a lo que sigue.<br />
</pre><br />
<br />
When translated:<br />
<br />
<pre><br />
Well done, you have my password. Hacking this television program was meaningless. Wait for what is coming.<br />
</pre><br />
<br />
The percent on the amomentincrime.com slowly increased over time. Once the 5% milestone was hit, the Sombra Protocol version number changed to to v1.95. Afterwards, the percentage increased by 0.0038% every 3 minutes in real time.<br />
<br />
In addition, another comment was added:<br />
<br />
<pre><br />
Parece que se están calentando un poco las cosas... tendré que pasar desapercibida mientras esto se finaliza.<br />
</pre><br />
<br />
Translated:<br />
<br />
<pre><br />
It seems things are heating up a bit... I'll have to go unnoticed while this is finishing.<br />
</pre><br />
<br />
On 18th October at 19:02 GMT the site reached 100%, and the site updated with the following message:<br />
<br />
<pre><br />
...Transmisión finalizada - finalizando carga... <br />
...Carga finalizada. Unidad Bastion E-54 comprometida...<br />
</pre><br />
<br />
Which roughly translates to:<br />
<br />
<pre><br />
...Transmission complete - finishing upload...<br />
...Upload finished. Unit Bastion E-54 engaged...<br />
</pre><br />
<br />
Hidden in the source code of the site was the text <code>v1.4.0.2.324??</code>. Players then correctly assumed that this referred to a future build of Overwatch itself.<br />
<br />
== Sombra vs. LumériCo ==<br />
<br />
=== The Hacked Bastion ===<br />
<br />
On October 19, 2016, a new Overwatch version was released - version 1.4.0.2.32448. Shortly afterwards, the version number in the source code of the amomentincrime site updated to the same version number. After the build launched, players discovered that the hero Bastion had a strange interaction when near the "SOMBRA PROTOCOL" monitors on Dorado, and would emit a message in morse code, which can be heard [https://www.youtube.com/watch?v=Hkd__ceYm-Y here]. When the morse was decoded, players received the following string:<br />
<pre><br />
SQOFJFBNITIZWGDXSDO<br />
</pre><br />
<br />
Players discovered that this was a Vigenere cipher, and the key consisted of the alphabetic characters from the<br />
<code>SOMBr@1NF:rM@7iON1SP0vvErrSOMBr@</code> string, it was decoded to read:<br />
<br />
<pre><br />
ACCESSWWWLUMERICOMX<br />
</pre><br />
<br />
This led players to the [https://lumerico.mx/ LumeriCo website]. ''(Editor's note: as of 2018, this site appears to be inactive.)''<br />
<br />
=== LuméReaction ===<br />
<br />
[[File:Lumerico.png|thumbnail|right|The homepage of https://lumerico.mx]]<br />
<br />
The LumeriCo website was for the in-universe Mexican tech giant LumériCo, who had built several reactors in the Dorado region. The website had a [https://lumerico.mx/news news page], noting the imminent opening of a new reactor on November 1 as well as a recent attack on its construction site. There were also [https://lumerico.mx/about About] and [https://lumerico.mx/login Login] pages.<br />
<br />
Players also discovered a <code>robot.txt</code> file, which appeared to server no purpose and only contained the text <code>Allow: omnics</code>, and appeared to be a joke about the [https://en.wikipedia.org/wiki/Robots_exclusion_standard Robots exclusion standard]. Another text file was discovered called <code>omnics.txt</code>, which contained the text:<br />
<br />
<pre><br />
Allow: ??<br />
Allow: ???<br />
</pre><br />
<br />
And appeared to be yet anotehr joke about the Robots exclusion standard. And, finally, an <code>api</code> file that contained <code>{"message":"thanks for calling the api"}</code> and, humorously, has no practical purpose.<br />
<br />
=== Phone Number ===<br />
<br />
At the bottom of the LumeriCo website, players discovered a phone number <code>(510) 766-2726</code>. When called, players heard a woman listing off a string of numbers in Spanish, a recording of which can be found [https://soundcloud.com/jackwilsdon/510-766-2726a here]. The numbers spoken are: <code>5-2-4-1-3 (pause) 23-4-14-8-6-18-17-23-21-18-15</code>.<br />
When assuming that a=1, b=2, etc, the second part of the message can be decoded to: <code>WDNHFRQWURO</code>. This was found to be a ROT-23 cipher, and decoded to: <code>TAKECONTROL</code>.<br />
<br />
=== Take Control ===<br />
<br />
The phone message led players to an important [https://lumerico.mx/TAKECONTROL/index.html page] on the site, under the directory <code>TAKECONTROL</code>. It was styled the same way as amomentincrime.com and featured [https://lumerico.mx/calavera.png an image of Sombra's skull icon], named "calavera.png". There was also text on the page:<br />
<br />
<pre style="word-break:break-all;word-wrap: break-word;"><br />
ethldtíoíesnoemfetuylm.bnlsssqtann)hcnslararuCpdGeoopéqubdsroaan.arnasdmdor1vrsmerñerlsdacnnnoaexedsidcn.iarsgcyi,iqeqnd.pooitoaeaaransterLetéáedasodocMrnseeiuCsimnosetlójnueodacapsadcoanfasest.rnucaodacadmdoemoipíogPoipbehaSussai.,yccandin.reueatenaoiorneoeetaoéyenimt¿rPehec,uurobudeílrysriteenasni,adngpjrálireecgrolsmhYnao?nmonomepeldezmapcpunoaulrrruCstmeitltetlróesoapsdéyufcuascaa,rensbuinergnqedlmvlbpdtaz.enebuineuldoerecrGefqfirrasulrbeatHsilnbaúaeeaaooassraooa,ioedo:aLiuielPr ursmoootlnielteeánlosulobeauaanopearrúiesltéyrosssisuaaeaenremsieaismdjmolrsspebiecdéyusittnvrcacp.taebrtLiunróporner<br />
<br />
eúcrneuyraarsettsyrseen.aaPnrneuyraeastuCpnhl/wLloaloa.qartlsyuínreute.evgdpiuábdmPooucvdeccmoreurr.o?unriorydbaSnalegeáezadienáutalaaioeemfcbgdinableoc¿éppoeocelsumuoaHearsosqadrrrftuLiorannnoneneriiatcnlomoqnaqdunrcno,enmerosaereisloabolii.e.dormerosepopdé,eo:r#5scoegaqoeaibs(edioraamtdírnlyoetjcgratmnrrobnrsstloeYqoeocicpnómlpernmaepogenmodqamubodnaeasuaenMoolloupeqvgrLtúr<br />
<br />
tsosrdvoeaerroaeusdmaauamoMobsnaeanraunnt,roierbeoiemaodbmantursotñauoureeuoerreopc.etlr<br />
<br />
sotñneerLimeaFsNJ<br />
</pre><br />
<br />
Players found this to be a column order transposition cipher with the key <code>5 2 4 1 3</code>, which was found in the phone message. The cleaned up result was: <br />
<br />
<pre><br />
Los felicito por haber llegado hasta aquí. Solo quería saber si estaban listos. (Hey, es muy difícil encontrar buena ayuda últimamente...deberían ver algunos de los payasitos que están trabajando conmigo) Por ahora, continuemos con el verdadero reto: acabar con LumériCo y su president e Guillermo Portero. ¿Y porqué? Porque es un hombre codicioso, corrupto y un ladrón abominable. Su plan de traer en línea el más grande y el más poderoso zigurat el 1 de noviembre no es nada más que una artimaña, un elaborado plan designado para ejercer aún más influencia sobre la gente de México y en gordar los bolsillos de sus compinches. ¿Y quién va a pagar por eso? La gente común y corriente, los mismos que siempre quedan olvidados.<br />
<br />
He empezado a mejorar mis protocolos para que sean usados para derrumbar la infraestructura de LumériCo y Los Muertos también están intentando levantarse en contra de la corrupción. Mientras tanto, escarben por el sitio de LumériCo y busquen información que podamos usar en contra del cabrón, mejor aún, encuentren su nombre de usuario y contraseña para asegurarnos de que ciertos detalles no muy favorables sobre el presidentito...aparezcan...<br />
<br />
Pude encontrar el nombre de usuario y contraseña de un empleado de soporte de LumériCo, empiecen por ahí:<br />
<br />
GFlores/g#fNwP5qJ<br />
</pre><br />
<br />
Translated:<br />
<br />
<pre><br />
I'm congratulating you for getting in here. I only wanted to know if you were ready or not. (Hey, it's really difficult to get good help lately... you should see some of the clowns I'm working with). For now, let's continue with the true challenge: taking down Lumerico Corp president Guillermo Portero. Why? Because he's a greedy and corrupt man, and an abominable thief. His plan of bringing in line the most powerful and biggest zigurat the 1st of november us nothing more than a deceit, an elaborate plan by his gang to become even more influential in the people of Mexico and get more money. And who's gonna pay for that? Common people, the ones that are always forgotten.<br />
<br />
I've started upgrading my protocols so that they are used to take down the Lumerico Corp infraestructure and Los Muertos are also trying to go against the corruption. Meanwhile, search the Lumerico Corp site for info we can use against the bastard, or better, get his username and password so that hundreds "not so favorable" facts about the president start popping up.<br />
<br />
I was able to get the username and pass of a Lumerico Corp employee, start here:<br />
<br />
GFlores/g#fNwP5qJ<br />
</pre><br />
<br />
=== Presidential Login ===<br />
<br />
Players used the credentials above on the [https://lumerico.mx/login Lumerico login page], and accessed the account of Gonzalo Flores, which included [https://lumerico.mx/email his emails]. Transcripts of these emails were archived [https://docs.google.com/spreadsheets/d/1zh7OU2dEOnD4X43ImvZBNpS75FLkj-rL75pXJ2l3TuQ/htmlview?sle=true# here].<br />
<br />
However, only one email had relevance to the ARG:<br />
<br />
<pre><br />
De:Valeria Valderrama<VValderama@lumerico.mx><br />
Para:Gonzalo Flores<GFlores@lumerico.mx><br />
Asunto:Página de Guillermo<br />
<br />
Hola, Gonzo:<br />
¿Puedes ver el tráfico de https://lumerico.mx/president-bypass? Guillermo debería ser el único accediendo desde su página de inicio privada, pero parece que está teniendo mucho tráfico. Tal vez tengamos que escalar esto a<br />
la señorita Jiménez, pero quiero estar segura de que es digno de su tiempo.<br />
<br />
Valeria Valderrama<br />
</pre><br />
<br />
The email referenced high traffic on the [https://lumerico.mx/president-bypass President Bypass Link]. The page displayed an "access denied" message, but players found a <code>President Auth-Bypass Revision 1.02: /.git/</code> line in the source code.<br />
<br />
This line led players to [https://github.com/internetwache/GitTools/tree/master/Dumper dump the data] from the [https://lumerico.mx/president-bypass/.git/ /.git/ subpage] with git protocol and upload it to [https://gist.github.com/anonymous/987beb6a5c817b53da820562854bdebe Github]. These were the code files behind the website, and included a '''class.authentication.php''' file that contained an encryption function, and '''class.president-bypass.php''' file which contained the president's (Guillermo Portero) username, <code>GPortero</code>, and encrypted password <code>?MzY:MTI5:?AzY:OWM?:?EDO:ZGU?:jVTM:MTJm:2ITM:MTUw:?QjY:OWY?:?kTO:MTQx:?MzY</code>.<br />
<br />
Some players wrote a function to decode the encrypted <code>class.authentication.php</code> file, and then used it on the encrypted password. The resulting password was <code>Xy@4+Bkuqd<53uJ</code>.<br />
<br />
After logging in to the President's account, players were able to read his emails. After 30 minutes, another email appeared in the President's inbox, from Sombra herself:<br />
<br />
<pre><br />
Veo que se han podido infiltrar en su correo.<br />
No se preocupen, él no puede ver este correo, lo he ocultado de su vista si se conecta desde una de sus direcciones conocidas de IP.<br />
Necesito un poco más de tiempo para establecer el próximo grupo de potocolos. Manténganse atentos a principios de la otra semana. Le echaré unos cuantos trapitos sucios en sus correos para que se filtren al público<br />
"accidentalmente". Ya veremos como reaccionan los medios de comunicación.<br />
</pre><br />
<br />
The rough translation was:<br />
<br />
<pre><br />
I see you have been able to infiltrate into his mail.<br />
Don't worry, he cannot see this email, I've hidden it from his sight if he connects from one of his known IP addresses.<br />
I need a little bit of time to establish the next set of protocols. Stay alert early next week. I'll throw some dirty laundry in his emails that can "accidentally" leak to the public. We'll see how the media will react to that.<br />
</pre><br />
<br />
=== Admin Access ===<br />
<br />
[[File:Lumerico admin panel.png|thumbnail|right|The admin panel of the Lumerico site, only accessible by logging in as MJimenez]]<br />
<br />
On October 25, 2016, new emails were discovered in the GFlores account, but they had no immediate significance to the ARG. In addition, omnics.txt was updated:<br />
<br />
<pre><br />
Allow: Tzolk'in<br />
Allow: Imix ChikchanManik Imix ChikchanImixChikchanImix Manik Chikchan Imix Kimi Chikchan Chikchan Kimi ChikchanImixChikchanImix ChikchanKimi<br />
</pre><br />
<br />
Tzolk'in is the name of a [[Wikipedia:Maya calendar#Tzolk'in|Mayan Calendar]], and the second line was a series of animals from it in the Tzolk'in dialect. Imix stands for Day 1, Chikchan — 5, Manik — 7 and Kimi — 6. When turned into numbers, the string read <code>1 57 1 5151 7 5 1 6 5 5 6 5151 56</code>. These digits turned into pictograms of [[Wikipedia:Maya numerals|Maya numerals]] (one by one, not numbers as a whole) written horizontally become <code>. -..- . -.-. ..- - . .- - - .- -.-. -.-</code> This was found to be morse code, and decoded to: <code>EXECUTEATTACK</code>.<br />
<br />
This led players to the "EXECUTEATTACK" [https://lumerico.mx/EXECUTEATTACK/index.html directory], where the following text was discovered:<br />
<br />
<pre><br />
Ha llegado el momento. Esos correos expuestos la verdad sobre Portero, iniciado la revuelta, y hemos convencido a la gente de México a apoyar nuestra causa. Ahora es el momento para el golpe. Convertiremos su preciada inauguración el 1 de noviembre en un gran movimiento en su contra. Necesito que hagan una cosa:<br />
Consigan acceso al correo del jefa de seguridad y busquen alguna forma de ayudarme en el ataque. Es posible que lo vean contactando a Portero pronto. He cambiado su contraseña a: d0r*NuLw9<br />
</pre><br />
<br />
Translated to English:<br />
<br />
<pre><br />
The moment has come. These emails exposed the truth about Portero, initiated the revolt, and have convinced people of Mexico to support our cause. Now is the time to strike. Convert his precious inauguration on November 1 to a large movement against it. I need you to do one thing:<br />
Get access to the email security chief and seek some form of help in the attack. You may see her contacting Portero soon. I've changed her password: d0r*NuLw9<br />
</pre><br />
<br />
Logging in with the credentials <code>MJimenez / d0r*NuLw9</code> gave players access to the [https://lumerico.mx/admin admin panel] of the LumeriCo reactor. Until November 1, 2016, it stayed inactive and any command was answered with the same message saying that the terminal disconnected.<br />
<br />
=== The Terminal ===<br />
Once the console became usable, players could type <code>help</code> to see a list of commands:<br />
<br />
<pre><br />
override Engineer safety mode override<br />
help Provides help information about commands<br />
version Displays system version information<br />
about Displays information about the system<br />
grep Search output by string<br />
</pre><br />
<br />
In the MJimenez email account, there was an email labeled <code>Corrupción de correo electrónico</code> with highlighted text in side of it, specifically <code>/ter/</code>. Players discovered that performing the Linux command <code>about | grep 'ter'</code> in the console returned this text:<br />
<br />
<pre><br />
Open source lightweight shell for any terminal.<br />
Anything with a terminal<br />
1.1.0 - expanded terminal support<br />
</pre><br />
<br />
The first word of every line given from the output was bolded and purple. Putting the letters together, players received the text <code>OpenAnything1.1.0</code>, which was a later solution.<br />
<br />
Another available command for the terminal was <code>override</code>, and prompted players with three security questions:<br />
<br />
# '''Favorite Movie'''. The answer to the prompt is <code>some like it bot</code>, a movie from the Overwatch universe.<br />
# '''Favorite Cookie Flavor'''. The answer being <code>nuevas sabor delicias</code>, a flavor referenced in an email in the MJimenez account.<br />
# '''Secret'''. The answer to this prompt is <code>OpenAnything1.1.0</code>.<br />
<br />
This returned <code>OK</code>, gave players admin access, and enabled a new set of commands: <br />
<br />
'''ls''' Lists files by path<br />
'''cat''' Read file by path<br />
'''exec''' Execute a file <br />
<br />
Typing <code>ls</code> listed two files: <code>payload</code> and <code>d_ilqh_nhb.html</code> (the file name was a ROT23 for ''a_fine_key'').<br />
<br />
[[Image:A fine key.png|thumb|right|a_fine_key.html]] Reading the second file with <code>cat mnt/d_ilqh_nhb.html</code> yielded a text where ASCII characters (repeating string <code>vhnl tldv xyl vcxelo xv qhrtv. zkolg[nl]</code>) were in a shape of a key. Deciphering it using an Affine cipher (A=23, B=23) yielded the following string: <code>some keys are shaped as locks. index[me]</code>. It is assumed that ''some keys are shaped as locks'' line alluded to the [[#Tracer_Trail_Cipher|Tracer Trail]] ciphertext being used as a key.<br />
<br />
Simultaneously, entering <code>exec payload</code> presented players with a prompt — the answer to which was the [[#Tracer_Trail_Cipher|Tracer Trail]]. When inputted, players were given a message that looked similar to what was previously seen at amomentincrime.com. The counter shown in the top right was then incremented.<br />
<br />
[[Image:LumericoTerminalTracerEntered.jpg|850px]]<br />
<br />
=== Misdirection ===<br />
<br />
[[Image:LumericoHacked.jpg|thumb|right|lumerico.mx website hacked by Sombra]]<br />
<br />
On October 1, 2016, the lumerico.mx home page changed to show "glitches" and the black overlay with a message under the purple skull, while a string <code>&lt;!-- MISDIRECTION --></code> was also added to the source of the page.<br />
<br />
The message says: <br />
<br />
<pre><br />
Buen trabajo, amigos. No lo hubiera logrado sin su ayuda. En fin, me consiguieron los recursos que necesitaba para mi siguiente golpe – les encantará.<br />
Esperen noticias de mí en los próximos días...<br />
Les voy a mandar algo para agradecerles… Ojalá lo puedan aprovechar.<br />
Dasvidanya amigos<br />
</pre><br />
<br />
Translated:<br />
<br />
</pre><br />
Good job, folks. I would not have done it without your help. Anyway, I got the resources needed for my next hit - you'll love it.<br />
Expect to hear from me in the coming days...<br />
I'm going to send something to thank you ... Hopefully you can use it.<br />
Dasvidanya friends<br />
</pre><br />
<br />
[[File:Dia de los muertos spray.jpg|thumbnail|right|The Día de Los Muertos spray that was added to the game after Sombra hacked the Lumerico site]]<br />
<br />
Note that ''Dasvidanya'' is a phonetic transliteration of ''до свиданья'' — a russian phrase for "goodbye". The thing that Sombra sent as a ''thank you'' was a new spray, named "Día de Los Muertos" after the Mexican festival that took place at the same time as the ARG. The spray is currently only available on the PC version of the game.<br />
<br />
The '''MISDIRECTION''' string lead to the page [https://lumerico.mx/MISDIRECTION/index.html https://lumerico.mx/MISDIRECTION/index.html] containing:<br />
<br />
...Estableciendo conexiуn...<br />
...Protocolo Sombra v2.3 iniciado...<br />
<br />
...Desviando datos del zigurat de LumériCo hacia el objetivo...<br />
...Descifrando contraseсas del objetivo...<br />
...Acceso otorgado al directorio de volskayaindustries.com...<br />
<br />
...boop ;)...<br />
...Terminando conexión...<br />
<br />
Translated: <br />
<br />
...Establishing connection...<br />
...Sombra Protocol v2.3 initiated...<br />
<br />
...Forwarding the data from the LumériCo ziggurat to the target...<br />
...Deciphering the target passwords...<br />
...Access Granted to the directory of volskayaindustries.com...<br />
<br />
...boop ;)...<br />
...Ending connection..<br />
<br />
== Blizzcon ==<br />
<br />
Blizzcon 2016 opened with the [https://www.youtube.com/watch?v=Og5-Pm4HNlI Overwatch short "Infiltration"], a short depicting Reaper, Widowmaker, and Sombra on Volskaya Industries. During the showing of the short, Sombra's [https://playoverwatch.com/en-us/heroes/sombra hero page] went live, showcasing her abilities and character backstory.<br />
<br />
[[File:SombraBG.jpg|center|500px]]<br />
<br />
== References ==<br />
<br />
=== Community Resources ===<br />
<br />
A collection of tools and resources made by the Game Detectives Discord community for use in the ARG.<br />
<br />
==== ASCII Skull ====<br />
<br />
'''ASCII Skull Analysis:''' https://github.com/bahamas10/sombra<br />
<br />
'''Removing SOMBR@ Analysis:''' https://pastebin.com/15u27YTC<br />
<br />
'''ASCII Skull Eye Analysys:''' https://docs.google.com/spreadsheets/d/1-JQpWyitMKYhP-4l8ZDFiJI3NjqRrvoEnRdFQawike8<br />
<br />
==== Google Docs ====<br />
<br />
'''Observations and Speculations Spreadsheet:''' https://docs.google.com/spreadsheets/d/1rI08baFQmAwaqHC-9GF9VNGCYjuRE-q4LN9k4ottjuQ/pubhtml<br />
<br />
'''LumériCo Emails and Translations Spreadsheet:''' https://goo.gl/cQgdIJ (Courtesy of UberPilot)<br />
<br />
==== Tracer Code ====<br />
<br />
'''GOL! Guesser:''' https://axxim.net/ow/gol-guesser/<br />
<br />
'''Uber GOL! Guesser:''' https://axxim.net/ow/gol-guesser/uber/<br />
<br />
The Uber GOL! Guesser only prints out UTF-8 compliant results, which makes it easier to identify potentially correct answers.<br />
<br />
'''Bruteforcing tool:''' https://github.com/glv2/bruteforce-salted-openssl<br />
<br />
=== Third-Party Resources ===<br />
<br />
A collection of third-party tools and resources that the Game Detectives Discord community has used in the ARG.<br />
<br />
==== Image of Reaper ====<br />
<br />
'''stegdetect (Linux):''' https://github.com/abeluck/stegdetect<br />
<br />
stegdetect is a Linux utility used to determine if a given image may contain encoded information.<br />
<br />
'''JPHide & JPSeek:''' https://linux01.gwdg.de/~alatham/stego.html<br><br />
'''iSteg (Mac OSX):''' https://www.hanynet.com/isteg/<br />
<br />
JPHide & JPSeek is used to hide and find, respectively, a file inside a JPEG image.<br><br />
iSteg works similarly to JPHide on the Mac OSX platform.<br />
<br />
'''stegbreak (Linux):''' https://linux.die.net/man/1/stegbreak<br />
<br />
stegbreak is used to do brute-force dictionary attacks on JPEG images.<br />
<br />
=== Easter Eggs ===<br />
<br />
The following are collection of references and Easter Eggs encountered throughout the ARG.<br />
<br />
==== In-Game ====<br />
<br />
'''Sombra's "Amused" Emote'''<br />
<br />
This character emote features the [[Sombra_ARG_False_Leads | Skycode]], accompanied by soft music resembling the [https://www.reddit.com/r/Overwatch/comments/4w7ey1/the_sombra_skysong/ Skysong]. Sombra's expression is one of amusement, and it's a nod to the community's prolonged creative attempts to solving an nonexistent puzzle.<br />
<br />
[[File:EmoteSkycode.png|200px]]<br />
<br />
'''Skycode Spray'''<br />
<br />
This character spray features Sombra's iconic skull in front of a compass rose and the [[Sombra_ARG_False_Leads | Skycode]]. This is a reference to both the [[#Directions_&_Letters|cardinal directions]] used in one of the puzzles and to the Skycode, which is considered the most significant false lead that solvers encountered.<br />
<br />
[[File:SkycodeSpray.png|200px]]<br />
<br />
==== In-ARG ====<br />
<br />
'''Espresso Command'''<br />
<br />
There was a hidden command in LumériCo's [[#The_Terminal | admin terminal]]. Inputting the word <code>espresso</code> returned the following message: <code>Coffee Pot Status: Brewed approximately 23 hours ago, currently 0% full</code><br />
This is referencing a variety of [https://goo.gl/cQgdIJ emails] found in the LumériCo site involving broken espresso machines and incompetent coffee brewing, which caught the attention of the community and gave way to a vast variety of mediocre jokes. Furthermore, "23 hours" makes reference to the number 23, which was believed by many to possess some sort of significance to the ARG, as Sombra would be the 23rd character in Overwatch. Finally, "0%" references the ARG's notable waiting periods that have been widely criticized by the community, specifically [[#A_Moment_in_Crime_Transmission | A Moment in Crime's upload percentage]].<br />
Due to the iconic purple text it is believed that this hidden command was created by Sombra herself.<br />
<br />
[[File:EspressoCommand.png]]<br />
<br />
=== Media Appearances ===<br />
<br />
'''3rd Aug. 2016'''<br />
<br />
[EN] [https://kotaku.com/overwatch-fans-find-new-clues-about-the-mysterious-hero-1784767759 Kotaku - Overwatch Fans Find New Clues About The Mysterious Hero Sombra]<br />
<br />
[EN] [https://www.polygon.com/2016/8/3/12369144/overwatch-summer-games-sombra-arg-blizzard?utm_campaign=polygon&utm_content=chorus&utm_medium=social&utm_source=twitter Polygon - Overwatch fans are trying to crack the latest mystery about Sombra]<br />
<br />
[EN] [https://www.pcgamesn.com/overwatch/overwatch-sombra PCGamesN - Overwatch's Sombra ARG continues with new clues, but no solutions]<br />
<br />
[EN] [https://team-dignitas.net/articles/blogs/overwatch/9989/who-is-sombra-all-facts-and-clues-about-sombra Team-Dignitas - Who is Sombra? All facts and clues about Sombra]<br />
<br />
[FR] [https://overwatch.gamewave.fr/un-nouveau-code-cache-dans-la-derniere-cinematique-d-overwatch/ Gamewave - UN NOUVEAU CODE CACHÉ DANS LA DERNIÈRE CINÉMATIQUE D'OVERWATCH!]<br />
<br />
[EN] [https://www.follownews.com/overwatch-fans-find-new-clues-about-the-mysterious-hero-sombra-1nhqt FollowNews - Overwatch Fans Find New Clues About The Mysterious Hero Sombra]<br />
<br />
'''4th Aug. 2016'''<br />
<br />
[EN] [https://www.pcgamer.com/overwatch-summer-games-trailer-hides-a-mysterious-secret/ PCGamer - Overwatch Summer Games trailer hides a mysterious secret]<br />
<br />
[SK] [https://www.sector.sk/novinka/121273/nove-overwatch-video-obsahuje-dalsie-tajomstva.htm Sector - Nové Overwatch video obsahuje ďalšie tajomstvá]<br />
<br />
[EN] [https://www.techinsider.io/overwatch-sombra-character-2016-8 Techinsider - 'Overwatch' players are going to insane lengths to solve a mystery that Blizzard's teased for months]<br />
<br />
[EN] [https://gamerant.com/overwatch-sombra-clues/ Gamerant - Overwatch Players Uncover More ‘Sombra’ Clues]<br />
<br />
[HU] [https://www.gamestar.hu/hir/overwatch-sombra-karakter-214739.html Gamestar - Overwatch - újabb nyomok utalnak a még be nem jelentett hősre]<br />
<br />
'''5th Aug. 2016'''<br />
<br />
[EN] [https://kotaku.com/days-later-overwatch-fans-cant-figure-out-the-sky-cod-1784872143 Kotaku - Days Later, Overwatch Fans Can't Figure Out The 'Sky Code' Mystery]<br />
<br />
[NL] [https://www.gamersnet.nl/nieuws/201608/cryptische_speurtocht_naar_overwatch_nieuwe_heldin_sombra_gaat_bizar_diep/ Gamersnet - Cryptische speurtocht naar Overwatch' nieuwe heldin Sombra gaat bizar diep]<br />
<br />
[ES] [https://www.alfabetajuega.com/noticia/overwatch-el-enigma-de-sombra-sigue-ofreciendo-nuevos-detalles-n-71772 Alfa Beta Jeuga - Overwatch: El enigma de Sombra sigue ofreciendo nuevos detalles]<br />
<br />
[EN] [https://www.youtube.com/watch?v=5ROjN-_F0ZU&feature=youtu.be&t=4m22s IGN (Video) - Sombra: Overwatch's Secret New Hero - Overwatch HQ]<br />
<br />
'''7th Aug. 2016'''<br />
<br />
[EN] [https://www.gamespresso.com/2016/08/summary-state-sombras-arg-overwatch/ Gamespresso - Summary of the state of sombra's ARG in Overwatch]<br />
<br />
'''8th Aug. 2016'''<br />
<br />
[EN/CN] [https://www.zhentoo.com/doc92368 Zhentoo - Overwatch new hero Secret Dorado hidden mystery] <br />
<br />
[EN] [https://www.technewstoday.com/30880-overwatch-sombra-continues-to-elude-detectives/ TechNewsToday - Overwatch: Sombra Continues to Elude Detectives]<br />
<br />
'''11th Aug. 2016'''<br />
<br />
[EN] [https://www.youtube.com/watch?v=IZR-pa0it4Q The Know - New Overwatch Hero Hints]<br />
<br />
'''12th Aug. 2016'''<br />
<br />
[EN] [https://kotaku.com/after-two-weeks-overwatch-fans-sombra-investigation-re-1785204389 Kotaku - Overwatch Fans' Sombra Investigation Reaps A Skull Code]<br />
<br />
'''14th Aug. 2016'''<br />
<br />
[EN] [https://gamerant.com/overwatch-sombra-skull-code/ Gamerant - Skull Code is Latest Clue in Overwatch’s Sombra Investigation]<br />
<br />
'''16th Aug. 2016'''<br />
<br />
[EN] [https://www.christiantoday.com/article/overwatch.dlc.update.skull.code.the.latest.clue.for.sombra.investigation/93197.htm Christian Today - 'Overwatch' DLC update: Skull Code the latest clue for Sombra investigation]<br />
<br />
[EN] [https://en.yibada.com/articles/151811/20160816/overwatch-dlc-update.htm Yibada - 'Overwatch' DLC update: New clues on Sombra's inclusion to the roster revealed]<br />
<br />
'''23rd Aug. 2016'''<br />
<br />
[EN] [https://www.technewstoday.com/31129-overwatch-all-we-know-about-the-sombra-arg/ Tech News Today - Overwatch: All We Know About the Sombra ARG]<br />
<br />
'''24th Aug. 2016'''<br />
<br />
[EN] [https://gamerant.com/overwatch-forums-sombra-message/ Gamerant - Overwatch Forums Glitch Out, Reveals Hidden Message From Sombra]<br />
<br />
[EN] [https://gamerant.com/overwatch-sombra-clue-website/ Gamerant - New Website Counts Down To Next Clue For Overwatch’s Sombra]<br />
<br />
[EN] [https://www.polygon.com/2016/8/24/12623736/overwatch-sombra-arg-clues-skycoder Polygon - Overwatch's Sombra mystery appears to be coming to a close]<br />
<br />
[EN] [https://www.vg247.com/2016/08/24/overwatch-forums-glitch-out-reveal-a-message-from-the-mysterious-sombra/ VG247 - Overwatch forums glitch out, reveal a message from the mysterious Sombra]<br />
<br />
[EN] [https://www.technewstoday.com/31151-sombra-hacks-into-overwatch-forums/ Tech News Today - Sombra Hacks Into Overwatch Forums]<br />
<br />
[EN] [https://www.ign.com/articles/2016/08/24/overwatch-mystery-character-sombra-could-be-revealed-today IGN - Overwatch Mystery Character Sombra Could Be Revealed Today]<br />
<br />
'''25th Aug. 2016'''<br />
<br />
[EN] [https://kotaku.com/overwatch-players-are-getting-fed-up-with-the-sombra-ar-1785765307 Kotaku - Overwatch Players Are Getting Sick Of The Sombra ARG]<br />
<br />
[EN] [https://www.ign.com/articles/2016/08/25/overwatch-made-the-internet-lose-its-mind-last-night-and-i-had-a-front-row-seat IGN - Overwatch Made the Internet Lose its Mind Last Night, And I Had a Front-Row Seat]<br />
<br />
[EN] [https://www.technewstoday.com/31182-overwatch-countdown-to-sombra/ Tech News Today - Overwatch: Countdown to Sombra]<br />
<br />
<br />
'''30th Aug. 2016'''<br />
<br />
[EN] [https://www.pcgamer.com/overwatch-sombra-arg-mystery/ PC Gamer - Overwatch's Sombra riddle begins to irritate the players trying to solve it]<br />
<br />
'''3rd Oct. 2016'''<br />
<br />
[EN] [https://www.mobilenapps.com/articles/19398/20161003/overwatch-update-sombra-blizzcon-halloween-event-leak.htm Mobile & Apps - Sombra To Be Revealed At Blizzcon? Halloween Event Confirmed In Data Leak]<br />
<br />
'''4th Oct. 2016'''<br />
<br />
[EN] [https://www.itechpost.com/articles/36011/20161004/overwatch-overwatch-update-overwatch-finally-getting-sombra-overwatch-sombra-sombra.htm iTechPost - Overwatch Update: Are We Finally Getting Sombra?]<br />
<br />
'''11th Oct. 2016'''<br />
<br />
[EN] [https://www.kotaku.com.au/2016/10/overwatch-fans-hacked-actual-people-in-an-attempt-to-find-sombra/ Kotaku - Overwatch Fans Hacked Actual People In An Attempt To Find Sombra]<br />
<br />
'''17th Oct. 2016'''<br />
<br />
[EN] [https://telkomgaming.co.za/will-sombra-hack-her-way-into-blizzcon-2016/ TelKom Gaming - Will Sombra Hack Her Way Into BlizzCon 2016?]<br />
<br />
'''18th Oct. 2016'''<br />
<br />
[EN] [https://overwatchtips.info/overwatch-sombra-arg-everything-you-need-to-know/ OverwatchTips - Everything You NEED To Know (Sombra ARG)]<br />
<br />
'''26th Oct. 2016'''<br />
<br />
[EN] [https://mic.com/articles/157757/overwatch-sombra-arg-everything-we-know-about-the-countdown-and-rumored-nov-1-release#.UILrZHRiM Min Network - Everything we know about Blizzard's rumored Nov. 1 release]<br />
<br />
'''28th Oct. 2016'''<br />
<br />
[EN] [https://kotaku.com/imagining-horror-stories-for-a-never-ending-overwatch-a-1788324673 Kotaku - Imagining Horror Stories Of A Never-Ending Overwatch ARG]<br />
<br />
'''1st Nov. 2016'''<br />
<br />
[EN] [https://www.ign.com/videos/2016/11/01/will-overwatchs-sombra-be-at-blizzcon-2016 IGN - Will Sombra be at BlizzCon 2016?]<br />
<br />
'''8th Nov. 2016'''<br />
<br />
[EN] [https://mic.com/articles/158812/overwatch-sombra-arg-gameplay-emote-directly-references-one-of-the-wildest-fan-theories Mic Tech - 'Overwatch' Sombra ARG: Gameplay emote directly references one of the wildest fan theories]</div>Halke234https://wiki.gamedetectives.net/index.php?title=Sombra_ARG&diff=16623Sombra ARG2018-07-24T22:55:27Z<p>Halke234: /* Admin Access */</p>
<hr />
<div>{{argbox<br />
| float = right<br />
| name = Sombra ARG<br />
| image = File:Sombra_skull.png<br />
| description= The Sombra ARG - an ARG involving an unreleased Overwatch hero.<br />
| creator = [https://www.blizzard.com/ Blizzard Entertainment]<br />
| type = Official<br />
| status = Completed<br />
| discovered = 2016-06-12<br />
| completed = 2016-11-04<br />
}}<br />
<br />
{{ArgHeader|arg=Sombra ARG}}<br />
The Sombra ARG was an ARG for the first-person shooter [https://www.playoverwatch.com Overwatch], developed by [https://www.blizzard.com/ Blizzard Entertainment]. Sombra was the name of a then-unreleased Overwatch hero. The ARG was comprised of clues and ciphers referencing Sombra, which were found in various developer updates and short animations.<br />
<br />
At the game's release, there were numerous pieces of in-game information that appeared in the map Dorado, hinting at a character called Sombra. When the hero Ana was revealed, more Sombra clues appeared in Ana's origin video. In the weeks that followed, more clues were discovered, which led up to a character reveal animation at BlizzCon 2016.<br />
<br />
== Ana Videos ==<br />
<br />
=== Ana Origin Video ===<br />
<br />
On July 12, 2016, a [https://www.youtube.com/watch?v=TE0CXgpNxG0 video] for the new Overwatch hero named Ana was released. At the 1:16 mark, players discovered a set of hexidecmial values:<br />
<br />
[[File:Ana_Hex2.png|400px]]<br />
<br />
<pre><br />
2E 2E 2E 7B 76 20 66 62 72 20 63 7E 72 79 72 20 7B 76 20 7E<br />
79 71 78 65 7A 76 74 7E D4 A4 79 2C 20 63 7E 72 79 72 20 72<br />
7B 20 67 78 73 72 65 2E 2E 2E 7B 76 20 66 62 72 20 63 7E 72<br />
79 72 20 7B 76 20 7E 79 71 78 65 7A 76 74 7E D4 A4 79 2C 20<br />
63 7E 72 79 72 20 72 7B 20 67 78 73 72 65 2E 2E 2E 7B 76 20<br />
66 62 72 20 63 7E 72 79 72 20 7B 76 20 7E 79 71 78 65 7A 76<br />
74 7E D4 A4 79 2C 20 63 7E 72 79 72 20 72 7B 20 67 78 73 72<br />
65 2E 2E 2E 7B 76 20 66 62 72 20 63 7E 72 79 72 20 7B 76 20<br />
7E 79 71 78 65 7A 76 74 7E D4 A4 79 2C 20 63 7E 72 79 72 20<br />
72 7B 20 67 78 73 72 65 2E 2E 2E 64 78 7A 75<br />
</pre><br />
<br />
A hex to ASCII translation yielded the following:<br />
<br />
<pre><br />
...{v fbr c~ryr {v ~yqxezvt~Ô¤y, c~ryr r{ gxsre...{v fbr c~ryr {v ~yqxezvt~Ô¤y, c~ryr r{ gxsre...{v fbr c~ryr {v ~yqxezvt~Ô¤y, c~ryr r{ gxsre...{v fbr <br />
c~ryr {v ~yqxezvt~Ô¤y, c~ryr r{ gxsre...dxzu<br />
</pre><br />
<br />
Using an XOR Cipher with the constant 23 on the above text resulted in the following message:<br />
<br />
<pre><br />
..la que tiene la información; tiene el poder...la que tiene la información; tiene el poder...la que tiene la información; tiene el poder...la que tiene la <br />
información; tiene el poder...somb<br />
</pre><br />
<br />
This was a repeating phrase in Spanish, which translated to:<br />
<br />
<pre><br />
She who has the information, has the power...<br />
</pre><br />
<br />
Players then discovered a second set of hexidecimal values at the 2:11 mark:<br />
<br />
[[File:Ana Hex.png|400px]]<br />
<br />
<pre><br />
65 76 2E 2E 2E 7B 76 20 66 62 72 20 63 7E 72 79 72 20 7B 76<br />
20 7E 79 71 78 65 7A 76 74 7E D4 A4 79 2C 20 63 7E 72 79 72<br />
20 72 7B 20 67 78 73 72 65 2E 2E 2E 7B 76 20 66 62 72 20 63<br />
7E 72 79 72 20 7B 76 20 7E 79 71 78 65 7A 76 74 7E D4 A4 79<br />
2C 20 63 7E 72 79 72 20 72 7B 20 67 78 73 72 65 2E 2E 2E 7B<br />
76 20 66 62 72 20 63 7E 72 79 72 20 7B 76 20 7E 79 71 78 65<br />
7A 76 74 7E D4 A4 79 2C 20 63 7E 72 79 72 20 72 7B 20 67 78<br />
73 72 65 2E 2E 2E 7B 76 20 66 62 72 20 63 7E 72 79 72 20 7B<br />
76 20 7E 79 71 78 65 7A 76 74 7E D4 A4 79 2C 20 63 7E 72 79<br />
72 20 72 7B 20 67 78 73 72 65 2E 2E 2E<br />
</pre><br />
<br />
When put through the same process, the same string of Spanish was revealed, but with the letters <code>ra</code> at the beginning of the message. These letters were combined with <code>somb</code> from the first cipher to create the name <code>sombra</code>. No more clues were discovered until the release of the Dev Update video.<br />
<br />
=== Dev Update Video ===<br />
<br />
[[File:Sombra Barcodes.png|thumbnail|right|The vertical barcodes found at the end of the Ana Dev Update video]]<br />
<br />
On July 19, 2016, the first [https://www.youtube.com/watch?v=evghkilg2eQ Developer Update] was released for Ana. At the end of the video, players discovered a series of vertical barcodes. When scanned, players discovered a large set of hexidecimal values which where then converted to binary, a dump of which is available [https://gist.github.com/zapu/31165efab0d6264e2fd0fa75cc53b1aa here].<br />
<br />
Turning the ones and zeroes into black and white pixels formed a QR code:<br />
<br />
[[File:Sombra_QR_code.png|300px]]<br />
<br />
Scanning this QR code yielded the following message: <code>¿Estuvo eso facilito? Ahora que tengo su atención, déjenme se las pongo más difícil.</code> In English, the message reads: <code>Was that easy? Well, now that I have your attention, allow me to make things much more difficult.</code> After this, no more clues were discovered until the Summer Games video was released.<br />
<br />
== Welcome to the Summer Games Video ==<br />
<br />
=== Tracer Trail Cipher ===<br />
<br />
[[File:Base64_trail.jpg|thumbnail|right|The unsolved base64 cipher in the Summer Games video]]<br />
<br />
'''Note: The cipher described below remains unsolved.'''<br />
<br />
On August 2, 2016, players discovered another cipher in the [https://www.youtube.com/watch?v=qpcOD9tJM4k Welcome to the Summer Games trailer]:<br />
<br />
<pre><br />
U2FsdGVkX1+vupppZksvRf5pq5g5XjFRIipRkwB0K1Y96Qsv2L<br />
m+31cmzaAILwytX/z66ZVWEQM/ccf1g+9m5Ubu1+sit+A9cenD<br />
xxqkIaxbm4cMeh2oKhqIHhdaBKOi6XX2XDWpa6+P5o9MQw==<br />
</pre><br />
<br />
Players discovered this text to be base64 encryption. When decrypted, players received the following output:<br />
<br />
<pre><br />
Salted__���ifK/E�i��9^1Q�*Q�t+V=�<br />
/ع��W/<br />
�_����V��?q����f�F���"��=q�������[��<br />
z��*����Z����u�\5�k�C<br />
</pre><br />
<br />
''(Note: copy/pasting this string will not work; some of the characters are not printable and are not even displayed correctly on this page)''<br />
<br />
==== Decrypting the Cipher ====<br />
<br />
The "Salted__" header at the start of the string indicated to players that the remainder of the text was encrypted with the OpenSSL software library, which requires a password and the encryption cipher that was used. Salt is added by OpenSSL to ensure uniqueness of the key and the IV derived from the password and used for the encryption. However, due to the age of OpenSSL and its massive library, it was proven to be quite difficult for players to identify the encryption used.<br />
<br />
==== Narrowing Down Ciphers ====<br />
<br />
[[File:HexOfEncryptedMessage.png|thumbnail|right|Hex view of the encrypted string]]<br />
<br />
Players narrowed down the potential ciphers used by examining a hex dump of the encrypted string. There are two major types of ciphers, stream ciphers and block ciphers. Stream ciphers encrypt only the data fed into them, whereas block ciphers always encrypt a certain number of bytes at a time (a "chunk").<br />
<br />
A byte is roughly a single character, but special characters can take up multiple bytes. We know that OpenSSL Salted Encryption uses the first 8 bytes of the output for <code>Salted__</code> and the next 8 bytes for the actual salt. The rest of the information is the '''encrypted message'''.<br />
<br />
The immediately interesting thing here is that the '''encrypted message''' data stops 3 bytes short of a full chunk. This is a excellent indicator that the cipher used is a stream cipher (or a block cipher in CTR/OFB/CFB mode). This narrows the list of potential ciphers down significantly. This also means that the final string that Blizzard encrypted is less than 93 bytes!<br />
<br />
'''This cipher remains unsolved, but it's speculated that Blizzard moved past the cipher by creating alternate puzzles.'''<br />
<br />
=== Directions & Letters ===<br />
<br />
Players discovered that in the North American version of the Summer Games trailer there were repeated references to the cardinal directions, each associated with a particular hero. These references were conspicuously absent from other versions of the trailer. These references are shown below, with the relevant heroes and timestamps:<br />
<br />
<gallery mode="packed"><br />
File:Ow1.png|East - Mercy - Route 66 - 0:17<br />
File:Ow2.png|Center - D. Va - Temple of Anubis - 0:19<br />
File:Ow3.png|North - Torbjorn - Nepal - 0:21<br />
File:Ow4.png|South - Genji - Hanamura - 0:22<br />
File:Ow5.png|Southeast - McCree - Hollywood - 0:24<br />
File:Ow6.png|West - Symmetra - Watchpoint: Gibraltar - 0:30<br />
File:Ow7.png|Southwest - Bastion - Hollywood - 0:34<br />
File:Ow8.png|Northeast - Winston - Volskaya Industries - 0:46<br />
File:Ow9.png|Northwest - Tracer - King's Row - 0:47<br />
</gallery><br />
<br />
Screenshots of all the directions and their respective heroes can be found in an album [https://imgur.com/a/FQXmy here].<br />
<br />
[[File:Overwatch map.jpg|frameless]]<br />
<br />
These heroes, arranged in this particular order, provided a password that was used later in the ARG.<br />
<br />
== Dorado Photo ==<br />
<br />
At an unknown date, a new, "corrupted" photo of the [https://blzgdapipro-a.akamaihd.net/media/screenshot/dorado-screenshot-004.jpg Dorado attackers spawn point] was added to the Overwatch [https://playoverwatch.com/en-us/media/ media page]. Players discovered that the screenshot was "'''datamoshed'''", which means it concealed a hidden message while also taking on a distorted appearance. ([https://prntscr.com/c3dce7 Here] is an example of purposely data moshing the image manually to achieve similar effects.) <br />
<br />
<gallery mode="packed" heights=500px><br />
File:dorado-datamosh.jpg|The datamoshed image<br />
File:dorado-screenshot-005.jpg|The original image<br />
</gallery><br />
<br />
After comparing the images with difference checking tools, players found that certain English and Spanish characters were replaced with exclamation points. The missing characters produced the following Spanish phrase:<br />
<br />
<code>Por que estan mirando al cielo? La respuesta no esta sobre sus cabezas, esta detras de ustedes. A veces, necesitan analizar sus logros previos.</code><br />
<br />
Translated into English, this phrase read:<br />
<br />
<code>Why are you looking at the sky? The answer isn't over your heads, it's behind you. Sometimes, you need to analyze your previous achievements.</code><br />
<br />
The phrase "Why are you looking at the sky?" was most likely a reference to a strange artifact that was discovered in the sky of the Dorado map, dubbed the "Skycode". The Skycode ended up being a red herring, and was completely unrelated to the ARG.<br />
<br />
=== Analyzing Achievements ===<br />
<br />
[[File:achievements.png|thumbnail|right|"¿" Achievement, comment in source code]]<br />
<br />
The phrase "you need to analyze your previous achievements" led players to look at the achievements on the [https://www.playoverwatch.com Overwatch] website. It was noticed noticed that by logging in and viewing the achievements on a player profile, a mystery achievement appeared. Examining a hex dump of the image lead players to a new phrase:<br />
<br />
<pre><br />
Vientos, nada mal. No obstante, me aburro. Intentemos algo nuevo en la misma dirección.<br />
uczihriwgsxorxwunaarawryqhbrsfmeqrjjmu 5552E494 78T3 4VM9 OPL6 IS8208O913KRlrx<br />
</pre><br />
<br />
Translated, it said:<br />
<br />
<pre><br />
Damn, not bad. However, I'm getting bored. Let's try something new in the same direction.<br />
uczihriwgsxorxwunaarawryqhbrsfmeqrjjmu 5552E494 78T3 4VM9 OPL6 IS8208O913KRlrx<br />
</pre><br />
<br />
== Volskaya Datamosh ==<br />
<br />
After a long period of toying around, players discovered that the ciphertext <code> uczihriwgsxorxwunaarawryqhbrsfmeqrjjmu 5552E494 78T3 4VM9 OPL6 IS8208O913KRlrx</code> from the "?" achievement was a Vigenére cipher. Players discovered the key <code>tracertorbjornwinstonsymmetradvamercybastiongenjimccree</code> by ordering the heroes in the Summer Games trailer by the cardinal directions associated with each of them, as said further above. Once decoded, players received the following text: <br />
<pre>blzgdapiproaakamaihdnetmediascreenshot 5552E494 78B3 4CE9 ACF6 EF8208F913CFjpg</pre><br />
<br />
Players found this to be a [https://blzgdapipro-a.akamaihd.net/media/screenshot/5552E494-78B3-4CE9-ACF6-EF8208F913CF.jpg blzgdapipro-a.akamaihd.net/media/screenshot/5552E494-78B3-4CE9-ACF6-EF8208F913CF.jpg URL], which led players to a datamoshed screenshot of the Volskaya Industries map. ''(Editor's note: This link appears to now be dead)''. When players ran a difference check with the [https://blzgdapipro-a.akamaihd.net/media/screenshot/volskaya-screenshot-004.jpg original image], they received an interesting message.<br />
<br />
<gallery mode="packed"><br />
File:volskaya-datamosh.jpg|The datamoshed image<br />
File:Volskaya-screenshot-004.jpg|The original image<br />
</gallery><br />
<br />
=== ASCII Skull #1 ===<br />
<br />
The diff from the datamoshed image resulted in the following output:<br />
<br />
<pre><br />
Parece que te gustan estos jueguitos... por que no jugamos uno de verdad?<br />
:PB@Bk:<br />
,jB@@B@B@B@BBL.<br />
7G@B@B@BMMMMMB@B@B@Nr<br />
:kB@B@@@MMOMOMOMOMMMM@B@B@B1,<br />
:5@B@B@B@BBMMOMOMOMOMOMOMM@@@B@B@BBu.<br />
70@@@B@B@B@BXBBOMOMOMOMOMOMMBMPB@B@B@B@B@Nr<br />
G@@@BJ iB@B@@ OBMOMOMOMOMOMOM@2 B@B@B. EB@B@S<br />
@@BM@GJBU. iSuB@OMOMOMOMOMOMM@OU1: .kBLM@M@B@<br />
B@MMB@B 7@BBMMOMOMOMOMOBB@: B@BMM@B<br />
@@@B@B 7@@@MMOMOMOMM@B@: @@B@B@<br />
@@OLB. BNB@MMOMOMM@BEB rBjM@B<br />
@@ @ M OBOMOMM@q M .@ @@<br />
@@OvB B:u@MMOMOMMBJiB .BvM@B<br />
@B@B@J 0@B@MMOMOMOMB@B@u q@@@B@<br />
B@MBB@v G@@BMMMMMMMMMMMBB@5 F@BMM@B<br />
@BBM@BPNi LMEB@OMMMM@B@MMOMM@BZM7 rEqB@MBB@<br />
B@@@BM B@B@B qBMOMB@B@B@BMOMBL B@B@B @B@B@M<br />
J@@@@PB@B@B@B7G@OMBB. ,@MMM@qLB@B@@@BqB@BBv<br />
iGB@,i0@M@B@MMO@E : M@OMM@@@B@Pii@@N:<br />
. B@M@B@MMM@B@B@B@MMM@@@M@B<br />
@B@B.i@MBB@B@B@@BM@::B@B@<br />
B@@@ .B@B.:@B@ :B@B @B@O<br />
:0 r@B@ B@@ .@B@: P:<br />
vMB :@B@ :BO7<br />
,B@B<br />
</pre><br />
<br />
'''Translation:'''<br />
<br />
<pre><br />
"It seems you like these little games... Why don't we play a real one?"<br />
</pre><br />
<br />
(''This is the python2 script to extract modified bytes from datamoshed Volskaya screenshot: https://gist.github.com/synap5e/27635d2ff6f0e3b15f0c902dca2974a9'')<br />
<br />
No further progress was made until August 23, 2016.<br />
<br />
== Overwatch Forums Glitching Page/ "Skycoder" ==<br />
<br />
On August 23rd, 2016, at an unknown time, an [https://us.battle.net/forums/en/overwatch/topic/20748794686 ominous post] by a user named "Skycoder" appeared on the official General Discussion forums for Overwatch. <br />
<br />
Players found that the name of the post, <code>00110010 00110011</code>, was binary for "23," which was a direct reference to Sombra being the 23rd hero in Overwatch. The age of the post started at 24 hours, and counted down rather than increasing. The post itself contained a single sentence in Spanish:<br />
<br />
<pre><br />
la que tiene la información; tiene el poder<br />
</pre><br />
<br />
Which, when translated to english, reads:<br />
<br />
<pre><br />
She who has the information, has the power.<br />
</pre><br />
<br />
After a short while, the post glitched and distorted, gradually turning a hue of purple. A text box then appeared, which printed the following ciphertext:<br />
<br />
<pre><br />
ICAgICAgICAgICAgICAgICAgICAgICAgICA6UEKPQms6CiAgICAgICAg<br />
ICAgICAgICAgICAgICAsakKIQEJAQkBCQEJCTC4KICAgICAgICAgICAg<br />
ICAgICAgIDdHlkKTQpVCTU1NTU1CQEJAQkBOcgogICAgICAgICAgICAg<br />
ICA6a0KSQpCIl01NT01PTU9NT01NTU2MQphCQEIxLAogICAgICAgICAg<br />
IDo1kUKNQphCiEJCTU1PTU9NT01PTU9NT01NipJuQm5CQEJCdS4KICAg<br />
ICAgICA3MG6GlUKIQpJClEJYQkJPTU9NT01PTU9NT01NQk1QQphCiEJA<br />
QkBCQE5yCiAgICAgIEeYlpdCSiBpQohCh4ggIE9CTU9NT01PTU9NT01P<br />
TZYyICBCj0JAQi4gRUJAQkBTCiAgICAgIJKWQk2HR0pCVS4gIGlTdUKI<br />
T01PTU9NT01PTU9NTZdPVTE6ICAua0JMTYhNhkKXCiAgICAgIEKMTU1C<br />
mUIgICAgICAgN4hCQk1NT01PTU9NT01PQkKWOiAgICAgICBCh0JNTYhC<br />
CiAgICAgII2YiEKKQiAgICAgICAgIDeSlkBNTU9NT01PTU1AQkA6ICAg<br />
ICAgICAgQEBCQEJACiAgICAgII+ST0xCLiAgICAgICAgICBCTkKPTU1P<br />
TU9NTY9CRUIgICAgICAgICAgckJqTYRCCiAgICAgIJBAICBAICAgICAg<br />
ICAgICBNICBPQk9NT01NQHEgIE0gICAgICAgICAgLkAgIEBACiAgICAg<br />
IISVT3ZCICAgICAgICAgICBCOnWMTU1PTU9NTUJKaUIgICAgICAgICAg<br />
LkJ2TUBCCiAgICAgIIRCkUKYSiAgICAgICAgIDCRQpdNTU9NT01PTUKV<br />
QkB1ICAgICAgICAgcUBAQEJACiAgICAgIEKETUJCjHYgICAgICAgR4+L<br />
Qk1NTU1NTU1NTU1NQkKINSAgICAgICBGhEJNTUBCCiAgICAgIIdCQk1/<br />
QlBOaSAgIExNRUKFT01NTU2PQoNNTU9NTYpCWk03ICAgckVxQodNQkKE<br />
CiAgICAgIEKYloRCTSAgQm1ChEIgIHFCTU9NQpBChUKEQk1PTUJMICBC<br />
QEJAQiAgQEJAQkBNCiAgICAgICBKlm2GhFBCj0KEQplCN0eIT01CQi4g<br />
ICAsQE1NTUBxTEJAQkBAQEJxQkBCQnYKICAgICAgICAgIGlHQpUsaTCE<br />
TZZCbk1NT4tFICA6ICBNQE9NTUBAQEJAUGlpQEBOOgogICAgICAgICAg<br />
ICAgLiAgIEKXTZBCj01NTUBCQEJAQkBNTU1AQEBNQEIKICAgICAgICAg<br />
ICAgICAgICBAQkBCLmlATUJCQEJAQkBAQk1AOjpCQEJACiAgICAgICAg<br />
ICAgICAgICAgQkBAQCAuQkBCLjpAQkAgOkJAQiAgQEJATwogICAgICAg<br />
ICAgICAgICAgICAgOjAgckBCQCAgQkBAIC5AQkA6IFA6CiAgICAgICAg<br />
ICAgICAgICAgICAgICAgdk1CIDpAQkAgOkJPNwogICAgICAgICAgICAg<br />
ICAgICAgICAgICAgICAsQkBCCg==<br />
</pre><br />
<br />
=== ASCII Skull #2 ===<br />
<br />
Players discovered that this was Base64 and, once decrypted, resulted in another ASCII skull:<br />
<br />
<pre><br />
:PB.Bk: <br />
,jBˆ@B@B@B@BBL. <br />
7G–B“B•BMMMMMB@B@B@Nr <br />
:kB’B.ˆ—MMOMOMOMOMMMMŒB˜B@B1, <br />
:5‘B.B˜BˆBBMMOMOMOMOMOMOMMŠ’nBnB@BBu. <br />
70n†•BˆB’B”BXBBOMOMOMOMOMOMMBMPB˜BˆB@B@B@Nr <br />
G˜–—BJ iBˆB‡ˆ OBMOMOMOMOMOMOM–2 B.B@B. EB@B@S <br />
’–BM‡GJBU. iSuBˆOMOMOMOMOMOMM—OU1: .kBLMˆM†B— <br />
BŒMMB™B 7ˆBBMMOMOMOMOMOBB–: B‡BMMˆB <br />
.˜ˆBŠB 7’–@MMOMOMOMM@B@: @@B@B@ <br />
.’OLB. BNB.MMOMOMM.BEB rBjM„B <br />
.@ @ M OBOMOMM@q M .@ @@ <br />
„•OvB B:uŒMMOMOMMBJiB .BvM@B <br />
„B‘B˜J 0‘B—MMOMOMOMB•B@u q@@@B@ <br />
B„MBBŒv G.‹BMMMMMMMMMMMBBˆ5 F„BMM@B <br />
‡BBM.BPNi LMEB…OMMMM.BƒMMOMMŠBZM7 rEqB‡MBB„ <br />
B˜–„BM BmB„B qBMOMB.B…B„BMOMBL B@B@B @B@B@M <br />
J–m†„PB.B„B™B7GˆOMBB. ,@MMM@qLB@B@@@BqB@BBv <br />
iGB•,i0„M–BnMMO‹E : M@OMM@@@B@Pii@@N: <br />
. B—M.B.MMM@B@B@B@MMM@@@M@B <br />
@B@B.i@MBB@B@B@@BM@::B@B@ <br />
B@@@ .B@B.:@B@ :B@B @B@O <br />
:0 r@B@ B@@ .@B@: P: <br />
vMB :@B@ :BO7 <br />
,B@B <br />
</pre><br />
<br />
Players discovered that, once both skulls had been stripped of spaces, the bytes of each skull that aren't equal to 0 could be subtracted using [https://pastebin.com/g3kA1Pif a script]. Once compiled, players received the following string:<br />
<br />
<pre><br />
OHVSURPHWLXQMXHJR...FUHRTXHXVWHGHVORVGHWHFWLYHVGHMXHJRVOROODPDULDQXQWUDLOKHDG?EOCJGDXVD-DPEDV-FDODYHUDV.KWPO<br />
</pre><br />
<br />
Players discovered that this was a caesar cipher. After shifting the string forward 23 places, it resulted in:<br />
<br />
<pre><br />
LESPROMETIUNJUEGO...CREOQUEUSTEDESLOSDETECTIVESDEJUEGOSLOLLAMARIANUNTRAILHEAD?BLZGDAUSA-AMBAS-CALAVERAS.HTML<br />
</pre><br />
<br />
When cleaned up, the message read:<br />
<br />
<pre><br />
Les prometi un juego...creo que ustedes los Detectives de Juegos lo llamarían un trailhead? BLZGDUSA-AMBAS-CALAVERAS.HTML<br />
</pre><br />
<br />
When translated from Spanish to English:<br />
<br />
<pre><br />
I promised you a game...I believe you Game Detectives would call it a trailhead? BLZGDAUSA-AMBAS-CALAVERAS.HTML<br />
</pre><br />
<br />
<code>USA-AMBAS-CALAVERAS</code> translated to <code>USE-BOTH-SKULLS</code>, and the <code>.HTML</code> extension hinted at a URL.<br />
<br />
=== Skull Video ===<br />
<br />
BLZGDA refers to the servers that Blizzard uses to host media on their website. As such, this led players to [ https://blzgdapipro-a.akamaihd.net/media/screenshot/usa-ambas-calaveras.html this page], which contains a video of a vitals screen depicting a skull and some other medical information. In addition, it also contained a graphic of one of the ASCII skulls. An Imgur mirror can be found [https://i.imgur.com/6Pk69LX.png here].<br />
<br />
Within the properties of the video, players found another comment in Spanish:<br />
<br />
<pre><br />
Parecen estar muy interesados en estos "héroes". ¿Tal vez les interese conocer algunos detallitos que he averiguado sobre ellos?<br />
</pre><br />
<br />
In English:<br />
<br />
<pre><br />
You seem to be very interested in these "heroes". Maybe interested to know some details that I found out about them?<br />
</pre><br />
<br />
In addition, the video contains a heartbeat monitor, and a series of 26 lines above it. When players assigned the letters of the alphabet to the 26 lines, and used the "pings" of the heartbeat to determine what letters to use, the following string was found:<br />
<br />
<pre><br />
momentincrime<br />
</pre><br />
<br />
=== amomentincrime E-mail ===<br />
<br />
'momentincrime' appeared to refer to the in-universe TV show "A Moment in Crime," which can be seen in the Roadhog and Junkrat [https://www.youtube.com/watch?v=l5kTATxt7bE video] that came out months before the release of Overwatch. However, players also discovered a website, [https://amomentincrime.com amomentincrime.com], and displayed the following text:<br />
<br />
<pre><br />
...Estableciendo conexión...<br />
...Protocolo Sombra v1.3 iniciado...<br />
<br />
...Infiltrando la respuesta automática del email de pistas...<br />
<br />
...Terminando conexión...<br />
</pre><br />
<br />
Players discovered that sending an e-mail to tips@amomentincrime.com resulted in an automated email response:<br />
<br />
<pre><br />
Thank you for contacting A Moment in Crime's anonymous crime line!<br />
<br />
We have analyzed your submission and forwarded the information to the relevant parties. Your help could be vital in apprehending these cri<br />
<br />
...Estableciendo conexión...<br />
...Protocolo Sombra v1.7 iniciado...<br />
<br />
<br />
01:07:47 02:02:02 01:08:06 02:13:43 01:18:32<br />
01:18:21 02:10:19 01:06:21 02:05:18 01:04:02<br />
01:07:08 02:18:25 01:13:04 02:19:20 01:23:02<br />
01:16:40 02:16:35 01:23:04 02:17:16 01:06:42<br />
01:13:29 02:18:06 01:05:02 02:15:41 01:08:34<br />
<br />
j.7F57O,NLv:qj.7B:,1qv@B1j5ivB:,<br />
<br />
...Terminando conexión...<br />
<br />
minals and bringing them to justice. These fugitives are responsible for a string of robberies, arson, and other crimes stretching from Sydney to King's Row.<br />
<br />
Authorities believe that they have set their sights on crossing the Atlantic to America.<br />
</pre><br />
<br />
Players discovered that, if the sets of numbers were taken as AA:BB:CC, where AA was the number of skull (in order of discovery), BB was the row and CC was the column (as seen [https://i.imgur.com/ZgN2MVQ.png here]), and organized into a 5x5 matrix, it would result in:<br />
<br />
<pre><br />
S j G B L <br />
. @ M O k <br />
i , v : 0 <br />
E 7 r q N <br />
J P 5 F 1<br />
</pre><br />
<br />
Players discovered that this Matrix could be used as a bifid key to decode the text underneath the table of numbers in the email, as shown below:<br />
<pre><br />
j . 7 F 5 7 O , N L v : q j . 7 B : , 1 q v @ B 1 j 5 i v B : ,<br />
12 21 42 54 53 42 24 32 45 15 33 34 44 12 21 42 14 34 32 55 44 33 22 14 55 12 53 31 33 14 34 32<br />
<br />
1 2 2 1 4 2 5 4 5 3 4 2 2 4 3 2 4 5 1 5 3 3 3 4 4 4 1 2 2 1 4 2<br />
1 4 3 4 3 2 5 5 4 4 3 3 2 2 1 4 5 5 1 2 5 3 3 1 3 3 1 4 3 4 3 2<br />
<br />
11 24 23 14 43 22 55 45 54 34 43 23 22 42 31 24 45 55 11 52 35 33 33 41 43 43 11 24 23 14 43 22<br />
</pre><br />
<br />
This gave players the following string:<br />
<br />
SOMBr@1NF:rM@7iON1SP0vvErrSOMBr@<br />
This phrase was found to be leet-speak, and was translated to:<br />
<br />
<pre><br />
Sombra Information is power Sombra<br />
</pre><br />
<br />
The string <code>SOMBr@1NF:rM@7iON1SP0vvErrSOMBr@</code> was used as a password later on in the ARG.<br />
<br />
== A Moment in Crime Transmission ==<br />
<br />
[[File:Momentincrime.png|thumbnail|right|amomentincrime.com as of August 24th, 2016]]<br />
<br />
Once the 23-hour countdown on the Skycoder forum post reached zero, [https://amomentincrime.com amomentincrime.com] was updated. It now read:<br />
<br />
<pre><br />
...Estableciendo conexión...<br />
...Protocolo Sombra v1.9 iniciado...<br />
<br />
...Transmitiendo información a ómnicos activos... 2%<br />
<br />
...Terminando conexión...<br />
</pre><br />
<br />
Translated from Spanish to English:<br />
<br />
<pre><br />
...Establishing connection...<br />
...Sombra Protocol v1.9 initiated...<br />
...Transmitting information to active omnics... 2%<br />
<br />
...Ending connection...<br />
</pre><br />
<br />
A comment was also added to the source code:<br />
<br />
<pre><br />
Bien hecho, ya tienen mi clave. Hackear este programa de televisión no tuvo chiste. Espérense a lo que sigue.<br />
</pre><br />
<br />
When translated:<br />
<br />
<pre><br />
Well done, you have my password. Hacking this television program was meaningless. Wait for what is coming.<br />
</pre><br />
<br />
The percent on the amomentincrime.com slowly increased over time. Once the 5% milestone was hit, the Sombra Protocol version number changed to to v1.95. Afterwards, the percentage increased by 0.0038% every 3 minutes in real time.<br />
<br />
In addition, another comment was added:<br />
<br />
<pre><br />
Parece que se están calentando un poco las cosas... tendré que pasar desapercibida mientras esto se finaliza.<br />
</pre><br />
<br />
Translated:<br />
<br />
<pre><br />
It seems things are heating up a bit... I'll have to go unnoticed while this is finishing.<br />
</pre><br />
<br />
On 18th October at 19:02 GMT the site reached 100%, and the site updated with the following message:<br />
<br />
<pre><br />
...Transmisión finalizada - finalizando carga... <br />
...Carga finalizada. Unidad Bastion E-54 comprometida...<br />
</pre><br />
<br />
Which roughly translates to:<br />
<br />
<pre><br />
...Transmission complete - finishing upload...<br />
...Upload finished. Unit Bastion E-54 engaged...<br />
</pre><br />
<br />
Hidden in the source code of the site was the text <code>v1.4.0.2.324??</code>. Players then correctly assumed that this referred to a future build of Overwatch itself.<br />
<br />
== Sombra vs. LumériCo ==<br />
<br />
=== The Hacked Bastion ===<br />
<br />
On October 19, 2016, a new Overwatch version was released - version 1.4.0.2.32448. Shortly afterwards, the version number in the source code of the amomentincrime site updated to the same version number. After the build launched, players discovered that the hero Bastion had a strange interaction when near the "SOMBRA PROTOCOL" monitors on Dorado, and would emit a message in morse code, which can be heard [https://www.youtube.com/watch?v=Hkd__ceYm-Y here]. When the morse was decoded, players received the following string:<br />
<pre><br />
SQOFJFBNITIZWGDXSDO<br />
</pre><br />
<br />
Players discovered that this was a Vigenere cipher, and the key consisted of the alphabetic characters from the<br />
<code>SOMBr@1NF:rM@7iON1SP0vvErrSOMBr@</code> string, it was decoded to read:<br />
<br />
<pre><br />
ACCESSWWWLUMERICOMX<br />
</pre><br />
<br />
This led players to the [https://lumerico.mx/ LumeriCo website]. ''(Editor's note: as of 2018, this site appears to be inactive.)''<br />
<br />
=== LuméReaction ===<br />
<br />
[[File:Lumerico.png|thumbnail|right|The homepage of https://lumerico.mx]]<br />
<br />
The LumeriCo website was for the in-universe Mexican tech giant LumériCo, who had built several reactors in the Dorado region. The website had a [https://lumerico.mx/news news page], noting the imminent opening of a new reactor on November 1 as well as a recent attack on its construction site. There were also [https://lumerico.mx/about About] and [https://lumerico.mx/login Login] pages.<br />
<br />
Players also discovered a <code>robot.txt</code> file, which appeared to server no purpose and only contained the text <code>Allow: omnics</code>, and appeared to be a joke about the [https://en.wikipedia.org/wiki/Robots_exclusion_standard Robots exclusion standard]. Another text file was discovered called <code>omnics.txt</code>, which contained the text:<br />
<br />
<pre><br />
Allow: ??<br />
Allow: ???<br />
</pre><br />
<br />
And appeared to be yet anotehr joke about the Robots exclusion standard. And, finally, an <code>api</code> file that contained <code>{"message":"thanks for calling the api"}</code> and, humorously, has no practical purpose.<br />
<br />
=== Phone Number ===<br />
<br />
At the bottom of the LumeriCo website, players discovered a phone number <code>(510) 766-2726</code>. When called, players heard a woman listing off a string of numbers in Spanish, a recording of which can be found [https://soundcloud.com/jackwilsdon/510-766-2726a here]. The numbers spoken are: <code>5-2-4-1-3 (pause) 23-4-14-8-6-18-17-23-21-18-15</code>.<br />
When assuming that a=1, b=2, etc, the second part of the message can be decoded to: <code>WDNHFRQWURO</code>. This was found to be a ROT-23 cipher, and decoded to: <code>TAKECONTROL</code>.<br />
<br />
=== Take Control ===<br />
<br />
The phone message led players to an important [https://lumerico.mx/TAKECONTROL/index.html page] on the site, under the directory <code>TAKECONTROL</code>. It was styled the same way as amomentincrime.com and featured [https://lumerico.mx/calavera.png an image of Sombra's skull icon], named "calavera.png". There was also text on the page:<br />
<br />
<pre style="word-break:break-all;word-wrap: break-word;"><br />
ethldtíoíesnoemfetuylm.bnlsssqtann)hcnslararuCpdGeoopéqubdsroaan.arnasdmdor1vrsmerñerlsdacnnnoaexedsidcn.iarsgcyi,iqeqnd.pooitoaeaaransterLetéáedasodocMrnseeiuCsimnosetlójnueodacapsadcoanfasest.rnucaodacadmdoemoipíogPoipbehaSussai.,yccandin.reueatenaoiorneoeetaoéyenimt¿rPehec,uurobudeílrysriteenasni,adngpjrálireecgrolsmhYnao?nmonomepeldezmapcpunoaulrrruCstmeitltetlróesoapsdéyufcuascaa,rensbuinergnqedlmvlbpdtaz.enebuineuldoerecrGefqfirrasulrbeatHsilnbaúaeeaaooassraooa,ioedo:aLiuielPr ursmoootlnielteeánlosulobeauaanopearrúiesltéyrosssisuaaeaenremsieaismdjmolrsspebiecdéyusittnvrcacp.taebrtLiunróporner<br />
<br />
eúcrneuyraarsettsyrseen.aaPnrneuyraeastuCpnhl/wLloaloa.qartlsyuínreute.evgdpiuábdmPooucvdeccmoreurr.o?unriorydbaSnalegeáezadienáutalaaioeemfcbgdinableoc¿éppoeocelsumuoaHearsosqadrrrftuLiorannnoneneriiatcnlomoqnaqdunrcno,enmerosaereisloabolii.e.dormerosepopdé,eo:r#5scoegaqoeaibs(edioraamtdírnlyoetjcgratmnrrobnrsstloeYqoeocicpnómlpernmaepogenmodqamubodnaeasuaenMoolloupeqvgrLtúr<br />
<br />
tsosrdvoeaerroaeusdmaauamoMobsnaeanraunnt,roierbeoiemaodbmantursotñauoureeuoerreopc.etlr<br />
<br />
sotñneerLimeaFsNJ<br />
</pre><br />
<br />
Players found this to be a column order transposition cipher with the key <code>5 2 4 1 3</code>, which was found in the phone message. The cleaned up result was: <br />
<br />
<pre><br />
Los felicito por haber llegado hasta aquí. Solo quería saber si estaban listos. (Hey, es muy difícil encontrar buena ayuda últimamente...deberían ver algunos de los payasitos que están trabajando conmigo) Por ahora, continuemos con el verdadero reto: acabar con LumériCo y su president e Guillermo Portero. ¿Y porqué? Porque es un hombre codicioso, corrupto y un ladrón abominable. Su plan de traer en línea el más grande y el más poderoso zigurat el 1 de noviembre no es nada más que una artimaña, un elaborado plan designado para ejercer aún más influencia sobre la gente de México y en gordar los bolsillos de sus compinches. ¿Y quién va a pagar por eso? La gente común y corriente, los mismos que siempre quedan olvidados.<br />
<br />
He empezado a mejorar mis protocolos para que sean usados para derrumbar la infraestructura de LumériCo y Los Muertos también están intentando levantarse en contra de la corrupción. Mientras tanto, escarben por el sitio de LumériCo y busquen información que podamos usar en contra del cabrón, mejor aún, encuentren su nombre de usuario y contraseña para asegurarnos de que ciertos detalles no muy favorables sobre el presidentito...aparezcan...<br />
<br />
Pude encontrar el nombre de usuario y contraseña de un empleado de soporte de LumériCo, empiecen por ahí:<br />
<br />
GFlores/g#fNwP5qJ<br />
</pre><br />
<br />
Translated:<br />
<br />
<pre><br />
I'm congratulating you for getting in here. I only wanted to know if you were ready or not. (Hey, it's really difficult to get good help lately... you should see some of the clowns I'm working with). For now, let's continue with the true challenge: taking down Lumerico Corp president Guillermo Portero. Why? Because he's a greedy and corrupt man, and an abominable thief. His plan of bringing in line the most powerful and biggest zigurat the 1st of november us nothing more than a deceit, an elaborate plan by his gang to become even more influential in the people of Mexico and get more money. And who's gonna pay for that? Common people, the ones that are always forgotten.<br />
<br />
I've started upgrading my protocols so that they are used to take down the Lumerico Corp infraestructure and Los Muertos are also trying to go against the corruption. Meanwhile, search the Lumerico Corp site for info we can use against the bastard, or better, get his username and password so that hundreds "not so favorable" facts about the president start popping up.<br />
<br />
I was able to get the username and pass of a Lumerico Corp employee, start here:<br />
<br />
GFlores/g#fNwP5qJ<br />
</pre><br />
<br />
=== Presidential Login ===<br />
<br />
Players used the credentials above on the [https://lumerico.mx/login Lumerico login page], and accessed the account of Gonzalo Flores, which included [https://lumerico.mx/email his emails]. Transcripts of these emails were archived [https://docs.google.com/spreadsheets/d/1zh7OU2dEOnD4X43ImvZBNpS75FLkj-rL75pXJ2l3TuQ/htmlview?sle=true# here].<br />
<br />
However, only one email had relevance to the ARG:<br />
<br />
<pre><br />
De:Valeria Valderrama<VValderama@lumerico.mx><br />
Para:Gonzalo Flores<GFlores@lumerico.mx><br />
Asunto:Página de Guillermo<br />
<br />
Hola, Gonzo:<br />
¿Puedes ver el tráfico de https://lumerico.mx/president-bypass? Guillermo debería ser el único accediendo desde su página de inicio privada, pero parece que está teniendo mucho tráfico. Tal vez tengamos que escalar esto a<br />
la señorita Jiménez, pero quiero estar segura de que es digno de su tiempo.<br />
<br />
Valeria Valderrama<br />
</pre><br />
<br />
The email referenced high traffic on the [https://lumerico.mx/president-bypass President Bypass Link]. The page displayed an "access denied" message, but players found a <code>President Auth-Bypass Revision 1.02: /.git/</code> line in the source code.<br />
<br />
This line led players to [https://github.com/internetwache/GitTools/tree/master/Dumper dump the data] from the [https://lumerico.mx/president-bypass/.git/ /.git/ subpage] with git protocol and upload it to [https://gist.github.com/anonymous/987beb6a5c817b53da820562854bdebe Github]. These were the code files behind the website, and included a '''class.authentication.php''' file that contained an encryption function, and '''class.president-bypass.php''' file which contained the president's (Guillermo Portero) username, <code>GPortero</code>, and encrypted password <code>?MzY:MTI5:?AzY:OWM?:?EDO:ZGU?:jVTM:MTJm:2ITM:MTUw:?QjY:OWY?:?kTO:MTQx:?MzY</code>.<br />
<br />
Some players wrote a function to decode the encrypted <code>class.authentication.php</code> file, and then used it on the encrypted password. The resulting password was <code>Xy@4+Bkuqd<53uJ</code>.<br />
<br />
After logging in to the President's account, players were able to read his emails. After 30 minutes, another email appeared in the President's inbox, from Sombra herself:<br />
<br />
<pre><br />
Veo que se han podido infiltrar en su correo.<br />
No se preocupen, él no puede ver este correo, lo he ocultado de su vista si se conecta desde una de sus direcciones conocidas de IP.<br />
Necesito un poco más de tiempo para establecer el próximo grupo de potocolos. Manténganse atentos a principios de la otra semana. Le echaré unos cuantos trapitos sucios en sus correos para que se filtren al público<br />
"accidentalmente". Ya veremos como reaccionan los medios de comunicación.<br />
</pre><br />
<br />
The rough translation was:<br />
<br />
<pre><br />
I see you have been able to infiltrate into his mail.<br />
Don't worry, he cannot see this email, I've hidden it from his sight if he connects from one of his known IP addresses.<br />
I need a little bit of time to establish the next set of protocols. Stay alert early next week. I'll throw some dirty laundry in his emails that can "accidentally" leak to the public. We'll see how the media will react to that.<br />
</pre><br />
<br />
=== Admin Access ===<br />
<br />
[[File:Lumerico admin panel.png|thumbnail|right|The admin panel of the Lumerico site, only accessible by logging in as MJimenez]]<br />
<br />
On October 25, 2016, new emails were discovered in the GFlores account, but they had no immediate significance to the ARG. In addition, omnics.txt was updated:<br />
<br />
<pre><br />
Allow: Tzolk'in<br />
Allow: Imix ChikchanManik Imix ChikchanImixChikchanImix Manik Chikchan Imix Kimi Chikchan Chikchan Kimi ChikchanImixChikchanImix ChikchanKimi<br />
</pre><br />
<br />
Tzolk'in is the name of a [[Wikipedia:Maya calendar#Tzolk'in|Mayan Calendar]], and the second line was a series of animals from it in the Tzolk'in dialect. Imix stands for Day 1, Chikchan — 5, Manik — 7 and Kimi — 6. When turned into numbers, the string read <code>1 57 1 5151 7 5 1 6 5 5 6 5151 56</code>. These digits turned into pictograms of [[Wikipedia:Maya numerals|Maya numerals]] (one by one, not numbers as a whole) written horizontally become <code>. -..- . -.-. ..- - . .- - - .- -.-. -.-</code> This was found to be morse code, and decoded to: <code>EXECUTEATTACK</code>.<br />
<br />
This led players to the "EXECUTEATTACK" [https://lumerico.mx/EXECUTEATTACK/index.html directory], where the following text was discovered:<br />
<br />
<pre><br />
Ha llegado el momento. Esos correos expuestos la verdad sobre Portero, iniciado la revuelta, y hemos convencido a la gente de México a apoyar nuestra causa. Ahora es el momento para el golpe. Convertiremos su preciada inauguración el 1 de noviembre en un gran movimiento en su contra. Necesito que hagan una cosa:<br />
Consigan acceso al correo del jefa de seguridad y busquen alguna forma de ayudarme en el ataque. Es posible que lo vean contactando a Portero pronto. He cambiado su contraseña a: d0r*NuLw9<br />
</pre><br />
<br />
Translated to English:<br />
<br />
<pre><br />
The moment has come. These emails exposed the truth about Portero, initiated the revolt, and have convinced people of Mexico to support our cause. Now is the time to strike. Convert his precious inauguration on November 1 to a large movement against it. I need you to do one thing:<br />
Get access to the email security chief and seek some form of help in the attack. You may see her contacting Portero soon. I've changed her password: d0r*NuLw9<br />
</pre><br />
<br />
Logging in with the credentials <code>MJimenez / d0r*NuLw9</code> gave players access to the [https://lumerico.mx/admin admin panel] of the LumeriCo reactor. Until November 1, 2016, it stayed inactive and any command was answered with the same message saying that the terminal disconnected.<br />
<br />
=== The Terminal ===<br />
Once the console became usable, players could type <code>help</code> to see a list of commands:<br />
<br />
'''override''' Engineer safety mode override<br />
'''help''' Provides help information about commands<br />
'''version''' Displays system version information<br />
'''about''' Displays information about the system<br />
'''grep''' Search output by string<br />
<br />
In the MJimenez email account, there was an email labeled <code>Corrupción de correo electrónico</code> with highlighted text in side of it, specifically <code>/ter/</code>. After some hard thinking, people discovered that doing <code>about | grep 'ter'</code> (in linux this is a command to list all the lines from the ''about'' that have a substring ''ter'') returns this text:<br />
<br />
'''Open''' source lightweight shell for any terminal.<br />
'''Anything''' with a terminal<br />
'''1.1.0''' - expanded terminal support<br />
<br />
The first word of every line given from the output was boldened and purple. Putting the words together, we got <code>OpenAnything1.1.0</code>, which was a solution which was used shortly.<br />
<br />
Another available command for the terminal was <code>override</code>. After typing <code>override</code>, the console prompted ARG players with three security questions:<br />
<br />
# '''Favorite Movie'''. The answer to the prompt is <code>some like it bot</code>, a movie from the Overwatch universe.<br />
# '''Favorite Cookie Flavor'''. The answer being <code>nuevas sabor delicias</code>, a flavor referenced in an email in the MJimenez account.<br />
# '''Secret'''. The answer to this prompt is <code>OpenAnything1.1.0</code>.<br />
<br />
This returned <code>OK</code>, gave players admin access, and enabled a new set of commands: <br />
<br />
'''ls''' Lists files by path<br />
'''cat''' Read file by path<br />
'''exec''' Execute a file <br />
<br />
Typing <code>ls</code> listed two files: <code>payload</code> and <code>d_ilqh_nhb.html</code> (the file name is a ROT23 for ''a_fine_key'').<br />
<br />
[[Image:A fine key.png|thumb|right|a_fine_key.html]] Reading the second file with <code>cat mnt/d_ilqh_nhb.html</code> yielded a text where ASCII characters (repeating string <code>vhnl tldv xyl vcxelo xv qhrtv. zkolg[nl]</code>) were in a shape of a key. Deciphering it using the Affine cipher (A=23, B=23) yielded the following string: <code>some keys are shaped as locks. index[me]</code>. It is assumed that ''some keys are shaped as locks'' line alluded to the [[#Tracer_Trail_Cipher|Tracer Trail]] ciphertext being used as a key.<br />
<br />
Simultaneously, entering <code>exec payload</code> presented players with a prompt — the answer to which is the [[#Tracer_Trail_Cipher|Tracer Trail]]. When inputted, players were given a message that looked quite similar to what was previously seen at amomentincrime.com. The counter shown in the top right is then incremented.<br />
<br />
[[Image:LumericoTerminalTracerEntered.jpg|850px]]<br />
<br />
=== Misdirection ===<br />
<br />
[[Image:LumericoHacked.jpg|thumb|right|lumerico.mx website hacked by Sombra]]<br />
<br />
On October 1, 2016, the lumerico.mx home page changed to show "glitches" and the black overlay with a message under the purple skull, while a string <code>&lt;!-- MISDIRECTION --></code> was also added to the source of the page.<br />
<br />
The message says: <br />
<br />
<pre><br />
Buen trabajo, amigos. No lo hubiera logrado sin su ayuda. En fin, me consiguieron los recursos que necesitaba para mi siguiente golpe – les encantará.<br />
Esperen noticias de mí en los próximos días...<br />
Les voy a mandar algo para agradecerles… Ojalá lo puedan aprovechar.<br />
Dasvidanya amigos<br />
</pre><br />
<br />
Translated:<br />
<br />
</pre><br />
Good job, folks. I would not have done it without your help. Anyway, I got the resources needed for my next hit - you'll love it.<br />
Expect to hear from me in the coming days...<br />
I'm going to send something to thank you ... Hopefully you can use it.<br />
Dasvidanya friends<br />
</pre><br />
<br />
[[File:Dia de los muertos spray.jpg|thumbnail|right|The Día de Los Muertos spray that was added to the game after Sombra hacked the Lumerico site]]<br />
<br />
Note that ''Dasvidanya'' is a phonetic transliteration of ''до свиданья'' — a russian phrase for "goodbye". The thing that Sombra sent as a ''thank you'' was a new spray, named "Día de Los Muertos" after the Mexican festival that took place at the same time as the ARG. The spray is currently only available on the PC version of the game.<br />
<br />
The '''MISDIRECTION''' string lead to the page [https://lumerico.mx/MISDIRECTION/index.html https://lumerico.mx/MISDIRECTION/index.html] containing:<br />
<br />
...Estableciendo conexiуn...<br />
...Protocolo Sombra v2.3 iniciado...<br />
<br />
...Desviando datos del zigurat de LumériCo hacia el objetivo...<br />
...Descifrando contraseсas del objetivo...<br />
...Acceso otorgado al directorio de volskayaindustries.com...<br />
<br />
...boop ;)...<br />
...Terminando conexión...<br />
<br />
Translated: <br />
<br />
...Establishing connection...<br />
...Sombra Protocol v2.3 initiated...<br />
<br />
...Forwarding the data from the LumériCo ziggurat to the target...<br />
...Deciphering the target passwords...<br />
...Access Granted to the directory of volskayaindustries.com...<br />
<br />
...boop ;)...<br />
...Ending connection..<br />
<br />
== Blizzcon ==<br />
<br />
Blizzcon 2016 opened with the [https://www.youtube.com/watch?v=Og5-Pm4HNlI Overwatch short "Infiltration"], a short depicting Reaper, Widowmaker, and Sombra on Volskaya Industries. During the showing of the short, Sombra's [https://playoverwatch.com/en-us/heroes/sombra hero page] went live, showcasing her abilities and character backstory.<br />
<br />
[[File:SombraBG.jpg|center|500px]]<br />
<br />
== References ==<br />
<br />
=== Community Resources ===<br />
<br />
A collection of tools and resources made by the Game Detectives Discord community for use in the ARG.<br />
<br />
==== ASCII Skull ====<br />
<br />
'''ASCII Skull Analysis:''' https://github.com/bahamas10/sombra<br />
<br />
'''Removing SOMBR@ Analysis:''' https://pastebin.com/15u27YTC<br />
<br />
'''ASCII Skull Eye Analysys:''' https://docs.google.com/spreadsheets/d/1-JQpWyitMKYhP-4l8ZDFiJI3NjqRrvoEnRdFQawike8<br />
<br />
==== Google Docs ====<br />
<br />
'''Observations and Speculations Spreadsheet:''' https://docs.google.com/spreadsheets/d/1rI08baFQmAwaqHC-9GF9VNGCYjuRE-q4LN9k4ottjuQ/pubhtml<br />
<br />
'''LumériCo Emails and Translations Spreadsheet:''' https://goo.gl/cQgdIJ (Courtesy of UberPilot)<br />
<br />
==== Tracer Code ====<br />
<br />
'''GOL! Guesser:''' https://axxim.net/ow/gol-guesser/<br />
<br />
'''Uber GOL! Guesser:''' https://axxim.net/ow/gol-guesser/uber/<br />
<br />
The Uber GOL! Guesser only prints out UTF-8 compliant results, which makes it easier to identify potentially correct answers.<br />
<br />
'''Bruteforcing tool:''' https://github.com/glv2/bruteforce-salted-openssl<br />
<br />
=== Third-Party Resources ===<br />
<br />
A collection of third-party tools and resources that the Game Detectives Discord community has used in the ARG.<br />
<br />
==== Image of Reaper ====<br />
<br />
'''stegdetect (Linux):''' https://github.com/abeluck/stegdetect<br />
<br />
stegdetect is a Linux utility used to determine if a given image may contain encoded information.<br />
<br />
'''JPHide & JPSeek:''' https://linux01.gwdg.de/~alatham/stego.html<br><br />
'''iSteg (Mac OSX):''' https://www.hanynet.com/isteg/<br />
<br />
JPHide & JPSeek is used to hide and find, respectively, a file inside a JPEG image.<br><br />
iSteg works similarly to JPHide on the Mac OSX platform.<br />
<br />
'''stegbreak (Linux):''' https://linux.die.net/man/1/stegbreak<br />
<br />
stegbreak is used to do brute-force dictionary attacks on JPEG images.<br />
<br />
=== Easter Eggs ===<br />
<br />
The following are collection of references and Easter Eggs encountered throughout the ARG.<br />
<br />
==== In-Game ====<br />
<br />
'''Sombra's "Amused" Emote'''<br />
<br />
This character emote features the [[Sombra_ARG_False_Leads | Skycode]], accompanied by soft music resembling the [https://www.reddit.com/r/Overwatch/comments/4w7ey1/the_sombra_skysong/ Skysong]. Sombra's expression is one of amusement, and it's a nod to the community's prolonged creative attempts to solving an nonexistent puzzle.<br />
<br />
[[File:EmoteSkycode.png|200px]]<br />
<br />
'''Skycode Spray'''<br />
<br />
This character spray features Sombra's iconic skull in front of a compass rose and the [[Sombra_ARG_False_Leads | Skycode]]. This is a reference to both the [[#Directions_&_Letters|cardinal directions]] used in one of the puzzles and to the Skycode, which is considered the most significant false lead that solvers encountered.<br />
<br />
[[File:SkycodeSpray.png|200px]]<br />
<br />
==== In-ARG ====<br />
<br />
'''Espresso Command'''<br />
<br />
There was a hidden command in LumériCo's [[#The_Terminal | admin terminal]]. Inputting the word <code>espresso</code> returned the following message: <code>Coffee Pot Status: Brewed approximately 23 hours ago, currently 0% full</code><br />
This is referencing a variety of [https://goo.gl/cQgdIJ emails] found in the LumériCo site involving broken espresso machines and incompetent coffee brewing, which caught the attention of the community and gave way to a vast variety of mediocre jokes. Furthermore, "23 hours" makes reference to the number 23, which was believed by many to possess some sort of significance to the ARG, as Sombra would be the 23rd character in Overwatch. Finally, "0%" references the ARG's notable waiting periods that have been widely criticized by the community, specifically [[#A_Moment_in_Crime_Transmission | A Moment in Crime's upload percentage]].<br />
Due to the iconic purple text it is believed that this hidden command was created by Sombra herself.<br />
<br />
[[File:EspressoCommand.png]]<br />
<br />
=== Media Appearances ===<br />
<br />
'''3rd Aug. 2016'''<br />
<br />
[EN] [https://kotaku.com/overwatch-fans-find-new-clues-about-the-mysterious-hero-1784767759 Kotaku - Overwatch Fans Find New Clues About The Mysterious Hero Sombra]<br />
<br />
[EN] [https://www.polygon.com/2016/8/3/12369144/overwatch-summer-games-sombra-arg-blizzard?utm_campaign=polygon&utm_content=chorus&utm_medium=social&utm_source=twitter Polygon - Overwatch fans are trying to crack the latest mystery about Sombra]<br />
<br />
[EN] [https://www.pcgamesn.com/overwatch/overwatch-sombra PCGamesN - Overwatch's Sombra ARG continues with new clues, but no solutions]<br />
<br />
[EN] [https://team-dignitas.net/articles/blogs/overwatch/9989/who-is-sombra-all-facts-and-clues-about-sombra Team-Dignitas - Who is Sombra? All facts and clues about Sombra]<br />
<br />
[FR] [https://overwatch.gamewave.fr/un-nouveau-code-cache-dans-la-derniere-cinematique-d-overwatch/ Gamewave - UN NOUVEAU CODE CACHÉ DANS LA DERNIÈRE CINÉMATIQUE D'OVERWATCH!]<br />
<br />
[EN] [https://www.follownews.com/overwatch-fans-find-new-clues-about-the-mysterious-hero-sombra-1nhqt FollowNews - Overwatch Fans Find New Clues About The Mysterious Hero Sombra]<br />
<br />
'''4th Aug. 2016'''<br />
<br />
[EN] [https://www.pcgamer.com/overwatch-summer-games-trailer-hides-a-mysterious-secret/ PCGamer - Overwatch Summer Games trailer hides a mysterious secret]<br />
<br />
[SK] [https://www.sector.sk/novinka/121273/nove-overwatch-video-obsahuje-dalsie-tajomstva.htm Sector - Nové Overwatch video obsahuje ďalšie tajomstvá]<br />
<br />
[EN] [https://www.techinsider.io/overwatch-sombra-character-2016-8 Techinsider - 'Overwatch' players are going to insane lengths to solve a mystery that Blizzard's teased for months]<br />
<br />
[EN] [https://gamerant.com/overwatch-sombra-clues/ Gamerant - Overwatch Players Uncover More ‘Sombra’ Clues]<br />
<br />
[HU] [https://www.gamestar.hu/hir/overwatch-sombra-karakter-214739.html Gamestar - Overwatch - újabb nyomok utalnak a még be nem jelentett hősre]<br />
<br />
'''5th Aug. 2016'''<br />
<br />
[EN] [https://kotaku.com/days-later-overwatch-fans-cant-figure-out-the-sky-cod-1784872143 Kotaku - Days Later, Overwatch Fans Can't Figure Out The 'Sky Code' Mystery]<br />
<br />
[NL] [https://www.gamersnet.nl/nieuws/201608/cryptische_speurtocht_naar_overwatch_nieuwe_heldin_sombra_gaat_bizar_diep/ Gamersnet - Cryptische speurtocht naar Overwatch' nieuwe heldin Sombra gaat bizar diep]<br />
<br />
[ES] [https://www.alfabetajuega.com/noticia/overwatch-el-enigma-de-sombra-sigue-ofreciendo-nuevos-detalles-n-71772 Alfa Beta Jeuga - Overwatch: El enigma de Sombra sigue ofreciendo nuevos detalles]<br />
<br />
[EN] [https://www.youtube.com/watch?v=5ROjN-_F0ZU&feature=youtu.be&t=4m22s IGN (Video) - Sombra: Overwatch's Secret New Hero - Overwatch HQ]<br />
<br />
'''7th Aug. 2016'''<br />
<br />
[EN] [https://www.gamespresso.com/2016/08/summary-state-sombras-arg-overwatch/ Gamespresso - Summary of the state of sombra's ARG in Overwatch]<br />
<br />
'''8th Aug. 2016'''<br />
<br />
[EN/CN] [https://www.zhentoo.com/doc92368 Zhentoo - Overwatch new hero Secret Dorado hidden mystery] <br />
<br />
[EN] [https://www.technewstoday.com/30880-overwatch-sombra-continues-to-elude-detectives/ TechNewsToday - Overwatch: Sombra Continues to Elude Detectives]<br />
<br />
'''11th Aug. 2016'''<br />
<br />
[EN] [https://www.youtube.com/watch?v=IZR-pa0it4Q The Know - New Overwatch Hero Hints]<br />
<br />
'''12th Aug. 2016'''<br />
<br />
[EN] [https://kotaku.com/after-two-weeks-overwatch-fans-sombra-investigation-re-1785204389 Kotaku - Overwatch Fans' Sombra Investigation Reaps A Skull Code]<br />
<br />
'''14th Aug. 2016'''<br />
<br />
[EN] [https://gamerant.com/overwatch-sombra-skull-code/ Gamerant - Skull Code is Latest Clue in Overwatch’s Sombra Investigation]<br />
<br />
'''16th Aug. 2016'''<br />
<br />
[EN] [https://www.christiantoday.com/article/overwatch.dlc.update.skull.code.the.latest.clue.for.sombra.investigation/93197.htm Christian Today - 'Overwatch' DLC update: Skull Code the latest clue for Sombra investigation]<br />
<br />
[EN] [https://en.yibada.com/articles/151811/20160816/overwatch-dlc-update.htm Yibada - 'Overwatch' DLC update: New clues on Sombra's inclusion to the roster revealed]<br />
<br />
'''23rd Aug. 2016'''<br />
<br />
[EN] [https://www.technewstoday.com/31129-overwatch-all-we-know-about-the-sombra-arg/ Tech News Today - Overwatch: All We Know About the Sombra ARG]<br />
<br />
'''24th Aug. 2016'''<br />
<br />
[EN] [https://gamerant.com/overwatch-forums-sombra-message/ Gamerant - Overwatch Forums Glitch Out, Reveals Hidden Message From Sombra]<br />
<br />
[EN] [https://gamerant.com/overwatch-sombra-clue-website/ Gamerant - New Website Counts Down To Next Clue For Overwatch’s Sombra]<br />
<br />
[EN] [https://www.polygon.com/2016/8/24/12623736/overwatch-sombra-arg-clues-skycoder Polygon - Overwatch's Sombra mystery appears to be coming to a close]<br />
<br />
[EN] [https://www.vg247.com/2016/08/24/overwatch-forums-glitch-out-reveal-a-message-from-the-mysterious-sombra/ VG247 - Overwatch forums glitch out, reveal a message from the mysterious Sombra]<br />
<br />
[EN] [https://www.technewstoday.com/31151-sombra-hacks-into-overwatch-forums/ Tech News Today - Sombra Hacks Into Overwatch Forums]<br />
<br />
[EN] [https://www.ign.com/articles/2016/08/24/overwatch-mystery-character-sombra-could-be-revealed-today IGN - Overwatch Mystery Character Sombra Could Be Revealed Today]<br />
<br />
'''25th Aug. 2016'''<br />
<br />
[EN] [https://kotaku.com/overwatch-players-are-getting-fed-up-with-the-sombra-ar-1785765307 Kotaku - Overwatch Players Are Getting Sick Of The Sombra ARG]<br />
<br />
[EN] [https://www.ign.com/articles/2016/08/25/overwatch-made-the-internet-lose-its-mind-last-night-and-i-had-a-front-row-seat IGN - Overwatch Made the Internet Lose its Mind Last Night, And I Had a Front-Row Seat]<br />
<br />
[EN] [https://www.technewstoday.com/31182-overwatch-countdown-to-sombra/ Tech News Today - Overwatch: Countdown to Sombra]<br />
<br />
<br />
'''30th Aug. 2016'''<br />
<br />
[EN] [https://www.pcgamer.com/overwatch-sombra-arg-mystery/ PC Gamer - Overwatch's Sombra riddle begins to irritate the players trying to solve it]<br />
<br />
'''3rd Oct. 2016'''<br />
<br />
[EN] [https://www.mobilenapps.com/articles/19398/20161003/overwatch-update-sombra-blizzcon-halloween-event-leak.htm Mobile & Apps - Sombra To Be Revealed At Blizzcon? Halloween Event Confirmed In Data Leak]<br />
<br />
'''4th Oct. 2016'''<br />
<br />
[EN] [https://www.itechpost.com/articles/36011/20161004/overwatch-overwatch-update-overwatch-finally-getting-sombra-overwatch-sombra-sombra.htm iTechPost - Overwatch Update: Are We Finally Getting Sombra?]<br />
<br />
'''11th Oct. 2016'''<br />
<br />
[EN] [https://www.kotaku.com.au/2016/10/overwatch-fans-hacked-actual-people-in-an-attempt-to-find-sombra/ Kotaku - Overwatch Fans Hacked Actual People In An Attempt To Find Sombra]<br />
<br />
'''17th Oct. 2016'''<br />
<br />
[EN] [https://telkomgaming.co.za/will-sombra-hack-her-way-into-blizzcon-2016/ TelKom Gaming - Will Sombra Hack Her Way Into BlizzCon 2016?]<br />
<br />
'''18th Oct. 2016'''<br />
<br />
[EN] [https://overwatchtips.info/overwatch-sombra-arg-everything-you-need-to-know/ OverwatchTips - Everything You NEED To Know (Sombra ARG)]<br />
<br />
'''26th Oct. 2016'''<br />
<br />
[EN] [https://mic.com/articles/157757/overwatch-sombra-arg-everything-we-know-about-the-countdown-and-rumored-nov-1-release#.UILrZHRiM Min Network - Everything we know about Blizzard's rumored Nov. 1 release]<br />
<br />
'''28th Oct. 2016'''<br />
<br />
[EN] [https://kotaku.com/imagining-horror-stories-for-a-never-ending-overwatch-a-1788324673 Kotaku - Imagining Horror Stories Of A Never-Ending Overwatch ARG]<br />
<br />
'''1st Nov. 2016'''<br />
<br />
[EN] [https://www.ign.com/videos/2016/11/01/will-overwatchs-sombra-be-at-blizzcon-2016 IGN - Will Sombra be at BlizzCon 2016?]<br />
<br />
'''8th Nov. 2016'''<br />
<br />
[EN] [https://mic.com/articles/158812/overwatch-sombra-arg-gameplay-emote-directly-references-one-of-the-wildest-fan-theories Mic Tech - 'Overwatch' Sombra ARG: Gameplay emote directly references one of the wildest fan theories]</div>Halke234https://wiki.gamedetectives.net/index.php?title=Sombra_ARG&diff=16622Sombra ARG2018-07-24T21:51:58Z<p>Halke234: /* Presidential Login */</p>
<hr />
<div>{{argbox<br />
| float = right<br />
| name = Sombra ARG<br />
| image = File:Sombra_skull.png<br />
| description= The Sombra ARG - an ARG involving an unreleased Overwatch hero.<br />
| creator = [https://www.blizzard.com/ Blizzard Entertainment]<br />
| type = Official<br />
| status = Completed<br />
| discovered = 2016-06-12<br />
| completed = 2016-11-04<br />
}}<br />
<br />
{{ArgHeader|arg=Sombra ARG}}<br />
The Sombra ARG was an ARG for the first-person shooter [https://www.playoverwatch.com Overwatch], developed by [https://www.blizzard.com/ Blizzard Entertainment]. Sombra was the name of a then-unreleased Overwatch hero. The ARG was comprised of clues and ciphers referencing Sombra, which were found in various developer updates and short animations.<br />
<br />
At the game's release, there were numerous pieces of in-game information that appeared in the map Dorado, hinting at a character called Sombra. When the hero Ana was revealed, more Sombra clues appeared in Ana's origin video. In the weeks that followed, more clues were discovered, which led up to a character reveal animation at BlizzCon 2016.<br />
<br />
== Ana Videos ==<br />
<br />
=== Ana Origin Video ===<br />
<br />
On July 12, 2016, a [https://www.youtube.com/watch?v=TE0CXgpNxG0 video] for the new Overwatch hero named Ana was released. At the 1:16 mark, players discovered a set of hexidecmial values:<br />
<br />
[[File:Ana_Hex2.png|400px]]<br />
<br />
<pre><br />
2E 2E 2E 7B 76 20 66 62 72 20 63 7E 72 79 72 20 7B 76 20 7E<br />
79 71 78 65 7A 76 74 7E D4 A4 79 2C 20 63 7E 72 79 72 20 72<br />
7B 20 67 78 73 72 65 2E 2E 2E 7B 76 20 66 62 72 20 63 7E 72<br />
79 72 20 7B 76 20 7E 79 71 78 65 7A 76 74 7E D4 A4 79 2C 20<br />
63 7E 72 79 72 20 72 7B 20 67 78 73 72 65 2E 2E 2E 7B 76 20<br />
66 62 72 20 63 7E 72 79 72 20 7B 76 20 7E 79 71 78 65 7A 76<br />
74 7E D4 A4 79 2C 20 63 7E 72 79 72 20 72 7B 20 67 78 73 72<br />
65 2E 2E 2E 7B 76 20 66 62 72 20 63 7E 72 79 72 20 7B 76 20<br />
7E 79 71 78 65 7A 76 74 7E D4 A4 79 2C 20 63 7E 72 79 72 20<br />
72 7B 20 67 78 73 72 65 2E 2E 2E 64 78 7A 75<br />
</pre><br />
<br />
A hex to ASCII translation yielded the following:<br />
<br />
<pre><br />
...{v fbr c~ryr {v ~yqxezvt~Ô¤y, c~ryr r{ gxsre...{v fbr c~ryr {v ~yqxezvt~Ô¤y, c~ryr r{ gxsre...{v fbr c~ryr {v ~yqxezvt~Ô¤y, c~ryr r{ gxsre...{v fbr <br />
c~ryr {v ~yqxezvt~Ô¤y, c~ryr r{ gxsre...dxzu<br />
</pre><br />
<br />
Using an XOR Cipher with the constant 23 on the above text resulted in the following message:<br />
<br />
<pre><br />
..la que tiene la información; tiene el poder...la que tiene la información; tiene el poder...la que tiene la información; tiene el poder...la que tiene la <br />
información; tiene el poder...somb<br />
</pre><br />
<br />
This was a repeating phrase in Spanish, which translated to:<br />
<br />
<pre><br />
She who has the information, has the power...<br />
</pre><br />
<br />
Players then discovered a second set of hexidecimal values at the 2:11 mark:<br />
<br />
[[File:Ana Hex.png|400px]]<br />
<br />
<pre><br />
65 76 2E 2E 2E 7B 76 20 66 62 72 20 63 7E 72 79 72 20 7B 76<br />
20 7E 79 71 78 65 7A 76 74 7E D4 A4 79 2C 20 63 7E 72 79 72<br />
20 72 7B 20 67 78 73 72 65 2E 2E 2E 7B 76 20 66 62 72 20 63<br />
7E 72 79 72 20 7B 76 20 7E 79 71 78 65 7A 76 74 7E D4 A4 79<br />
2C 20 63 7E 72 79 72 20 72 7B 20 67 78 73 72 65 2E 2E 2E 7B<br />
76 20 66 62 72 20 63 7E 72 79 72 20 7B 76 20 7E 79 71 78 65<br />
7A 76 74 7E D4 A4 79 2C 20 63 7E 72 79 72 20 72 7B 20 67 78<br />
73 72 65 2E 2E 2E 7B 76 20 66 62 72 20 63 7E 72 79 72 20 7B<br />
76 20 7E 79 71 78 65 7A 76 74 7E D4 A4 79 2C 20 63 7E 72 79<br />
72 20 72 7B 20 67 78 73 72 65 2E 2E 2E<br />
</pre><br />
<br />
When put through the same process, the same string of Spanish was revealed, but with the letters <code>ra</code> at the beginning of the message. These letters were combined with <code>somb</code> from the first cipher to create the name <code>sombra</code>. No more clues were discovered until the release of the Dev Update video.<br />
<br />
=== Dev Update Video ===<br />
<br />
[[File:Sombra Barcodes.png|thumbnail|right|The vertical barcodes found at the end of the Ana Dev Update video]]<br />
<br />
On July 19, 2016, the first [https://www.youtube.com/watch?v=evghkilg2eQ Developer Update] was released for Ana. At the end of the video, players discovered a series of vertical barcodes. When scanned, players discovered a large set of hexidecimal values which where then converted to binary, a dump of which is available [https://gist.github.com/zapu/31165efab0d6264e2fd0fa75cc53b1aa here].<br />
<br />
Turning the ones and zeroes into black and white pixels formed a QR code:<br />
<br />
[[File:Sombra_QR_code.png|300px]]<br />
<br />
Scanning this QR code yielded the following message: <code>¿Estuvo eso facilito? Ahora que tengo su atención, déjenme se las pongo más difícil.</code> In English, the message reads: <code>Was that easy? Well, now that I have your attention, allow me to make things much more difficult.</code> After this, no more clues were discovered until the Summer Games video was released.<br />
<br />
== Welcome to the Summer Games Video ==<br />
<br />
=== Tracer Trail Cipher ===<br />
<br />
[[File:Base64_trail.jpg|thumbnail|right|The unsolved base64 cipher in the Summer Games video]]<br />
<br />
'''Note: The cipher described below remains unsolved.'''<br />
<br />
On August 2, 2016, players discovered another cipher in the [https://www.youtube.com/watch?v=qpcOD9tJM4k Welcome to the Summer Games trailer]:<br />
<br />
<pre><br />
U2FsdGVkX1+vupppZksvRf5pq5g5XjFRIipRkwB0K1Y96Qsv2L<br />
m+31cmzaAILwytX/z66ZVWEQM/ccf1g+9m5Ubu1+sit+A9cenD<br />
xxqkIaxbm4cMeh2oKhqIHhdaBKOi6XX2XDWpa6+P5o9MQw==<br />
</pre><br />
<br />
Players discovered this text to be base64 encryption. When decrypted, players received the following output:<br />
<br />
<pre><br />
Salted__���ifK/E�i��9^1Q�*Q�t+V=�<br />
/ع��W/<br />
�_����V��?q����f�F���"��=q�������[��<br />
z��*����Z����u�\5�k�C<br />
</pre><br />
<br />
''(Note: copy/pasting this string will not work; some of the characters are not printable and are not even displayed correctly on this page)''<br />
<br />
==== Decrypting the Cipher ====<br />
<br />
The "Salted__" header at the start of the string indicated to players that the remainder of the text was encrypted with the OpenSSL software library, which requires a password and the encryption cipher that was used. Salt is added by OpenSSL to ensure uniqueness of the key and the IV derived from the password and used for the encryption. However, due to the age of OpenSSL and its massive library, it was proven to be quite difficult for players to identify the encryption used.<br />
<br />
==== Narrowing Down Ciphers ====<br />
<br />
[[File:HexOfEncryptedMessage.png|thumbnail|right|Hex view of the encrypted string]]<br />
<br />
Players narrowed down the potential ciphers used by examining a hex dump of the encrypted string. There are two major types of ciphers, stream ciphers and block ciphers. Stream ciphers encrypt only the data fed into them, whereas block ciphers always encrypt a certain number of bytes at a time (a "chunk").<br />
<br />
A byte is roughly a single character, but special characters can take up multiple bytes. We know that OpenSSL Salted Encryption uses the first 8 bytes of the output for <code>Salted__</code> and the next 8 bytes for the actual salt. The rest of the information is the '''encrypted message'''.<br />
<br />
The immediately interesting thing here is that the '''encrypted message''' data stops 3 bytes short of a full chunk. This is a excellent indicator that the cipher used is a stream cipher (or a block cipher in CTR/OFB/CFB mode). This narrows the list of potential ciphers down significantly. This also means that the final string that Blizzard encrypted is less than 93 bytes!<br />
<br />
'''This cipher remains unsolved, but it's speculated that Blizzard moved past the cipher by creating alternate puzzles.'''<br />
<br />
=== Directions & Letters ===<br />
<br />
Players discovered that in the North American version of the Summer Games trailer there were repeated references to the cardinal directions, each associated with a particular hero. These references were conspicuously absent from other versions of the trailer. These references are shown below, with the relevant heroes and timestamps:<br />
<br />
<gallery mode="packed"><br />
File:Ow1.png|East - Mercy - Route 66 - 0:17<br />
File:Ow2.png|Center - D. Va - Temple of Anubis - 0:19<br />
File:Ow3.png|North - Torbjorn - Nepal - 0:21<br />
File:Ow4.png|South - Genji - Hanamura - 0:22<br />
File:Ow5.png|Southeast - McCree - Hollywood - 0:24<br />
File:Ow6.png|West - Symmetra - Watchpoint: Gibraltar - 0:30<br />
File:Ow7.png|Southwest - Bastion - Hollywood - 0:34<br />
File:Ow8.png|Northeast - Winston - Volskaya Industries - 0:46<br />
File:Ow9.png|Northwest - Tracer - King's Row - 0:47<br />
</gallery><br />
<br />
Screenshots of all the directions and their respective heroes can be found in an album [https://imgur.com/a/FQXmy here].<br />
<br />
[[File:Overwatch map.jpg|frameless]]<br />
<br />
These heroes, arranged in this particular order, provided a password that was used later in the ARG.<br />
<br />
== Dorado Photo ==<br />
<br />
At an unknown date, a new, "corrupted" photo of the [https://blzgdapipro-a.akamaihd.net/media/screenshot/dorado-screenshot-004.jpg Dorado attackers spawn point] was added to the Overwatch [https://playoverwatch.com/en-us/media/ media page]. Players discovered that the screenshot was "'''datamoshed'''", which means it concealed a hidden message while also taking on a distorted appearance. ([https://prntscr.com/c3dce7 Here] is an example of purposely data moshing the image manually to achieve similar effects.) <br />
<br />
<gallery mode="packed" heights=500px><br />
File:dorado-datamosh.jpg|The datamoshed image<br />
File:dorado-screenshot-005.jpg|The original image<br />
</gallery><br />
<br />
After comparing the images with difference checking tools, players found that certain English and Spanish characters were replaced with exclamation points. The missing characters produced the following Spanish phrase:<br />
<br />
<code>Por que estan mirando al cielo? La respuesta no esta sobre sus cabezas, esta detras de ustedes. A veces, necesitan analizar sus logros previos.</code><br />
<br />
Translated into English, this phrase read:<br />
<br />
<code>Why are you looking at the sky? The answer isn't over your heads, it's behind you. Sometimes, you need to analyze your previous achievements.</code><br />
<br />
The phrase "Why are you looking at the sky?" was most likely a reference to a strange artifact that was discovered in the sky of the Dorado map, dubbed the "Skycode". The Skycode ended up being a red herring, and was completely unrelated to the ARG.<br />
<br />
=== Analyzing Achievements ===<br />
<br />
[[File:achievements.png|thumbnail|right|"¿" Achievement, comment in source code]]<br />
<br />
The phrase "you need to analyze your previous achievements" led players to look at the achievements on the [https://www.playoverwatch.com Overwatch] website. It was noticed noticed that by logging in and viewing the achievements on a player profile, a mystery achievement appeared. Examining a hex dump of the image lead players to a new phrase:<br />
<br />
<pre><br />
Vientos, nada mal. No obstante, me aburro. Intentemos algo nuevo en la misma dirección.<br />
uczihriwgsxorxwunaarawryqhbrsfmeqrjjmu 5552E494 78T3 4VM9 OPL6 IS8208O913KRlrx<br />
</pre><br />
<br />
Translated, it said:<br />
<br />
<pre><br />
Damn, not bad. However, I'm getting bored. Let's try something new in the same direction.<br />
uczihriwgsxorxwunaarawryqhbrsfmeqrjjmu 5552E494 78T3 4VM9 OPL6 IS8208O913KRlrx<br />
</pre><br />
<br />
== Volskaya Datamosh ==<br />
<br />
After a long period of toying around, players discovered that the ciphertext <code> uczihriwgsxorxwunaarawryqhbrsfmeqrjjmu 5552E494 78T3 4VM9 OPL6 IS8208O913KRlrx</code> from the "?" achievement was a Vigenére cipher. Players discovered the key <code>tracertorbjornwinstonsymmetradvamercybastiongenjimccree</code> by ordering the heroes in the Summer Games trailer by the cardinal directions associated with each of them, as said further above. Once decoded, players received the following text: <br />
<pre>blzgdapiproaakamaihdnetmediascreenshot 5552E494 78B3 4CE9 ACF6 EF8208F913CFjpg</pre><br />
<br />
Players found this to be a [https://blzgdapipro-a.akamaihd.net/media/screenshot/5552E494-78B3-4CE9-ACF6-EF8208F913CF.jpg blzgdapipro-a.akamaihd.net/media/screenshot/5552E494-78B3-4CE9-ACF6-EF8208F913CF.jpg URL], which led players to a datamoshed screenshot of the Volskaya Industries map. ''(Editor's note: This link appears to now be dead)''. When players ran a difference check with the [https://blzgdapipro-a.akamaihd.net/media/screenshot/volskaya-screenshot-004.jpg original image], they received an interesting message.<br />
<br />
<gallery mode="packed"><br />
File:volskaya-datamosh.jpg|The datamoshed image<br />
File:Volskaya-screenshot-004.jpg|The original image<br />
</gallery><br />
<br />
=== ASCII Skull #1 ===<br />
<br />
The diff from the datamoshed image resulted in the following output:<br />
<br />
<pre><br />
Parece que te gustan estos jueguitos... por que no jugamos uno de verdad?<br />
:PB@Bk:<br />
,jB@@B@B@B@BBL.<br />
7G@B@B@BMMMMMB@B@B@Nr<br />
:kB@B@@@MMOMOMOMOMMMM@B@B@B1,<br />
:5@B@B@B@BBMMOMOMOMOMOMOMM@@@B@B@BBu.<br />
70@@@B@B@B@BXBBOMOMOMOMOMOMMBMPB@B@B@B@B@Nr<br />
G@@@BJ iB@B@@ OBMOMOMOMOMOMOM@2 B@B@B. EB@B@S<br />
@@BM@GJBU. iSuB@OMOMOMOMOMOMM@OU1: .kBLM@M@B@<br />
B@MMB@B 7@BBMMOMOMOMOMOBB@: B@BMM@B<br />
@@@B@B 7@@@MMOMOMOMM@B@: @@B@B@<br />
@@OLB. BNB@MMOMOMM@BEB rBjM@B<br />
@@ @ M OBOMOMM@q M .@ @@<br />
@@OvB B:u@MMOMOMMBJiB .BvM@B<br />
@B@B@J 0@B@MMOMOMOMB@B@u q@@@B@<br />
B@MBB@v G@@BMMMMMMMMMMMBB@5 F@BMM@B<br />
@BBM@BPNi LMEB@OMMMM@B@MMOMM@BZM7 rEqB@MBB@<br />
B@@@BM B@B@B qBMOMB@B@B@BMOMBL B@B@B @B@B@M<br />
J@@@@PB@B@B@B7G@OMBB. ,@MMM@qLB@B@@@BqB@BBv<br />
iGB@,i0@M@B@MMO@E : M@OMM@@@B@Pii@@N:<br />
. B@M@B@MMM@B@B@B@MMM@@@M@B<br />
@B@B.i@MBB@B@B@@BM@::B@B@<br />
B@@@ .B@B.:@B@ :B@B @B@O<br />
:0 r@B@ B@@ .@B@: P:<br />
vMB :@B@ :BO7<br />
,B@B<br />
</pre><br />
<br />
'''Translation:'''<br />
<br />
<pre><br />
"It seems you like these little games... Why don't we play a real one?"<br />
</pre><br />
<br />
(''This is the python2 script to extract modified bytes from datamoshed Volskaya screenshot: https://gist.github.com/synap5e/27635d2ff6f0e3b15f0c902dca2974a9'')<br />
<br />
No further progress was made until August 23, 2016.<br />
<br />
== Overwatch Forums Glitching Page/ "Skycoder" ==<br />
<br />
On August 23rd, 2016, at an unknown time, an [https://us.battle.net/forums/en/overwatch/topic/20748794686 ominous post] by a user named "Skycoder" appeared on the official General Discussion forums for Overwatch. <br />
<br />
Players found that the name of the post, <code>00110010 00110011</code>, was binary for "23," which was a direct reference to Sombra being the 23rd hero in Overwatch. The age of the post started at 24 hours, and counted down rather than increasing. The post itself contained a single sentence in Spanish:<br />
<br />
<pre><br />
la que tiene la información; tiene el poder<br />
</pre><br />
<br />
Which, when translated to english, reads:<br />
<br />
<pre><br />
She who has the information, has the power.<br />
</pre><br />
<br />
After a short while, the post glitched and distorted, gradually turning a hue of purple. A text box then appeared, which printed the following ciphertext:<br />
<br />
<pre><br />
ICAgICAgICAgICAgICAgICAgICAgICAgICA6UEKPQms6CiAgICAgICAg<br />
ICAgICAgICAgICAgICAsakKIQEJAQkBCQEJCTC4KICAgICAgICAgICAg<br />
ICAgICAgIDdHlkKTQpVCTU1NTU1CQEJAQkBOcgogICAgICAgICAgICAg<br />
ICA6a0KSQpCIl01NT01PTU9NT01NTU2MQphCQEIxLAogICAgICAgICAg<br />
IDo1kUKNQphCiEJCTU1PTU9NT01PTU9NT01NipJuQm5CQEJCdS4KICAg<br />
ICAgICA3MG6GlUKIQpJClEJYQkJPTU9NT01PTU9NT01NQk1QQphCiEJA<br />
QkBCQE5yCiAgICAgIEeYlpdCSiBpQohCh4ggIE9CTU9NT01PTU9NT01P<br />
TZYyICBCj0JAQi4gRUJAQkBTCiAgICAgIJKWQk2HR0pCVS4gIGlTdUKI<br />
T01PTU9NT01PTU9NTZdPVTE6ICAua0JMTYhNhkKXCiAgICAgIEKMTU1C<br />
mUIgICAgICAgN4hCQk1NT01PTU9NT01PQkKWOiAgICAgICBCh0JNTYhC<br />
CiAgICAgII2YiEKKQiAgICAgICAgIDeSlkBNTU9NT01PTU1AQkA6ICAg<br />
ICAgICAgQEBCQEJACiAgICAgII+ST0xCLiAgICAgICAgICBCTkKPTU1P<br />
TU9NTY9CRUIgICAgICAgICAgckJqTYRCCiAgICAgIJBAICBAICAgICAg<br />
ICAgICBNICBPQk9NT01NQHEgIE0gICAgICAgICAgLkAgIEBACiAgICAg<br />
IISVT3ZCICAgICAgICAgICBCOnWMTU1PTU9NTUJKaUIgICAgICAgICAg<br />
LkJ2TUBCCiAgICAgIIRCkUKYSiAgICAgICAgIDCRQpdNTU9NT01PTUKV<br />
QkB1ICAgICAgICAgcUBAQEJACiAgICAgIEKETUJCjHYgICAgICAgR4+L<br />
Qk1NTU1NTU1NTU1NQkKINSAgICAgICBGhEJNTUBCCiAgICAgIIdCQk1/<br />
QlBOaSAgIExNRUKFT01NTU2PQoNNTU9NTYpCWk03ICAgckVxQodNQkKE<br />
CiAgICAgIEKYloRCTSAgQm1ChEIgIHFCTU9NQpBChUKEQk1PTUJMICBC<br />
QEJAQiAgQEJAQkBNCiAgICAgICBKlm2GhFBCj0KEQplCN0eIT01CQi4g<br />
ICAsQE1NTUBxTEJAQkBAQEJxQkBCQnYKICAgICAgICAgIGlHQpUsaTCE<br />
TZZCbk1NT4tFICA6ICBNQE9NTUBAQEJAUGlpQEBOOgogICAgICAgICAg<br />
ICAgLiAgIEKXTZBCj01NTUBCQEJAQkBNTU1AQEBNQEIKICAgICAgICAg<br />
ICAgICAgICBAQkBCLmlATUJCQEJAQkBAQk1AOjpCQEJACiAgICAgICAg<br />
ICAgICAgICAgQkBAQCAuQkBCLjpAQkAgOkJAQiAgQEJATwogICAgICAg<br />
ICAgICAgICAgICAgOjAgckBCQCAgQkBAIC5AQkA6IFA6CiAgICAgICAg<br />
ICAgICAgICAgICAgICAgdk1CIDpAQkAgOkJPNwogICAgICAgICAgICAg<br />
ICAgICAgICAgICAgICAsQkBCCg==<br />
</pre><br />
<br />
=== ASCII Skull #2 ===<br />
<br />
Players discovered that this was Base64 and, once decrypted, resulted in another ASCII skull:<br />
<br />
<pre><br />
:PB.Bk: <br />
,jBˆ@B@B@B@BBL. <br />
7G–B“B•BMMMMMB@B@B@Nr <br />
:kB’B.ˆ—MMOMOMOMOMMMMŒB˜B@B1, <br />
:5‘B.B˜BˆBBMMOMOMOMOMOMOMMŠ’nBnB@BBu. <br />
70n†•BˆB’B”BXBBOMOMOMOMOMOMMBMPB˜BˆB@B@B@Nr <br />
G˜–—BJ iBˆB‡ˆ OBMOMOMOMOMOMOM–2 B.B@B. EB@B@S <br />
’–BM‡GJBU. iSuBˆOMOMOMOMOMOMM—OU1: .kBLMˆM†B— <br />
BŒMMB™B 7ˆBBMMOMOMOMOMOBB–: B‡BMMˆB <br />
.˜ˆBŠB 7’–@MMOMOMOMM@B@: @@B@B@ <br />
.’OLB. BNB.MMOMOMM.BEB rBjM„B <br />
.@ @ M OBOMOMM@q M .@ @@ <br />
„•OvB B:uŒMMOMOMMBJiB .BvM@B <br />
„B‘B˜J 0‘B—MMOMOMOMB•B@u q@@@B@ <br />
B„MBBŒv G.‹BMMMMMMMMMMMBBˆ5 F„BMM@B <br />
‡BBM.BPNi LMEB…OMMMM.BƒMMOMMŠBZM7 rEqB‡MBB„ <br />
B˜–„BM BmB„B qBMOMB.B…B„BMOMBL B@B@B @B@B@M <br />
J–m†„PB.B„B™B7GˆOMBB. ,@MMM@qLB@B@@@BqB@BBv <br />
iGB•,i0„M–BnMMO‹E : M@OMM@@@B@Pii@@N: <br />
. B—M.B.MMM@B@B@B@MMM@@@M@B <br />
@B@B.i@MBB@B@B@@BM@::B@B@ <br />
B@@@ .B@B.:@B@ :B@B @B@O <br />
:0 r@B@ B@@ .@B@: P: <br />
vMB :@B@ :BO7 <br />
,B@B <br />
</pre><br />
<br />
Players discovered that, once both skulls had been stripped of spaces, the bytes of each skull that aren't equal to 0 could be subtracted using [https://pastebin.com/g3kA1Pif a script]. Once compiled, players received the following string:<br />
<br />
<pre><br />
OHVSURPHWLXQMXHJR...FUHRTXHXVWHGHVORVGHWHFWLYHVGHMXHJRVOROODPDULDQXQWUDLOKHDG?EOCJGDXVD-DPEDV-FDODYHUDV.KWPO<br />
</pre><br />
<br />
Players discovered that this was a caesar cipher. After shifting the string forward 23 places, it resulted in:<br />
<br />
<pre><br />
LESPROMETIUNJUEGO...CREOQUEUSTEDESLOSDETECTIVESDEJUEGOSLOLLAMARIANUNTRAILHEAD?BLZGDAUSA-AMBAS-CALAVERAS.HTML<br />
</pre><br />
<br />
When cleaned up, the message read:<br />
<br />
<pre><br />
Les prometi un juego...creo que ustedes los Detectives de Juegos lo llamarían un trailhead? BLZGDUSA-AMBAS-CALAVERAS.HTML<br />
</pre><br />
<br />
When translated from Spanish to English:<br />
<br />
<pre><br />
I promised you a game...I believe you Game Detectives would call it a trailhead? BLZGDAUSA-AMBAS-CALAVERAS.HTML<br />
</pre><br />
<br />
<code>USA-AMBAS-CALAVERAS</code> translated to <code>USE-BOTH-SKULLS</code>, and the <code>.HTML</code> extension hinted at a URL.<br />
<br />
=== Skull Video ===<br />
<br />
BLZGDA refers to the servers that Blizzard uses to host media on their website. As such, this led players to [ https://blzgdapipro-a.akamaihd.net/media/screenshot/usa-ambas-calaveras.html this page], which contains a video of a vitals screen depicting a skull and some other medical information. In addition, it also contained a graphic of one of the ASCII skulls. An Imgur mirror can be found [https://i.imgur.com/6Pk69LX.png here].<br />
<br />
Within the properties of the video, players found another comment in Spanish:<br />
<br />
<pre><br />
Parecen estar muy interesados en estos "héroes". ¿Tal vez les interese conocer algunos detallitos que he averiguado sobre ellos?<br />
</pre><br />
<br />
In English:<br />
<br />
<pre><br />
You seem to be very interested in these "heroes". Maybe interested to know some details that I found out about them?<br />
</pre><br />
<br />
In addition, the video contains a heartbeat monitor, and a series of 26 lines above it. When players assigned the letters of the alphabet to the 26 lines, and used the "pings" of the heartbeat to determine what letters to use, the following string was found:<br />
<br />
<pre><br />
momentincrime<br />
</pre><br />
<br />
=== amomentincrime E-mail ===<br />
<br />
'momentincrime' appeared to refer to the in-universe TV show "A Moment in Crime," which can be seen in the Roadhog and Junkrat [https://www.youtube.com/watch?v=l5kTATxt7bE video] that came out months before the release of Overwatch. However, players also discovered a website, [https://amomentincrime.com amomentincrime.com], and displayed the following text:<br />
<br />
<pre><br />
...Estableciendo conexión...<br />
...Protocolo Sombra v1.3 iniciado...<br />
<br />
...Infiltrando la respuesta automática del email de pistas...<br />
<br />
...Terminando conexión...<br />
</pre><br />
<br />
Players discovered that sending an e-mail to tips@amomentincrime.com resulted in an automated email response:<br />
<br />
<pre><br />
Thank you for contacting A Moment in Crime's anonymous crime line!<br />
<br />
We have analyzed your submission and forwarded the information to the relevant parties. Your help could be vital in apprehending these cri<br />
<br />
...Estableciendo conexión...<br />
...Protocolo Sombra v1.7 iniciado...<br />
<br />
<br />
01:07:47 02:02:02 01:08:06 02:13:43 01:18:32<br />
01:18:21 02:10:19 01:06:21 02:05:18 01:04:02<br />
01:07:08 02:18:25 01:13:04 02:19:20 01:23:02<br />
01:16:40 02:16:35 01:23:04 02:17:16 01:06:42<br />
01:13:29 02:18:06 01:05:02 02:15:41 01:08:34<br />
<br />
j.7F57O,NLv:qj.7B:,1qv@B1j5ivB:,<br />
<br />
...Terminando conexión...<br />
<br />
minals and bringing them to justice. These fugitives are responsible for a string of robberies, arson, and other crimes stretching from Sydney to King's Row.<br />
<br />
Authorities believe that they have set their sights on crossing the Atlantic to America.<br />
</pre><br />
<br />
Players discovered that, if the sets of numbers were taken as AA:BB:CC, where AA was the number of skull (in order of discovery), BB was the row and CC was the column (as seen [https://i.imgur.com/ZgN2MVQ.png here]), and organized into a 5x5 matrix, it would result in:<br />
<br />
<pre><br />
S j G B L <br />
. @ M O k <br />
i , v : 0 <br />
E 7 r q N <br />
J P 5 F 1<br />
</pre><br />
<br />
Players discovered that this Matrix could be used as a bifid key to decode the text underneath the table of numbers in the email, as shown below:<br />
<pre><br />
j . 7 F 5 7 O , N L v : q j . 7 B : , 1 q v @ B 1 j 5 i v B : ,<br />
12 21 42 54 53 42 24 32 45 15 33 34 44 12 21 42 14 34 32 55 44 33 22 14 55 12 53 31 33 14 34 32<br />
<br />
1 2 2 1 4 2 5 4 5 3 4 2 2 4 3 2 4 5 1 5 3 3 3 4 4 4 1 2 2 1 4 2<br />
1 4 3 4 3 2 5 5 4 4 3 3 2 2 1 4 5 5 1 2 5 3 3 1 3 3 1 4 3 4 3 2<br />
<br />
11 24 23 14 43 22 55 45 54 34 43 23 22 42 31 24 45 55 11 52 35 33 33 41 43 43 11 24 23 14 43 22<br />
</pre><br />
<br />
This gave players the following string:<br />
<br />
SOMBr@1NF:rM@7iON1SP0vvErrSOMBr@<br />
This phrase was found to be leet-speak, and was translated to:<br />
<br />
<pre><br />
Sombra Information is power Sombra<br />
</pre><br />
<br />
The string <code>SOMBr@1NF:rM@7iON1SP0vvErrSOMBr@</code> was used as a password later on in the ARG.<br />
<br />
== A Moment in Crime Transmission ==<br />
<br />
[[File:Momentincrime.png|thumbnail|right|amomentincrime.com as of August 24th, 2016]]<br />
<br />
Once the 23-hour countdown on the Skycoder forum post reached zero, [https://amomentincrime.com amomentincrime.com] was updated. It now read:<br />
<br />
<pre><br />
...Estableciendo conexión...<br />
...Protocolo Sombra v1.9 iniciado...<br />
<br />
...Transmitiendo información a ómnicos activos... 2%<br />
<br />
...Terminando conexión...<br />
</pre><br />
<br />
Translated from Spanish to English:<br />
<br />
<pre><br />
...Establishing connection...<br />
...Sombra Protocol v1.9 initiated...<br />
...Transmitting information to active omnics... 2%<br />
<br />
...Ending connection...<br />
</pre><br />
<br />
A comment was also added to the source code:<br />
<br />
<pre><br />
Bien hecho, ya tienen mi clave. Hackear este programa de televisión no tuvo chiste. Espérense a lo que sigue.<br />
</pre><br />
<br />
When translated:<br />
<br />
<pre><br />
Well done, you have my password. Hacking this television program was meaningless. Wait for what is coming.<br />
</pre><br />
<br />
The percent on the amomentincrime.com slowly increased over time. Once the 5% milestone was hit, the Sombra Protocol version number changed to to v1.95. Afterwards, the percentage increased by 0.0038% every 3 minutes in real time.<br />
<br />
In addition, another comment was added:<br />
<br />
<pre><br />
Parece que se están calentando un poco las cosas... tendré que pasar desapercibida mientras esto se finaliza.<br />
</pre><br />
<br />
Translated:<br />
<br />
<pre><br />
It seems things are heating up a bit... I'll have to go unnoticed while this is finishing.<br />
</pre><br />
<br />
On 18th October at 19:02 GMT the site reached 100%, and the site updated with the following message:<br />
<br />
<pre><br />
...Transmisión finalizada - finalizando carga... <br />
...Carga finalizada. Unidad Bastion E-54 comprometida...<br />
</pre><br />
<br />
Which roughly translates to:<br />
<br />
<pre><br />
...Transmission complete - finishing upload...<br />
...Upload finished. Unit Bastion E-54 engaged...<br />
</pre><br />
<br />
Hidden in the source code of the site was the text <code>v1.4.0.2.324??</code>. Players then correctly assumed that this referred to a future build of Overwatch itself.<br />
<br />
== Sombra vs. LumériCo ==<br />
<br />
=== The Hacked Bastion ===<br />
<br />
On October 19, 2016, a new Overwatch version was released - version 1.4.0.2.32448. Shortly afterwards, the version number in the source code of the amomentincrime site updated to the same version number. After the build launched, players discovered that the hero Bastion had a strange interaction when near the "SOMBRA PROTOCOL" monitors on Dorado, and would emit a message in morse code, which can be heard [https://www.youtube.com/watch?v=Hkd__ceYm-Y here]. When the morse was decoded, players received the following string:<br />
<pre><br />
SQOFJFBNITIZWGDXSDO<br />
</pre><br />
<br />
Players discovered that this was a Vigenere cipher, and the key consisted of the alphabetic characters from the<br />
<code>SOMBr@1NF:rM@7iON1SP0vvErrSOMBr@</code> string, it was decoded to read:<br />
<br />
<pre><br />
ACCESSWWWLUMERICOMX<br />
</pre><br />
<br />
This led players to the [https://lumerico.mx/ LumeriCo website]. ''(Editor's note: as of 2018, this site appears to be inactive.)''<br />
<br />
=== LuméReaction ===<br />
<br />
[[File:Lumerico.png|thumbnail|right|The homepage of https://lumerico.mx]]<br />
<br />
The LumeriCo website was for the in-universe Mexican tech giant LumériCo, who had built several reactors in the Dorado region. The website had a [https://lumerico.mx/news news page], noting the imminent opening of a new reactor on November 1 as well as a recent attack on its construction site. There were also [https://lumerico.mx/about About] and [https://lumerico.mx/login Login] pages.<br />
<br />
Players also discovered a <code>robot.txt</code> file, which appeared to server no purpose and only contained the text <code>Allow: omnics</code>, and appeared to be a joke about the [https://en.wikipedia.org/wiki/Robots_exclusion_standard Robots exclusion standard]. Another text file was discovered called <code>omnics.txt</code>, which contained the text:<br />
<br />
<pre><br />
Allow: ??<br />
Allow: ???<br />
</pre><br />
<br />
And appeared to be yet anotehr joke about the Robots exclusion standard. And, finally, an <code>api</code> file that contained <code>{"message":"thanks for calling the api"}</code> and, humorously, has no practical purpose.<br />
<br />
=== Phone Number ===<br />
<br />
At the bottom of the LumeriCo website, players discovered a phone number <code>(510) 766-2726</code>. When called, players heard a woman listing off a string of numbers in Spanish, a recording of which can be found [https://soundcloud.com/jackwilsdon/510-766-2726a here]. The numbers spoken are: <code>5-2-4-1-3 (pause) 23-4-14-8-6-18-17-23-21-18-15</code>.<br />
When assuming that a=1, b=2, etc, the second part of the message can be decoded to: <code>WDNHFRQWURO</code>. This was found to be a ROT-23 cipher, and decoded to: <code>TAKECONTROL</code>.<br />
<br />
=== Take Control ===<br />
<br />
The phone message led players to an important [https://lumerico.mx/TAKECONTROL/index.html page] on the site, under the directory <code>TAKECONTROL</code>. It was styled the same way as amomentincrime.com and featured [https://lumerico.mx/calavera.png an image of Sombra's skull icon], named "calavera.png". There was also text on the page:<br />
<br />
<pre style="word-break:break-all;word-wrap: break-word;"><br />
ethldtíoíesnoemfetuylm.bnlsssqtann)hcnslararuCpdGeoopéqubdsroaan.arnasdmdor1vrsmerñerlsdacnnnoaexedsidcn.iarsgcyi,iqeqnd.pooitoaeaaransterLetéáedasodocMrnseeiuCsimnosetlójnueodacapsadcoanfasest.rnucaodacadmdoemoipíogPoipbehaSussai.,yccandin.reueatenaoiorneoeetaoéyenimt¿rPehec,uurobudeílrysriteenasni,adngpjrálireecgrolsmhYnao?nmonomepeldezmapcpunoaulrrruCstmeitltetlróesoapsdéyufcuascaa,rensbuinergnqedlmvlbpdtaz.enebuineuldoerecrGefqfirrasulrbeatHsilnbaúaeeaaooassraooa,ioedo:aLiuielPr ursmoootlnielteeánlosulobeauaanopearrúiesltéyrosssisuaaeaenremsieaismdjmolrsspebiecdéyusittnvrcacp.taebrtLiunróporner<br />
<br />
eúcrneuyraarsettsyrseen.aaPnrneuyraeastuCpnhl/wLloaloa.qartlsyuínreute.evgdpiuábdmPooucvdeccmoreurr.o?unriorydbaSnalegeáezadienáutalaaioeemfcbgdinableoc¿éppoeocelsumuoaHearsosqadrrrftuLiorannnoneneriiatcnlomoqnaqdunrcno,enmerosaereisloabolii.e.dormerosepopdé,eo:r#5scoegaqoeaibs(edioraamtdírnlyoetjcgratmnrrobnrsstloeYqoeocicpnómlpernmaepogenmodqamubodnaeasuaenMoolloupeqvgrLtúr<br />
<br />
tsosrdvoeaerroaeusdmaauamoMobsnaeanraunnt,roierbeoiemaodbmantursotñauoureeuoerreopc.etlr<br />
<br />
sotñneerLimeaFsNJ<br />
</pre><br />
<br />
Players found this to be a column order transposition cipher with the key <code>5 2 4 1 3</code>, which was found in the phone message. The cleaned up result was: <br />
<br />
<pre><br />
Los felicito por haber llegado hasta aquí. Solo quería saber si estaban listos. (Hey, es muy difícil encontrar buena ayuda últimamente...deberían ver algunos de los payasitos que están trabajando conmigo) Por ahora, continuemos con el verdadero reto: acabar con LumériCo y su president e Guillermo Portero. ¿Y porqué? Porque es un hombre codicioso, corrupto y un ladrón abominable. Su plan de traer en línea el más grande y el más poderoso zigurat el 1 de noviembre no es nada más que una artimaña, un elaborado plan designado para ejercer aún más influencia sobre la gente de México y en gordar los bolsillos de sus compinches. ¿Y quién va a pagar por eso? La gente común y corriente, los mismos que siempre quedan olvidados.<br />
<br />
He empezado a mejorar mis protocolos para que sean usados para derrumbar la infraestructura de LumériCo y Los Muertos también están intentando levantarse en contra de la corrupción. Mientras tanto, escarben por el sitio de LumériCo y busquen información que podamos usar en contra del cabrón, mejor aún, encuentren su nombre de usuario y contraseña para asegurarnos de que ciertos detalles no muy favorables sobre el presidentito...aparezcan...<br />
<br />
Pude encontrar el nombre de usuario y contraseña de un empleado de soporte de LumériCo, empiecen por ahí:<br />
<br />
GFlores/g#fNwP5qJ<br />
</pre><br />
<br />
Translated:<br />
<br />
<pre><br />
I'm congratulating you for getting in here. I only wanted to know if you were ready or not. (Hey, it's really difficult to get good help lately... you should see some of the clowns I'm working with). For now, let's continue with the true challenge: taking down Lumerico Corp president Guillermo Portero. Why? Because he's a greedy and corrupt man, and an abominable thief. His plan of bringing in line the most powerful and biggest zigurat the 1st of november us nothing more than a deceit, an elaborate plan by his gang to become even more influential in the people of Mexico and get more money. And who's gonna pay for that? Common people, the ones that are always forgotten.<br />
<br />
I've started upgrading my protocols so that they are used to take down the Lumerico Corp infraestructure and Los Muertos are also trying to go against the corruption. Meanwhile, search the Lumerico Corp site for info we can use against the bastard, or better, get his username and password so that hundreds "not so favorable" facts about the president start popping up.<br />
<br />
I was able to get the username and pass of a Lumerico Corp employee, start here:<br />
<br />
GFlores/g#fNwP5qJ<br />
</pre><br />
<br />
=== Presidential Login ===<br />
<br />
Players used the credentials above on the [https://lumerico.mx/login Lumerico login page], and accessed the account of Gonzalo Flores, which included [https://lumerico.mx/email his emails]. Transcripts of these emails were archived [https://docs.google.com/spreadsheets/d/1zh7OU2dEOnD4X43ImvZBNpS75FLkj-rL75pXJ2l3TuQ/htmlview?sle=true# here].<br />
<br />
However, only one email had relevance to the ARG:<br />
<br />
<pre><br />
De:Valeria Valderrama<VValderama@lumerico.mx><br />
Para:Gonzalo Flores<GFlores@lumerico.mx><br />
Asunto:Página de Guillermo<br />
<br />
Hola, Gonzo:<br />
¿Puedes ver el tráfico de https://lumerico.mx/president-bypass? Guillermo debería ser el único accediendo desde su página de inicio privada, pero parece que está teniendo mucho tráfico. Tal vez tengamos que escalar esto a<br />
la señorita Jiménez, pero quiero estar segura de que es digno de su tiempo.<br />
<br />
Valeria Valderrama<br />
</pre><br />
<br />
The email referenced high traffic on the [https://lumerico.mx/president-bypass President Bypass Link]. The page displayed an "access denied" message, but players found a <code>President Auth-Bypass Revision 1.02: /.git/</code> line in the source code.<br />
<br />
This line led players to [https://github.com/internetwache/GitTools/tree/master/Dumper dump the data] from the [https://lumerico.mx/president-bypass/.git/ /.git/ subpage] with git protocol and upload it to [https://gist.github.com/anonymous/987beb6a5c817b53da820562854bdebe Github]. These were the code files behind the website, and included a '''class.authentication.php''' file that contained an encryption function, and '''class.president-bypass.php''' file which contained the president's (Guillermo Portero) username, <code>GPortero</code>, and encrypted password <code>?MzY:MTI5:?AzY:OWM?:?EDO:ZGU?:jVTM:MTJm:2ITM:MTUw:?QjY:OWY?:?kTO:MTQx:?MzY</code>.<br />
<br />
Some players wrote a function to decode the encrypted <code>class.authentication.php</code> file, and then used it on the encrypted password. The resulting password was <code>Xy@4+Bkuqd<53uJ</code>.<br />
<br />
After logging in to the President's account, players were able to read his emails. After 30 minutes, another email appeared in the President's inbox, from Sombra herself:<br />
<br />
<pre><br />
Veo que se han podido infiltrar en su correo.<br />
No se preocupen, él no puede ver este correo, lo he ocultado de su vista si se conecta desde una de sus direcciones conocidas de IP.<br />
Necesito un poco más de tiempo para establecer el próximo grupo de potocolos. Manténganse atentos a principios de la otra semana. Le echaré unos cuantos trapitos sucios en sus correos para que se filtren al público<br />
"accidentalmente". Ya veremos como reaccionan los medios de comunicación.<br />
</pre><br />
<br />
The rough translation was:<br />
<br />
<pre><br />
I see you have been able to infiltrate into his mail.<br />
Don't worry, he cannot see this email, I've hidden it from his sight if he connects from one of his known IP addresses.<br />
I need a little bit of time to establish the next set of protocols. Stay alert early next week. I'll throw some dirty laundry in his emails that can "accidentally" leak to the public. We'll see how the media will react to that.<br />
</pre><br />
<br />
=== Admin Access ===<br />
<br />
[[File:Lumerico admin panel.png|thumbnail|right|The admin panel of the Lumerico site, only accessible by logging in as MJimenez]]<br />
<br />
On October 25, new emails were discovered in the GFlores account, but they had no immediate significance to the ARG. In addition, omnics.txt was updated:<br />
<br />
<pre><br />
Allow: Tzolk'in<br />
Allow: Imix ChikchanManik Imix ChikchanImixChikchanImix Manik Chikchan Imix Kimi Chikchan Chikchan Kimi ChikchanImixChikchanImix ChikchanKimi<br />
</pre><br />
<br />
Tzolk'in is the name of a [[Wikipedia:Maya calendar#Tzolk'in|Mayan Calendar]], and the second line was a series of animals from it in the Tzolk'in dialect. Imix stands for Day 1, Chikchan — 5, Manik — 7 and Kimi — 6. Turned into numbers, the string reads <code>1 57 1 5151 7 5 1 6 5 5 6 5151 56</code>. These digits turned into pictograms of [[Wikipedia:Maya numerals|Maya numerals]] (one by one, not numbers as a whole) written horizontally become <code>. -..- . -.-. ..- - . .- - - .- -.-. -.-</code> That is a morse code, which decodes to <code>EXECUTEATTACK</code>.<br />
<br />
This led us to https://lumerico.mx/EXECUTEATTACK/index.html, where the following text was discovered:<br />
<br />
<pre><br />
Ha llegado el momento. Esos correos expuestos la verdad sobre Portero, iniciado la revuelta, y hemos convencido a la gente de México a apoyar nuestra causa. Ahora es el momento para el golpe. Convertiremos su preciada inauguración el 1 de noviembre en un gran movimiento en su contra. Necesito que hagan una cosa:<br />
Consigan acceso al correo del jefa de seguridad y busquen alguna forma de ayudarme en el ataque. Es posible que lo vean contactando a Portero pronto. He cambiado su contraseña a: d0r*NuLw9<br />
</pre><br />
<br />
Translated to English:<br />
<br />
<pre><br />
The moment has come. These emails exposed the truth about Portero, initiated the revolt, and have convinced people of Mexico to support our cause. Now is the time to strike. Convert his precious inauguration on November 1 to a large movement against it. I need you to do one thing:<br />
Get access to the email security chief and seek some form of help in the attack. You may see her contacting Portero soon. I've changed her password: d0r*NuLw9<br />
</pre><br />
<br />
Logging in with the credentials <code>MJimenez / d0r*NuLw9</code> gave us access to the [https://lumerico.mx/admin admin panel] of Lumerico. Until 01 Nov. 2016 it stayed inactive and any command was answered with the same message saying the terminal disconnected.<br />
<br />
=== The Terminal ===<br />
Once the console became usable, players could type <code>help</code> to see a list of commands:<br />
<br />
'''override''' Engineer safety mode override<br />
'''help''' Provides help information about commands<br />
'''version''' Displays system version information<br />
'''about''' Displays information about the system<br />
'''grep''' Search output by string<br />
<br />
In the MJimenez email account, there was an email labeled <code>Corrupción de correo electrónico</code> with highlighted text in side of it, specifically <code>/ter/</code>. After some hard thinking, people discovered that doing <code>about | grep 'ter'</code> (in linux this is a command to list all the lines from the ''about'' that have a substring ''ter'') returns this text:<br />
<br />
'''Open''' source lightweight shell for any terminal.<br />
'''Anything''' with a terminal<br />
'''1.1.0''' - expanded terminal support<br />
<br />
The first word of every line given from the output was boldened and purple. Putting the words together, we got <code>OpenAnything1.1.0</code>, which was a solution which was used shortly.<br />
<br />
Another available command for the terminal was <code>override</code>. After typing <code>override</code>, the console prompted ARG players with three security questions:<br />
<br />
# '''Favorite Movie'''. The answer to the prompt is <code>some like it bot</code>, a movie from the Overwatch universe.<br />
# '''Favorite Cookie Flavor'''. The answer being <code>nuevas sabor delicias</code>, a flavor referenced in an email in the MJimenez account.<br />
# '''Secret'''. The answer to this prompt is <code>OpenAnything1.1.0</code>.<br />
<br />
This returned <code>OK</code>, gave players admin access, and enabled a new set of commands: <br />
<br />
'''ls''' Lists files by path<br />
'''cat''' Read file by path<br />
'''exec''' Execute a file <br />
<br />
Typing <code>ls</code> listed two files: <code>payload</code> and <code>d_ilqh_nhb.html</code> (the file name is a ROT23 for ''a_fine_key'').<br />
<br />
[[Image:A fine key.png|thumb|right|a_fine_key.html]] Reading the second file with <code>cat mnt/d_ilqh_nhb.html</code> yielded a text where ASCII characters (repeating string <code>vhnl tldv xyl vcxelo xv qhrtv. zkolg[nl]</code>) were in a shape of a key. Deciphering it using the Affine cipher (A=23, B=23) yielded the following string: <code>some keys are shaped as locks. index[me]</code>. It is assumed that ''some keys are shaped as locks'' line alluded to the [[#Tracer_Trail_Cipher|Tracer Trail]] ciphertext being used as a key.<br />
<br />
Simultaneously, entering <code>exec payload</code> presented players with a prompt — the answer to which is the [[#Tracer_Trail_Cipher|Tracer Trail]]. When inputted, players were given a message that looked quite similar to what was previously seen at amomentincrime.com. The counter shown in the top right is then incremented.<br />
<br />
[[Image:LumericoTerminalTracerEntered.jpg|850px]]<br />
<br />
=== Misdirection ===<br />
<br />
[[Image:LumericoHacked.jpg|thumb|right|lumerico.mx website hacked by Sombra]]<br />
<br />
On October 1, 2016, the lumerico.mx home page changed to show "glitches" and the black overlay with a message under the purple skull, while a string <code>&lt;!-- MISDIRECTION --></code> was also added to the source of the page.<br />
<br />
The message says: <br />
<br />
<pre><br />
Buen trabajo, amigos. No lo hubiera logrado sin su ayuda. En fin, me consiguieron los recursos que necesitaba para mi siguiente golpe – les encantará.<br />
Esperen noticias de mí en los próximos días...<br />
Les voy a mandar algo para agradecerles… Ojalá lo puedan aprovechar.<br />
Dasvidanya amigos<br />
</pre><br />
<br />
Translated:<br />
<br />
</pre><br />
Good job, folks. I would not have done it without your help. Anyway, I got the resources needed for my next hit - you'll love it.<br />
Expect to hear from me in the coming days...<br />
I'm going to send something to thank you ... Hopefully you can use it.<br />
Dasvidanya friends<br />
</pre><br />
<br />
[[File:Dia de los muertos spray.jpg|thumbnail|right|The Día de Los Muertos spray that was added to the game after Sombra hacked the Lumerico site]]<br />
<br />
Note that ''Dasvidanya'' is a phonetic transliteration of ''до свиданья'' — a russian phrase for "goodbye". The thing that Sombra sent as a ''thank you'' was a new spray, named "Día de Los Muertos" after the Mexican festival that took place at the same time as the ARG. The spray is currently only available on the PC version of the game.<br />
<br />
The '''MISDIRECTION''' string lead to the page [https://lumerico.mx/MISDIRECTION/index.html https://lumerico.mx/MISDIRECTION/index.html] containing:<br />
<br />
...Estableciendo conexiуn...<br />
...Protocolo Sombra v2.3 iniciado...<br />
<br />
...Desviando datos del zigurat de LumériCo hacia el objetivo...<br />
...Descifrando contraseсas del objetivo...<br />
...Acceso otorgado al directorio de volskayaindustries.com...<br />
<br />
...boop ;)...<br />
...Terminando conexión...<br />
<br />
Translated: <br />
<br />
...Establishing connection...<br />
...Sombra Protocol v2.3 initiated...<br />
<br />
...Forwarding the data from the LumériCo ziggurat to the target...<br />
...Deciphering the target passwords...<br />
...Access Granted to the directory of volskayaindustries.com...<br />
<br />
...boop ;)...<br />
...Ending connection..<br />
<br />
== Blizzcon ==<br />
<br />
Blizzcon 2016 opened with the [https://www.youtube.com/watch?v=Og5-Pm4HNlI Overwatch short "Infiltration"], a short depicting Reaper, Widowmaker, and Sombra on Volskaya Industries. During the showing of the short, Sombra's [https://playoverwatch.com/en-us/heroes/sombra hero page] went live, showcasing her abilities and character backstory.<br />
<br />
[[File:SombraBG.jpg|center|500px]]<br />
<br />
== References ==<br />
<br />
=== Community Resources ===<br />
<br />
A collection of tools and resources made by the Game Detectives Discord community for use in the ARG.<br />
<br />
==== ASCII Skull ====<br />
<br />
'''ASCII Skull Analysis:''' https://github.com/bahamas10/sombra<br />
<br />
'''Removing SOMBR@ Analysis:''' https://pastebin.com/15u27YTC<br />
<br />
'''ASCII Skull Eye Analysys:''' https://docs.google.com/spreadsheets/d/1-JQpWyitMKYhP-4l8ZDFiJI3NjqRrvoEnRdFQawike8<br />
<br />
==== Google Docs ====<br />
<br />
'''Observations and Speculations Spreadsheet:''' https://docs.google.com/spreadsheets/d/1rI08baFQmAwaqHC-9GF9VNGCYjuRE-q4LN9k4ottjuQ/pubhtml<br />
<br />
'''LumériCo Emails and Translations Spreadsheet:''' https://goo.gl/cQgdIJ (Courtesy of UberPilot)<br />
<br />
==== Tracer Code ====<br />
<br />
'''GOL! Guesser:''' https://axxim.net/ow/gol-guesser/<br />
<br />
'''Uber GOL! Guesser:''' https://axxim.net/ow/gol-guesser/uber/<br />
<br />
The Uber GOL! Guesser only prints out UTF-8 compliant results, which makes it easier to identify potentially correct answers.<br />
<br />
'''Bruteforcing tool:''' https://github.com/glv2/bruteforce-salted-openssl<br />
<br />
=== Third-Party Resources ===<br />
<br />
A collection of third-party tools and resources that the Game Detectives Discord community has used in the ARG.<br />
<br />
==== Image of Reaper ====<br />
<br />
'''stegdetect (Linux):''' https://github.com/abeluck/stegdetect<br />
<br />
stegdetect is a Linux utility used to determine if a given image may contain encoded information.<br />
<br />
'''JPHide & JPSeek:''' https://linux01.gwdg.de/~alatham/stego.html<br><br />
'''iSteg (Mac OSX):''' https://www.hanynet.com/isteg/<br />
<br />
JPHide & JPSeek is used to hide and find, respectively, a file inside a JPEG image.<br><br />
iSteg works similarly to JPHide on the Mac OSX platform.<br />
<br />
'''stegbreak (Linux):''' https://linux.die.net/man/1/stegbreak<br />
<br />
stegbreak is used to do brute-force dictionary attacks on JPEG images.<br />
<br />
=== Easter Eggs ===<br />
<br />
The following are collection of references and Easter Eggs encountered throughout the ARG.<br />
<br />
==== In-Game ====<br />
<br />
'''Sombra's "Amused" Emote'''<br />
<br />
This character emote features the [[Sombra_ARG_False_Leads | Skycode]], accompanied by soft music resembling the [https://www.reddit.com/r/Overwatch/comments/4w7ey1/the_sombra_skysong/ Skysong]. Sombra's expression is one of amusement, and it's a nod to the community's prolonged creative attempts to solving an nonexistent puzzle.<br />
<br />
[[File:EmoteSkycode.png|200px]]<br />
<br />
'''Skycode Spray'''<br />
<br />
This character spray features Sombra's iconic skull in front of a compass rose and the [[Sombra_ARG_False_Leads | Skycode]]. This is a reference to both the [[#Directions_&_Letters|cardinal directions]] used in one of the puzzles and to the Skycode, which is considered the most significant false lead that solvers encountered.<br />
<br />
[[File:SkycodeSpray.png|200px]]<br />
<br />
==== In-ARG ====<br />
<br />
'''Espresso Command'''<br />
<br />
There was a hidden command in LumériCo's [[#The_Terminal | admin terminal]]. Inputting the word <code>espresso</code> returned the following message: <code>Coffee Pot Status: Brewed approximately 23 hours ago, currently 0% full</code><br />
This is referencing a variety of [https://goo.gl/cQgdIJ emails] found in the LumériCo site involving broken espresso machines and incompetent coffee brewing, which caught the attention of the community and gave way to a vast variety of mediocre jokes. Furthermore, "23 hours" makes reference to the number 23, which was believed by many to possess some sort of significance to the ARG, as Sombra would be the 23rd character in Overwatch. Finally, "0%" references the ARG's notable waiting periods that have been widely criticized by the community, specifically [[#A_Moment_in_Crime_Transmission | A Moment in Crime's upload percentage]].<br />
Due to the iconic purple text it is believed that this hidden command was created by Sombra herself.<br />
<br />
[[File:EspressoCommand.png]]<br />
<br />
=== Media Appearances ===<br />
<br />
'''3rd Aug. 2016'''<br />
<br />
[EN] [https://kotaku.com/overwatch-fans-find-new-clues-about-the-mysterious-hero-1784767759 Kotaku - Overwatch Fans Find New Clues About The Mysterious Hero Sombra]<br />
<br />
[EN] [https://www.polygon.com/2016/8/3/12369144/overwatch-summer-games-sombra-arg-blizzard?utm_campaign=polygon&utm_content=chorus&utm_medium=social&utm_source=twitter Polygon - Overwatch fans are trying to crack the latest mystery about Sombra]<br />
<br />
[EN] [https://www.pcgamesn.com/overwatch/overwatch-sombra PCGamesN - Overwatch's Sombra ARG continues with new clues, but no solutions]<br />
<br />
[EN] [https://team-dignitas.net/articles/blogs/overwatch/9989/who-is-sombra-all-facts-and-clues-about-sombra Team-Dignitas - Who is Sombra? All facts and clues about Sombra]<br />
<br />
[FR] [https://overwatch.gamewave.fr/un-nouveau-code-cache-dans-la-derniere-cinematique-d-overwatch/ Gamewave - UN NOUVEAU CODE CACHÉ DANS LA DERNIÈRE CINÉMATIQUE D'OVERWATCH!]<br />
<br />
[EN] [https://www.follownews.com/overwatch-fans-find-new-clues-about-the-mysterious-hero-sombra-1nhqt FollowNews - Overwatch Fans Find New Clues About The Mysterious Hero Sombra]<br />
<br />
'''4th Aug. 2016'''<br />
<br />
[EN] [https://www.pcgamer.com/overwatch-summer-games-trailer-hides-a-mysterious-secret/ PCGamer - Overwatch Summer Games trailer hides a mysterious secret]<br />
<br />
[SK] [https://www.sector.sk/novinka/121273/nove-overwatch-video-obsahuje-dalsie-tajomstva.htm Sector - Nové Overwatch video obsahuje ďalšie tajomstvá]<br />
<br />
[EN] [https://www.techinsider.io/overwatch-sombra-character-2016-8 Techinsider - 'Overwatch' players are going to insane lengths to solve a mystery that Blizzard's teased for months]<br />
<br />
[EN] [https://gamerant.com/overwatch-sombra-clues/ Gamerant - Overwatch Players Uncover More ‘Sombra’ Clues]<br />
<br />
[HU] [https://www.gamestar.hu/hir/overwatch-sombra-karakter-214739.html Gamestar - Overwatch - újabb nyomok utalnak a még be nem jelentett hősre]<br />
<br />
'''5th Aug. 2016'''<br />
<br />
[EN] [https://kotaku.com/days-later-overwatch-fans-cant-figure-out-the-sky-cod-1784872143 Kotaku - Days Later, Overwatch Fans Can't Figure Out The 'Sky Code' Mystery]<br />
<br />
[NL] [https://www.gamersnet.nl/nieuws/201608/cryptische_speurtocht_naar_overwatch_nieuwe_heldin_sombra_gaat_bizar_diep/ Gamersnet - Cryptische speurtocht naar Overwatch' nieuwe heldin Sombra gaat bizar diep]<br />
<br />
[ES] [https://www.alfabetajuega.com/noticia/overwatch-el-enigma-de-sombra-sigue-ofreciendo-nuevos-detalles-n-71772 Alfa Beta Jeuga - Overwatch: El enigma de Sombra sigue ofreciendo nuevos detalles]<br />
<br />
[EN] [https://www.youtube.com/watch?v=5ROjN-_F0ZU&feature=youtu.be&t=4m22s IGN (Video) - Sombra: Overwatch's Secret New Hero - Overwatch HQ]<br />
<br />
'''7th Aug. 2016'''<br />
<br />
[EN] [https://www.gamespresso.com/2016/08/summary-state-sombras-arg-overwatch/ Gamespresso - Summary of the state of sombra's ARG in Overwatch]<br />
<br />
'''8th Aug. 2016'''<br />
<br />
[EN/CN] [https://www.zhentoo.com/doc92368 Zhentoo - Overwatch new hero Secret Dorado hidden mystery] <br />
<br />
[EN] [https://www.technewstoday.com/30880-overwatch-sombra-continues-to-elude-detectives/ TechNewsToday - Overwatch: Sombra Continues to Elude Detectives]<br />
<br />
'''11th Aug. 2016'''<br />
<br />
[EN] [https://www.youtube.com/watch?v=IZR-pa0it4Q The Know - New Overwatch Hero Hints]<br />
<br />
'''12th Aug. 2016'''<br />
<br />
[EN] [https://kotaku.com/after-two-weeks-overwatch-fans-sombra-investigation-re-1785204389 Kotaku - Overwatch Fans' Sombra Investigation Reaps A Skull Code]<br />
<br />
'''14th Aug. 2016'''<br />
<br />
[EN] [https://gamerant.com/overwatch-sombra-skull-code/ Gamerant - Skull Code is Latest Clue in Overwatch’s Sombra Investigation]<br />
<br />
'''16th Aug. 2016'''<br />
<br />
[EN] [https://www.christiantoday.com/article/overwatch.dlc.update.skull.code.the.latest.clue.for.sombra.investigation/93197.htm Christian Today - 'Overwatch' DLC update: Skull Code the latest clue for Sombra investigation]<br />
<br />
[EN] [https://en.yibada.com/articles/151811/20160816/overwatch-dlc-update.htm Yibada - 'Overwatch' DLC update: New clues on Sombra's inclusion to the roster revealed]<br />
<br />
'''23rd Aug. 2016'''<br />
<br />
[EN] [https://www.technewstoday.com/31129-overwatch-all-we-know-about-the-sombra-arg/ Tech News Today - Overwatch: All We Know About the Sombra ARG]<br />
<br />
'''24th Aug. 2016'''<br />
<br />
[EN] [https://gamerant.com/overwatch-forums-sombra-message/ Gamerant - Overwatch Forums Glitch Out, Reveals Hidden Message From Sombra]<br />
<br />
[EN] [https://gamerant.com/overwatch-sombra-clue-website/ Gamerant - New Website Counts Down To Next Clue For Overwatch’s Sombra]<br />
<br />
[EN] [https://www.polygon.com/2016/8/24/12623736/overwatch-sombra-arg-clues-skycoder Polygon - Overwatch's Sombra mystery appears to be coming to a close]<br />
<br />
[EN] [https://www.vg247.com/2016/08/24/overwatch-forums-glitch-out-reveal-a-message-from-the-mysterious-sombra/ VG247 - Overwatch forums glitch out, reveal a message from the mysterious Sombra]<br />
<br />
[EN] [https://www.technewstoday.com/31151-sombra-hacks-into-overwatch-forums/ Tech News Today - Sombra Hacks Into Overwatch Forums]<br />
<br />
[EN] [https://www.ign.com/articles/2016/08/24/overwatch-mystery-character-sombra-could-be-revealed-today IGN - Overwatch Mystery Character Sombra Could Be Revealed Today]<br />
<br />
'''25th Aug. 2016'''<br />
<br />
[EN] [https://kotaku.com/overwatch-players-are-getting-fed-up-with-the-sombra-ar-1785765307 Kotaku - Overwatch Players Are Getting Sick Of The Sombra ARG]<br />
<br />
[EN] [https://www.ign.com/articles/2016/08/25/overwatch-made-the-internet-lose-its-mind-last-night-and-i-had-a-front-row-seat IGN - Overwatch Made the Internet Lose its Mind Last Night, And I Had a Front-Row Seat]<br />
<br />
[EN] [https://www.technewstoday.com/31182-overwatch-countdown-to-sombra/ Tech News Today - Overwatch: Countdown to Sombra]<br />
<br />
<br />
'''30th Aug. 2016'''<br />
<br />
[EN] [https://www.pcgamer.com/overwatch-sombra-arg-mystery/ PC Gamer - Overwatch's Sombra riddle begins to irritate the players trying to solve it]<br />
<br />
'''3rd Oct. 2016'''<br />
<br />
[EN] [https://www.mobilenapps.com/articles/19398/20161003/overwatch-update-sombra-blizzcon-halloween-event-leak.htm Mobile & Apps - Sombra To Be Revealed At Blizzcon? Halloween Event Confirmed In Data Leak]<br />
<br />
'''4th Oct. 2016'''<br />
<br />
[EN] [https://www.itechpost.com/articles/36011/20161004/overwatch-overwatch-update-overwatch-finally-getting-sombra-overwatch-sombra-sombra.htm iTechPost - Overwatch Update: Are We Finally Getting Sombra?]<br />
<br />
'''11th Oct. 2016'''<br />
<br />
[EN] [https://www.kotaku.com.au/2016/10/overwatch-fans-hacked-actual-people-in-an-attempt-to-find-sombra/ Kotaku - Overwatch Fans Hacked Actual People In An Attempt To Find Sombra]<br />
<br />
'''17th Oct. 2016'''<br />
<br />
[EN] [https://telkomgaming.co.za/will-sombra-hack-her-way-into-blizzcon-2016/ TelKom Gaming - Will Sombra Hack Her Way Into BlizzCon 2016?]<br />
<br />
'''18th Oct. 2016'''<br />
<br />
[EN] [https://overwatchtips.info/overwatch-sombra-arg-everything-you-need-to-know/ OverwatchTips - Everything You NEED To Know (Sombra ARG)]<br />
<br />
'''26th Oct. 2016'''<br />
<br />
[EN] [https://mic.com/articles/157757/overwatch-sombra-arg-everything-we-know-about-the-countdown-and-rumored-nov-1-release#.UILrZHRiM Min Network - Everything we know about Blizzard's rumored Nov. 1 release]<br />
<br />
'''28th Oct. 2016'''<br />
<br />
[EN] [https://kotaku.com/imagining-horror-stories-for-a-never-ending-overwatch-a-1788324673 Kotaku - Imagining Horror Stories Of A Never-Ending Overwatch ARG]<br />
<br />
'''1st Nov. 2016'''<br />
<br />
[EN] [https://www.ign.com/videos/2016/11/01/will-overwatchs-sombra-be-at-blizzcon-2016 IGN - Will Sombra be at BlizzCon 2016?]<br />
<br />
'''8th Nov. 2016'''<br />
<br />
[EN] [https://mic.com/articles/158812/overwatch-sombra-arg-gameplay-emote-directly-references-one-of-the-wildest-fan-theories Mic Tech - 'Overwatch' Sombra ARG: Gameplay emote directly references one of the wildest fan theories]</div>Halke234https://wiki.gamedetectives.net/index.php?title=Sombra_ARG&diff=16619Sombra ARG2018-07-24T14:06:38Z<p>Halke234: /* Take Control */</p>
<hr />
<div>{{argbox<br />
| float = right<br />
| name = Sombra ARG<br />
| image = File:Sombra_skull.png<br />
| description= The Sombra ARG - an ARG involving an unreleased Overwatch hero.<br />
| creator = [https://www.blizzard.com/ Blizzard Entertainment]<br />
| type = Official<br />
| status = Completed<br />
| discovered = 2016-06-12<br />
| completed = 2016-11-04<br />
}}<br />
<br />
{{ArgHeader|arg=Sombra ARG}}<br />
The Sombra ARG was an ARG for the first-person shooter [https://www.playoverwatch.com Overwatch], developed by [https://www.blizzard.com/ Blizzard Entertainment]. Sombra was the name of a then-unreleased Overwatch hero. The ARG was comprised of clues and ciphers referencing Sombra, which were found in various developer updates and short animations.<br />
<br />
At the game's release, there were numerous pieces of in-game information that appeared in the map Dorado, hinting at a character called Sombra. When the hero Ana was revealed, more Sombra clues appeared in Ana's origin video. In the weeks that followed, more clues were discovered, which led up to a character reveal animation at BlizzCon 2016.<br />
<br />
== Ana Videos ==<br />
<br />
=== Ana Origin Video ===<br />
<br />
On July 12, 2016, a [https://www.youtube.com/watch?v=TE0CXgpNxG0 video] for the new Overwatch hero named Ana was released. At the 1:16 mark, players discovered a set of hexidecmial values:<br />
<br />
[[File:Ana_Hex2.png|400px]]<br />
<br />
<pre><br />
2E 2E 2E 7B 76 20 66 62 72 20 63 7E 72 79 72 20 7B 76 20 7E<br />
79 71 78 65 7A 76 74 7E D4 A4 79 2C 20 63 7E 72 79 72 20 72<br />
7B 20 67 78 73 72 65 2E 2E 2E 7B 76 20 66 62 72 20 63 7E 72<br />
79 72 20 7B 76 20 7E 79 71 78 65 7A 76 74 7E D4 A4 79 2C 20<br />
63 7E 72 79 72 20 72 7B 20 67 78 73 72 65 2E 2E 2E 7B 76 20<br />
66 62 72 20 63 7E 72 79 72 20 7B 76 20 7E 79 71 78 65 7A 76<br />
74 7E D4 A4 79 2C 20 63 7E 72 79 72 20 72 7B 20 67 78 73 72<br />
65 2E 2E 2E 7B 76 20 66 62 72 20 63 7E 72 79 72 20 7B 76 20<br />
7E 79 71 78 65 7A 76 74 7E D4 A4 79 2C 20 63 7E 72 79 72 20<br />
72 7B 20 67 78 73 72 65 2E 2E 2E 64 78 7A 75<br />
</pre><br />
<br />
A hex to ASCII translation yielded the following:<br />
<br />
<pre><br />
...{v fbr c~ryr {v ~yqxezvt~Ô¤y, c~ryr r{ gxsre...{v fbr c~ryr {v ~yqxezvt~Ô¤y, c~ryr r{ gxsre...{v fbr c~ryr {v ~yqxezvt~Ô¤y, c~ryr r{ gxsre...{v fbr <br />
c~ryr {v ~yqxezvt~Ô¤y, c~ryr r{ gxsre...dxzu<br />
</pre><br />
<br />
Using an XOR Cipher with the constant 23 on the above text resulted in the following message:<br />
<br />
<pre><br />
..la que tiene la información; tiene el poder...la que tiene la información; tiene el poder...la que tiene la información; tiene el poder...la que tiene la <br />
información; tiene el poder...somb<br />
</pre><br />
<br />
This was a repeating phrase in Spanish, which translated to:<br />
<br />
<pre><br />
She who has the information, has the power...<br />
</pre><br />
<br />
Players then discovered a second set of hexidecimal values at the 2:11 mark:<br />
<br />
[[File:Ana Hex.png|400px]]<br />
<br />
<pre><br />
65 76 2E 2E 2E 7B 76 20 66 62 72 20 63 7E 72 79 72 20 7B 76<br />
20 7E 79 71 78 65 7A 76 74 7E D4 A4 79 2C 20 63 7E 72 79 72<br />
20 72 7B 20 67 78 73 72 65 2E 2E 2E 7B 76 20 66 62 72 20 63<br />
7E 72 79 72 20 7B 76 20 7E 79 71 78 65 7A 76 74 7E D4 A4 79<br />
2C 20 63 7E 72 79 72 20 72 7B 20 67 78 73 72 65 2E 2E 2E 7B<br />
76 20 66 62 72 20 63 7E 72 79 72 20 7B 76 20 7E 79 71 78 65<br />
7A 76 74 7E D4 A4 79 2C 20 63 7E 72 79 72 20 72 7B 20 67 78<br />
73 72 65 2E 2E 2E 7B 76 20 66 62 72 20 63 7E 72 79 72 20 7B<br />
76 20 7E 79 71 78 65 7A 76 74 7E D4 A4 79 2C 20 63 7E 72 79<br />
72 20 72 7B 20 67 78 73 72 65 2E 2E 2E<br />
</pre><br />
<br />
When put through the same process, the same string of Spanish was revealed, but with the letters <code>ra</code> at the beginning of the message. These letters were combined with <code>somb</code> from the first cipher to create the name <code>sombra</code>. No more clues were discovered until the release of the Dev Update video.<br />
<br />
=== Dev Update Video ===<br />
<br />
[[File:Sombra Barcodes.png|thumbnail|right|The vertical barcodes found at the end of the Ana Dev Update video]]<br />
<br />
On July 19, 2016, the first [https://www.youtube.com/watch?v=evghkilg2eQ Developer Update] was released for Ana. At the end of the video, players discovered a series of vertical barcodes. When scanned, players discovered a large set of hexidecimal values which where then converted to binary, a dump of which is available [https://gist.github.com/zapu/31165efab0d6264e2fd0fa75cc53b1aa here].<br />
<br />
Turning the ones and zeroes into black and white pixels formed a QR code:<br />
<br />
[[File:Sombra_QR_code.png|300px]]<br />
<br />
Scanning this QR code yielded the following message: <code>¿Estuvo eso facilito? Ahora que tengo su atención, déjenme se las pongo más difícil.</code> In English, the message reads: <code>Was that easy? Well, now that I have your attention, allow me to make things much more difficult.</code> After this, no more clues were discovered until the Summer Games video was released.<br />
<br />
== Welcome to the Summer Games Video ==<br />
<br />
=== Tracer Trail Cipher ===<br />
<br />
[[File:Base64_trail.jpg|thumbnail|right|The unsolved base64 cipher in the Summer Games video]]<br />
<br />
'''Note: The cipher described below remains unsolved.'''<br />
<br />
On August 2, 2016, players discovered another cipher in the [https://www.youtube.com/watch?v=qpcOD9tJM4k Welcome to the Summer Games trailer]:<br />
<br />
<pre><br />
U2FsdGVkX1+vupppZksvRf5pq5g5XjFRIipRkwB0K1Y96Qsv2L<br />
m+31cmzaAILwytX/z66ZVWEQM/ccf1g+9m5Ubu1+sit+A9cenD<br />
xxqkIaxbm4cMeh2oKhqIHhdaBKOi6XX2XDWpa6+P5o9MQw==<br />
</pre><br />
<br />
Players discovered this text to be base64 encryption. When decrypted, players received the following output:<br />
<br />
<pre><br />
Salted__���ifK/E�i��9^1Q�*Q�t+V=�<br />
/ع��W/<br />
�_����V��?q����f�F���"��=q�������[��<br />
z��*����Z����u�\5�k�C<br />
</pre><br />
<br />
''(Note: copy/pasting this string will not work; some of the characters are not printable and are not even displayed correctly on this page)''<br />
<br />
==== Decrypting the Cipher ====<br />
<br />
The "Salted__" header at the start of the string indicated to players that the remainder of the text was encrypted with the OpenSSL software library, which requires a password and the encryption cipher that was used. Salt is added by OpenSSL to ensure uniqueness of the key and the IV derived from the password and used for the encryption. However, due to the age of OpenSSL and its massive library, it was proven to be quite difficult for players to identify the encryption used.<br />
<br />
==== Narrowing Down Ciphers ====<br />
<br />
[[File:HexOfEncryptedMessage.png|thumbnail|right|Hex view of the encrypted string]]<br />
<br />
Players narrowed down the potential ciphers used by examining a hex dump of the encrypted string. There are two major types of ciphers, stream ciphers and block ciphers. Stream ciphers encrypt only the data fed into them, whereas block ciphers always encrypt a certain number of bytes at a time (a "chunk").<br />
<br />
A byte is roughly a single character, but special characters can take up multiple bytes. We know that OpenSSL Salted Encryption uses the first 8 bytes of the output for <code>Salted__</code> and the next 8 bytes for the actual salt. The rest of the information is the '''encrypted message'''.<br />
<br />
The immediately interesting thing here is that the '''encrypted message''' data stops 3 bytes short of a full chunk. This is a excellent indicator that the cipher used is a stream cipher (or a block cipher in CTR/OFB/CFB mode). This narrows the list of potential ciphers down significantly. This also means that the final string that Blizzard encrypted is less than 93 bytes!<br />
<br />
'''This cipher remains unsolved, but it's speculated that Blizzard moved past the cipher by creating alternate puzzles.'''<br />
<br />
=== Directions & Letters ===<br />
<br />
Players discovered that in the North American version of the Summer Games trailer there were repeated references to the cardinal directions, each associated with a particular hero. These references were conspicuously absent from other versions of the trailer. These references are shown below, with the relevant heroes and timestamps:<br />
<br />
<gallery mode="packed"><br />
File:Ow1.png|East - Mercy - Route 66 - 0:17<br />
File:Ow2.png|Center - D. Va - Temple of Anubis - 0:19<br />
File:Ow3.png|North - Torbjorn - Nepal - 0:21<br />
File:Ow4.png|South - Genji - Hanamura - 0:22<br />
File:Ow5.png|Southeast - McCree - Hollywood - 0:24<br />
File:Ow6.png|West - Symmetra - Watchpoint: Gibraltar - 0:30<br />
File:Ow7.png|Southwest - Bastion - Hollywood - 0:34<br />
File:Ow8.png|Northeast - Winston - Volskaya Industries - 0:46<br />
File:Ow9.png|Northwest - Tracer - King's Row - 0:47<br />
</gallery><br />
<br />
Screenshots of all the directions and their respective heroes can be found in an album [https://imgur.com/a/FQXmy here].<br />
<br />
[[File:Overwatch map.jpg|frameless]]<br />
<br />
These heroes, arranged in this particular order, provided a password that was used later in the ARG.<br />
<br />
== Dorado Photo ==<br />
<br />
At an unknown date, a new, "corrupted" photo of the [https://blzgdapipro-a.akamaihd.net/media/screenshot/dorado-screenshot-004.jpg Dorado attackers spawn point] was added to the Overwatch [https://playoverwatch.com/en-us/media/ media page]. Players discovered that the screenshot was "'''datamoshed'''", which means it concealed a hidden message while also taking on a distorted appearance. ([https://prntscr.com/c3dce7 Here] is an example of purposely data moshing the image manually to achieve similar effects.) <br />
<br />
<gallery mode="packed" heights=500px><br />
File:dorado-datamosh.jpg|The datamoshed image<br />
File:dorado-screenshot-005.jpg|The original image<br />
</gallery><br />
<br />
After comparing the images with difference checking tools, players found that certain English and Spanish characters were replaced with exclamation points. The missing characters produced the following Spanish phrase:<br />
<br />
<code>Por que estan mirando al cielo? La respuesta no esta sobre sus cabezas, esta detras de ustedes. A veces, necesitan analizar sus logros previos.</code><br />
<br />
Translated into English, this phrase read:<br />
<br />
<code>Why are you looking at the sky? The answer isn't over your heads, it's behind you. Sometimes, you need to analyze your previous achievements.</code><br />
<br />
The phrase "Why are you looking at the sky?" was most likely a reference to a strange artifact that was discovered in the sky of the Dorado map, dubbed the "Skycode". The Skycode ended up being a red herring, and was completely unrelated to the ARG.<br />
<br />
=== Analyzing Achievements ===<br />
<br />
[[File:achievements.png|thumbnail|right|"¿" Achievement, comment in source code]]<br />
<br />
The phrase "you need to analyze your previous achievements" led players to look at the achievements on the [https://www.playoverwatch.com Overwatch] website. It was noticed noticed that by logging in and viewing the achievements on a player profile, a mystery achievement appeared. Examining a hex dump of the image lead players to a new phrase:<br />
<br />
<pre><br />
Vientos, nada mal. No obstante, me aburro. Intentemos algo nuevo en la misma dirección.<br />
uczihriwgsxorxwunaarawryqhbrsfmeqrjjmu 5552E494 78T3 4VM9 OPL6 IS8208O913KRlrx<br />
</pre><br />
<br />
Translated, it said:<br />
<br />
<pre><br />
Damn, not bad. However, I'm getting bored. Let's try something new in the same direction.<br />
uczihriwgsxorxwunaarawryqhbrsfmeqrjjmu 5552E494 78T3 4VM9 OPL6 IS8208O913KRlrx<br />
</pre><br />
<br />
== Volskaya Datamosh ==<br />
<br />
After a long period of toying around, players discovered that the ciphertext <code> uczihriwgsxorxwunaarawryqhbrsfmeqrjjmu 5552E494 78T3 4VM9 OPL6 IS8208O913KRlrx</code> from the "?" achievement was a Vigenére cipher. Players discovered the key <code>tracertorbjornwinstonsymmetradvamercybastiongenjimccree</code> by ordering the heroes in the Summer Games trailer by the cardinal directions associated with each of them, as said further above. Once decoded, players received the following text: <br />
<pre>blzgdapiproaakamaihdnetmediascreenshot 5552E494 78B3 4CE9 ACF6 EF8208F913CFjpg</pre><br />
<br />
Players found this to be a [https://blzgdapipro-a.akamaihd.net/media/screenshot/5552E494-78B3-4CE9-ACF6-EF8208F913CF.jpg blzgdapipro-a.akamaihd.net/media/screenshot/5552E494-78B3-4CE9-ACF6-EF8208F913CF.jpg URL], which led players to a datamoshed screenshot of the Volskaya Industries map. ''(Editor's note: This link appears to now be dead)''. When players ran a difference check with the [https://blzgdapipro-a.akamaihd.net/media/screenshot/volskaya-screenshot-004.jpg original image], they received an interesting message.<br />
<br />
<gallery mode="packed"><br />
File:volskaya-datamosh.jpg|The datamoshed image<br />
File:Volskaya-screenshot-004.jpg|The original image<br />
</gallery><br />
<br />
=== ASCII Skull #1 ===<br />
<br />
The diff from the datamoshed image resulted in the following output:<br />
<br />
<pre><br />
Parece que te gustan estos jueguitos... por que no jugamos uno de verdad?<br />
:PB@Bk:<br />
,jB@@B@B@B@BBL.<br />
7G@B@B@BMMMMMB@B@B@Nr<br />
:kB@B@@@MMOMOMOMOMMMM@B@B@B1,<br />
:5@B@B@B@BBMMOMOMOMOMOMOMM@@@B@B@BBu.<br />
70@@@B@B@B@BXBBOMOMOMOMOMOMMBMPB@B@B@B@B@Nr<br />
G@@@BJ iB@B@@ OBMOMOMOMOMOMOM@2 B@B@B. EB@B@S<br />
@@BM@GJBU. iSuB@OMOMOMOMOMOMM@OU1: .kBLM@M@B@<br />
B@MMB@B 7@BBMMOMOMOMOMOBB@: B@BMM@B<br />
@@@B@B 7@@@MMOMOMOMM@B@: @@B@B@<br />
@@OLB. BNB@MMOMOMM@BEB rBjM@B<br />
@@ @ M OBOMOMM@q M .@ @@<br />
@@OvB B:u@MMOMOMMBJiB .BvM@B<br />
@B@B@J 0@B@MMOMOMOMB@B@u q@@@B@<br />
B@MBB@v G@@BMMMMMMMMMMMBB@5 F@BMM@B<br />
@BBM@BPNi LMEB@OMMMM@B@MMOMM@BZM7 rEqB@MBB@<br />
B@@@BM B@B@B qBMOMB@B@B@BMOMBL B@B@B @B@B@M<br />
J@@@@PB@B@B@B7G@OMBB. ,@MMM@qLB@B@@@BqB@BBv<br />
iGB@,i0@M@B@MMO@E : M@OMM@@@B@Pii@@N:<br />
. B@M@B@MMM@B@B@B@MMM@@@M@B<br />
@B@B.i@MBB@B@B@@BM@::B@B@<br />
B@@@ .B@B.:@B@ :B@B @B@O<br />
:0 r@B@ B@@ .@B@: P:<br />
vMB :@B@ :BO7<br />
,B@B<br />
</pre><br />
<br />
'''Translation:'''<br />
<br />
<pre><br />
"It seems you like these little games... Why don't we play a real one?"<br />
</pre><br />
<br />
(''This is the python2 script to extract modified bytes from datamoshed Volskaya screenshot: https://gist.github.com/synap5e/27635d2ff6f0e3b15f0c902dca2974a9'')<br />
<br />
No further progress was made until August 23, 2016.<br />
<br />
== Overwatch Forums Glitching Page/ "Skycoder" ==<br />
<br />
On August 23rd, 2016, at an unknown time, an [https://us.battle.net/forums/en/overwatch/topic/20748794686 ominous post] by a user named "Skycoder" appeared on the official General Discussion forums for Overwatch. <br />
<br />
Players found that the name of the post, <code>00110010 00110011</code>, was binary for "23," which was a direct reference to Sombra being the 23rd hero in Overwatch. The age of the post started at 24 hours, and counted down rather than increasing. The post itself contained a single sentence in Spanish:<br />
<br />
<pre><br />
la que tiene la información; tiene el poder<br />
</pre><br />
<br />
Which, when translated to english, reads:<br />
<br />
<pre><br />
She who has the information, has the power.<br />
</pre><br />
<br />
After a short while, the post glitched and distorted, gradually turning a hue of purple. A text box then appeared, which printed the following ciphertext:<br />
<br />
<pre><br />
ICAgICAgICAgICAgICAgICAgICAgICAgICA6UEKPQms6CiAgICAgICAg<br />
ICAgICAgICAgICAgICAsakKIQEJAQkBCQEJCTC4KICAgICAgICAgICAg<br />
ICAgICAgIDdHlkKTQpVCTU1NTU1CQEJAQkBOcgogICAgICAgICAgICAg<br />
ICA6a0KSQpCIl01NT01PTU9NT01NTU2MQphCQEIxLAogICAgICAgICAg<br />
IDo1kUKNQphCiEJCTU1PTU9NT01PTU9NT01NipJuQm5CQEJCdS4KICAg<br />
ICAgICA3MG6GlUKIQpJClEJYQkJPTU9NT01PTU9NT01NQk1QQphCiEJA<br />
QkBCQE5yCiAgICAgIEeYlpdCSiBpQohCh4ggIE9CTU9NT01PTU9NT01P<br />
TZYyICBCj0JAQi4gRUJAQkBTCiAgICAgIJKWQk2HR0pCVS4gIGlTdUKI<br />
T01PTU9NT01PTU9NTZdPVTE6ICAua0JMTYhNhkKXCiAgICAgIEKMTU1C<br />
mUIgICAgICAgN4hCQk1NT01PTU9NT01PQkKWOiAgICAgICBCh0JNTYhC<br />
CiAgICAgII2YiEKKQiAgICAgICAgIDeSlkBNTU9NT01PTU1AQkA6ICAg<br />
ICAgICAgQEBCQEJACiAgICAgII+ST0xCLiAgICAgICAgICBCTkKPTU1P<br />
TU9NTY9CRUIgICAgICAgICAgckJqTYRCCiAgICAgIJBAICBAICAgICAg<br />
ICAgICBNICBPQk9NT01NQHEgIE0gICAgICAgICAgLkAgIEBACiAgICAg<br />
IISVT3ZCICAgICAgICAgICBCOnWMTU1PTU9NTUJKaUIgICAgICAgICAg<br />
LkJ2TUBCCiAgICAgIIRCkUKYSiAgICAgICAgIDCRQpdNTU9NT01PTUKV<br />
QkB1ICAgICAgICAgcUBAQEJACiAgICAgIEKETUJCjHYgICAgICAgR4+L<br />
Qk1NTU1NTU1NTU1NQkKINSAgICAgICBGhEJNTUBCCiAgICAgIIdCQk1/<br />
QlBOaSAgIExNRUKFT01NTU2PQoNNTU9NTYpCWk03ICAgckVxQodNQkKE<br />
CiAgICAgIEKYloRCTSAgQm1ChEIgIHFCTU9NQpBChUKEQk1PTUJMICBC<br />
QEJAQiAgQEJAQkBNCiAgICAgICBKlm2GhFBCj0KEQplCN0eIT01CQi4g<br />
ICAsQE1NTUBxTEJAQkBAQEJxQkBCQnYKICAgICAgICAgIGlHQpUsaTCE<br />
TZZCbk1NT4tFICA6ICBNQE9NTUBAQEJAUGlpQEBOOgogICAgICAgICAg<br />
ICAgLiAgIEKXTZBCj01NTUBCQEJAQkBNTU1AQEBNQEIKICAgICAgICAg<br />
ICAgICAgICBAQkBCLmlATUJCQEJAQkBAQk1AOjpCQEJACiAgICAgICAg<br />
ICAgICAgICAgQkBAQCAuQkBCLjpAQkAgOkJAQiAgQEJATwogICAgICAg<br />
ICAgICAgICAgICAgOjAgckBCQCAgQkBAIC5AQkA6IFA6CiAgICAgICAg<br />
ICAgICAgICAgICAgICAgdk1CIDpAQkAgOkJPNwogICAgICAgICAgICAg<br />
ICAgICAgICAgICAgICAsQkBCCg==<br />
</pre><br />
<br />
=== ASCII Skull #2 ===<br />
<br />
Players discovered that this was Base64 and, once decrypted, resulted in another ASCII skull:<br />
<br />
<pre><br />
:PB.Bk: <br />
,jBˆ@B@B@B@BBL. <br />
7G–B“B•BMMMMMB@B@B@Nr <br />
:kB’B.ˆ—MMOMOMOMOMMMMŒB˜B@B1, <br />
:5‘B.B˜BˆBBMMOMOMOMOMOMOMMŠ’nBnB@BBu. <br />
70n†•BˆB’B”BXBBOMOMOMOMOMOMMBMPB˜BˆB@B@B@Nr <br />
G˜–—BJ iBˆB‡ˆ OBMOMOMOMOMOMOM–2 B.B@B. EB@B@S <br />
’–BM‡GJBU. iSuBˆOMOMOMOMOMOMM—OU1: .kBLMˆM†B— <br />
BŒMMB™B 7ˆBBMMOMOMOMOMOBB–: B‡BMMˆB <br />
.˜ˆBŠB 7’–@MMOMOMOMM@B@: @@B@B@ <br />
.’OLB. BNB.MMOMOMM.BEB rBjM„B <br />
.@ @ M OBOMOMM@q M .@ @@ <br />
„•OvB B:uŒMMOMOMMBJiB .BvM@B <br />
„B‘B˜J 0‘B—MMOMOMOMB•B@u q@@@B@ <br />
B„MBBŒv G.‹BMMMMMMMMMMMBBˆ5 F„BMM@B <br />
‡BBM.BPNi LMEB…OMMMM.BƒMMOMMŠBZM7 rEqB‡MBB„ <br />
B˜–„BM BmB„B qBMOMB.B…B„BMOMBL B@B@B @B@B@M <br />
J–m†„PB.B„B™B7GˆOMBB. ,@MMM@qLB@B@@@BqB@BBv <br />
iGB•,i0„M–BnMMO‹E : M@OMM@@@B@Pii@@N: <br />
. B—M.B.MMM@B@B@B@MMM@@@M@B <br />
@B@B.i@MBB@B@B@@BM@::B@B@ <br />
B@@@ .B@B.:@B@ :B@B @B@O <br />
:0 r@B@ B@@ .@B@: P: <br />
vMB :@B@ :BO7 <br />
,B@B <br />
</pre><br />
<br />
Players discovered that, once both skulls had been stripped of spaces, the bytes of each skull that aren't equal to 0 could be subtracted using [https://pastebin.com/g3kA1Pif a script]. Once compiled, players received the following string:<br />
<br />
<pre><br />
OHVSURPHWLXQMXHJR...FUHRTXHXVWHGHVORVGHWHFWLYHVGHMXHJRVOROODPDULDQXQWUDLOKHDG?EOCJGDXVD-DPEDV-FDODYHUDV.KWPO<br />
</pre><br />
<br />
Players discovered that this was a caesar cipher. After shifting the string forward 23 places, it resulted in:<br />
<br />
<pre><br />
LESPROMETIUNJUEGO...CREOQUEUSTEDESLOSDETECTIVESDEJUEGOSLOLLAMARIANUNTRAILHEAD?BLZGDAUSA-AMBAS-CALAVERAS.HTML<br />
</pre><br />
<br />
When cleaned up, the message read:<br />
<br />
<pre><br />
Les prometi un juego...creo que ustedes los Detectives de Juegos lo llamarían un trailhead? BLZGDUSA-AMBAS-CALAVERAS.HTML<br />
</pre><br />
<br />
When translated from Spanish to English:<br />
<br />
<pre><br />
I promised you a game...I believe you Game Detectives would call it a trailhead? BLZGDAUSA-AMBAS-CALAVERAS.HTML<br />
</pre><br />
<br />
<code>USA-AMBAS-CALAVERAS</code> translated to <code>USE-BOTH-SKULLS</code>, and the <code>.HTML</code> extension hinted at a URL.<br />
<br />
=== Skull Video ===<br />
<br />
BLZGDA refers to the servers that Blizzard uses to host media on their website. As such, this led players to [ https://blzgdapipro-a.akamaihd.net/media/screenshot/usa-ambas-calaveras.html this page], which contains a video of a vitals screen depicting a skull and some other medical information. In addition, it also contained a graphic of one of the ASCII skulls. An Imgur mirror can be found [https://i.imgur.com/6Pk69LX.png here].<br />
<br />
Within the properties of the video, players found another comment in Spanish:<br />
<br />
<pre><br />
Parecen estar muy interesados en estos "héroes". ¿Tal vez les interese conocer algunos detallitos que he averiguado sobre ellos?<br />
</pre><br />
<br />
In English:<br />
<br />
<pre><br />
You seem to be very interested in these "heroes". Maybe interested to know some details that I found out about them?<br />
</pre><br />
<br />
In addition, the video contains a heartbeat monitor, and a series of 26 lines above it. When players assigned the letters of the alphabet to the 26 lines, and used the "pings" of the heartbeat to determine what letters to use, the following string was found:<br />
<br />
<pre><br />
momentincrime<br />
</pre><br />
<br />
=== amomentincrime E-mail ===<br />
<br />
'momentincrime' appeared to refer to the in-universe TV show "A Moment in Crime," which can be seen in the Roadhog and Junkrat [https://www.youtube.com/watch?v=l5kTATxt7bE video] that came out months before the release of Overwatch. However, players also discovered a website, [https://amomentincrime.com amomentincrime.com], and displayed the following text:<br />
<br />
<pre><br />
...Estableciendo conexión...<br />
...Protocolo Sombra v1.3 iniciado...<br />
<br />
...Infiltrando la respuesta automática del email de pistas...<br />
<br />
...Terminando conexión...<br />
</pre><br />
<br />
Players discovered that sending an e-mail to tips@amomentincrime.com resulted in an automated email response:<br />
<br />
<pre><br />
Thank you for contacting A Moment in Crime's anonymous crime line!<br />
<br />
We have analyzed your submission and forwarded the information to the relevant parties. Your help could be vital in apprehending these cri<br />
<br />
...Estableciendo conexión...<br />
...Protocolo Sombra v1.7 iniciado...<br />
<br />
<br />
01:07:47 02:02:02 01:08:06 02:13:43 01:18:32<br />
01:18:21 02:10:19 01:06:21 02:05:18 01:04:02<br />
01:07:08 02:18:25 01:13:04 02:19:20 01:23:02<br />
01:16:40 02:16:35 01:23:04 02:17:16 01:06:42<br />
01:13:29 02:18:06 01:05:02 02:15:41 01:08:34<br />
<br />
j.7F57O,NLv:qj.7B:,1qv@B1j5ivB:,<br />
<br />
...Terminando conexión...<br />
<br />
minals and bringing them to justice. These fugitives are responsible for a string of robberies, arson, and other crimes stretching from Sydney to King's Row.<br />
<br />
Authorities believe that they have set their sights on crossing the Atlantic to America.<br />
</pre><br />
<br />
Players discovered that, if the sets of numbers were taken as AA:BB:CC, where AA was the number of skull (in order of discovery), BB was the row and CC was the column (as seen [https://i.imgur.com/ZgN2MVQ.png here]), and organized into a 5x5 matrix, it would result in:<br />
<br />
<pre><br />
S j G B L <br />
. @ M O k <br />
i , v : 0 <br />
E 7 r q N <br />
J P 5 F 1<br />
</pre><br />
<br />
Players discovered that this Matrix could be used as a bifid key to decode the text underneath the table of numbers in the email, as shown below:<br />
<pre><br />
j . 7 F 5 7 O , N L v : q j . 7 B : , 1 q v @ B 1 j 5 i v B : ,<br />
12 21 42 54 53 42 24 32 45 15 33 34 44 12 21 42 14 34 32 55 44 33 22 14 55 12 53 31 33 14 34 32<br />
<br />
1 2 2 1 4 2 5 4 5 3 4 2 2 4 3 2 4 5 1 5 3 3 3 4 4 4 1 2 2 1 4 2<br />
1 4 3 4 3 2 5 5 4 4 3 3 2 2 1 4 5 5 1 2 5 3 3 1 3 3 1 4 3 4 3 2<br />
<br />
11 24 23 14 43 22 55 45 54 34 43 23 22 42 31 24 45 55 11 52 35 33 33 41 43 43 11 24 23 14 43 22<br />
</pre><br />
<br />
This gave players the following string:<br />
<br />
SOMBr@1NF:rM@7iON1SP0vvErrSOMBr@<br />
This phrase was found to be leet-speak, and was translated to:<br />
<br />
<pre><br />
Sombra Information is power Sombra<br />
</pre><br />
<br />
The string <code>SOMBr@1NF:rM@7iON1SP0vvErrSOMBr@</code> was used as a password later on in the ARG.<br />
<br />
== A Moment in Crime Transmission ==<br />
<br />
[[File:Momentincrime.png|thumbnail|right|amomentincrime.com as of August 24th, 2016]]<br />
<br />
Once the 23-hour countdown on the Skycoder forum post reached zero, [https://amomentincrime.com amomentincrime.com] was updated. It now read:<br />
<br />
<pre><br />
...Estableciendo conexión...<br />
...Protocolo Sombra v1.9 iniciado...<br />
<br />
...Transmitiendo información a ómnicos activos... 2%<br />
<br />
...Terminando conexión...<br />
</pre><br />
<br />
Translated from Spanish to English:<br />
<br />
<pre><br />
...Establishing connection...<br />
...Sombra Protocol v1.9 initiated...<br />
...Transmitting information to active omnics... 2%<br />
<br />
...Ending connection...<br />
</pre><br />
<br />
A comment was also added to the source code:<br />
<br />
<pre><br />
Bien hecho, ya tienen mi clave. Hackear este programa de televisión no tuvo chiste. Espérense a lo que sigue.<br />
</pre><br />
<br />
When translated:<br />
<br />
<pre><br />
Well done, you have my password. Hacking this television program was meaningless. Wait for what is coming.<br />
</pre><br />
<br />
The percent on the amomentincrime.com slowly increased over time. Once the 5% milestone was hit, the Sombra Protocol version number changed to to v1.95. Afterwards, the percentage increased by 0.0038% every 3 minutes in real time.<br />
<br />
In addition, another comment was added:<br />
<br />
<pre><br />
Parece que se están calentando un poco las cosas... tendré que pasar desapercibida mientras esto se finaliza.<br />
</pre><br />
<br />
Translated:<br />
<br />
<pre><br />
It seems things are heating up a bit... I'll have to go unnoticed while this is finishing.<br />
</pre><br />
<br />
On 18th October at 19:02 GMT the site reached 100%, and the site updated with the following message:<br />
<br />
<pre><br />
...Transmisión finalizada - finalizando carga... <br />
...Carga finalizada. Unidad Bastion E-54 comprometida...<br />
</pre><br />
<br />
Which roughly translates to:<br />
<br />
<pre><br />
...Transmission complete - finishing upload...<br />
...Upload finished. Unit Bastion E-54 engaged...<br />
</pre><br />
<br />
Hidden in the source code of the site was the text <code>v1.4.0.2.324??</code>. Players then correctly assumed that this referred to a future build of Overwatch itself.<br />
<br />
== Sombra vs. LumériCo ==<br />
<br />
=== The Hacked Bastion ===<br />
<br />
On October 19, 2016, a new Overwatch version was released - version 1.4.0.2.32448. Shortly afterwards, the version number in the source code of the amomentincrime site updated to the same version number. After the build launched, players discovered that the hero Bastion had a strange interaction when near the "SOMBRA PROTOCOL" monitors on Dorado, and would emit a message in morse code, which can be heard [https://www.youtube.com/watch?v=Hkd__ceYm-Y here]. When the morse was decoded, players received the following string:<br />
<pre><br />
SQOFJFBNITIZWGDXSDO<br />
</pre><br />
<br />
Players discovered that this was a Vigenere cipher, and the key consisted of the alphabetic characters from the<br />
<code>SOMBr@1NF:rM@7iON1SP0vvErrSOMBr@</code> string, it was decoded to read:<br />
<br />
<pre><br />
ACCESSWWWLUMERICOMX<br />
</pre><br />
<br />
This led players to the [https://lumerico.mx/ LumeriCo website]. ''(Editor's note: as of 2018, this site appears to be inactive.)''<br />
<br />
=== LuméReaction ===<br />
<br />
[[File:Lumerico.png|thumbnail|right|The homepage of https://lumerico.mx]]<br />
<br />
The LumeriCo website was for the in-universe, Mexican tech giant LumériCo, who had built several reactors in the Dorado region. The website had a [https://lumerico.mx/news news page], noting the imminent opening of a new reactor on November 1 as well as a recent attack on its construction site. There were also [https://lumerico.mx/about About] and [https://lumerico.mx/login Login] pages.<br />
<br />
Players also discovered a <code>robot.txt</code> file, which appeared to server no purpose and only contained the text <code>Allow: omnics</code>, and appeared to be a joke about the [https://en.wikipedia.org/wiki/Robots_exclusion_standard Robots exclusion standard]. Another text file was discovered called <code>omnics.txt</code>, which contained the text:<br />
<br />
<pre><br />
Allow: ??<br />
Allow: ???<br />
</pre><br />
<br />
And appeared to be yet anotehr joke about the Robots exclusion standard. And, finally, an <code>api</code> file that contained <code>{"message":"thanks for calling the api"}</code> and, humorously, has no practical purpose.<br />
<br />
=== Phone Number ===<br />
<br />
At the bottom of the LumeriCo website, players discovered a phone number <code>(510) 766-2726</code>. When called, players heard a woman listing off a string of numbers in Spanish, a recording of which can be found [https://soundcloud.com/jackwilsdon/510-766-2726a here]. The numbers spoken are: <code>5-2-4-1-3 (pause) 23-4-14-8-6-18-17-23-21-18-15</code>.<br />
When assuming that a=1, b=2, etc, the second part of the message can be decoded to: <code>WDNHFRQWURO</code>. This was found to be a ROT-23 cipher, and decoded to: <code>TAKECONTROL</code>.<br />
<br />
=== Take Control ===<br />
<br />
The phone message led players to an important [https://lumerico.mx/TAKECONTROL/index.html page] on the site, under the directory <code>TAKECONTROL</code>. It was styled the same way as amomentincrime.com and featured [https://lumerico.mx/calavera.png an image of Sombra's skull icon], named "calavera.png". There was also text on the page:<br />
<br />
<pre style="word-break:break-all;word-wrap: break-word;"><br />
ethldtíoíesnoemfetuylm.bnlsssqtann)hcnslararuCpdGeoopéqubdsroaan.arnasdmdor1vrsmerñerlsdacnnnoaexedsidcn.iarsgcyi,iqeqnd.pooitoaeaaransterLetéáedasodocMrnseeiuCsimnosetlójnueodacapsadcoanfasest.rnucaodacadmdoemoipíogPoipbehaSussai.,yccandin.reueatenaoiorneoeetaoéyenimt¿rPehec,uurobudeílrysriteenasni,adngpjrálireecgrolsmhYnao?nmonomepeldezmapcpunoaulrrruCstmeitltetlróesoapsdéyufcuascaa,rensbuinergnqedlmvlbpdtaz.enebuineuldoerecrGefqfirrasulrbeatHsilnbaúaeeaaooassraooa,ioedo:aLiuielPr ursmoootlnielteeánlosulobeauaanopearrúiesltéyrosssisuaaeaenremsieaismdjmolrsspebiecdéyusittnvrcacp.taebrtLiunróporner<br />
<br />
eúcrneuyraarsettsyrseen.aaPnrneuyraeastuCpnhl/wLloaloa.qartlsyuínreute.evgdpiuábdmPooucvdeccmoreurr.o?unriorydbaSnalegeáezadienáutalaaioeemfcbgdinableoc¿éppoeocelsumuoaHearsosqadrrrftuLiorannnoneneriiatcnlomoqnaqdunrcno,enmerosaereisloabolii.e.dormerosepopdé,eo:r#5scoegaqoeaibs(edioraamtdírnlyoetjcgratmnrrobnrsstloeYqoeocicpnómlpernmaepogenmodqamubodnaeasuaenMoolloupeqvgrLtúr<br />
<br />
tsosrdvoeaerroaeusdmaauamoMobsnaeanraunnt,roierbeoiemaodbmantursotñauoureeuoerreopc.etlr<br />
<br />
sotñneerLimeaFsNJ<br />
</pre><br />
<br />
Players found this to be a column order transposition cipher with the key <code>5 2 4 1 3</code>, which was found in the phone message. The cleaned up result was: <br />
<br />
<pre><br />
Los felicito por haber llegado hasta aquí. Solo quería saber si estaban listos. (Hey, es muy difícil encontrar buena ayuda últimamente...deberían ver algunos de los payasitos que están trabajando conmigo) Por ahora, continuemos con el verdadero reto: acabar con LumériCo y su president e Guillermo Portero. ¿Y porqué? Porque es un hombre codicioso, corrupto y un ladrón abominable. Su plan de traer en línea el más grande y el más poderoso zigurat el 1 de noviembre no es nada más que una artimaña, un elaborado plan designado para ejercer aún más influencia sobre la gente de México y en gordar los bolsillos de sus compinches. ¿Y quién va a pagar por eso? La gente común y corriente, los mismos que siempre quedan olvidados.<br />
<br />
He empezado a mejorar mis protocolos para que sean usados para derrumbar la infraestructura de LumériCo y Los Muertos también están intentando levantarse en contra de la corrupción. Mientras tanto, escarben por el sitio de LumériCo y busquen información que podamos usar en contra del cabrón, mejor aún, encuentren su nombre de usuario y contraseña para asegurarnos de que ciertos detalles no muy favorables sobre el presidentito...aparezcan...<br />
<br />
Pude encontrar el nombre de usuario y contraseña de un empleado de soporte de LumériCo, empiecen por ahí:<br />
<br />
GFlores/g#fNwP5qJ<br />
</pre><br />
<br />
Translated:<br />
<br />
<pre><br />
I'm congratulating you for getting in here. I only wanted to know if you were ready or not. (Hey, it's really difficult to get good help lately... you should see some of the clowns I'm working with). For now, let's continue with the true challenge: taking down Lumerico Corp president Guillermo Portero. Why? Because he's a greedy and corrupt man, and an abominable thief. His plan of bringing in line the most powerful and biggest zigurat the 1st of november us nothing more than a deceit, an elaborate plan by his gang to become even more influential in the people of Mexico and get more money. And who's gonna pay for that? Common people, the ones that are always forgotten.<br />
<br />
I've started upgrading my protocols so that they are used to take down the Lumerico Corp infraestructure and Los Muertos are also trying to go against the corruption. Meanwhile, search the Lumerico Corp site for info we can use against the bastard, or better, get his username and password so that hundreds "not so favorable" facts about the president start popping up.<br />
<br />
I was able to get the username and pass of a Lumerico Corp employee, start here:<br />
<br />
GFlores/g#fNwP5qJ<br />
</pre><br />
<br />
=== Presidential Login ===<br />
<br />
Using the credentials obtained through the message above on the https://lumerico.mx/login Lumerico login page], players accessed the account of Gonzalo Flores, including [https://lumerico.mx/email his emails]. Transcripts of these emails are archived [https://docs.google.com/spreadsheets/d/1zh7OU2dEOnD4X43ImvZBNpS75FLkj-rL75pXJ2l3TuQ/htmlview?sle=true# here].<br />
<br />
Here is the only email that held relevance to the ARG:<br />
<br />
<pre><br />
De:Valeria Valderrama<VValderama@lumerico.mx><br />
Para:Gonzalo Flores<GFlores@lumerico.mx><br />
Asunto:Página de Guillermo<br />
<br />
Hola, Gonzo:<br />
¿Puedes ver el tráfico de https://lumerico.mx/president-bypass? Guillermo debería ser el único accediendo desde su página de inicio privada, pero parece que está teniendo mucho tráfico. Tal vez tengamos que escalar esto a<br />
la señorita Jiménez, pero quiero estar segura de que es digno de su tiempo.<br />
<br />
Valeria Valderrama<br />
</pre><br />
<br />
The email references a lot of traffic to the [https://lumerico.mx/president-bypass President Bypass Link]. That page displays an "access denied" message, but there is a <code>President Auth-Bypass Revision 1.02: /.git/</code> line in the source code.<br />
<br />
This line led players to [https://github.com/internetwache/GitTools/tree/master/Dumper dump the data] from the [https://lumerico.mx/president-bypass/.git/ /.git/ subpage] with git protocol and upload it to [https://gist.github.com/anonymous/987beb6a5c817b53da820562854bdebe Github]. That were codebehind files for the website, including a '''class.authentication.php''' file containing an encryption function and '''class.president-bypass.php''' file containing the president's (Guillermo Portero) username <code>GPortero</code> and encrypted password <code>?MzY:MTI5:?AzY:OWM?:?EDO:ZGU?:jVTM:MTJm:2ITM:MTUw:?QjY:OWY?:?kTO:MTQx:?MzY</code>.<br />
<br />
ARG players with technical knowledge wrote a function that reversed the encryption from class.authentication.php and used it on the encrypted password. The resulting password was <code>Xy@4+Bkuqd<53uJ</code>.<br />
<br />
After logging in to the President's account, players were able to read his emails. After 30 minutes, another email appeared in the President's inbox, from Sombra herself:<br />
<br />
<pre><br />
Veo que se han podido infiltrar en su correo.<br />
No se preocupen, él no puede ver este correo, lo he ocultado de su vista si se conecta desde una de sus direcciones conocidas de IP.<br />
Necesito un poco más de tiempo para establecer el próximo grupo de potocolos. Manténganse atentos a principios de la otra semana. Le echaré unos cuantos trapitos sucios en sus correos para que se filtren al público<br />
"accidentalmente". Ya veremos como reaccionan los medios de comunicación.<br />
</pre><br />
<br />
The rough translation is:<br />
<br />
<pre><br />
I see you have been able to infiltrate into his mail.<br />
Don't worry, he cannot see this email, I've hidden it from his sight if he connects from one of his known IP addresses.<br />
I need a little bit of time to establish the next set of protocols. Stay alert early next week. I'll throw some dirty laundry in his emails that can "accidentally" leak to the public. We'll see how the media will react to that.<br />
</pre><br />
<br />
=== Admin Access ===<br />
<br />
[[File:Lumerico admin panel.png|thumbnail|right|The admin panel of the Lumerico site, only accessible by logging in as MJimenez]]<br />
<br />
On October 25, new emails were discovered in the GFlores account, but they had no immediate significance to the ARG. In addition, omnics.txt was updated:<br />
<br />
<pre><br />
Allow: Tzolk'in<br />
Allow: Imix ChikchanManik Imix ChikchanImixChikchanImix Manik Chikchan Imix Kimi Chikchan Chikchan Kimi ChikchanImixChikchanImix ChikchanKimi<br />
</pre><br />
<br />
Tzolk'in is the name of a [[Wikipedia:Maya calendar#Tzolk'in|Mayan Calendar]], and the second line was a series of animals from it in the Tzolk'in dialect. Imix stands for Day 1, Chikchan — 5, Manik — 7 and Kimi — 6. Turned into numbers, the string reads <code>1 57 1 5151 7 5 1 6 5 5 6 5151 56</code>. These digits turned into pictograms of [[Wikipedia:Maya numerals|Maya numerals]] (one by one, not numbers as a whole) written horizontally become <code>. -..- . -.-. ..- - . .- - - .- -.-. -.-</code> That is a morse code, which decodes to <code>EXECUTEATTACK</code>.<br />
<br />
This led us to https://lumerico.mx/EXECUTEATTACK/index.html, where the following text was discovered:<br />
<br />
<pre><br />
Ha llegado el momento. Esos correos expuestos la verdad sobre Portero, iniciado la revuelta, y hemos convencido a la gente de México a apoyar nuestra causa. Ahora es el momento para el golpe. Convertiremos su preciada inauguración el 1 de noviembre en un gran movimiento en su contra. Necesito que hagan una cosa:<br />
Consigan acceso al correo del jefa de seguridad y busquen alguna forma de ayudarme en el ataque. Es posible que lo vean contactando a Portero pronto. He cambiado su contraseña a: d0r*NuLw9<br />
</pre><br />
<br />
Translated to English:<br />
<br />
<pre><br />
The moment has come. These emails exposed the truth about Portero, initiated the revolt, and have convinced people of Mexico to support our cause. Now is the time to strike. Convert his precious inauguration on November 1 to a large movement against it. I need you to do one thing:<br />
Get access to the email security chief and seek some form of help in the attack. You may see her contacting Portero soon. I've changed her password: d0r*NuLw9<br />
</pre><br />
<br />
Logging in with the credentials <code>MJimenez / d0r*NuLw9</code> gave us access to the [https://lumerico.mx/admin admin panel] of Lumerico. Until 01 Nov. 2016 it stayed inactive and any command was answered with the same message saying the terminal disconnected.<br />
<br />
=== The Terminal ===<br />
Once the console became usable, players could type <code>help</code> to see a list of commands:<br />
<br />
'''override''' Engineer safety mode override<br />
'''help''' Provides help information about commands<br />
'''version''' Displays system version information<br />
'''about''' Displays information about the system<br />
'''grep''' Search output by string<br />
<br />
In the MJimenez email account, there was an email labeled <code>Corrupción de correo electrónico</code> with highlighted text in side of it, specifically <code>/ter/</code>. After some hard thinking, people discovered that doing <code>about | grep 'ter'</code> (in linux this is a command to list all the lines from the ''about'' that have a substring ''ter'') returns this text:<br />
<br />
'''Open''' source lightweight shell for any terminal.<br />
'''Anything''' with a terminal<br />
'''1.1.0''' - expanded terminal support<br />
<br />
The first word of every line given from the output was boldened and purple. Putting the words together, we got <code>OpenAnything1.1.0</code>, which was a solution which was used shortly.<br />
<br />
Another available command for the terminal was <code>override</code>. After typing <code>override</code>, the console prompted ARG players with three security questions:<br />
<br />
# '''Favorite Movie'''. The answer to the prompt is <code>some like it bot</code>, a movie from the Overwatch universe.<br />
# '''Favorite Cookie Flavor'''. The answer being <code>nuevas sabor delicias</code>, a flavor referenced in an email in the MJimenez account.<br />
# '''Secret'''. The answer to this prompt is <code>OpenAnything1.1.0</code>.<br />
<br />
This returned <code>OK</code>, gave players admin access, and enabled a new set of commands: <br />
<br />
'''ls''' Lists files by path<br />
'''cat''' Read file by path<br />
'''exec''' Execute a file <br />
<br />
Typing <code>ls</code> listed two files: <code>payload</code> and <code>d_ilqh_nhb.html</code> (the file name is a ROT23 for ''a_fine_key'').<br />
<br />
[[Image:A fine key.png|thumb|right|a_fine_key.html]] Reading the second file with <code>cat mnt/d_ilqh_nhb.html</code> yielded a text where ASCII characters (repeating string <code>vhnl tldv xyl vcxelo xv qhrtv. zkolg[nl]</code>) were in a shape of a key. Deciphering it using the Affine cipher (A=23, B=23) yielded the following string: <code>some keys are shaped as locks. index[me]</code>. It is assumed that ''some keys are shaped as locks'' line alluded to the [[#Tracer_Trail_Cipher|Tracer Trail]] ciphertext being used as a key.<br />
<br />
Simultaneously, entering <code>exec payload</code> presented players with a prompt — the answer to which is the [[#Tracer_Trail_Cipher|Tracer Trail]]. When inputted, players were given a message that looked quite similar to what was previously seen at amomentincrime.com. The counter shown in the top right is then incremented.<br />
<br />
[[Image:LumericoTerminalTracerEntered.jpg|850px]]<br />
<br />
=== Misdirection ===<br />
<br />
[[Image:LumericoHacked.jpg|thumb|right|lumerico.mx website hacked by Sombra]]<br />
<br />
On October 1, 2016, the lumerico.mx home page changed to show "glitches" and the black overlay with a message under the purple skull, while a string <code>&lt;!-- MISDIRECTION --></code> was also added to the source of the page.<br />
<br />
The message says: <br />
<br />
<pre><br />
Buen trabajo, amigos. No lo hubiera logrado sin su ayuda. En fin, me consiguieron los recursos que necesitaba para mi siguiente golpe – les encantará.<br />
Esperen noticias de mí en los próximos días...<br />
Les voy a mandar algo para agradecerles… Ojalá lo puedan aprovechar.<br />
Dasvidanya amigos<br />
</pre><br />
<br />
Translated:<br />
<br />
</pre><br />
Good job, folks. I would not have done it without your help. Anyway, I got the resources needed for my next hit - you'll love it.<br />
Expect to hear from me in the coming days...<br />
I'm going to send something to thank you ... Hopefully you can use it.<br />
Dasvidanya friends<br />
</pre><br />
<br />
[[File:Dia de los muertos spray.jpg|thumbnail|right|The Día de Los Muertos spray that was added to the game after Sombra hacked the Lumerico site]]<br />
<br />
Note that ''Dasvidanya'' is a phonetic transliteration of ''до свиданья'' — a russian phrase for "goodbye". The thing that Sombra sent as a ''thank you'' was a new spray, named "Día de Los Muertos" after the Mexican festival that took place at the same time as the ARG. The spray is currently only available on the PC version of the game.<br />
<br />
The '''MISDIRECTION''' string lead to the page [https://lumerico.mx/MISDIRECTION/index.html https://lumerico.mx/MISDIRECTION/index.html] containing:<br />
<br />
...Estableciendo conexiуn...<br />
...Protocolo Sombra v2.3 iniciado...<br />
<br />
...Desviando datos del zigurat de LumériCo hacia el objetivo...<br />
...Descifrando contraseсas del objetivo...<br />
...Acceso otorgado al directorio de volskayaindustries.com...<br />
<br />
...boop ;)...<br />
...Terminando conexión...<br />
<br />
Translated: <br />
<br />
...Establishing connection...<br />
...Sombra Protocol v2.3 initiated...<br />
<br />
...Forwarding the data from the LumériCo ziggurat to the target...<br />
...Deciphering the target passwords...<br />
...Access Granted to the directory of volskayaindustries.com...<br />
<br />
...boop ;)...<br />
...Ending connection..<br />
<br />
== Blizzcon ==<br />
<br />
Blizzcon 2016 opened with the [https://www.youtube.com/watch?v=Og5-Pm4HNlI Overwatch short "Infiltration"], a short depicting Reaper, Widowmaker, and Sombra on Volskaya Industries. During the showing of the short, Sombra's [https://playoverwatch.com/en-us/heroes/sombra hero page] went live, showcasing her abilities and character backstory.<br />
<br />
[[File:SombraBG.jpg|center|500px]]<br />
<br />
== References ==<br />
<br />
=== Community Resources ===<br />
<br />
A collection of tools and resources made by the Game Detectives Discord community for use in the ARG.<br />
<br />
==== ASCII Skull ====<br />
<br />
'''ASCII Skull Analysis:''' https://github.com/bahamas10/sombra<br />
<br />
'''Removing SOMBR@ Analysis:''' https://pastebin.com/15u27YTC<br />
<br />
'''ASCII Skull Eye Analysys:''' https://docs.google.com/spreadsheets/d/1-JQpWyitMKYhP-4l8ZDFiJI3NjqRrvoEnRdFQawike8<br />
<br />
==== Google Docs ====<br />
<br />
'''Observations and Speculations Spreadsheet:''' https://docs.google.com/spreadsheets/d/1rI08baFQmAwaqHC-9GF9VNGCYjuRE-q4LN9k4ottjuQ/pubhtml<br />
<br />
'''LumériCo Emails and Translations Spreadsheet:''' https://goo.gl/cQgdIJ (Courtesy of UberPilot)<br />
<br />
==== Tracer Code ====<br />
<br />
'''GOL! Guesser:''' https://axxim.net/ow/gol-guesser/<br />
<br />
'''Uber GOL! Guesser:''' https://axxim.net/ow/gol-guesser/uber/<br />
<br />
The Uber GOL! Guesser only prints out UTF-8 compliant results, which makes it easier to identify potentially correct answers.<br />
<br />
'''Bruteforcing tool:''' https://github.com/glv2/bruteforce-salted-openssl<br />
<br />
=== Third-Party Resources ===<br />
<br />
A collection of third-party tools and resources that the Game Detectives Discord community has used in the ARG.<br />
<br />
==== Image of Reaper ====<br />
<br />
'''stegdetect (Linux):''' https://github.com/abeluck/stegdetect<br />
<br />
stegdetect is a Linux utility used to determine if a given image may contain encoded information.<br />
<br />
'''JPHide & JPSeek:''' https://linux01.gwdg.de/~alatham/stego.html<br><br />
'''iSteg (Mac OSX):''' https://www.hanynet.com/isteg/<br />
<br />
JPHide & JPSeek is used to hide and find, respectively, a file inside a JPEG image.<br><br />
iSteg works similarly to JPHide on the Mac OSX platform.<br />
<br />
'''stegbreak (Linux):''' https://linux.die.net/man/1/stegbreak<br />
<br />
stegbreak is used to do brute-force dictionary attacks on JPEG images.<br />
<br />
=== Easter Eggs ===<br />
<br />
The following are collection of references and Easter Eggs encountered throughout the ARG.<br />
<br />
==== In-Game ====<br />
<br />
'''Sombra's "Amused" Emote'''<br />
<br />
This character emote features the [[Sombra_ARG_False_Leads | Skycode]], accompanied by soft music resembling the [https://www.reddit.com/r/Overwatch/comments/4w7ey1/the_sombra_skysong/ Skysong]. Sombra's expression is one of amusement, and it's a nod to the community's prolonged creative attempts to solving an nonexistent puzzle.<br />
<br />
[[File:EmoteSkycode.png|200px]]<br />
<br />
'''Skycode Spray'''<br />
<br />
This character spray features Sombra's iconic skull in front of a compass rose and the [[Sombra_ARG_False_Leads | Skycode]]. This is a reference to both the [[#Directions_&_Letters|cardinal directions]] used in one of the puzzles and to the Skycode, which is considered the most significant false lead that solvers encountered.<br />
<br />
[[File:SkycodeSpray.png|200px]]<br />
<br />
==== In-ARG ====<br />
<br />
'''Espresso Command'''<br />
<br />
There was a hidden command in LumériCo's [[#The_Terminal | admin terminal]]. Inputting the word <code>espresso</code> returned the following message: <code>Coffee Pot Status: Brewed approximately 23 hours ago, currently 0% full</code><br />
This is referencing a variety of [https://goo.gl/cQgdIJ emails] found in the LumériCo site involving broken espresso machines and incompetent coffee brewing, which caught the attention of the community and gave way to a vast variety of mediocre jokes. Furthermore, "23 hours" makes reference to the number 23, which was believed by many to possess some sort of significance to the ARG, as Sombra would be the 23rd character in Overwatch. Finally, "0%" references the ARG's notable waiting periods that have been widely criticized by the community, specifically [[#A_Moment_in_Crime_Transmission | A Moment in Crime's upload percentage]].<br />
Due to the iconic purple text it is believed that this hidden command was created by Sombra herself.<br />
<br />
[[File:EspressoCommand.png]]<br />
<br />
=== Media Appearances ===<br />
<br />
'''3rd Aug. 2016'''<br />
<br />
[EN] [https://kotaku.com/overwatch-fans-find-new-clues-about-the-mysterious-hero-1784767759 Kotaku - Overwatch Fans Find New Clues About The Mysterious Hero Sombra]<br />
<br />
[EN] [https://www.polygon.com/2016/8/3/12369144/overwatch-summer-games-sombra-arg-blizzard?utm_campaign=polygon&utm_content=chorus&utm_medium=social&utm_source=twitter Polygon - Overwatch fans are trying to crack the latest mystery about Sombra]<br />
<br />
[EN] [https://www.pcgamesn.com/overwatch/overwatch-sombra PCGamesN - Overwatch's Sombra ARG continues with new clues, but no solutions]<br />
<br />
[EN] [https://team-dignitas.net/articles/blogs/overwatch/9989/who-is-sombra-all-facts-and-clues-about-sombra Team-Dignitas - Who is Sombra? All facts and clues about Sombra]<br />
<br />
[FR] [https://overwatch.gamewave.fr/un-nouveau-code-cache-dans-la-derniere-cinematique-d-overwatch/ Gamewave - UN NOUVEAU CODE CACHÉ DANS LA DERNIÈRE CINÉMATIQUE D'OVERWATCH!]<br />
<br />
[EN] [https://www.follownews.com/overwatch-fans-find-new-clues-about-the-mysterious-hero-sombra-1nhqt FollowNews - Overwatch Fans Find New Clues About The Mysterious Hero Sombra]<br />
<br />
'''4th Aug. 2016'''<br />
<br />
[EN] [https://www.pcgamer.com/overwatch-summer-games-trailer-hides-a-mysterious-secret/ PCGamer - Overwatch Summer Games trailer hides a mysterious secret]<br />
<br />
[SK] [https://www.sector.sk/novinka/121273/nove-overwatch-video-obsahuje-dalsie-tajomstva.htm Sector - Nové Overwatch video obsahuje ďalšie tajomstvá]<br />
<br />
[EN] [https://www.techinsider.io/overwatch-sombra-character-2016-8 Techinsider - 'Overwatch' players are going to insane lengths to solve a mystery that Blizzard's teased for months]<br />
<br />
[EN] [https://gamerant.com/overwatch-sombra-clues/ Gamerant - Overwatch Players Uncover More ‘Sombra’ Clues]<br />
<br />
[HU] [https://www.gamestar.hu/hir/overwatch-sombra-karakter-214739.html Gamestar - Overwatch - újabb nyomok utalnak a még be nem jelentett hősre]<br />
<br />
'''5th Aug. 2016'''<br />
<br />
[EN] [https://kotaku.com/days-later-overwatch-fans-cant-figure-out-the-sky-cod-1784872143 Kotaku - Days Later, Overwatch Fans Can't Figure Out The 'Sky Code' Mystery]<br />
<br />
[NL] [https://www.gamersnet.nl/nieuws/201608/cryptische_speurtocht_naar_overwatch_nieuwe_heldin_sombra_gaat_bizar_diep/ Gamersnet - Cryptische speurtocht naar Overwatch' nieuwe heldin Sombra gaat bizar diep]<br />
<br />
[ES] [https://www.alfabetajuega.com/noticia/overwatch-el-enigma-de-sombra-sigue-ofreciendo-nuevos-detalles-n-71772 Alfa Beta Jeuga - Overwatch: El enigma de Sombra sigue ofreciendo nuevos detalles]<br />
<br />
[EN] [https://www.youtube.com/watch?v=5ROjN-_F0ZU&feature=youtu.be&t=4m22s IGN (Video) - Sombra: Overwatch's Secret New Hero - Overwatch HQ]<br />
<br />
'''7th Aug. 2016'''<br />
<br />
[EN] [https://www.gamespresso.com/2016/08/summary-state-sombras-arg-overwatch/ Gamespresso - Summary of the state of sombra's ARG in Overwatch]<br />
<br />
'''8th Aug. 2016'''<br />
<br />
[EN/CN] [https://www.zhentoo.com/doc92368 Zhentoo - Overwatch new hero Secret Dorado hidden mystery] <br />
<br />
[EN] [https://www.technewstoday.com/30880-overwatch-sombra-continues-to-elude-detectives/ TechNewsToday - Overwatch: Sombra Continues to Elude Detectives]<br />
<br />
'''11th Aug. 2016'''<br />
<br />
[EN] [https://www.youtube.com/watch?v=IZR-pa0it4Q The Know - New Overwatch Hero Hints]<br />
<br />
'''12th Aug. 2016'''<br />
<br />
[EN] [https://kotaku.com/after-two-weeks-overwatch-fans-sombra-investigation-re-1785204389 Kotaku - Overwatch Fans' Sombra Investigation Reaps A Skull Code]<br />
<br />
'''14th Aug. 2016'''<br />
<br />
[EN] [https://gamerant.com/overwatch-sombra-skull-code/ Gamerant - Skull Code is Latest Clue in Overwatch’s Sombra Investigation]<br />
<br />
'''16th Aug. 2016'''<br />
<br />
[EN] [https://www.christiantoday.com/article/overwatch.dlc.update.skull.code.the.latest.clue.for.sombra.investigation/93197.htm Christian Today - 'Overwatch' DLC update: Skull Code the latest clue for Sombra investigation]<br />
<br />
[EN] [https://en.yibada.com/articles/151811/20160816/overwatch-dlc-update.htm Yibada - 'Overwatch' DLC update: New clues on Sombra's inclusion to the roster revealed]<br />
<br />
'''23rd Aug. 2016'''<br />
<br />
[EN] [https://www.technewstoday.com/31129-overwatch-all-we-know-about-the-sombra-arg/ Tech News Today - Overwatch: All We Know About the Sombra ARG]<br />
<br />
'''24th Aug. 2016'''<br />
<br />
[EN] [https://gamerant.com/overwatch-forums-sombra-message/ Gamerant - Overwatch Forums Glitch Out, Reveals Hidden Message From Sombra]<br />
<br />
[EN] [https://gamerant.com/overwatch-sombra-clue-website/ Gamerant - New Website Counts Down To Next Clue For Overwatch’s Sombra]<br />
<br />
[EN] [https://www.polygon.com/2016/8/24/12623736/overwatch-sombra-arg-clues-skycoder Polygon - Overwatch's Sombra mystery appears to be coming to a close]<br />
<br />
[EN] [https://www.vg247.com/2016/08/24/overwatch-forums-glitch-out-reveal-a-message-from-the-mysterious-sombra/ VG247 - Overwatch forums glitch out, reveal a message from the mysterious Sombra]<br />
<br />
[EN] [https://www.technewstoday.com/31151-sombra-hacks-into-overwatch-forums/ Tech News Today - Sombra Hacks Into Overwatch Forums]<br />
<br />
[EN] [https://www.ign.com/articles/2016/08/24/overwatch-mystery-character-sombra-could-be-revealed-today IGN - Overwatch Mystery Character Sombra Could Be Revealed Today]<br />
<br />
'''25th Aug. 2016'''<br />
<br />
[EN] [https://kotaku.com/overwatch-players-are-getting-fed-up-with-the-sombra-ar-1785765307 Kotaku - Overwatch Players Are Getting Sick Of The Sombra ARG]<br />
<br />
[EN] [https://www.ign.com/articles/2016/08/25/overwatch-made-the-internet-lose-its-mind-last-night-and-i-had-a-front-row-seat IGN - Overwatch Made the Internet Lose its Mind Last Night, And I Had a Front-Row Seat]<br />
<br />
[EN] [https://www.technewstoday.com/31182-overwatch-countdown-to-sombra/ Tech News Today - Overwatch: Countdown to Sombra]<br />
<br />
<br />
'''30th Aug. 2016'''<br />
<br />
[EN] [https://www.pcgamer.com/overwatch-sombra-arg-mystery/ PC Gamer - Overwatch's Sombra riddle begins to irritate the players trying to solve it]<br />
<br />
'''3rd Oct. 2016'''<br />
<br />
[EN] [https://www.mobilenapps.com/articles/19398/20161003/overwatch-update-sombra-blizzcon-halloween-event-leak.htm Mobile & Apps - Sombra To Be Revealed At Blizzcon? Halloween Event Confirmed In Data Leak]<br />
<br />
'''4th Oct. 2016'''<br />
<br />
[EN] [https://www.itechpost.com/articles/36011/20161004/overwatch-overwatch-update-overwatch-finally-getting-sombra-overwatch-sombra-sombra.htm iTechPost - Overwatch Update: Are We Finally Getting Sombra?]<br />
<br />
'''11th Oct. 2016'''<br />
<br />
[EN] [https://www.kotaku.com.au/2016/10/overwatch-fans-hacked-actual-people-in-an-attempt-to-find-sombra/ Kotaku - Overwatch Fans Hacked Actual People In An Attempt To Find Sombra]<br />
<br />
'''17th Oct. 2016'''<br />
<br />
[EN] [https://telkomgaming.co.za/will-sombra-hack-her-way-into-blizzcon-2016/ TelKom Gaming - Will Sombra Hack Her Way Into BlizzCon 2016?]<br />
<br />
'''18th Oct. 2016'''<br />
<br />
[EN] [https://overwatchtips.info/overwatch-sombra-arg-everything-you-need-to-know/ OverwatchTips - Everything You NEED To Know (Sombra ARG)]<br />
<br />
'''26th Oct. 2016'''<br />
<br />
[EN] [https://mic.com/articles/157757/overwatch-sombra-arg-everything-we-know-about-the-countdown-and-rumored-nov-1-release#.UILrZHRiM Min Network - Everything we know about Blizzard's rumored Nov. 1 release]<br />
<br />
'''28th Oct. 2016'''<br />
<br />
[EN] [https://kotaku.com/imagining-horror-stories-for-a-never-ending-overwatch-a-1788324673 Kotaku - Imagining Horror Stories Of A Never-Ending Overwatch ARG]<br />
<br />
'''1st Nov. 2016'''<br />
<br />
[EN] [https://www.ign.com/videos/2016/11/01/will-overwatchs-sombra-be-at-blizzcon-2016 IGN - Will Sombra be at BlizzCon 2016?]<br />
<br />
'''8th Nov. 2016'''<br />
<br />
[EN] [https://mic.com/articles/158812/overwatch-sombra-arg-gameplay-emote-directly-references-one-of-the-wildest-fan-theories Mic Tech - 'Overwatch' Sombra ARG: Gameplay emote directly references one of the wildest fan theories]</div>Halke234https://wiki.gamedetectives.net/index.php?title=Sombra_ARG&diff=16618Sombra ARG2018-07-23T23:57:25Z<p>Halke234: /* Phone Number */</p>
<hr />
<div>{{argbox<br />
| float = right<br />
| name = Sombra ARG<br />
| image = File:Sombra_skull.png<br />
| description= The Sombra ARG - an ARG involving an unreleased Overwatch hero.<br />
| creator = [https://www.blizzard.com/ Blizzard Entertainment]<br />
| type = Official<br />
| status = Completed<br />
| discovered = 2016-06-12<br />
| completed = 2016-11-04<br />
}}<br />
<br />
{{ArgHeader|arg=Sombra ARG}}<br />
The Sombra ARG was an ARG for the first-person shooter [https://www.playoverwatch.com Overwatch], developed by [https://www.blizzard.com/ Blizzard Entertainment]. Sombra was the name of a then-unreleased Overwatch hero. The ARG was comprised of clues and ciphers referencing Sombra, which were found in various developer updates and short animations.<br />
<br />
At the game's release, there were numerous pieces of in-game information that appeared in the map Dorado, hinting at a character called Sombra. When the hero Ana was revealed, more Sombra clues appeared in Ana's origin video. In the weeks that followed, more clues were discovered, which led up to a character reveal animation at BlizzCon 2016.<br />
<br />
== Ana Videos ==<br />
<br />
=== Ana Origin Video ===<br />
<br />
On July 12, 2016, a [https://www.youtube.com/watch?v=TE0CXgpNxG0 video] for the new Overwatch hero named Ana was released. At the 1:16 mark, players discovered a set of hexidecmial values:<br />
<br />
[[File:Ana_Hex2.png|400px]]<br />
<br />
<pre><br />
2E 2E 2E 7B 76 20 66 62 72 20 63 7E 72 79 72 20 7B 76 20 7E<br />
79 71 78 65 7A 76 74 7E D4 A4 79 2C 20 63 7E 72 79 72 20 72<br />
7B 20 67 78 73 72 65 2E 2E 2E 7B 76 20 66 62 72 20 63 7E 72<br />
79 72 20 7B 76 20 7E 79 71 78 65 7A 76 74 7E D4 A4 79 2C 20<br />
63 7E 72 79 72 20 72 7B 20 67 78 73 72 65 2E 2E 2E 7B 76 20<br />
66 62 72 20 63 7E 72 79 72 20 7B 76 20 7E 79 71 78 65 7A 76<br />
74 7E D4 A4 79 2C 20 63 7E 72 79 72 20 72 7B 20 67 78 73 72<br />
65 2E 2E 2E 7B 76 20 66 62 72 20 63 7E 72 79 72 20 7B 76 20<br />
7E 79 71 78 65 7A 76 74 7E D4 A4 79 2C 20 63 7E 72 79 72 20<br />
72 7B 20 67 78 73 72 65 2E 2E 2E 64 78 7A 75<br />
</pre><br />
<br />
A hex to ASCII translation yielded the following:<br />
<br />
<pre><br />
...{v fbr c~ryr {v ~yqxezvt~Ô¤y, c~ryr r{ gxsre...{v fbr c~ryr {v ~yqxezvt~Ô¤y, c~ryr r{ gxsre...{v fbr c~ryr {v ~yqxezvt~Ô¤y, c~ryr r{ gxsre...{v fbr <br />
c~ryr {v ~yqxezvt~Ô¤y, c~ryr r{ gxsre...dxzu<br />
</pre><br />
<br />
Using an XOR Cipher with the constant 23 on the above text resulted in the following message:<br />
<br />
<pre><br />
..la que tiene la información; tiene el poder...la que tiene la información; tiene el poder...la que tiene la información; tiene el poder...la que tiene la <br />
información; tiene el poder...somb<br />
</pre><br />
<br />
This was a repeating phrase in Spanish, which translated to:<br />
<br />
<pre><br />
She who has the information, has the power...<br />
</pre><br />
<br />
Players then discovered a second set of hexidecimal values at the 2:11 mark:<br />
<br />
[[File:Ana Hex.png|400px]]<br />
<br />
<pre><br />
65 76 2E 2E 2E 7B 76 20 66 62 72 20 63 7E 72 79 72 20 7B 76<br />
20 7E 79 71 78 65 7A 76 74 7E D4 A4 79 2C 20 63 7E 72 79 72<br />
20 72 7B 20 67 78 73 72 65 2E 2E 2E 7B 76 20 66 62 72 20 63<br />
7E 72 79 72 20 7B 76 20 7E 79 71 78 65 7A 76 74 7E D4 A4 79<br />
2C 20 63 7E 72 79 72 20 72 7B 20 67 78 73 72 65 2E 2E 2E 7B<br />
76 20 66 62 72 20 63 7E 72 79 72 20 7B 76 20 7E 79 71 78 65<br />
7A 76 74 7E D4 A4 79 2C 20 63 7E 72 79 72 20 72 7B 20 67 78<br />
73 72 65 2E 2E 2E 7B 76 20 66 62 72 20 63 7E 72 79 72 20 7B<br />
76 20 7E 79 71 78 65 7A 76 74 7E D4 A4 79 2C 20 63 7E 72 79<br />
72 20 72 7B 20 67 78 73 72 65 2E 2E 2E<br />
</pre><br />
<br />
When put through the same process, the same string of Spanish was revealed, but with the letters <code>ra</code> at the beginning of the message. These letters were combined with <code>somb</code> from the first cipher to create the name <code>sombra</code>. No more clues were discovered until the release of the Dev Update video.<br />
<br />
=== Dev Update Video ===<br />
<br />
[[File:Sombra Barcodes.png|thumbnail|right|The vertical barcodes found at the end of the Ana Dev Update video]]<br />
<br />
On July 19, 2016, the first [https://www.youtube.com/watch?v=evghkilg2eQ Developer Update] was released for Ana. At the end of the video, players discovered a series of vertical barcodes. When scanned, players discovered a large set of hexidecimal values which where then converted to binary, a dump of which is available [https://gist.github.com/zapu/31165efab0d6264e2fd0fa75cc53b1aa here].<br />
<br />
Turning the ones and zeroes into black and white pixels formed a QR code:<br />
<br />
[[File:Sombra_QR_code.png|300px]]<br />
<br />
Scanning this QR code yielded the following message: <code>¿Estuvo eso facilito? Ahora que tengo su atención, déjenme se las pongo más difícil.</code> In English, the message reads: <code>Was that easy? Well, now that I have your attention, allow me to make things much more difficult.</code> After this, no more clues were discovered until the Summer Games video was released.<br />
<br />
== Welcome to the Summer Games Video ==<br />
<br />
=== Tracer Trail Cipher ===<br />
<br />
[[File:Base64_trail.jpg|thumbnail|right|The unsolved base64 cipher in the Summer Games video]]<br />
<br />
'''Note: The cipher described below remains unsolved.'''<br />
<br />
On August 2, 2016, players discovered another cipher in the [https://www.youtube.com/watch?v=qpcOD9tJM4k Welcome to the Summer Games trailer]:<br />
<br />
<pre><br />
U2FsdGVkX1+vupppZksvRf5pq5g5XjFRIipRkwB0K1Y96Qsv2L<br />
m+31cmzaAILwytX/z66ZVWEQM/ccf1g+9m5Ubu1+sit+A9cenD<br />
xxqkIaxbm4cMeh2oKhqIHhdaBKOi6XX2XDWpa6+P5o9MQw==<br />
</pre><br />
<br />
Players discovered this text to be base64 encryption. When decrypted, players received the following output:<br />
<br />
<pre><br />
Salted__���ifK/E�i��9^1Q�*Q�t+V=�<br />
/ع��W/<br />
�_����V��?q����f�F���"��=q�������[��<br />
z��*����Z����u�\5�k�C<br />
</pre><br />
<br />
''(Note: copy/pasting this string will not work; some of the characters are not printable and are not even displayed correctly on this page)''<br />
<br />
==== Decrypting the Cipher ====<br />
<br />
The "Salted__" header at the start of the string indicated to players that the remainder of the text was encrypted with the OpenSSL software library, which requires a password and the encryption cipher that was used. Salt is added by OpenSSL to ensure uniqueness of the key and the IV derived from the password and used for the encryption. However, due to the age of OpenSSL and its massive library, it was proven to be quite difficult for players to identify the encryption used.<br />
<br />
==== Narrowing Down Ciphers ====<br />
<br />
[[File:HexOfEncryptedMessage.png|thumbnail|right|Hex view of the encrypted string]]<br />
<br />
Players narrowed down the potential ciphers used by examining a hex dump of the encrypted string. There are two major types of ciphers, stream ciphers and block ciphers. Stream ciphers encrypt only the data fed into them, whereas block ciphers always encrypt a certain number of bytes at a time (a "chunk").<br />
<br />
A byte is roughly a single character, but special characters can take up multiple bytes. We know that OpenSSL Salted Encryption uses the first 8 bytes of the output for <code>Salted__</code> and the next 8 bytes for the actual salt. The rest of the information is the '''encrypted message'''.<br />
<br />
The immediately interesting thing here is that the '''encrypted message''' data stops 3 bytes short of a full chunk. This is a excellent indicator that the cipher used is a stream cipher (or a block cipher in CTR/OFB/CFB mode). This narrows the list of potential ciphers down significantly. This also means that the final string that Blizzard encrypted is less than 93 bytes!<br />
<br />
'''This cipher remains unsolved, but it's speculated that Blizzard moved past the cipher by creating alternate puzzles.'''<br />
<br />
=== Directions & Letters ===<br />
<br />
Players discovered that in the North American version of the Summer Games trailer there were repeated references to the cardinal directions, each associated with a particular hero. These references were conspicuously absent from other versions of the trailer. These references are shown below, with the relevant heroes and timestamps:<br />
<br />
<gallery mode="packed"><br />
File:Ow1.png|East - Mercy - Route 66 - 0:17<br />
File:Ow2.png|Center - D. Va - Temple of Anubis - 0:19<br />
File:Ow3.png|North - Torbjorn - Nepal - 0:21<br />
File:Ow4.png|South - Genji - Hanamura - 0:22<br />
File:Ow5.png|Southeast - McCree - Hollywood - 0:24<br />
File:Ow6.png|West - Symmetra - Watchpoint: Gibraltar - 0:30<br />
File:Ow7.png|Southwest - Bastion - Hollywood - 0:34<br />
File:Ow8.png|Northeast - Winston - Volskaya Industries - 0:46<br />
File:Ow9.png|Northwest - Tracer - King's Row - 0:47<br />
</gallery><br />
<br />
Screenshots of all the directions and their respective heroes can be found in an album [https://imgur.com/a/FQXmy here].<br />
<br />
[[File:Overwatch map.jpg|frameless]]<br />
<br />
These heroes, arranged in this particular order, provided a password that was used later in the ARG.<br />
<br />
== Dorado Photo ==<br />
<br />
At an unknown date, a new, "corrupted" photo of the [https://blzgdapipro-a.akamaihd.net/media/screenshot/dorado-screenshot-004.jpg Dorado attackers spawn point] was added to the Overwatch [https://playoverwatch.com/en-us/media/ media page]. Players discovered that the screenshot was "'''datamoshed'''", which means it concealed a hidden message while also taking on a distorted appearance. ([https://prntscr.com/c3dce7 Here] is an example of purposely data moshing the image manually to achieve similar effects.) <br />
<br />
<gallery mode="packed" heights=500px><br />
File:dorado-datamosh.jpg|The datamoshed image<br />
File:dorado-screenshot-005.jpg|The original image<br />
</gallery><br />
<br />
After comparing the images with difference checking tools, players found that certain English and Spanish characters were replaced with exclamation points. The missing characters produced the following Spanish phrase:<br />
<br />
<code>Por que estan mirando al cielo? La respuesta no esta sobre sus cabezas, esta detras de ustedes. A veces, necesitan analizar sus logros previos.</code><br />
<br />
Translated into English, this phrase read:<br />
<br />
<code>Why are you looking at the sky? The answer isn't over your heads, it's behind you. Sometimes, you need to analyze your previous achievements.</code><br />
<br />
The phrase "Why are you looking at the sky?" was most likely a reference to a strange artifact that was discovered in the sky of the Dorado map, dubbed the "Skycode". The Skycode ended up being a red herring, and was completely unrelated to the ARG.<br />
<br />
=== Analyzing Achievements ===<br />
<br />
[[File:achievements.png|thumbnail|right|"¿" Achievement, comment in source code]]<br />
<br />
The phrase "you need to analyze your previous achievements" led players to look at the achievements on the [https://www.playoverwatch.com Overwatch] website. It was noticed noticed that by logging in and viewing the achievements on a player profile, a mystery achievement appeared. Examining a hex dump of the image lead players to a new phrase:<br />
<br />
<pre><br />
Vientos, nada mal. No obstante, me aburro. Intentemos algo nuevo en la misma dirección.<br />
uczihriwgsxorxwunaarawryqhbrsfmeqrjjmu 5552E494 78T3 4VM9 OPL6 IS8208O913KRlrx<br />
</pre><br />
<br />
Translated, it said:<br />
<br />
<pre><br />
Damn, not bad. However, I'm getting bored. Let's try something new in the same direction.<br />
uczihriwgsxorxwunaarawryqhbrsfmeqrjjmu 5552E494 78T3 4VM9 OPL6 IS8208O913KRlrx<br />
</pre><br />
<br />
== Volskaya Datamosh ==<br />
<br />
After a long period of toying around, players discovered that the ciphertext <code> uczihriwgsxorxwunaarawryqhbrsfmeqrjjmu 5552E494 78T3 4VM9 OPL6 IS8208O913KRlrx</code> from the "?" achievement was a Vigenére cipher. Players discovered the key <code>tracertorbjornwinstonsymmetradvamercybastiongenjimccree</code> by ordering the heroes in the Summer Games trailer by the cardinal directions associated with each of them, as said further above. Once decoded, players received the following text: <br />
<pre>blzgdapiproaakamaihdnetmediascreenshot 5552E494 78B3 4CE9 ACF6 EF8208F913CFjpg</pre><br />
<br />
Players found this to be a [https://blzgdapipro-a.akamaihd.net/media/screenshot/5552E494-78B3-4CE9-ACF6-EF8208F913CF.jpg blzgdapipro-a.akamaihd.net/media/screenshot/5552E494-78B3-4CE9-ACF6-EF8208F913CF.jpg URL], which led players to a datamoshed screenshot of the Volskaya Industries map. ''(Editor's note: This link appears to now be dead)''. When players ran a difference check with the [https://blzgdapipro-a.akamaihd.net/media/screenshot/volskaya-screenshot-004.jpg original image], they received an interesting message.<br />
<br />
<gallery mode="packed"><br />
File:volskaya-datamosh.jpg|The datamoshed image<br />
File:Volskaya-screenshot-004.jpg|The original image<br />
</gallery><br />
<br />
=== ASCII Skull #1 ===<br />
<br />
The diff from the datamoshed image resulted in the following output:<br />
<br />
<pre><br />
Parece que te gustan estos jueguitos... por que no jugamos uno de verdad?<br />
:PB@Bk:<br />
,jB@@B@B@B@BBL.<br />
7G@B@B@BMMMMMB@B@B@Nr<br />
:kB@B@@@MMOMOMOMOMMMM@B@B@B1,<br />
:5@B@B@B@BBMMOMOMOMOMOMOMM@@@B@B@BBu.<br />
70@@@B@B@B@BXBBOMOMOMOMOMOMMBMPB@B@B@B@B@Nr<br />
G@@@BJ iB@B@@ OBMOMOMOMOMOMOM@2 B@B@B. EB@B@S<br />
@@BM@GJBU. iSuB@OMOMOMOMOMOMM@OU1: .kBLM@M@B@<br />
B@MMB@B 7@BBMMOMOMOMOMOBB@: B@BMM@B<br />
@@@B@B 7@@@MMOMOMOMM@B@: @@B@B@<br />
@@OLB. BNB@MMOMOMM@BEB rBjM@B<br />
@@ @ M OBOMOMM@q M .@ @@<br />
@@OvB B:u@MMOMOMMBJiB .BvM@B<br />
@B@B@J 0@B@MMOMOMOMB@B@u q@@@B@<br />
B@MBB@v G@@BMMMMMMMMMMMBB@5 F@BMM@B<br />
@BBM@BPNi LMEB@OMMMM@B@MMOMM@BZM7 rEqB@MBB@<br />
B@@@BM B@B@B qBMOMB@B@B@BMOMBL B@B@B @B@B@M<br />
J@@@@PB@B@B@B7G@OMBB. ,@MMM@qLB@B@@@BqB@BBv<br />
iGB@,i0@M@B@MMO@E : M@OMM@@@B@Pii@@N:<br />
. B@M@B@MMM@B@B@B@MMM@@@M@B<br />
@B@B.i@MBB@B@B@@BM@::B@B@<br />
B@@@ .B@B.:@B@ :B@B @B@O<br />
:0 r@B@ B@@ .@B@: P:<br />
vMB :@B@ :BO7<br />
,B@B<br />
</pre><br />
<br />
'''Translation:'''<br />
<br />
<pre><br />
"It seems you like these little games... Why don't we play a real one?"<br />
</pre><br />
<br />
(''This is the python2 script to extract modified bytes from datamoshed Volskaya screenshot: https://gist.github.com/synap5e/27635d2ff6f0e3b15f0c902dca2974a9'')<br />
<br />
No further progress was made until August 23, 2016.<br />
<br />
== Overwatch Forums Glitching Page/ "Skycoder" ==<br />
<br />
On August 23rd, 2016, at an unknown time, an [https://us.battle.net/forums/en/overwatch/topic/20748794686 ominous post] by a user named "Skycoder" appeared on the official General Discussion forums for Overwatch. <br />
<br />
Players found that the name of the post, <code>00110010 00110011</code>, was binary for "23," which was a direct reference to Sombra being the 23rd hero in Overwatch. The age of the post started at 24 hours, and counted down rather than increasing. The post itself contained a single sentence in Spanish:<br />
<br />
<pre><br />
la que tiene la información; tiene el poder<br />
</pre><br />
<br />
Which, when translated to english, reads:<br />
<br />
<pre><br />
She who has the information, has the power.<br />
</pre><br />
<br />
After a short while, the post glitched and distorted, gradually turning a hue of purple. A text box then appeared, which printed the following ciphertext:<br />
<br />
<pre><br />
ICAgICAgICAgICAgICAgICAgICAgICAgICA6UEKPQms6CiAgICAgICAg<br />
ICAgICAgICAgICAgICAsakKIQEJAQkBCQEJCTC4KICAgICAgICAgICAg<br />
ICAgICAgIDdHlkKTQpVCTU1NTU1CQEJAQkBOcgogICAgICAgICAgICAg<br />
ICA6a0KSQpCIl01NT01PTU9NT01NTU2MQphCQEIxLAogICAgICAgICAg<br />
IDo1kUKNQphCiEJCTU1PTU9NT01PTU9NT01NipJuQm5CQEJCdS4KICAg<br />
ICAgICA3MG6GlUKIQpJClEJYQkJPTU9NT01PTU9NT01NQk1QQphCiEJA<br />
QkBCQE5yCiAgICAgIEeYlpdCSiBpQohCh4ggIE9CTU9NT01PTU9NT01P<br />
TZYyICBCj0JAQi4gRUJAQkBTCiAgICAgIJKWQk2HR0pCVS4gIGlTdUKI<br />
T01PTU9NT01PTU9NTZdPVTE6ICAua0JMTYhNhkKXCiAgICAgIEKMTU1C<br />
mUIgICAgICAgN4hCQk1NT01PTU9NT01PQkKWOiAgICAgICBCh0JNTYhC<br />
CiAgICAgII2YiEKKQiAgICAgICAgIDeSlkBNTU9NT01PTU1AQkA6ICAg<br />
ICAgICAgQEBCQEJACiAgICAgII+ST0xCLiAgICAgICAgICBCTkKPTU1P<br />
TU9NTY9CRUIgICAgICAgICAgckJqTYRCCiAgICAgIJBAICBAICAgICAg<br />
ICAgICBNICBPQk9NT01NQHEgIE0gICAgICAgICAgLkAgIEBACiAgICAg<br />
IISVT3ZCICAgICAgICAgICBCOnWMTU1PTU9NTUJKaUIgICAgICAgICAg<br />
LkJ2TUBCCiAgICAgIIRCkUKYSiAgICAgICAgIDCRQpdNTU9NT01PTUKV<br />
QkB1ICAgICAgICAgcUBAQEJACiAgICAgIEKETUJCjHYgICAgICAgR4+L<br />
Qk1NTU1NTU1NTU1NQkKINSAgICAgICBGhEJNTUBCCiAgICAgIIdCQk1/<br />
QlBOaSAgIExNRUKFT01NTU2PQoNNTU9NTYpCWk03ICAgckVxQodNQkKE<br />
CiAgICAgIEKYloRCTSAgQm1ChEIgIHFCTU9NQpBChUKEQk1PTUJMICBC<br />
QEJAQiAgQEJAQkBNCiAgICAgICBKlm2GhFBCj0KEQplCN0eIT01CQi4g<br />
ICAsQE1NTUBxTEJAQkBAQEJxQkBCQnYKICAgICAgICAgIGlHQpUsaTCE<br />
TZZCbk1NT4tFICA6ICBNQE9NTUBAQEJAUGlpQEBOOgogICAgICAgICAg<br />
ICAgLiAgIEKXTZBCj01NTUBCQEJAQkBNTU1AQEBNQEIKICAgICAgICAg<br />
ICAgICAgICBAQkBCLmlATUJCQEJAQkBAQk1AOjpCQEJACiAgICAgICAg<br />
ICAgICAgICAgQkBAQCAuQkBCLjpAQkAgOkJAQiAgQEJATwogICAgICAg<br />
ICAgICAgICAgICAgOjAgckBCQCAgQkBAIC5AQkA6IFA6CiAgICAgICAg<br />
ICAgICAgICAgICAgICAgdk1CIDpAQkAgOkJPNwogICAgICAgICAgICAg<br />
ICAgICAgICAgICAgICAsQkBCCg==<br />
</pre><br />
<br />
=== ASCII Skull #2 ===<br />
<br />
Players discovered that this was Base64 and, once decrypted, resulted in another ASCII skull:<br />
<br />
<pre><br />
:PB.Bk: <br />
,jBˆ@B@B@B@BBL. <br />
7G–B“B•BMMMMMB@B@B@Nr <br />
:kB’B.ˆ—MMOMOMOMOMMMMŒB˜B@B1, <br />
:5‘B.B˜BˆBBMMOMOMOMOMOMOMMŠ’nBnB@BBu. <br />
70n†•BˆB’B”BXBBOMOMOMOMOMOMMBMPB˜BˆB@B@B@Nr <br />
G˜–—BJ iBˆB‡ˆ OBMOMOMOMOMOMOM–2 B.B@B. EB@B@S <br />
’–BM‡GJBU. iSuBˆOMOMOMOMOMOMM—OU1: .kBLMˆM†B— <br />
BŒMMB™B 7ˆBBMMOMOMOMOMOBB–: B‡BMMˆB <br />
.˜ˆBŠB 7’–@MMOMOMOMM@B@: @@B@B@ <br />
.’OLB. BNB.MMOMOMM.BEB rBjM„B <br />
.@ @ M OBOMOMM@q M .@ @@ <br />
„•OvB B:uŒMMOMOMMBJiB .BvM@B <br />
„B‘B˜J 0‘B—MMOMOMOMB•B@u q@@@B@ <br />
B„MBBŒv G.‹BMMMMMMMMMMMBBˆ5 F„BMM@B <br />
‡BBM.BPNi LMEB…OMMMM.BƒMMOMMŠBZM7 rEqB‡MBB„ <br />
B˜–„BM BmB„B qBMOMB.B…B„BMOMBL B@B@B @B@B@M <br />
J–m†„PB.B„B™B7GˆOMBB. ,@MMM@qLB@B@@@BqB@BBv <br />
iGB•,i0„M–BnMMO‹E : M@OMM@@@B@Pii@@N: <br />
. B—M.B.MMM@B@B@B@MMM@@@M@B <br />
@B@B.i@MBB@B@B@@BM@::B@B@ <br />
B@@@ .B@B.:@B@ :B@B @B@O <br />
:0 r@B@ B@@ .@B@: P: <br />
vMB :@B@ :BO7 <br />
,B@B <br />
</pre><br />
<br />
Players discovered that, once both skulls had been stripped of spaces, the bytes of each skull that aren't equal to 0 could be subtracted using [https://pastebin.com/g3kA1Pif a script]. Once compiled, players received the following string:<br />
<br />
<pre><br />
OHVSURPHWLXQMXHJR...FUHRTXHXVWHGHVORVGHWHFWLYHVGHMXHJRVOROODPDULDQXQWUDLOKHDG?EOCJGDXVD-DPEDV-FDODYHUDV.KWPO<br />
</pre><br />
<br />
Players discovered that this was a caesar cipher. After shifting the string forward 23 places, it resulted in:<br />
<br />
<pre><br />
LESPROMETIUNJUEGO...CREOQUEUSTEDESLOSDETECTIVESDEJUEGOSLOLLAMARIANUNTRAILHEAD?BLZGDAUSA-AMBAS-CALAVERAS.HTML<br />
</pre><br />
<br />
When cleaned up, the message read:<br />
<br />
<pre><br />
Les prometi un juego...creo que ustedes los Detectives de Juegos lo llamarían un trailhead? BLZGDUSA-AMBAS-CALAVERAS.HTML<br />
</pre><br />
<br />
When translated from Spanish to English:<br />
<br />
<pre><br />
I promised you a game...I believe you Game Detectives would call it a trailhead? BLZGDAUSA-AMBAS-CALAVERAS.HTML<br />
</pre><br />
<br />
<code>USA-AMBAS-CALAVERAS</code> translated to <code>USE-BOTH-SKULLS</code>, and the <code>.HTML</code> extension hinted at a URL.<br />
<br />
=== Skull Video ===<br />
<br />
BLZGDA refers to the servers that Blizzard uses to host media on their website. As such, this led players to [ https://blzgdapipro-a.akamaihd.net/media/screenshot/usa-ambas-calaveras.html this page], which contains a video of a vitals screen depicting a skull and some other medical information. In addition, it also contained a graphic of one of the ASCII skulls. An Imgur mirror can be found [https://i.imgur.com/6Pk69LX.png here].<br />
<br />
Within the properties of the video, players found another comment in Spanish:<br />
<br />
<pre><br />
Parecen estar muy interesados en estos "héroes". ¿Tal vez les interese conocer algunos detallitos que he averiguado sobre ellos?<br />
</pre><br />
<br />
In English:<br />
<br />
<pre><br />
You seem to be very interested in these "heroes". Maybe interested to know some details that I found out about them?<br />
</pre><br />
<br />
In addition, the video contains a heartbeat monitor, and a series of 26 lines above it. When players assigned the letters of the alphabet to the 26 lines, and used the "pings" of the heartbeat to determine what letters to use, the following string was found:<br />
<br />
<pre><br />
momentincrime<br />
</pre><br />
<br />
=== amomentincrime E-mail ===<br />
<br />
'momentincrime' appeared to refer to the in-universe TV show "A Moment in Crime," which can be seen in the Roadhog and Junkrat [https://www.youtube.com/watch?v=l5kTATxt7bE video] that came out months before the release of Overwatch. However, players also discovered a website, [https://amomentincrime.com amomentincrime.com], and displayed the following text:<br />
<br />
<pre><br />
...Estableciendo conexión...<br />
...Protocolo Sombra v1.3 iniciado...<br />
<br />
...Infiltrando la respuesta automática del email de pistas...<br />
<br />
...Terminando conexión...<br />
</pre><br />
<br />
Players discovered that sending an e-mail to tips@amomentincrime.com resulted in an automated email response:<br />
<br />
<pre><br />
Thank you for contacting A Moment in Crime's anonymous crime line!<br />
<br />
We have analyzed your submission and forwarded the information to the relevant parties. Your help could be vital in apprehending these cri<br />
<br />
...Estableciendo conexión...<br />
...Protocolo Sombra v1.7 iniciado...<br />
<br />
<br />
01:07:47 02:02:02 01:08:06 02:13:43 01:18:32<br />
01:18:21 02:10:19 01:06:21 02:05:18 01:04:02<br />
01:07:08 02:18:25 01:13:04 02:19:20 01:23:02<br />
01:16:40 02:16:35 01:23:04 02:17:16 01:06:42<br />
01:13:29 02:18:06 01:05:02 02:15:41 01:08:34<br />
<br />
j.7F57O,NLv:qj.7B:,1qv@B1j5ivB:,<br />
<br />
...Terminando conexión...<br />
<br />
minals and bringing them to justice. These fugitives are responsible for a string of robberies, arson, and other crimes stretching from Sydney to King's Row.<br />
<br />
Authorities believe that they have set their sights on crossing the Atlantic to America.<br />
</pre><br />
<br />
Players discovered that, if the sets of numbers were taken as AA:BB:CC, where AA was the number of skull (in order of discovery), BB was the row and CC was the column (as seen [https://i.imgur.com/ZgN2MVQ.png here]), and organized into a 5x5 matrix, it would result in:<br />
<br />
<pre><br />
S j G B L <br />
. @ M O k <br />
i , v : 0 <br />
E 7 r q N <br />
J P 5 F 1<br />
</pre><br />
<br />
Players discovered that this Matrix could be used as a bifid key to decode the text underneath the table of numbers in the email, as shown below:<br />
<pre><br />
j . 7 F 5 7 O , N L v : q j . 7 B : , 1 q v @ B 1 j 5 i v B : ,<br />
12 21 42 54 53 42 24 32 45 15 33 34 44 12 21 42 14 34 32 55 44 33 22 14 55 12 53 31 33 14 34 32<br />
<br />
1 2 2 1 4 2 5 4 5 3 4 2 2 4 3 2 4 5 1 5 3 3 3 4 4 4 1 2 2 1 4 2<br />
1 4 3 4 3 2 5 5 4 4 3 3 2 2 1 4 5 5 1 2 5 3 3 1 3 3 1 4 3 4 3 2<br />
<br />
11 24 23 14 43 22 55 45 54 34 43 23 22 42 31 24 45 55 11 52 35 33 33 41 43 43 11 24 23 14 43 22<br />
</pre><br />
<br />
This gave players the following string:<br />
<br />
SOMBr@1NF:rM@7iON1SP0vvErrSOMBr@<br />
This phrase was found to be leet-speak, and was translated to:<br />
<br />
<pre><br />
Sombra Information is power Sombra<br />
</pre><br />
<br />
The string <code>SOMBr@1NF:rM@7iON1SP0vvErrSOMBr@</code> was used as a password later on in the ARG.<br />
<br />
== A Moment in Crime Transmission ==<br />
<br />
[[File:Momentincrime.png|thumbnail|right|amomentincrime.com as of August 24th, 2016]]<br />
<br />
Once the 23-hour countdown on the Skycoder forum post reached zero, [https://amomentincrime.com amomentincrime.com] was updated. It now read:<br />
<br />
<pre><br />
...Estableciendo conexión...<br />
...Protocolo Sombra v1.9 iniciado...<br />
<br />
...Transmitiendo información a ómnicos activos... 2%<br />
<br />
...Terminando conexión...<br />
</pre><br />
<br />
Translated from Spanish to English:<br />
<br />
<pre><br />
...Establishing connection...<br />
...Sombra Protocol v1.9 initiated...<br />
...Transmitting information to active omnics... 2%<br />
<br />
...Ending connection...<br />
</pre><br />
<br />
A comment was also added to the source code:<br />
<br />
<pre><br />
Bien hecho, ya tienen mi clave. Hackear este programa de televisión no tuvo chiste. Espérense a lo que sigue.<br />
</pre><br />
<br />
When translated:<br />
<br />
<pre><br />
Well done, you have my password. Hacking this television program was meaningless. Wait for what is coming.<br />
</pre><br />
<br />
The percent on the amomentincrime.com slowly increased over time. Once the 5% milestone was hit, the Sombra Protocol version number changed to to v1.95. Afterwards, the percentage increased by 0.0038% every 3 minutes in real time.<br />
<br />
In addition, another comment was added:<br />
<br />
<pre><br />
Parece que se están calentando un poco las cosas... tendré que pasar desapercibida mientras esto se finaliza.<br />
</pre><br />
<br />
Translated:<br />
<br />
<pre><br />
It seems things are heating up a bit... I'll have to go unnoticed while this is finishing.<br />
</pre><br />
<br />
On 18th October at 19:02 GMT the site reached 100%, and the site updated with the following message:<br />
<br />
<pre><br />
...Transmisión finalizada - finalizando carga... <br />
...Carga finalizada. Unidad Bastion E-54 comprometida...<br />
</pre><br />
<br />
Which roughly translates to:<br />
<br />
<pre><br />
...Transmission complete - finishing upload...<br />
...Upload finished. Unit Bastion E-54 engaged...<br />
</pre><br />
<br />
Hidden in the source code of the site was the text <code>v1.4.0.2.324??</code>. Players then correctly assumed that this referred to a future build of Overwatch itself.<br />
<br />
== Sombra vs. LumériCo ==<br />
<br />
=== The Hacked Bastion ===<br />
<br />
On October 19, 2016, a new Overwatch version was released - version 1.4.0.2.32448. Shortly afterwards, the version number in the source code of the amomentincrime site updated to the same version number. After the build launched, players discovered that the hero Bastion had a strange interaction when near the "SOMBRA PROTOCOL" monitors on Dorado, and would emit a message in morse code, which can be heard [https://www.youtube.com/watch?v=Hkd__ceYm-Y here]. When the morse was decoded, players received the following string:<br />
<pre><br />
SQOFJFBNITIZWGDXSDO<br />
</pre><br />
<br />
Players discovered that this was a Vigenere cipher, and the key consisted of the alphabetic characters from the<br />
<code>SOMBr@1NF:rM@7iON1SP0vvErrSOMBr@</code> string, it was decoded to read:<br />
<br />
<pre><br />
ACCESSWWWLUMERICOMX<br />
</pre><br />
<br />
This led players to the [https://lumerico.mx/ LumeriCo website]. ''(Editor's note: as of 2018, this site appears to be inactive.)''<br />
<br />
=== LuméReaction ===<br />
<br />
[[File:Lumerico.png|thumbnail|right|The homepage of https://lumerico.mx]]<br />
<br />
The LumeriCo website was for the in-universe, Mexican tech giant LumériCo, who had built several reactors in the Dorado region. The website had a [https://lumerico.mx/news news page], noting the imminent opening of a new reactor on November 1 as well as a recent attack on its construction site. There were also [https://lumerico.mx/about About] and [https://lumerico.mx/login Login] pages.<br />
<br />
Players also discovered a <code>robot.txt</code> file, which appeared to server no purpose and only contained the text <code>Allow: omnics</code>, and appeared to be a joke about the [https://en.wikipedia.org/wiki/Robots_exclusion_standard Robots exclusion standard]. Another text file was discovered called <code>omnics.txt</code>, which contained the text:<br />
<br />
<pre><br />
Allow: ??<br />
Allow: ???<br />
</pre><br />
<br />
And appeared to be yet anotehr joke about the Robots exclusion standard. And, finally, an <code>api</code> file that contained <code>{"message":"thanks for calling the api"}</code> and, humorously, has no practical purpose.<br />
<br />
=== Phone Number ===<br />
<br />
At the bottom of the LumeriCo website, players discovered a phone number <code>(510) 766-2726</code>. When called, players heard a woman listing off a string of numbers in Spanish, a recording of which can be found [https://soundcloud.com/jackwilsdon/510-766-2726a here]. The numbers spoken are: <code>5-2-4-1-3 (pause) 23-4-14-8-6-18-17-23-21-18-15</code>.<br />
When assuming that a=1, b=2, etc, the second part of the message can be decoded to: <code>WDNHFRQWURO</code>. This was found to be a ROT-23 cipher, and decoded to: <code>TAKECONTROL</code>.<br />
<br />
=== Take Control ===<br />
<br />
The phone message lead to a more significant page on the site: https://lumerico.mx/TAKECONTROL/index.html. It was styled the same way as amomentincrime.com and featured [https://lumerico.mx/calavera.png an image of Sombra's skull icon], named "calavera.png" (a [https://en.wikipedia.org/wiki/Calavera Spanish name] for "skull" associated with the Mexican Day of the Dead). There was also text on the page:<br />
<br />
<pre style="word-break:break-all;word-wrap: break-word;"><br />
ethldtíoíesnoemfetuylm.bnlsssqtann)hcnslararuCpdGeoopéqubdsroaan.arnasdmdor1vrsmerñerlsdacnnnoaexedsidcn.iarsgcyi,iqeqnd.pooitoaeaaransterLetéáedasodocMrnseeiuCsimnosetlójnueodacapsadcoanfasest.rnucaodacadmdoemoipíogPoipbehaSussai.,yccandin.reueatenaoiorneoeetaoéyenimt¿rPehec,uurobudeílrysriteenasni,adngpjrálireecgrolsmhYnao?nmonomepeldezmapcpunoaulrrruCstmeitltetlróesoapsdéyufcuascaa,rensbuinergnqedlmvlbpdtaz.enebuineuldoerecrGefqfirrasulrbeatHsilnbaúaeeaaooassraooa,ioedo:aLiuielPr ursmoootlnielteeánlosulobeauaanopearrúiesltéyrosssisuaaeaenremsieaismdjmolrsspebiecdéyusittnvrcacp.taebrtLiunróporner<br />
<br />
eúcrneuyraarsettsyrseen.aaPnrneuyraeastuCpnhl/wLloaloa.qartlsyuínreute.evgdpiuábdmPooucvdeccmoreurr.o?unriorydbaSnalegeáezadienáutalaaioeemfcbgdinableoc¿éppoeocelsumuoaHearsosqadrrrftuLiorannnoneneriiatcnlomoqnaqdunrcno,enmerosaereisloabolii.e.dormerosepopdé,eo:r#5scoegaqoeaibs(edioraamtdírnlyoetjcgratmnrrobnrsstloeYqoeocicpnómlpernmaepogenmodqamubodnaeasuaenMoolloupeqvgrLtúr<br />
<br />
tsosrdvoeaerroaeusdmaauamoMobsnaeanraunnt,roierbeoiemaodbmantursotñauoureeuoerreopc.etlr<br />
<br />
sotñneerLimeaFsNJ<br />
</pre><br />
<br />
This is a column order transposition cipher with the key <code>5 2 4 1 3</code>, which was obtained in the phone call. The result is: (spaced out for clarity)<br />
<br />
Los felicito por haber llegado hasta aquí. Solo quería saber si estaban listos. (Hey, es muy difícil encontrar buena ayuda últimamente...deberían ver algunos de los payasitos que están trabajando conmigo) Por ahora, continuemos con el verdadero reto: acabar con LumériCo y su president e Guillermo Portero. ¿Y porqué? Porque es un hombre codicioso, corrupto y un ladrón abominable. Su plan de traer en línea el más grande y el más poderoso zigurat el 1 de noviembre no es nada más que una artimaña, un elaborado plan designado para ejercer aún más influencia sobre la gente de México y en gordar los bolsillos de sus compinches. ¿Y quién va a pagar por eso? La gente común y corriente, los mismos que siempre quedan olvidados.<br />
<br />
He empezado a mejorar mis protocolos para que sean usados para derrumbar la infraestructura de LumériCo y Los Muertos también están intentando levantarse en contra de la corrupción. Mientras tanto, escarben por el sitio de LumériCo y busquen información que podamos usar en contra del cabrón, mejor aún, encuentren su nombre de usuario y contraseña para asegurarnos de que ciertos detalles no muy favorables sobre el presidentito...aparezcan...<br />
<br />
Pude encontrar el nombre de usuario y contraseña de un empleado de soporte de LumériCo, empiecen por ahí:<br />
<br />
GFlores/g#fNwP5qJ<br />
<br />
Translated:<br />
<br />
I'm congratulating you for getting in here. I only wanted to know if you were ready or not. (Hey, it's really difficult to get good help lately... you should see some of the clowns I'm working with). For now, let's continue with the true challenge: taking down Lumerico Corp president Guillermo Portero. Why? Because he's a greedy and corrupt man, and an abominable thief. His plan of bringing in line the most powerful and biggest zigurat the 1st of november us nothing more than a deceit, an elaborate plan by his gang to become even more influential in the people of Mexico and get more money. And who's gonna pay for that? Common people, the ones that are always forgotten.<br />
<br />
I've started upgrading my protocols so that they are used to take down the Lumerico Corp infraestructure and Los Muertos are also trying to go against the corruption. Meanwhile, search the Lumerico Corp site for info we can use against the bastard, or better, get his username and password so that hundreds "not so favorable" facts about the president start popping up.<br />
<br />
I was able to get the username and pass of a Lumerico Corp employee, start here:<br />
<br />
GFlores/g#fNwP5qJ<br />
<br />
=== Presidential Login ===<br />
<br />
Using the credentials obtained through the message above on the https://lumerico.mx/login Lumerico login page], players accessed the account of Gonzalo Flores, including [https://lumerico.mx/email his emails]. Transcripts of these emails are archived [https://docs.google.com/spreadsheets/d/1zh7OU2dEOnD4X43ImvZBNpS75FLkj-rL75pXJ2l3TuQ/htmlview?sle=true# here].<br />
<br />
Here is the only email that held relevance to the ARG:<br />
<br />
<pre><br />
De:Valeria Valderrama<VValderama@lumerico.mx><br />
Para:Gonzalo Flores<GFlores@lumerico.mx><br />
Asunto:Página de Guillermo<br />
<br />
Hola, Gonzo:<br />
¿Puedes ver el tráfico de https://lumerico.mx/president-bypass? Guillermo debería ser el único accediendo desde su página de inicio privada, pero parece que está teniendo mucho tráfico. Tal vez tengamos que escalar esto a<br />
la señorita Jiménez, pero quiero estar segura de que es digno de su tiempo.<br />
<br />
Valeria Valderrama<br />
</pre><br />
<br />
The email references a lot of traffic to the [https://lumerico.mx/president-bypass President Bypass Link]. That page displays an "access denied" message, but there is a <code>President Auth-Bypass Revision 1.02: /.git/</code> line in the source code.<br />
<br />
This line led players to [https://github.com/internetwache/GitTools/tree/master/Dumper dump the data] from the [https://lumerico.mx/president-bypass/.git/ /.git/ subpage] with git protocol and upload it to [https://gist.github.com/anonymous/987beb6a5c817b53da820562854bdebe Github]. That were codebehind files for the website, including a '''class.authentication.php''' file containing an encryption function and '''class.president-bypass.php''' file containing the president's (Guillermo Portero) username <code>GPortero</code> and encrypted password <code>?MzY:MTI5:?AzY:OWM?:?EDO:ZGU?:jVTM:MTJm:2ITM:MTUw:?QjY:OWY?:?kTO:MTQx:?MzY</code>.<br />
<br />
ARG players with technical knowledge wrote a function that reversed the encryption from class.authentication.php and used it on the encrypted password. The resulting password was <code>Xy@4+Bkuqd<53uJ</code>.<br />
<br />
After logging in to the President's account, players were able to read his emails. After 30 minutes, another email appeared in the President's inbox, from Sombra herself:<br />
<br />
<pre><br />
Veo que se han podido infiltrar en su correo.<br />
No se preocupen, él no puede ver este correo, lo he ocultado de su vista si se conecta desde una de sus direcciones conocidas de IP.<br />
Necesito un poco más de tiempo para establecer el próximo grupo de potocolos. Manténganse atentos a principios de la otra semana. Le echaré unos cuantos trapitos sucios en sus correos para que se filtren al público<br />
"accidentalmente". Ya veremos como reaccionan los medios de comunicación.<br />
</pre><br />
<br />
The rough translation is:<br />
<br />
<pre><br />
I see you have been able to infiltrate into his mail.<br />
Don't worry, he cannot see this email, I've hidden it from his sight if he connects from one of his known IP addresses.<br />
I need a little bit of time to establish the next set of protocols. Stay alert early next week. I'll throw some dirty laundry in his emails that can "accidentally" leak to the public. We'll see how the media will react to that.<br />
</pre><br />
<br />
=== Admin Access ===<br />
<br />
[[File:Lumerico admin panel.png|thumbnail|right|The admin panel of the Lumerico site, only accessible by logging in as MJimenez]]<br />
<br />
On October 25, new emails were discovered in the GFlores account, but they had no immediate significance to the ARG. In addition, omnics.txt was updated:<br />
<br />
<pre><br />
Allow: Tzolk'in<br />
Allow: Imix ChikchanManik Imix ChikchanImixChikchanImix Manik Chikchan Imix Kimi Chikchan Chikchan Kimi ChikchanImixChikchanImix ChikchanKimi<br />
</pre><br />
<br />
Tzolk'in is the name of a [[Wikipedia:Maya calendar#Tzolk'in|Mayan Calendar]], and the second line was a series of animals from it in the Tzolk'in dialect. Imix stands for Day 1, Chikchan — 5, Manik — 7 and Kimi — 6. Turned into numbers, the string reads <code>1 57 1 5151 7 5 1 6 5 5 6 5151 56</code>. These digits turned into pictograms of [[Wikipedia:Maya numerals|Maya numerals]] (one by one, not numbers as a whole) written horizontally become <code>. -..- . -.-. ..- - . .- - - .- -.-. -.-</code> That is a morse code, which decodes to <code>EXECUTEATTACK</code>.<br />
<br />
This led us to https://lumerico.mx/EXECUTEATTACK/index.html, where the following text was discovered:<br />
<br />
<pre><br />
Ha llegado el momento. Esos correos expuestos la verdad sobre Portero, iniciado la revuelta, y hemos convencido a la gente de México a apoyar nuestra causa. Ahora es el momento para el golpe. Convertiremos su preciada inauguración el 1 de noviembre en un gran movimiento en su contra. Necesito que hagan una cosa:<br />
Consigan acceso al correo del jefa de seguridad y busquen alguna forma de ayudarme en el ataque. Es posible que lo vean contactando a Portero pronto. He cambiado su contraseña a: d0r*NuLw9<br />
</pre><br />
<br />
Translated to English:<br />
<br />
<pre><br />
The moment has come. These emails exposed the truth about Portero, initiated the revolt, and have convinced people of Mexico to support our cause. Now is the time to strike. Convert his precious inauguration on November 1 to a large movement against it. I need you to do one thing:<br />
Get access to the email security chief and seek some form of help in the attack. You may see her contacting Portero soon. I've changed her password: d0r*NuLw9<br />
</pre><br />
<br />
Logging in with the credentials <code>MJimenez / d0r*NuLw9</code> gave us access to the [https://lumerico.mx/admin admin panel] of Lumerico. Until 01 Nov. 2016 it stayed inactive and any command was answered with the same message saying the terminal disconnected.<br />
<br />
=== The Terminal ===<br />
Once the console became usable, players could type <code>help</code> to see a list of commands:<br />
<br />
'''override''' Engineer safety mode override<br />
'''help''' Provides help information about commands<br />
'''version''' Displays system version information<br />
'''about''' Displays information about the system<br />
'''grep''' Search output by string<br />
<br />
In the MJimenez email account, there was an email labeled <code>Corrupción de correo electrónico</code> with highlighted text in side of it, specifically <code>/ter/</code>. After some hard thinking, people discovered that doing <code>about | grep 'ter'</code> (in linux this is a command to list all the lines from the ''about'' that have a substring ''ter'') returns this text:<br />
<br />
'''Open''' source lightweight shell for any terminal.<br />
'''Anything''' with a terminal<br />
'''1.1.0''' - expanded terminal support<br />
<br />
The first word of every line given from the output was boldened and purple. Putting the words together, we got <code>OpenAnything1.1.0</code>, which was a solution which was used shortly.<br />
<br />
Another available command for the terminal was <code>override</code>. After typing <code>override</code>, the console prompted ARG players with three security questions:<br />
<br />
# '''Favorite Movie'''. The answer to the prompt is <code>some like it bot</code>, a movie from the Overwatch universe.<br />
# '''Favorite Cookie Flavor'''. The answer being <code>nuevas sabor delicias</code>, a flavor referenced in an email in the MJimenez account.<br />
# '''Secret'''. The answer to this prompt is <code>OpenAnything1.1.0</code>.<br />
<br />
This returned <code>OK</code>, gave players admin access, and enabled a new set of commands: <br />
<br />
'''ls''' Lists files by path<br />
'''cat''' Read file by path<br />
'''exec''' Execute a file <br />
<br />
Typing <code>ls</code> listed two files: <code>payload</code> and <code>d_ilqh_nhb.html</code> (the file name is a ROT23 for ''a_fine_key'').<br />
<br />
[[Image:A fine key.png|thumb|right|a_fine_key.html]] Reading the second file with <code>cat mnt/d_ilqh_nhb.html</code> yielded a text where ASCII characters (repeating string <code>vhnl tldv xyl vcxelo xv qhrtv. zkolg[nl]</code>) were in a shape of a key. Deciphering it using the Affine cipher (A=23, B=23) yielded the following string: <code>some keys are shaped as locks. index[me]</code>. It is assumed that ''some keys are shaped as locks'' line alluded to the [[#Tracer_Trail_Cipher|Tracer Trail]] ciphertext being used as a key.<br />
<br />
Simultaneously, entering <code>exec payload</code> presented players with a prompt — the answer to which is the [[#Tracer_Trail_Cipher|Tracer Trail]]. When inputted, players were given a message that looked quite similar to what was previously seen at amomentincrime.com. The counter shown in the top right is then incremented.<br />
<br />
[[Image:LumericoTerminalTracerEntered.jpg|850px]]<br />
<br />
=== Misdirection ===<br />
<br />
[[Image:LumericoHacked.jpg|thumb|right|lumerico.mx website hacked by Sombra]]<br />
<br />
On October 1, 2016, the lumerico.mx home page changed to show "glitches" and the black overlay with a message under the purple skull, while a string <code>&lt;!-- MISDIRECTION --></code> was also added to the source of the page.<br />
<br />
The message says: <br />
<br />
<pre><br />
Buen trabajo, amigos. No lo hubiera logrado sin su ayuda. En fin, me consiguieron los recursos que necesitaba para mi siguiente golpe – les encantará.<br />
Esperen noticias de mí en los próximos días...<br />
Les voy a mandar algo para agradecerles… Ojalá lo puedan aprovechar.<br />
Dasvidanya amigos<br />
</pre><br />
<br />
Translated:<br />
<br />
</pre><br />
Good job, folks. I would not have done it without your help. Anyway, I got the resources needed for my next hit - you'll love it.<br />
Expect to hear from me in the coming days...<br />
I'm going to send something to thank you ... Hopefully you can use it.<br />
Dasvidanya friends<br />
</pre><br />
<br />
[[File:Dia de los muertos spray.jpg|thumbnail|right|The Día de Los Muertos spray that was added to the game after Sombra hacked the Lumerico site]]<br />
<br />
Note that ''Dasvidanya'' is a phonetic transliteration of ''до свиданья'' — a russian phrase for "goodbye". The thing that Sombra sent as a ''thank you'' was a new spray, named "Día de Los Muertos" after the Mexican festival that took place at the same time as the ARG. The spray is currently only available on the PC version of the game.<br />
<br />
The '''MISDIRECTION''' string lead to the page [https://lumerico.mx/MISDIRECTION/index.html https://lumerico.mx/MISDIRECTION/index.html] containing:<br />
<br />
...Estableciendo conexiуn...<br />
...Protocolo Sombra v2.3 iniciado...<br />
<br />
...Desviando datos del zigurat de LumériCo hacia el objetivo...<br />
...Descifrando contraseсas del objetivo...<br />
...Acceso otorgado al directorio de volskayaindustries.com...<br />
<br />
...boop ;)...<br />
...Terminando conexión...<br />
<br />
Translated: <br />
<br />
...Establishing connection...<br />
...Sombra Protocol v2.3 initiated...<br />
<br />
...Forwarding the data from the LumériCo ziggurat to the target...<br />
...Deciphering the target passwords...<br />
...Access Granted to the directory of volskayaindustries.com...<br />
<br />
...boop ;)...<br />
...Ending connection..<br />
<br />
== Blizzcon ==<br />
<br />
Blizzcon 2016 opened with the [https://www.youtube.com/watch?v=Og5-Pm4HNlI Overwatch short "Infiltration"], a short depicting Reaper, Widowmaker, and Sombra on Volskaya Industries. During the showing of the short, Sombra's [https://playoverwatch.com/en-us/heroes/sombra hero page] went live, showcasing her abilities and character backstory.<br />
<br />
[[File:SombraBG.jpg|center|500px]]<br />
<br />
== References ==<br />
<br />
=== Community Resources ===<br />
<br />
A collection of tools and resources made by the Game Detectives Discord community for use in the ARG.<br />
<br />
==== ASCII Skull ====<br />
<br />
'''ASCII Skull Analysis:''' https://github.com/bahamas10/sombra<br />
<br />
'''Removing SOMBR@ Analysis:''' https://pastebin.com/15u27YTC<br />
<br />
'''ASCII Skull Eye Analysys:''' https://docs.google.com/spreadsheets/d/1-JQpWyitMKYhP-4l8ZDFiJI3NjqRrvoEnRdFQawike8<br />
<br />
==== Google Docs ====<br />
<br />
'''Observations and Speculations Spreadsheet:''' https://docs.google.com/spreadsheets/d/1rI08baFQmAwaqHC-9GF9VNGCYjuRE-q4LN9k4ottjuQ/pubhtml<br />
<br />
'''LumériCo Emails and Translations Spreadsheet:''' https://goo.gl/cQgdIJ (Courtesy of UberPilot)<br />
<br />
==== Tracer Code ====<br />
<br />
'''GOL! Guesser:''' https://axxim.net/ow/gol-guesser/<br />
<br />
'''Uber GOL! Guesser:''' https://axxim.net/ow/gol-guesser/uber/<br />
<br />
The Uber GOL! Guesser only prints out UTF-8 compliant results, which makes it easier to identify potentially correct answers.<br />
<br />
'''Bruteforcing tool:''' https://github.com/glv2/bruteforce-salted-openssl<br />
<br />
=== Third-Party Resources ===<br />
<br />
A collection of third-party tools and resources that the Game Detectives Discord community has used in the ARG.<br />
<br />
==== Image of Reaper ====<br />
<br />
'''stegdetect (Linux):''' https://github.com/abeluck/stegdetect<br />
<br />
stegdetect is a Linux utility used to determine if a given image may contain encoded information.<br />
<br />
'''JPHide & JPSeek:''' https://linux01.gwdg.de/~alatham/stego.html<br><br />
'''iSteg (Mac OSX):''' https://www.hanynet.com/isteg/<br />
<br />
JPHide & JPSeek is used to hide and find, respectively, a file inside a JPEG image.<br><br />
iSteg works similarly to JPHide on the Mac OSX platform.<br />
<br />
'''stegbreak (Linux):''' https://linux.die.net/man/1/stegbreak<br />
<br />
stegbreak is used to do brute-force dictionary attacks on JPEG images.<br />
<br />
=== Easter Eggs ===<br />
<br />
The following are collection of references and Easter Eggs encountered throughout the ARG.<br />
<br />
==== In-Game ====<br />
<br />
'''Sombra's "Amused" Emote'''<br />
<br />
This character emote features the [[Sombra_ARG_False_Leads | Skycode]], accompanied by soft music resembling the [https://www.reddit.com/r/Overwatch/comments/4w7ey1/the_sombra_skysong/ Skysong]. Sombra's expression is one of amusement, and it's a nod to the community's prolonged creative attempts to solving an nonexistent puzzle.<br />
<br />
[[File:EmoteSkycode.png|200px]]<br />
<br />
'''Skycode Spray'''<br />
<br />
This character spray features Sombra's iconic skull in front of a compass rose and the [[Sombra_ARG_False_Leads | Skycode]]. This is a reference to both the [[#Directions_&_Letters|cardinal directions]] used in one of the puzzles and to the Skycode, which is considered the most significant false lead that solvers encountered.<br />
<br />
[[File:SkycodeSpray.png|200px]]<br />
<br />
==== In-ARG ====<br />
<br />
'''Espresso Command'''<br />
<br />
There was a hidden command in LumériCo's [[#The_Terminal | admin terminal]]. Inputting the word <code>espresso</code> returned the following message: <code>Coffee Pot Status: Brewed approximately 23 hours ago, currently 0% full</code><br />
This is referencing a variety of [https://goo.gl/cQgdIJ emails] found in the LumériCo site involving broken espresso machines and incompetent coffee brewing, which caught the attention of the community and gave way to a vast variety of mediocre jokes. Furthermore, "23 hours" makes reference to the number 23, which was believed by many to possess some sort of significance to the ARG, as Sombra would be the 23rd character in Overwatch. Finally, "0%" references the ARG's notable waiting periods that have been widely criticized by the community, specifically [[#A_Moment_in_Crime_Transmission | A Moment in Crime's upload percentage]].<br />
Due to the iconic purple text it is believed that this hidden command was created by Sombra herself.<br />
<br />
[[File:EspressoCommand.png]]<br />
<br />
=== Media Appearances ===<br />
<br />
'''3rd Aug. 2016'''<br />
<br />
[EN] [https://kotaku.com/overwatch-fans-find-new-clues-about-the-mysterious-hero-1784767759 Kotaku - Overwatch Fans Find New Clues About The Mysterious Hero Sombra]<br />
<br />
[EN] [https://www.polygon.com/2016/8/3/12369144/overwatch-summer-games-sombra-arg-blizzard?utm_campaign=polygon&utm_content=chorus&utm_medium=social&utm_source=twitter Polygon - Overwatch fans are trying to crack the latest mystery about Sombra]<br />
<br />
[EN] [https://www.pcgamesn.com/overwatch/overwatch-sombra PCGamesN - Overwatch's Sombra ARG continues with new clues, but no solutions]<br />
<br />
[EN] [https://team-dignitas.net/articles/blogs/overwatch/9989/who-is-sombra-all-facts-and-clues-about-sombra Team-Dignitas - Who is Sombra? All facts and clues about Sombra]<br />
<br />
[FR] [https://overwatch.gamewave.fr/un-nouveau-code-cache-dans-la-derniere-cinematique-d-overwatch/ Gamewave - UN NOUVEAU CODE CACHÉ DANS LA DERNIÈRE CINÉMATIQUE D'OVERWATCH!]<br />
<br />
[EN] [https://www.follownews.com/overwatch-fans-find-new-clues-about-the-mysterious-hero-sombra-1nhqt FollowNews - Overwatch Fans Find New Clues About The Mysterious Hero Sombra]<br />
<br />
'''4th Aug. 2016'''<br />
<br />
[EN] [https://www.pcgamer.com/overwatch-summer-games-trailer-hides-a-mysterious-secret/ PCGamer - Overwatch Summer Games trailer hides a mysterious secret]<br />
<br />
[SK] [https://www.sector.sk/novinka/121273/nove-overwatch-video-obsahuje-dalsie-tajomstva.htm Sector - Nové Overwatch video obsahuje ďalšie tajomstvá]<br />
<br />
[EN] [https://www.techinsider.io/overwatch-sombra-character-2016-8 Techinsider - 'Overwatch' players are going to insane lengths to solve a mystery that Blizzard's teased for months]<br />
<br />
[EN] [https://gamerant.com/overwatch-sombra-clues/ Gamerant - Overwatch Players Uncover More ‘Sombra’ Clues]<br />
<br />
[HU] [https://www.gamestar.hu/hir/overwatch-sombra-karakter-214739.html Gamestar - Overwatch - újabb nyomok utalnak a még be nem jelentett hősre]<br />
<br />
'''5th Aug. 2016'''<br />
<br />
[EN] [https://kotaku.com/days-later-overwatch-fans-cant-figure-out-the-sky-cod-1784872143 Kotaku - Days Later, Overwatch Fans Can't Figure Out The 'Sky Code' Mystery]<br />
<br />
[NL] [https://www.gamersnet.nl/nieuws/201608/cryptische_speurtocht_naar_overwatch_nieuwe_heldin_sombra_gaat_bizar_diep/ Gamersnet - Cryptische speurtocht naar Overwatch' nieuwe heldin Sombra gaat bizar diep]<br />
<br />
[ES] [https://www.alfabetajuega.com/noticia/overwatch-el-enigma-de-sombra-sigue-ofreciendo-nuevos-detalles-n-71772 Alfa Beta Jeuga - Overwatch: El enigma de Sombra sigue ofreciendo nuevos detalles]<br />
<br />
[EN] [https://www.youtube.com/watch?v=5ROjN-_F0ZU&feature=youtu.be&t=4m22s IGN (Video) - Sombra: Overwatch's Secret New Hero - Overwatch HQ]<br />
<br />
'''7th Aug. 2016'''<br />
<br />
[EN] [https://www.gamespresso.com/2016/08/summary-state-sombras-arg-overwatch/ Gamespresso - Summary of the state of sombra's ARG in Overwatch]<br />
<br />
'''8th Aug. 2016'''<br />
<br />
[EN/CN] [https://www.zhentoo.com/doc92368 Zhentoo - Overwatch new hero Secret Dorado hidden mystery] <br />
<br />
[EN] [https://www.technewstoday.com/30880-overwatch-sombra-continues-to-elude-detectives/ TechNewsToday - Overwatch: Sombra Continues to Elude Detectives]<br />
<br />
'''11th Aug. 2016'''<br />
<br />
[EN] [https://www.youtube.com/watch?v=IZR-pa0it4Q The Know - New Overwatch Hero Hints]<br />
<br />
'''12th Aug. 2016'''<br />
<br />
[EN] [https://kotaku.com/after-two-weeks-overwatch-fans-sombra-investigation-re-1785204389 Kotaku - Overwatch Fans' Sombra Investigation Reaps A Skull Code]<br />
<br />
'''14th Aug. 2016'''<br />
<br />
[EN] [https://gamerant.com/overwatch-sombra-skull-code/ Gamerant - Skull Code is Latest Clue in Overwatch’s Sombra Investigation]<br />
<br />
'''16th Aug. 2016'''<br />
<br />
[EN] [https://www.christiantoday.com/article/overwatch.dlc.update.skull.code.the.latest.clue.for.sombra.investigation/93197.htm Christian Today - 'Overwatch' DLC update: Skull Code the latest clue for Sombra investigation]<br />
<br />
[EN] [https://en.yibada.com/articles/151811/20160816/overwatch-dlc-update.htm Yibada - 'Overwatch' DLC update: New clues on Sombra's inclusion to the roster revealed]<br />
<br />
'''23rd Aug. 2016'''<br />
<br />
[EN] [https://www.technewstoday.com/31129-overwatch-all-we-know-about-the-sombra-arg/ Tech News Today - Overwatch: All We Know About the Sombra ARG]<br />
<br />
'''24th Aug. 2016'''<br />
<br />
[EN] [https://gamerant.com/overwatch-forums-sombra-message/ Gamerant - Overwatch Forums Glitch Out, Reveals Hidden Message From Sombra]<br />
<br />
[EN] [https://gamerant.com/overwatch-sombra-clue-website/ Gamerant - New Website Counts Down To Next Clue For Overwatch’s Sombra]<br />
<br />
[EN] [https://www.polygon.com/2016/8/24/12623736/overwatch-sombra-arg-clues-skycoder Polygon - Overwatch's Sombra mystery appears to be coming to a close]<br />
<br />
[EN] [https://www.vg247.com/2016/08/24/overwatch-forums-glitch-out-reveal-a-message-from-the-mysterious-sombra/ VG247 - Overwatch forums glitch out, reveal a message from the mysterious Sombra]<br />
<br />
[EN] [https://www.technewstoday.com/31151-sombra-hacks-into-overwatch-forums/ Tech News Today - Sombra Hacks Into Overwatch Forums]<br />
<br />
[EN] [https://www.ign.com/articles/2016/08/24/overwatch-mystery-character-sombra-could-be-revealed-today IGN - Overwatch Mystery Character Sombra Could Be Revealed Today]<br />
<br />
'''25th Aug. 2016'''<br />
<br />
[EN] [https://kotaku.com/overwatch-players-are-getting-fed-up-with-the-sombra-ar-1785765307 Kotaku - Overwatch Players Are Getting Sick Of The Sombra ARG]<br />
<br />
[EN] [https://www.ign.com/articles/2016/08/25/overwatch-made-the-internet-lose-its-mind-last-night-and-i-had-a-front-row-seat IGN - Overwatch Made the Internet Lose its Mind Last Night, And I Had a Front-Row Seat]<br />
<br />
[EN] [https://www.technewstoday.com/31182-overwatch-countdown-to-sombra/ Tech News Today - Overwatch: Countdown to Sombra]<br />
<br />
<br />
'''30th Aug. 2016'''<br />
<br />
[EN] [https://www.pcgamer.com/overwatch-sombra-arg-mystery/ PC Gamer - Overwatch's Sombra riddle begins to irritate the players trying to solve it]<br />
<br />
'''3rd Oct. 2016'''<br />
<br />
[EN] [https://www.mobilenapps.com/articles/19398/20161003/overwatch-update-sombra-blizzcon-halloween-event-leak.htm Mobile & Apps - Sombra To Be Revealed At Blizzcon? Halloween Event Confirmed In Data Leak]<br />
<br />
'''4th Oct. 2016'''<br />
<br />
[EN] [https://www.itechpost.com/articles/36011/20161004/overwatch-overwatch-update-overwatch-finally-getting-sombra-overwatch-sombra-sombra.htm iTechPost - Overwatch Update: Are We Finally Getting Sombra?]<br />
<br />
'''11th Oct. 2016'''<br />
<br />
[EN] [https://www.kotaku.com.au/2016/10/overwatch-fans-hacked-actual-people-in-an-attempt-to-find-sombra/ Kotaku - Overwatch Fans Hacked Actual People In An Attempt To Find Sombra]<br />
<br />
'''17th Oct. 2016'''<br />
<br />
[EN] [https://telkomgaming.co.za/will-sombra-hack-her-way-into-blizzcon-2016/ TelKom Gaming - Will Sombra Hack Her Way Into BlizzCon 2016?]<br />
<br />
'''18th Oct. 2016'''<br />
<br />
[EN] [https://overwatchtips.info/overwatch-sombra-arg-everything-you-need-to-know/ OverwatchTips - Everything You NEED To Know (Sombra ARG)]<br />
<br />
'''26th Oct. 2016'''<br />
<br />
[EN] [https://mic.com/articles/157757/overwatch-sombra-arg-everything-we-know-about-the-countdown-and-rumored-nov-1-release#.UILrZHRiM Min Network - Everything we know about Blizzard's rumored Nov. 1 release]<br />
<br />
'''28th Oct. 2016'''<br />
<br />
[EN] [https://kotaku.com/imagining-horror-stories-for-a-never-ending-overwatch-a-1788324673 Kotaku - Imagining Horror Stories Of A Never-Ending Overwatch ARG]<br />
<br />
'''1st Nov. 2016'''<br />
<br />
[EN] [https://www.ign.com/videos/2016/11/01/will-overwatchs-sombra-be-at-blizzcon-2016 IGN - Will Sombra be at BlizzCon 2016?]<br />
<br />
'''8th Nov. 2016'''<br />
<br />
[EN] [https://mic.com/articles/158812/overwatch-sombra-arg-gameplay-emote-directly-references-one-of-the-wildest-fan-theories Mic Tech - 'Overwatch' Sombra ARG: Gameplay emote directly references one of the wildest fan theories]</div>Halke234https://wiki.gamedetectives.net/index.php?title=Sombra_ARG&diff=16617Sombra ARG2018-07-23T23:52:19Z<p>Halke234: /* LuméReaction */</p>
<hr />
<div>{{argbox<br />
| float = right<br />
| name = Sombra ARG<br />
| image = File:Sombra_skull.png<br />
| description= The Sombra ARG - an ARG involving an unreleased Overwatch hero.<br />
| creator = [https://www.blizzard.com/ Blizzard Entertainment]<br />
| type = Official<br />
| status = Completed<br />
| discovered = 2016-06-12<br />
| completed = 2016-11-04<br />
}}<br />
<br />
{{ArgHeader|arg=Sombra ARG}}<br />
The Sombra ARG was an ARG for the first-person shooter [https://www.playoverwatch.com Overwatch], developed by [https://www.blizzard.com/ Blizzard Entertainment]. Sombra was the name of a then-unreleased Overwatch hero. The ARG was comprised of clues and ciphers referencing Sombra, which were found in various developer updates and short animations.<br />
<br />
At the game's release, there were numerous pieces of in-game information that appeared in the map Dorado, hinting at a character called Sombra. When the hero Ana was revealed, more Sombra clues appeared in Ana's origin video. In the weeks that followed, more clues were discovered, which led up to a character reveal animation at BlizzCon 2016.<br />
<br />
== Ana Videos ==<br />
<br />
=== Ana Origin Video ===<br />
<br />
On July 12, 2016, a [https://www.youtube.com/watch?v=TE0CXgpNxG0 video] for the new Overwatch hero named Ana was released. At the 1:16 mark, players discovered a set of hexidecmial values:<br />
<br />
[[File:Ana_Hex2.png|400px]]<br />
<br />
<pre><br />
2E 2E 2E 7B 76 20 66 62 72 20 63 7E 72 79 72 20 7B 76 20 7E<br />
79 71 78 65 7A 76 74 7E D4 A4 79 2C 20 63 7E 72 79 72 20 72<br />
7B 20 67 78 73 72 65 2E 2E 2E 7B 76 20 66 62 72 20 63 7E 72<br />
79 72 20 7B 76 20 7E 79 71 78 65 7A 76 74 7E D4 A4 79 2C 20<br />
63 7E 72 79 72 20 72 7B 20 67 78 73 72 65 2E 2E 2E 7B 76 20<br />
66 62 72 20 63 7E 72 79 72 20 7B 76 20 7E 79 71 78 65 7A 76<br />
74 7E D4 A4 79 2C 20 63 7E 72 79 72 20 72 7B 20 67 78 73 72<br />
65 2E 2E 2E 7B 76 20 66 62 72 20 63 7E 72 79 72 20 7B 76 20<br />
7E 79 71 78 65 7A 76 74 7E D4 A4 79 2C 20 63 7E 72 79 72 20<br />
72 7B 20 67 78 73 72 65 2E 2E 2E 64 78 7A 75<br />
</pre><br />
<br />
A hex to ASCII translation yielded the following:<br />
<br />
<pre><br />
...{v fbr c~ryr {v ~yqxezvt~Ô¤y, c~ryr r{ gxsre...{v fbr c~ryr {v ~yqxezvt~Ô¤y, c~ryr r{ gxsre...{v fbr c~ryr {v ~yqxezvt~Ô¤y, c~ryr r{ gxsre...{v fbr <br />
c~ryr {v ~yqxezvt~Ô¤y, c~ryr r{ gxsre...dxzu<br />
</pre><br />
<br />
Using an XOR Cipher with the constant 23 on the above text resulted in the following message:<br />
<br />
<pre><br />
..la que tiene la información; tiene el poder...la que tiene la información; tiene el poder...la que tiene la información; tiene el poder...la que tiene la <br />
información; tiene el poder...somb<br />
</pre><br />
<br />
This was a repeating phrase in Spanish, which translated to:<br />
<br />
<pre><br />
She who has the information, has the power...<br />
</pre><br />
<br />
Players then discovered a second set of hexidecimal values at the 2:11 mark:<br />
<br />
[[File:Ana Hex.png|400px]]<br />
<br />
<pre><br />
65 76 2E 2E 2E 7B 76 20 66 62 72 20 63 7E 72 79 72 20 7B 76<br />
20 7E 79 71 78 65 7A 76 74 7E D4 A4 79 2C 20 63 7E 72 79 72<br />
20 72 7B 20 67 78 73 72 65 2E 2E 2E 7B 76 20 66 62 72 20 63<br />
7E 72 79 72 20 7B 76 20 7E 79 71 78 65 7A 76 74 7E D4 A4 79<br />
2C 20 63 7E 72 79 72 20 72 7B 20 67 78 73 72 65 2E 2E 2E 7B<br />
76 20 66 62 72 20 63 7E 72 79 72 20 7B 76 20 7E 79 71 78 65<br />
7A 76 74 7E D4 A4 79 2C 20 63 7E 72 79 72 20 72 7B 20 67 78<br />
73 72 65 2E 2E 2E 7B 76 20 66 62 72 20 63 7E 72 79 72 20 7B<br />
76 20 7E 79 71 78 65 7A 76 74 7E D4 A4 79 2C 20 63 7E 72 79<br />
72 20 72 7B 20 67 78 73 72 65 2E 2E 2E<br />
</pre><br />
<br />
When put through the same process, the same string of Spanish was revealed, but with the letters <code>ra</code> at the beginning of the message. These letters were combined with <code>somb</code> from the first cipher to create the name <code>sombra</code>. No more clues were discovered until the release of the Dev Update video.<br />
<br />
=== Dev Update Video ===<br />
<br />
[[File:Sombra Barcodes.png|thumbnail|right|The vertical barcodes found at the end of the Ana Dev Update video]]<br />
<br />
On July 19, 2016, the first [https://www.youtube.com/watch?v=evghkilg2eQ Developer Update] was released for Ana. At the end of the video, players discovered a series of vertical barcodes. When scanned, players discovered a large set of hexidecimal values which where then converted to binary, a dump of which is available [https://gist.github.com/zapu/31165efab0d6264e2fd0fa75cc53b1aa here].<br />
<br />
Turning the ones and zeroes into black and white pixels formed a QR code:<br />
<br />
[[File:Sombra_QR_code.png|300px]]<br />
<br />
Scanning this QR code yielded the following message: <code>¿Estuvo eso facilito? Ahora que tengo su atención, déjenme se las pongo más difícil.</code> In English, the message reads: <code>Was that easy? Well, now that I have your attention, allow me to make things much more difficult.</code> After this, no more clues were discovered until the Summer Games video was released.<br />
<br />
== Welcome to the Summer Games Video ==<br />
<br />
=== Tracer Trail Cipher ===<br />
<br />
[[File:Base64_trail.jpg|thumbnail|right|The unsolved base64 cipher in the Summer Games video]]<br />
<br />
'''Note: The cipher described below remains unsolved.'''<br />
<br />
On August 2, 2016, players discovered another cipher in the [https://www.youtube.com/watch?v=qpcOD9tJM4k Welcome to the Summer Games trailer]:<br />
<br />
<pre><br />
U2FsdGVkX1+vupppZksvRf5pq5g5XjFRIipRkwB0K1Y96Qsv2L<br />
m+31cmzaAILwytX/z66ZVWEQM/ccf1g+9m5Ubu1+sit+A9cenD<br />
xxqkIaxbm4cMeh2oKhqIHhdaBKOi6XX2XDWpa6+P5o9MQw==<br />
</pre><br />
<br />
Players discovered this text to be base64 encryption. When decrypted, players received the following output:<br />
<br />
<pre><br />
Salted__���ifK/E�i��9^1Q�*Q�t+V=�<br />
/ع��W/<br />
�_����V��?q����f�F���"��=q�������[��<br />
z��*����Z����u�\5�k�C<br />
</pre><br />
<br />
''(Note: copy/pasting this string will not work; some of the characters are not printable and are not even displayed correctly on this page)''<br />
<br />
==== Decrypting the Cipher ====<br />
<br />
The "Salted__" header at the start of the string indicated to players that the remainder of the text was encrypted with the OpenSSL software library, which requires a password and the encryption cipher that was used. Salt is added by OpenSSL to ensure uniqueness of the key and the IV derived from the password and used for the encryption. However, due to the age of OpenSSL and its massive library, it was proven to be quite difficult for players to identify the encryption used.<br />
<br />
==== Narrowing Down Ciphers ====<br />
<br />
[[File:HexOfEncryptedMessage.png|thumbnail|right|Hex view of the encrypted string]]<br />
<br />
Players narrowed down the potential ciphers used by examining a hex dump of the encrypted string. There are two major types of ciphers, stream ciphers and block ciphers. Stream ciphers encrypt only the data fed into them, whereas block ciphers always encrypt a certain number of bytes at a time (a "chunk").<br />
<br />
A byte is roughly a single character, but special characters can take up multiple bytes. We know that OpenSSL Salted Encryption uses the first 8 bytes of the output for <code>Salted__</code> and the next 8 bytes for the actual salt. The rest of the information is the '''encrypted message'''.<br />
<br />
The immediately interesting thing here is that the '''encrypted message''' data stops 3 bytes short of a full chunk. This is a excellent indicator that the cipher used is a stream cipher (or a block cipher in CTR/OFB/CFB mode). This narrows the list of potential ciphers down significantly. This also means that the final string that Blizzard encrypted is less than 93 bytes!<br />
<br />
'''This cipher remains unsolved, but it's speculated that Blizzard moved past the cipher by creating alternate puzzles.'''<br />
<br />
=== Directions & Letters ===<br />
<br />
Players discovered that in the North American version of the Summer Games trailer there were repeated references to the cardinal directions, each associated with a particular hero. These references were conspicuously absent from other versions of the trailer. These references are shown below, with the relevant heroes and timestamps:<br />
<br />
<gallery mode="packed"><br />
File:Ow1.png|East - Mercy - Route 66 - 0:17<br />
File:Ow2.png|Center - D. Va - Temple of Anubis - 0:19<br />
File:Ow3.png|North - Torbjorn - Nepal - 0:21<br />
File:Ow4.png|South - Genji - Hanamura - 0:22<br />
File:Ow5.png|Southeast - McCree - Hollywood - 0:24<br />
File:Ow6.png|West - Symmetra - Watchpoint: Gibraltar - 0:30<br />
File:Ow7.png|Southwest - Bastion - Hollywood - 0:34<br />
File:Ow8.png|Northeast - Winston - Volskaya Industries - 0:46<br />
File:Ow9.png|Northwest - Tracer - King's Row - 0:47<br />
</gallery><br />
<br />
Screenshots of all the directions and their respective heroes can be found in an album [https://imgur.com/a/FQXmy here].<br />
<br />
[[File:Overwatch map.jpg|frameless]]<br />
<br />
These heroes, arranged in this particular order, provided a password that was used later in the ARG.<br />
<br />
== Dorado Photo ==<br />
<br />
At an unknown date, a new, "corrupted" photo of the [https://blzgdapipro-a.akamaihd.net/media/screenshot/dorado-screenshot-004.jpg Dorado attackers spawn point] was added to the Overwatch [https://playoverwatch.com/en-us/media/ media page]. Players discovered that the screenshot was "'''datamoshed'''", which means it concealed a hidden message while also taking on a distorted appearance. ([https://prntscr.com/c3dce7 Here] is an example of purposely data moshing the image manually to achieve similar effects.) <br />
<br />
<gallery mode="packed" heights=500px><br />
File:dorado-datamosh.jpg|The datamoshed image<br />
File:dorado-screenshot-005.jpg|The original image<br />
</gallery><br />
<br />
After comparing the images with difference checking tools, players found that certain English and Spanish characters were replaced with exclamation points. The missing characters produced the following Spanish phrase:<br />
<br />
<code>Por que estan mirando al cielo? La respuesta no esta sobre sus cabezas, esta detras de ustedes. A veces, necesitan analizar sus logros previos.</code><br />
<br />
Translated into English, this phrase read:<br />
<br />
<code>Why are you looking at the sky? The answer isn't over your heads, it's behind you. Sometimes, you need to analyze your previous achievements.</code><br />
<br />
The phrase "Why are you looking at the sky?" was most likely a reference to a strange artifact that was discovered in the sky of the Dorado map, dubbed the "Skycode". The Skycode ended up being a red herring, and was completely unrelated to the ARG.<br />
<br />
=== Analyzing Achievements ===<br />
<br />
[[File:achievements.png|thumbnail|right|"¿" Achievement, comment in source code]]<br />
<br />
The phrase "you need to analyze your previous achievements" led players to look at the achievements on the [https://www.playoverwatch.com Overwatch] website. It was noticed noticed that by logging in and viewing the achievements on a player profile, a mystery achievement appeared. Examining a hex dump of the image lead players to a new phrase:<br />
<br />
<pre><br />
Vientos, nada mal. No obstante, me aburro. Intentemos algo nuevo en la misma dirección.<br />
uczihriwgsxorxwunaarawryqhbrsfmeqrjjmu 5552E494 78T3 4VM9 OPL6 IS8208O913KRlrx<br />
</pre><br />
<br />
Translated, it said:<br />
<br />
<pre><br />
Damn, not bad. However, I'm getting bored. Let's try something new in the same direction.<br />
uczihriwgsxorxwunaarawryqhbrsfmeqrjjmu 5552E494 78T3 4VM9 OPL6 IS8208O913KRlrx<br />
</pre><br />
<br />
== Volskaya Datamosh ==<br />
<br />
After a long period of toying around, players discovered that the ciphertext <code> uczihriwgsxorxwunaarawryqhbrsfmeqrjjmu 5552E494 78T3 4VM9 OPL6 IS8208O913KRlrx</code> from the "?" achievement was a Vigenére cipher. Players discovered the key <code>tracertorbjornwinstonsymmetradvamercybastiongenjimccree</code> by ordering the heroes in the Summer Games trailer by the cardinal directions associated with each of them, as said further above. Once decoded, players received the following text: <br />
<pre>blzgdapiproaakamaihdnetmediascreenshot 5552E494 78B3 4CE9 ACF6 EF8208F913CFjpg</pre><br />
<br />
Players found this to be a [https://blzgdapipro-a.akamaihd.net/media/screenshot/5552E494-78B3-4CE9-ACF6-EF8208F913CF.jpg blzgdapipro-a.akamaihd.net/media/screenshot/5552E494-78B3-4CE9-ACF6-EF8208F913CF.jpg URL], which led players to a datamoshed screenshot of the Volskaya Industries map. ''(Editor's note: This link appears to now be dead)''. When players ran a difference check with the [https://blzgdapipro-a.akamaihd.net/media/screenshot/volskaya-screenshot-004.jpg original image], they received an interesting message.<br />
<br />
<gallery mode="packed"><br />
File:volskaya-datamosh.jpg|The datamoshed image<br />
File:Volskaya-screenshot-004.jpg|The original image<br />
</gallery><br />
<br />
=== ASCII Skull #1 ===<br />
<br />
The diff from the datamoshed image resulted in the following output:<br />
<br />
<pre><br />
Parece que te gustan estos jueguitos... por que no jugamos uno de verdad?<br />
:PB@Bk:<br />
,jB@@B@B@B@BBL.<br />
7G@B@B@BMMMMMB@B@B@Nr<br />
:kB@B@@@MMOMOMOMOMMMM@B@B@B1,<br />
:5@B@B@B@BBMMOMOMOMOMOMOMM@@@B@B@BBu.<br />
70@@@B@B@B@BXBBOMOMOMOMOMOMMBMPB@B@B@B@B@Nr<br />
G@@@BJ iB@B@@ OBMOMOMOMOMOMOM@2 B@B@B. EB@B@S<br />
@@BM@GJBU. iSuB@OMOMOMOMOMOMM@OU1: .kBLM@M@B@<br />
B@MMB@B 7@BBMMOMOMOMOMOBB@: B@BMM@B<br />
@@@B@B 7@@@MMOMOMOMM@B@: @@B@B@<br />
@@OLB. BNB@MMOMOMM@BEB rBjM@B<br />
@@ @ M OBOMOMM@q M .@ @@<br />
@@OvB B:u@MMOMOMMBJiB .BvM@B<br />
@B@B@J 0@B@MMOMOMOMB@B@u q@@@B@<br />
B@MBB@v G@@BMMMMMMMMMMMBB@5 F@BMM@B<br />
@BBM@BPNi LMEB@OMMMM@B@MMOMM@BZM7 rEqB@MBB@<br />
B@@@BM B@B@B qBMOMB@B@B@BMOMBL B@B@B @B@B@M<br />
J@@@@PB@B@B@B7G@OMBB. ,@MMM@qLB@B@@@BqB@BBv<br />
iGB@,i0@M@B@MMO@E : M@OMM@@@B@Pii@@N:<br />
. B@M@B@MMM@B@B@B@MMM@@@M@B<br />
@B@B.i@MBB@B@B@@BM@::B@B@<br />
B@@@ .B@B.:@B@ :B@B @B@O<br />
:0 r@B@ B@@ .@B@: P:<br />
vMB :@B@ :BO7<br />
,B@B<br />
</pre><br />
<br />
'''Translation:'''<br />
<br />
<pre><br />
"It seems you like these little games... Why don't we play a real one?"<br />
</pre><br />
<br />
(''This is the python2 script to extract modified bytes from datamoshed Volskaya screenshot: https://gist.github.com/synap5e/27635d2ff6f0e3b15f0c902dca2974a9'')<br />
<br />
No further progress was made until August 23, 2016.<br />
<br />
== Overwatch Forums Glitching Page/ "Skycoder" ==<br />
<br />
On August 23rd, 2016, at an unknown time, an [https://us.battle.net/forums/en/overwatch/topic/20748794686 ominous post] by a user named "Skycoder" appeared on the official General Discussion forums for Overwatch. <br />
<br />
Players found that the name of the post, <code>00110010 00110011</code>, was binary for "23," which was a direct reference to Sombra being the 23rd hero in Overwatch. The age of the post started at 24 hours, and counted down rather than increasing. The post itself contained a single sentence in Spanish:<br />
<br />
<pre><br />
la que tiene la información; tiene el poder<br />
</pre><br />
<br />
Which, when translated to english, reads:<br />
<br />
<pre><br />
She who has the information, has the power.<br />
</pre><br />
<br />
After a short while, the post glitched and distorted, gradually turning a hue of purple. A text box then appeared, which printed the following ciphertext:<br />
<br />
<pre><br />
ICAgICAgICAgICAgICAgICAgICAgICAgICA6UEKPQms6CiAgICAgICAg<br />
ICAgICAgICAgICAgICAsakKIQEJAQkBCQEJCTC4KICAgICAgICAgICAg<br />
ICAgICAgIDdHlkKTQpVCTU1NTU1CQEJAQkBOcgogICAgICAgICAgICAg<br />
ICA6a0KSQpCIl01NT01PTU9NT01NTU2MQphCQEIxLAogICAgICAgICAg<br />
IDo1kUKNQphCiEJCTU1PTU9NT01PTU9NT01NipJuQm5CQEJCdS4KICAg<br />
ICAgICA3MG6GlUKIQpJClEJYQkJPTU9NT01PTU9NT01NQk1QQphCiEJA<br />
QkBCQE5yCiAgICAgIEeYlpdCSiBpQohCh4ggIE9CTU9NT01PTU9NT01P<br />
TZYyICBCj0JAQi4gRUJAQkBTCiAgICAgIJKWQk2HR0pCVS4gIGlTdUKI<br />
T01PTU9NT01PTU9NTZdPVTE6ICAua0JMTYhNhkKXCiAgICAgIEKMTU1C<br />
mUIgICAgICAgN4hCQk1NT01PTU9NT01PQkKWOiAgICAgICBCh0JNTYhC<br />
CiAgICAgII2YiEKKQiAgICAgICAgIDeSlkBNTU9NT01PTU1AQkA6ICAg<br />
ICAgICAgQEBCQEJACiAgICAgII+ST0xCLiAgICAgICAgICBCTkKPTU1P<br />
TU9NTY9CRUIgICAgICAgICAgckJqTYRCCiAgICAgIJBAICBAICAgICAg<br />
ICAgICBNICBPQk9NT01NQHEgIE0gICAgICAgICAgLkAgIEBACiAgICAg<br />
IISVT3ZCICAgICAgICAgICBCOnWMTU1PTU9NTUJKaUIgICAgICAgICAg<br />
LkJ2TUBCCiAgICAgIIRCkUKYSiAgICAgICAgIDCRQpdNTU9NT01PTUKV<br />
QkB1ICAgICAgICAgcUBAQEJACiAgICAgIEKETUJCjHYgICAgICAgR4+L<br />
Qk1NTU1NTU1NTU1NQkKINSAgICAgICBGhEJNTUBCCiAgICAgIIdCQk1/<br />
QlBOaSAgIExNRUKFT01NTU2PQoNNTU9NTYpCWk03ICAgckVxQodNQkKE<br />
CiAgICAgIEKYloRCTSAgQm1ChEIgIHFCTU9NQpBChUKEQk1PTUJMICBC<br />
QEJAQiAgQEJAQkBNCiAgICAgICBKlm2GhFBCj0KEQplCN0eIT01CQi4g<br />
ICAsQE1NTUBxTEJAQkBAQEJxQkBCQnYKICAgICAgICAgIGlHQpUsaTCE<br />
TZZCbk1NT4tFICA6ICBNQE9NTUBAQEJAUGlpQEBOOgogICAgICAgICAg<br />
ICAgLiAgIEKXTZBCj01NTUBCQEJAQkBNTU1AQEBNQEIKICAgICAgICAg<br />
ICAgICAgICBAQkBCLmlATUJCQEJAQkBAQk1AOjpCQEJACiAgICAgICAg<br />
ICAgICAgICAgQkBAQCAuQkBCLjpAQkAgOkJAQiAgQEJATwogICAgICAg<br />
ICAgICAgICAgICAgOjAgckBCQCAgQkBAIC5AQkA6IFA6CiAgICAgICAg<br />
ICAgICAgICAgICAgICAgdk1CIDpAQkAgOkJPNwogICAgICAgICAgICAg<br />
ICAgICAgICAgICAgICAsQkBCCg==<br />
</pre><br />
<br />
=== ASCII Skull #2 ===<br />
<br />
Players discovered that this was Base64 and, once decrypted, resulted in another ASCII skull:<br />
<br />
<pre><br />
:PB.Bk: <br />
,jBˆ@B@B@B@BBL. <br />
7G–B“B•BMMMMMB@B@B@Nr <br />
:kB’B.ˆ—MMOMOMOMOMMMMŒB˜B@B1, <br />
:5‘B.B˜BˆBBMMOMOMOMOMOMOMMŠ’nBnB@BBu. <br />
70n†•BˆB’B”BXBBOMOMOMOMOMOMMBMPB˜BˆB@B@B@Nr <br />
G˜–—BJ iBˆB‡ˆ OBMOMOMOMOMOMOM–2 B.B@B. EB@B@S <br />
’–BM‡GJBU. iSuBˆOMOMOMOMOMOMM—OU1: .kBLMˆM†B— <br />
BŒMMB™B 7ˆBBMMOMOMOMOMOBB–: B‡BMMˆB <br />
.˜ˆBŠB 7’–@MMOMOMOMM@B@: @@B@B@ <br />
.’OLB. BNB.MMOMOMM.BEB rBjM„B <br />
.@ @ M OBOMOMM@q M .@ @@ <br />
„•OvB B:uŒMMOMOMMBJiB .BvM@B <br />
„B‘B˜J 0‘B—MMOMOMOMB•B@u q@@@B@ <br />
B„MBBŒv G.‹BMMMMMMMMMMMBBˆ5 F„BMM@B <br />
‡BBM.BPNi LMEB…OMMMM.BƒMMOMMŠBZM7 rEqB‡MBB„ <br />
B˜–„BM BmB„B qBMOMB.B…B„BMOMBL B@B@B @B@B@M <br />
J–m†„PB.B„B™B7GˆOMBB. ,@MMM@qLB@B@@@BqB@BBv <br />
iGB•,i0„M–BnMMO‹E : M@OMM@@@B@Pii@@N: <br />
. B—M.B.MMM@B@B@B@MMM@@@M@B <br />
@B@B.i@MBB@B@B@@BM@::B@B@ <br />
B@@@ .B@B.:@B@ :B@B @B@O <br />
:0 r@B@ B@@ .@B@: P: <br />
vMB :@B@ :BO7 <br />
,B@B <br />
</pre><br />
<br />
Players discovered that, once both skulls had been stripped of spaces, the bytes of each skull that aren't equal to 0 could be subtracted using [https://pastebin.com/g3kA1Pif a script]. Once compiled, players received the following string:<br />
<br />
<pre><br />
OHVSURPHWLXQMXHJR...FUHRTXHXVWHGHVORVGHWHFWLYHVGHMXHJRVOROODPDULDQXQWUDLOKHDG?EOCJGDXVD-DPEDV-FDODYHUDV.KWPO<br />
</pre><br />
<br />
Players discovered that this was a caesar cipher. After shifting the string forward 23 places, it resulted in:<br />
<br />
<pre><br />
LESPROMETIUNJUEGO...CREOQUEUSTEDESLOSDETECTIVESDEJUEGOSLOLLAMARIANUNTRAILHEAD?BLZGDAUSA-AMBAS-CALAVERAS.HTML<br />
</pre><br />
<br />
When cleaned up, the message read:<br />
<br />
<pre><br />
Les prometi un juego...creo que ustedes los Detectives de Juegos lo llamarían un trailhead? BLZGDUSA-AMBAS-CALAVERAS.HTML<br />
</pre><br />
<br />
When translated from Spanish to English:<br />
<br />
<pre><br />
I promised you a game...I believe you Game Detectives would call it a trailhead? BLZGDAUSA-AMBAS-CALAVERAS.HTML<br />
</pre><br />
<br />
<code>USA-AMBAS-CALAVERAS</code> translated to <code>USE-BOTH-SKULLS</code>, and the <code>.HTML</code> extension hinted at a URL.<br />
<br />
=== Skull Video ===<br />
<br />
BLZGDA refers to the servers that Blizzard uses to host media on their website. As such, this led players to [ https://blzgdapipro-a.akamaihd.net/media/screenshot/usa-ambas-calaveras.html this page], which contains a video of a vitals screen depicting a skull and some other medical information. In addition, it also contained a graphic of one of the ASCII skulls. An Imgur mirror can be found [https://i.imgur.com/6Pk69LX.png here].<br />
<br />
Within the properties of the video, players found another comment in Spanish:<br />
<br />
<pre><br />
Parecen estar muy interesados en estos "héroes". ¿Tal vez les interese conocer algunos detallitos que he averiguado sobre ellos?<br />
</pre><br />
<br />
In English:<br />
<br />
<pre><br />
You seem to be very interested in these "heroes". Maybe interested to know some details that I found out about them?<br />
</pre><br />
<br />
In addition, the video contains a heartbeat monitor, and a series of 26 lines above it. When players assigned the letters of the alphabet to the 26 lines, and used the "pings" of the heartbeat to determine what letters to use, the following string was found:<br />
<br />
<pre><br />
momentincrime<br />
</pre><br />
<br />
=== amomentincrime E-mail ===<br />
<br />
'momentincrime' appeared to refer to the in-universe TV show "A Moment in Crime," which can be seen in the Roadhog and Junkrat [https://www.youtube.com/watch?v=l5kTATxt7bE video] that came out months before the release of Overwatch. However, players also discovered a website, [https://amomentincrime.com amomentincrime.com], and displayed the following text:<br />
<br />
<pre><br />
...Estableciendo conexión...<br />
...Protocolo Sombra v1.3 iniciado...<br />
<br />
...Infiltrando la respuesta automática del email de pistas...<br />
<br />
...Terminando conexión...<br />
</pre><br />
<br />
Players discovered that sending an e-mail to tips@amomentincrime.com resulted in an automated email response:<br />
<br />
<pre><br />
Thank you for contacting A Moment in Crime's anonymous crime line!<br />
<br />
We have analyzed your submission and forwarded the information to the relevant parties. Your help could be vital in apprehending these cri<br />
<br />
...Estableciendo conexión...<br />
...Protocolo Sombra v1.7 iniciado...<br />
<br />
<br />
01:07:47 02:02:02 01:08:06 02:13:43 01:18:32<br />
01:18:21 02:10:19 01:06:21 02:05:18 01:04:02<br />
01:07:08 02:18:25 01:13:04 02:19:20 01:23:02<br />
01:16:40 02:16:35 01:23:04 02:17:16 01:06:42<br />
01:13:29 02:18:06 01:05:02 02:15:41 01:08:34<br />
<br />
j.7F57O,NLv:qj.7B:,1qv@B1j5ivB:,<br />
<br />
...Terminando conexión...<br />
<br />
minals and bringing them to justice. These fugitives are responsible for a string of robberies, arson, and other crimes stretching from Sydney to King's Row.<br />
<br />
Authorities believe that they have set their sights on crossing the Atlantic to America.<br />
</pre><br />
<br />
Players discovered that, if the sets of numbers were taken as AA:BB:CC, where AA was the number of skull (in order of discovery), BB was the row and CC was the column (as seen [https://i.imgur.com/ZgN2MVQ.png here]), and organized into a 5x5 matrix, it would result in:<br />
<br />
<pre><br />
S j G B L <br />
. @ M O k <br />
i , v : 0 <br />
E 7 r q N <br />
J P 5 F 1<br />
</pre><br />
<br />
Players discovered that this Matrix could be used as a bifid key to decode the text underneath the table of numbers in the email, as shown below:<br />
<pre><br />
j . 7 F 5 7 O , N L v : q j . 7 B : , 1 q v @ B 1 j 5 i v B : ,<br />
12 21 42 54 53 42 24 32 45 15 33 34 44 12 21 42 14 34 32 55 44 33 22 14 55 12 53 31 33 14 34 32<br />
<br />
1 2 2 1 4 2 5 4 5 3 4 2 2 4 3 2 4 5 1 5 3 3 3 4 4 4 1 2 2 1 4 2<br />
1 4 3 4 3 2 5 5 4 4 3 3 2 2 1 4 5 5 1 2 5 3 3 1 3 3 1 4 3 4 3 2<br />
<br />
11 24 23 14 43 22 55 45 54 34 43 23 22 42 31 24 45 55 11 52 35 33 33 41 43 43 11 24 23 14 43 22<br />
</pre><br />
<br />
This gave players the following string:<br />
<br />
SOMBr@1NF:rM@7iON1SP0vvErrSOMBr@<br />
This phrase was found to be leet-speak, and was translated to:<br />
<br />
<pre><br />
Sombra Information is power Sombra<br />
</pre><br />
<br />
The string <code>SOMBr@1NF:rM@7iON1SP0vvErrSOMBr@</code> was used as a password later on in the ARG.<br />
<br />
== A Moment in Crime Transmission ==<br />
<br />
[[File:Momentincrime.png|thumbnail|right|amomentincrime.com as of August 24th, 2016]]<br />
<br />
Once the 23-hour countdown on the Skycoder forum post reached zero, [https://amomentincrime.com amomentincrime.com] was updated. It now read:<br />
<br />
<pre><br />
...Estableciendo conexión...<br />
...Protocolo Sombra v1.9 iniciado...<br />
<br />
...Transmitiendo información a ómnicos activos... 2%<br />
<br />
...Terminando conexión...<br />
</pre><br />
<br />
Translated from Spanish to English:<br />
<br />
<pre><br />
...Establishing connection...<br />
...Sombra Protocol v1.9 initiated...<br />
...Transmitting information to active omnics... 2%<br />
<br />
...Ending connection...<br />
</pre><br />
<br />
A comment was also added to the source code:<br />
<br />
<pre><br />
Bien hecho, ya tienen mi clave. Hackear este programa de televisión no tuvo chiste. Espérense a lo que sigue.<br />
</pre><br />
<br />
When translated:<br />
<br />
<pre><br />
Well done, you have my password. Hacking this television program was meaningless. Wait for what is coming.<br />
</pre><br />
<br />
The percent on the amomentincrime.com slowly increased over time. Once the 5% milestone was hit, the Sombra Protocol version number changed to to v1.95. Afterwards, the percentage increased by 0.0038% every 3 minutes in real time.<br />
<br />
In addition, another comment was added:<br />
<br />
<pre><br />
Parece que se están calentando un poco las cosas... tendré que pasar desapercibida mientras esto se finaliza.<br />
</pre><br />
<br />
Translated:<br />
<br />
<pre><br />
It seems things are heating up a bit... I'll have to go unnoticed while this is finishing.<br />
</pre><br />
<br />
On 18th October at 19:02 GMT the site reached 100%, and the site updated with the following message:<br />
<br />
<pre><br />
...Transmisión finalizada - finalizando carga... <br />
...Carga finalizada. Unidad Bastion E-54 comprometida...<br />
</pre><br />
<br />
Which roughly translates to:<br />
<br />
<pre><br />
...Transmission complete - finishing upload...<br />
...Upload finished. Unit Bastion E-54 engaged...<br />
</pre><br />
<br />
Hidden in the source code of the site was the text <code>v1.4.0.2.324??</code>. Players then correctly assumed that this referred to a future build of Overwatch itself.<br />
<br />
== Sombra vs. LumériCo ==<br />
<br />
=== The Hacked Bastion ===<br />
<br />
On October 19, 2016, a new Overwatch version was released - version 1.4.0.2.32448. Shortly afterwards, the version number in the source code of the amomentincrime site updated to the same version number. After the build launched, players discovered that the hero Bastion had a strange interaction when near the "SOMBRA PROTOCOL" monitors on Dorado, and would emit a message in morse code, which can be heard [https://www.youtube.com/watch?v=Hkd__ceYm-Y here]. When the morse was decoded, players received the following string:<br />
<pre><br />
SQOFJFBNITIZWGDXSDO<br />
</pre><br />
<br />
Players discovered that this was a Vigenere cipher, and the key consisted of the alphabetic characters from the<br />
<code>SOMBr@1NF:rM@7iON1SP0vvErrSOMBr@</code> string, it was decoded to read:<br />
<br />
<pre><br />
ACCESSWWWLUMERICOMX<br />
</pre><br />
<br />
This led players to the [https://lumerico.mx/ LumeriCo website]. ''(Editor's note: as of 2018, this site appears to be inactive.)''<br />
<br />
=== LuméReaction ===<br />
<br />
[[File:Lumerico.png|thumbnail|right|The homepage of https://lumerico.mx]]<br />
<br />
The LumeriCo website was for the in-universe, Mexican tech giant LumériCo, who had built several reactors in the Dorado region. The website had a [https://lumerico.mx/news news page], noting the imminent opening of a new reactor on November 1 as well as a recent attack on its construction site. There were also [https://lumerico.mx/about About] and [https://lumerico.mx/login Login] pages.<br />
<br />
Players also discovered a <code>robot.txt</code> file, which appeared to server no purpose and only contained the text <code>Allow: omnics</code>, and appeared to be a joke about the [https://en.wikipedia.org/wiki/Robots_exclusion_standard Robots exclusion standard]. Another text file was discovered called <code>omnics.txt</code>, which contained the text:<br />
<br />
<pre><br />
Allow: ??<br />
Allow: ???<br />
</pre><br />
<br />
And appeared to be yet anotehr joke about the Robots exclusion standard. And, finally, an <code>api</code> file that contained <code>{"message":"thanks for calling the api"}</code> and, humorously, has no practical purpose.<br />
<br />
=== Phone Number ===<br />
<br />
At the bottom of the Lumerico website, a phone number was discovered: (510) 766-2726. ARG players called the phone number to hear [https://soundcloud.com/jackwilsdon/510-766-2726a a woman speaking in Spanish]. She says a string of numbers: <code>5-2-4-1-3 (pause) 23-4-14-8-6-18-17-23-21-18-15</code><br />
<br />
The second part translates (a=1, b=2, etc) to '''WDNHFRQWURO'''. After rotating 23 times (ROT-23 cipher) this becomes '''TAKECONTROL'''.<br />
<br />
=== Take Control ===<br />
<br />
The phone message lead to a more significant page on the site: https://lumerico.mx/TAKECONTROL/index.html. It was styled the same way as amomentincrime.com and featured [https://lumerico.mx/calavera.png an image of Sombra's skull icon], named "calavera.png" (a [https://en.wikipedia.org/wiki/Calavera Spanish name] for "skull" associated with the Mexican Day of the Dead). There was also text on the page:<br />
<br />
<pre style="word-break:break-all;word-wrap: break-word;"><br />
ethldtíoíesnoemfetuylm.bnlsssqtann)hcnslararuCpdGeoopéqubdsroaan.arnasdmdor1vrsmerñerlsdacnnnoaexedsidcn.iarsgcyi,iqeqnd.pooitoaeaaransterLetéáedasodocMrnseeiuCsimnosetlójnueodacapsadcoanfasest.rnucaodacadmdoemoipíogPoipbehaSussai.,yccandin.reueatenaoiorneoeetaoéyenimt¿rPehec,uurobudeílrysriteenasni,adngpjrálireecgrolsmhYnao?nmonomepeldezmapcpunoaulrrruCstmeitltetlróesoapsdéyufcuascaa,rensbuinergnqedlmvlbpdtaz.enebuineuldoerecrGefqfirrasulrbeatHsilnbaúaeeaaooassraooa,ioedo:aLiuielPr ursmoootlnielteeánlosulobeauaanopearrúiesltéyrosssisuaaeaenremsieaismdjmolrsspebiecdéyusittnvrcacp.taebrtLiunróporner<br />
<br />
eúcrneuyraarsettsyrseen.aaPnrneuyraeastuCpnhl/wLloaloa.qartlsyuínreute.evgdpiuábdmPooucvdeccmoreurr.o?unriorydbaSnalegeáezadienáutalaaioeemfcbgdinableoc¿éppoeocelsumuoaHearsosqadrrrftuLiorannnoneneriiatcnlomoqnaqdunrcno,enmerosaereisloabolii.e.dormerosepopdé,eo:r#5scoegaqoeaibs(edioraamtdírnlyoetjcgratmnrrobnrsstloeYqoeocicpnómlpernmaepogenmodqamubodnaeasuaenMoolloupeqvgrLtúr<br />
<br />
tsosrdvoeaerroaeusdmaauamoMobsnaeanraunnt,roierbeoiemaodbmantursotñauoureeuoerreopc.etlr<br />
<br />
sotñneerLimeaFsNJ<br />
</pre><br />
<br />
This is a column order transposition cipher with the key <code>5 2 4 1 3</code>, which was obtained in the phone call. The result is: (spaced out for clarity)<br />
<br />
Los felicito por haber llegado hasta aquí. Solo quería saber si estaban listos. (Hey, es muy difícil encontrar buena ayuda últimamente...deberían ver algunos de los payasitos que están trabajando conmigo) Por ahora, continuemos con el verdadero reto: acabar con LumériCo y su president e Guillermo Portero. ¿Y porqué? Porque es un hombre codicioso, corrupto y un ladrón abominable. Su plan de traer en línea el más grande y el más poderoso zigurat el 1 de noviembre no es nada más que una artimaña, un elaborado plan designado para ejercer aún más influencia sobre la gente de México y en gordar los bolsillos de sus compinches. ¿Y quién va a pagar por eso? La gente común y corriente, los mismos que siempre quedan olvidados.<br />
<br />
He empezado a mejorar mis protocolos para que sean usados para derrumbar la infraestructura de LumériCo y Los Muertos también están intentando levantarse en contra de la corrupción. Mientras tanto, escarben por el sitio de LumériCo y busquen información que podamos usar en contra del cabrón, mejor aún, encuentren su nombre de usuario y contraseña para asegurarnos de que ciertos detalles no muy favorables sobre el presidentito...aparezcan...<br />
<br />
Pude encontrar el nombre de usuario y contraseña de un empleado de soporte de LumériCo, empiecen por ahí:<br />
<br />
GFlores/g#fNwP5qJ<br />
<br />
Translated:<br />
<br />
I'm congratulating you for getting in here. I only wanted to know if you were ready or not. (Hey, it's really difficult to get good help lately... you should see some of the clowns I'm working with). For now, let's continue with the true challenge: taking down Lumerico Corp president Guillermo Portero. Why? Because he's a greedy and corrupt man, and an abominable thief. His plan of bringing in line the most powerful and biggest zigurat the 1st of november us nothing more than a deceit, an elaborate plan by his gang to become even more influential in the people of Mexico and get more money. And who's gonna pay for that? Common people, the ones that are always forgotten.<br />
<br />
I've started upgrading my protocols so that they are used to take down the Lumerico Corp infraestructure and Los Muertos are also trying to go against the corruption. Meanwhile, search the Lumerico Corp site for info we can use against the bastard, or better, get his username and password so that hundreds "not so favorable" facts about the president start popping up.<br />
<br />
I was able to get the username and pass of a Lumerico Corp employee, start here:<br />
<br />
GFlores/g#fNwP5qJ<br />
<br />
=== Presidential Login ===<br />
<br />
Using the credentials obtained through the message above on the https://lumerico.mx/login Lumerico login page], players accessed the account of Gonzalo Flores, including [https://lumerico.mx/email his emails]. Transcripts of these emails are archived [https://docs.google.com/spreadsheets/d/1zh7OU2dEOnD4X43ImvZBNpS75FLkj-rL75pXJ2l3TuQ/htmlview?sle=true# here].<br />
<br />
Here is the only email that held relevance to the ARG:<br />
<br />
<pre><br />
De:Valeria Valderrama<VValderama@lumerico.mx><br />
Para:Gonzalo Flores<GFlores@lumerico.mx><br />
Asunto:Página de Guillermo<br />
<br />
Hola, Gonzo:<br />
¿Puedes ver el tráfico de https://lumerico.mx/president-bypass? Guillermo debería ser el único accediendo desde su página de inicio privada, pero parece que está teniendo mucho tráfico. Tal vez tengamos que escalar esto a<br />
la señorita Jiménez, pero quiero estar segura de que es digno de su tiempo.<br />
<br />
Valeria Valderrama<br />
</pre><br />
<br />
The email references a lot of traffic to the [https://lumerico.mx/president-bypass President Bypass Link]. That page displays an "access denied" message, but there is a <code>President Auth-Bypass Revision 1.02: /.git/</code> line in the source code.<br />
<br />
This line led players to [https://github.com/internetwache/GitTools/tree/master/Dumper dump the data] from the [https://lumerico.mx/president-bypass/.git/ /.git/ subpage] with git protocol and upload it to [https://gist.github.com/anonymous/987beb6a5c817b53da820562854bdebe Github]. That were codebehind files for the website, including a '''class.authentication.php''' file containing an encryption function and '''class.president-bypass.php''' file containing the president's (Guillermo Portero) username <code>GPortero</code> and encrypted password <code>?MzY:MTI5:?AzY:OWM?:?EDO:ZGU?:jVTM:MTJm:2ITM:MTUw:?QjY:OWY?:?kTO:MTQx:?MzY</code>.<br />
<br />
ARG players with technical knowledge wrote a function that reversed the encryption from class.authentication.php and used it on the encrypted password. The resulting password was <code>Xy@4+Bkuqd<53uJ</code>.<br />
<br />
After logging in to the President's account, players were able to read his emails. After 30 minutes, another email appeared in the President's inbox, from Sombra herself:<br />
<br />
<pre><br />
Veo que se han podido infiltrar en su correo.<br />
No se preocupen, él no puede ver este correo, lo he ocultado de su vista si se conecta desde una de sus direcciones conocidas de IP.<br />
Necesito un poco más de tiempo para establecer el próximo grupo de potocolos. Manténganse atentos a principios de la otra semana. Le echaré unos cuantos trapitos sucios en sus correos para que se filtren al público<br />
"accidentalmente". Ya veremos como reaccionan los medios de comunicación.<br />
</pre><br />
<br />
The rough translation is:<br />
<br />
<pre><br />
I see you have been able to infiltrate into his mail.<br />
Don't worry, he cannot see this email, I've hidden it from his sight if he connects from one of his known IP addresses.<br />
I need a little bit of time to establish the next set of protocols. Stay alert early next week. I'll throw some dirty laundry in his emails that can "accidentally" leak to the public. We'll see how the media will react to that.<br />
</pre><br />
<br />
=== Admin Access ===<br />
<br />
[[File:Lumerico admin panel.png|thumbnail|right|The admin panel of the Lumerico site, only accessible by logging in as MJimenez]]<br />
<br />
On October 25, new emails were discovered in the GFlores account, but they had no immediate significance to the ARG. In addition, omnics.txt was updated:<br />
<br />
<pre><br />
Allow: Tzolk'in<br />
Allow: Imix ChikchanManik Imix ChikchanImixChikchanImix Manik Chikchan Imix Kimi Chikchan Chikchan Kimi ChikchanImixChikchanImix ChikchanKimi<br />
</pre><br />
<br />
Tzolk'in is the name of a [[Wikipedia:Maya calendar#Tzolk'in|Mayan Calendar]], and the second line was a series of animals from it in the Tzolk'in dialect. Imix stands for Day 1, Chikchan — 5, Manik — 7 and Kimi — 6. Turned into numbers, the string reads <code>1 57 1 5151 7 5 1 6 5 5 6 5151 56</code>. These digits turned into pictograms of [[Wikipedia:Maya numerals|Maya numerals]] (one by one, not numbers as a whole) written horizontally become <code>. -..- . -.-. ..- - . .- - - .- -.-. -.-</code> That is a morse code, which decodes to <code>EXECUTEATTACK</code>.<br />
<br />
This led us to https://lumerico.mx/EXECUTEATTACK/index.html, where the following text was discovered:<br />
<br />
<pre><br />
Ha llegado el momento. Esos correos expuestos la verdad sobre Portero, iniciado la revuelta, y hemos convencido a la gente de México a apoyar nuestra causa. Ahora es el momento para el golpe. Convertiremos su preciada inauguración el 1 de noviembre en un gran movimiento en su contra. Necesito que hagan una cosa:<br />
Consigan acceso al correo del jefa de seguridad y busquen alguna forma de ayudarme en el ataque. Es posible que lo vean contactando a Portero pronto. He cambiado su contraseña a: d0r*NuLw9<br />
</pre><br />
<br />
Translated to English:<br />
<br />
<pre><br />
The moment has come. These emails exposed the truth about Portero, initiated the revolt, and have convinced people of Mexico to support our cause. Now is the time to strike. Convert his precious inauguration on November 1 to a large movement against it. I need you to do one thing:<br />
Get access to the email security chief and seek some form of help in the attack. You may see her contacting Portero soon. I've changed her password: d0r*NuLw9<br />
</pre><br />
<br />
Logging in with the credentials <code>MJimenez / d0r*NuLw9</code> gave us access to the [https://lumerico.mx/admin admin panel] of Lumerico. Until 01 Nov. 2016 it stayed inactive and any command was answered with the same message saying the terminal disconnected.<br />
<br />
=== The Terminal ===<br />
Once the console became usable, players could type <code>help</code> to see a list of commands:<br />
<br />
'''override''' Engineer safety mode override<br />
'''help''' Provides help information about commands<br />
'''version''' Displays system version information<br />
'''about''' Displays information about the system<br />
'''grep''' Search output by string<br />
<br />
In the MJimenez email account, there was an email labeled <code>Corrupción de correo electrónico</code> with highlighted text in side of it, specifically <code>/ter/</code>. After some hard thinking, people discovered that doing <code>about | grep 'ter'</code> (in linux this is a command to list all the lines from the ''about'' that have a substring ''ter'') returns this text:<br />
<br />
'''Open''' source lightweight shell for any terminal.<br />
'''Anything''' with a terminal<br />
'''1.1.0''' - expanded terminal support<br />
<br />
The first word of every line given from the output was boldened and purple. Putting the words together, we got <code>OpenAnything1.1.0</code>, which was a solution which was used shortly.<br />
<br />
Another available command for the terminal was <code>override</code>. After typing <code>override</code>, the console prompted ARG players with three security questions:<br />
<br />
# '''Favorite Movie'''. The answer to the prompt is <code>some like it bot</code>, a movie from the Overwatch universe.<br />
# '''Favorite Cookie Flavor'''. The answer being <code>nuevas sabor delicias</code>, a flavor referenced in an email in the MJimenez account.<br />
# '''Secret'''. The answer to this prompt is <code>OpenAnything1.1.0</code>.<br />
<br />
This returned <code>OK</code>, gave players admin access, and enabled a new set of commands: <br />
<br />
'''ls''' Lists files by path<br />
'''cat''' Read file by path<br />
'''exec''' Execute a file <br />
<br />
Typing <code>ls</code> listed two files: <code>payload</code> and <code>d_ilqh_nhb.html</code> (the file name is a ROT23 for ''a_fine_key'').<br />
<br />
[[Image:A fine key.png|thumb|right|a_fine_key.html]] Reading the second file with <code>cat mnt/d_ilqh_nhb.html</code> yielded a text where ASCII characters (repeating string <code>vhnl tldv xyl vcxelo xv qhrtv. zkolg[nl]</code>) were in a shape of a key. Deciphering it using the Affine cipher (A=23, B=23) yielded the following string: <code>some keys are shaped as locks. index[me]</code>. It is assumed that ''some keys are shaped as locks'' line alluded to the [[#Tracer_Trail_Cipher|Tracer Trail]] ciphertext being used as a key.<br />
<br />
Simultaneously, entering <code>exec payload</code> presented players with a prompt — the answer to which is the [[#Tracer_Trail_Cipher|Tracer Trail]]. When inputted, players were given a message that looked quite similar to what was previously seen at amomentincrime.com. The counter shown in the top right is then incremented.<br />
<br />
[[Image:LumericoTerminalTracerEntered.jpg|850px]]<br />
<br />
=== Misdirection ===<br />
<br />
[[Image:LumericoHacked.jpg|thumb|right|lumerico.mx website hacked by Sombra]]<br />
<br />
On October 1, 2016, the lumerico.mx home page changed to show "glitches" and the black overlay with a message under the purple skull, while a string <code>&lt;!-- MISDIRECTION --></code> was also added to the source of the page.<br />
<br />
The message says: <br />
<br />
<pre><br />
Buen trabajo, amigos. No lo hubiera logrado sin su ayuda. En fin, me consiguieron los recursos que necesitaba para mi siguiente golpe – les encantará.<br />
Esperen noticias de mí en los próximos días...<br />
Les voy a mandar algo para agradecerles… Ojalá lo puedan aprovechar.<br />
Dasvidanya amigos<br />
</pre><br />
<br />
Translated:<br />
<br />
</pre><br />
Good job, folks. I would not have done it without your help. Anyway, I got the resources needed for my next hit - you'll love it.<br />
Expect to hear from me in the coming days...<br />
I'm going to send something to thank you ... Hopefully you can use it.<br />
Dasvidanya friends<br />
</pre><br />
<br />
[[File:Dia de los muertos spray.jpg|thumbnail|right|The Día de Los Muertos spray that was added to the game after Sombra hacked the Lumerico site]]<br />
<br />
Note that ''Dasvidanya'' is a phonetic transliteration of ''до свиданья'' — a russian phrase for "goodbye". The thing that Sombra sent as a ''thank you'' was a new spray, named "Día de Los Muertos" after the Mexican festival that took place at the same time as the ARG. The spray is currently only available on the PC version of the game.<br />
<br />
The '''MISDIRECTION''' string lead to the page [https://lumerico.mx/MISDIRECTION/index.html https://lumerico.mx/MISDIRECTION/index.html] containing:<br />
<br />
...Estableciendo conexiуn...<br />
...Protocolo Sombra v2.3 iniciado...<br />
<br />
...Desviando datos del zigurat de LumériCo hacia el objetivo...<br />
...Descifrando contraseсas del objetivo...<br />
...Acceso otorgado al directorio de volskayaindustries.com...<br />
<br />
...boop ;)...<br />
...Terminando conexión...<br />
<br />
Translated: <br />
<br />
...Establishing connection...<br />
...Sombra Protocol v2.3 initiated...<br />
<br />
...Forwarding the data from the LumériCo ziggurat to the target...<br />
...Deciphering the target passwords...<br />
...Access Granted to the directory of volskayaindustries.com...<br />
<br />
...boop ;)...<br />
...Ending connection..<br />
<br />
== Blizzcon ==<br />
<br />
Blizzcon 2016 opened with the [https://www.youtube.com/watch?v=Og5-Pm4HNlI Overwatch short "Infiltration"], a short depicting Reaper, Widowmaker, and Sombra on Volskaya Industries. During the showing of the short, Sombra's [https://playoverwatch.com/en-us/heroes/sombra hero page] went live, showcasing her abilities and character backstory.<br />
<br />
[[File:SombraBG.jpg|center|500px]]<br />
<br />
== References ==<br />
<br />
=== Community Resources ===<br />
<br />
A collection of tools and resources made by the Game Detectives Discord community for use in the ARG.<br />
<br />
==== ASCII Skull ====<br />
<br />
'''ASCII Skull Analysis:''' https://github.com/bahamas10/sombra<br />
<br />
'''Removing SOMBR@ Analysis:''' https://pastebin.com/15u27YTC<br />
<br />
'''ASCII Skull Eye Analysys:''' https://docs.google.com/spreadsheets/d/1-JQpWyitMKYhP-4l8ZDFiJI3NjqRrvoEnRdFQawike8<br />
<br />
==== Google Docs ====<br />
<br />
'''Observations and Speculations Spreadsheet:''' https://docs.google.com/spreadsheets/d/1rI08baFQmAwaqHC-9GF9VNGCYjuRE-q4LN9k4ottjuQ/pubhtml<br />
<br />
'''LumériCo Emails and Translations Spreadsheet:''' https://goo.gl/cQgdIJ (Courtesy of UberPilot)<br />
<br />
==== Tracer Code ====<br />
<br />
'''GOL! Guesser:''' https://axxim.net/ow/gol-guesser/<br />
<br />
'''Uber GOL! Guesser:''' https://axxim.net/ow/gol-guesser/uber/<br />
<br />
The Uber GOL! Guesser only prints out UTF-8 compliant results, which makes it easier to identify potentially correct answers.<br />
<br />
'''Bruteforcing tool:''' https://github.com/glv2/bruteforce-salted-openssl<br />
<br />
=== Third-Party Resources ===<br />
<br />
A collection of third-party tools and resources that the Game Detectives Discord community has used in the ARG.<br />
<br />
==== Image of Reaper ====<br />
<br />
'''stegdetect (Linux):''' https://github.com/abeluck/stegdetect<br />
<br />
stegdetect is a Linux utility used to determine if a given image may contain encoded information.<br />
<br />
'''JPHide & JPSeek:''' https://linux01.gwdg.de/~alatham/stego.html<br><br />
'''iSteg (Mac OSX):''' https://www.hanynet.com/isteg/<br />
<br />
JPHide & JPSeek is used to hide and find, respectively, a file inside a JPEG image.<br><br />
iSteg works similarly to JPHide on the Mac OSX platform.<br />
<br />
'''stegbreak (Linux):''' https://linux.die.net/man/1/stegbreak<br />
<br />
stegbreak is used to do brute-force dictionary attacks on JPEG images.<br />
<br />
=== Easter Eggs ===<br />
<br />
The following are collection of references and Easter Eggs encountered throughout the ARG.<br />
<br />
==== In-Game ====<br />
<br />
'''Sombra's "Amused" Emote'''<br />
<br />
This character emote features the [[Sombra_ARG_False_Leads | Skycode]], accompanied by soft music resembling the [https://www.reddit.com/r/Overwatch/comments/4w7ey1/the_sombra_skysong/ Skysong]. Sombra's expression is one of amusement, and it's a nod to the community's prolonged creative attempts to solving an nonexistent puzzle.<br />
<br />
[[File:EmoteSkycode.png|200px]]<br />
<br />
'''Skycode Spray'''<br />
<br />
This character spray features Sombra's iconic skull in front of a compass rose and the [[Sombra_ARG_False_Leads | Skycode]]. This is a reference to both the [[#Directions_&_Letters|cardinal directions]] used in one of the puzzles and to the Skycode, which is considered the most significant false lead that solvers encountered.<br />
<br />
[[File:SkycodeSpray.png|200px]]<br />
<br />
==== In-ARG ====<br />
<br />
'''Espresso Command'''<br />
<br />
There was a hidden command in LumériCo's [[#The_Terminal | admin terminal]]. Inputting the word <code>espresso</code> returned the following message: <code>Coffee Pot Status: Brewed approximately 23 hours ago, currently 0% full</code><br />
This is referencing a variety of [https://goo.gl/cQgdIJ emails] found in the LumériCo site involving broken espresso machines and incompetent coffee brewing, which caught the attention of the community and gave way to a vast variety of mediocre jokes. Furthermore, "23 hours" makes reference to the number 23, which was believed by many to possess some sort of significance to the ARG, as Sombra would be the 23rd character in Overwatch. Finally, "0%" references the ARG's notable waiting periods that have been widely criticized by the community, specifically [[#A_Moment_in_Crime_Transmission | A Moment in Crime's upload percentage]].<br />
Due to the iconic purple text it is believed that this hidden command was created by Sombra herself.<br />
<br />
[[File:EspressoCommand.png]]<br />
<br />
=== Media Appearances ===<br />
<br />
'''3rd Aug. 2016'''<br />
<br />
[EN] [https://kotaku.com/overwatch-fans-find-new-clues-about-the-mysterious-hero-1784767759 Kotaku - Overwatch Fans Find New Clues About The Mysterious Hero Sombra]<br />
<br />
[EN] [https://www.polygon.com/2016/8/3/12369144/overwatch-summer-games-sombra-arg-blizzard?utm_campaign=polygon&utm_content=chorus&utm_medium=social&utm_source=twitter Polygon - Overwatch fans are trying to crack the latest mystery about Sombra]<br />
<br />
[EN] [https://www.pcgamesn.com/overwatch/overwatch-sombra PCGamesN - Overwatch's Sombra ARG continues with new clues, but no solutions]<br />
<br />
[EN] [https://team-dignitas.net/articles/blogs/overwatch/9989/who-is-sombra-all-facts-and-clues-about-sombra Team-Dignitas - Who is Sombra? All facts and clues about Sombra]<br />
<br />
[FR] [https://overwatch.gamewave.fr/un-nouveau-code-cache-dans-la-derniere-cinematique-d-overwatch/ Gamewave - UN NOUVEAU CODE CACHÉ DANS LA DERNIÈRE CINÉMATIQUE D'OVERWATCH!]<br />
<br />
[EN] [https://www.follownews.com/overwatch-fans-find-new-clues-about-the-mysterious-hero-sombra-1nhqt FollowNews - Overwatch Fans Find New Clues About The Mysterious Hero Sombra]<br />
<br />
'''4th Aug. 2016'''<br />
<br />
[EN] [https://www.pcgamer.com/overwatch-summer-games-trailer-hides-a-mysterious-secret/ PCGamer - Overwatch Summer Games trailer hides a mysterious secret]<br />
<br />
[SK] [https://www.sector.sk/novinka/121273/nove-overwatch-video-obsahuje-dalsie-tajomstva.htm Sector - Nové Overwatch video obsahuje ďalšie tajomstvá]<br />
<br />
[EN] [https://www.techinsider.io/overwatch-sombra-character-2016-8 Techinsider - 'Overwatch' players are going to insane lengths to solve a mystery that Blizzard's teased for months]<br />
<br />
[EN] [https://gamerant.com/overwatch-sombra-clues/ Gamerant - Overwatch Players Uncover More ‘Sombra’ Clues]<br />
<br />
[HU] [https://www.gamestar.hu/hir/overwatch-sombra-karakter-214739.html Gamestar - Overwatch - újabb nyomok utalnak a még be nem jelentett hősre]<br />
<br />
'''5th Aug. 2016'''<br />
<br />
[EN] [https://kotaku.com/days-later-overwatch-fans-cant-figure-out-the-sky-cod-1784872143 Kotaku - Days Later, Overwatch Fans Can't Figure Out The 'Sky Code' Mystery]<br />
<br />
[NL] [https://www.gamersnet.nl/nieuws/201608/cryptische_speurtocht_naar_overwatch_nieuwe_heldin_sombra_gaat_bizar_diep/ Gamersnet - Cryptische speurtocht naar Overwatch' nieuwe heldin Sombra gaat bizar diep]<br />
<br />
[ES] [https://www.alfabetajuega.com/noticia/overwatch-el-enigma-de-sombra-sigue-ofreciendo-nuevos-detalles-n-71772 Alfa Beta Jeuga - Overwatch: El enigma de Sombra sigue ofreciendo nuevos detalles]<br />
<br />
[EN] [https://www.youtube.com/watch?v=5ROjN-_F0ZU&feature=youtu.be&t=4m22s IGN (Video) - Sombra: Overwatch's Secret New Hero - Overwatch HQ]<br />
<br />
'''7th Aug. 2016'''<br />
<br />
[EN] [https://www.gamespresso.com/2016/08/summary-state-sombras-arg-overwatch/ Gamespresso - Summary of the state of sombra's ARG in Overwatch]<br />
<br />
'''8th Aug. 2016'''<br />
<br />
[EN/CN] [https://www.zhentoo.com/doc92368 Zhentoo - Overwatch new hero Secret Dorado hidden mystery] <br />
<br />
[EN] [https://www.technewstoday.com/30880-overwatch-sombra-continues-to-elude-detectives/ TechNewsToday - Overwatch: Sombra Continues to Elude Detectives]<br />
<br />
'''11th Aug. 2016'''<br />
<br />
[EN] [https://www.youtube.com/watch?v=IZR-pa0it4Q The Know - New Overwatch Hero Hints]<br />
<br />
'''12th Aug. 2016'''<br />
<br />
[EN] [https://kotaku.com/after-two-weeks-overwatch-fans-sombra-investigation-re-1785204389 Kotaku - Overwatch Fans' Sombra Investigation Reaps A Skull Code]<br />
<br />
'''14th Aug. 2016'''<br />
<br />
[EN] [https://gamerant.com/overwatch-sombra-skull-code/ Gamerant - Skull Code is Latest Clue in Overwatch’s Sombra Investigation]<br />
<br />
'''16th Aug. 2016'''<br />
<br />
[EN] [https://www.christiantoday.com/article/overwatch.dlc.update.skull.code.the.latest.clue.for.sombra.investigation/93197.htm Christian Today - 'Overwatch' DLC update: Skull Code the latest clue for Sombra investigation]<br />
<br />
[EN] [https://en.yibada.com/articles/151811/20160816/overwatch-dlc-update.htm Yibada - 'Overwatch' DLC update: New clues on Sombra's inclusion to the roster revealed]<br />
<br />
'''23rd Aug. 2016'''<br />
<br />
[EN] [https://www.technewstoday.com/31129-overwatch-all-we-know-about-the-sombra-arg/ Tech News Today - Overwatch: All We Know About the Sombra ARG]<br />
<br />
'''24th Aug. 2016'''<br />
<br />
[EN] [https://gamerant.com/overwatch-forums-sombra-message/ Gamerant - Overwatch Forums Glitch Out, Reveals Hidden Message From Sombra]<br />
<br />
[EN] [https://gamerant.com/overwatch-sombra-clue-website/ Gamerant - New Website Counts Down To Next Clue For Overwatch’s Sombra]<br />
<br />
[EN] [https://www.polygon.com/2016/8/24/12623736/overwatch-sombra-arg-clues-skycoder Polygon - Overwatch's Sombra mystery appears to be coming to a close]<br />
<br />
[EN] [https://www.vg247.com/2016/08/24/overwatch-forums-glitch-out-reveal-a-message-from-the-mysterious-sombra/ VG247 - Overwatch forums glitch out, reveal a message from the mysterious Sombra]<br />
<br />
[EN] [https://www.technewstoday.com/31151-sombra-hacks-into-overwatch-forums/ Tech News Today - Sombra Hacks Into Overwatch Forums]<br />
<br />
[EN] [https://www.ign.com/articles/2016/08/24/overwatch-mystery-character-sombra-could-be-revealed-today IGN - Overwatch Mystery Character Sombra Could Be Revealed Today]<br />
<br />
'''25th Aug. 2016'''<br />
<br />
[EN] [https://kotaku.com/overwatch-players-are-getting-fed-up-with-the-sombra-ar-1785765307 Kotaku - Overwatch Players Are Getting Sick Of The Sombra ARG]<br />
<br />
[EN] [https://www.ign.com/articles/2016/08/25/overwatch-made-the-internet-lose-its-mind-last-night-and-i-had-a-front-row-seat IGN - Overwatch Made the Internet Lose its Mind Last Night, And I Had a Front-Row Seat]<br />
<br />
[EN] [https://www.technewstoday.com/31182-overwatch-countdown-to-sombra/ Tech News Today - Overwatch: Countdown to Sombra]<br />
<br />
<br />
'''30th Aug. 2016'''<br />
<br />
[EN] [https://www.pcgamer.com/overwatch-sombra-arg-mystery/ PC Gamer - Overwatch's Sombra riddle begins to irritate the players trying to solve it]<br />
<br />
'''3rd Oct. 2016'''<br />
<br />
[EN] [https://www.mobilenapps.com/articles/19398/20161003/overwatch-update-sombra-blizzcon-halloween-event-leak.htm Mobile & Apps - Sombra To Be Revealed At Blizzcon? Halloween Event Confirmed In Data Leak]<br />
<br />
'''4th Oct. 2016'''<br />
<br />
[EN] [https://www.itechpost.com/articles/36011/20161004/overwatch-overwatch-update-overwatch-finally-getting-sombra-overwatch-sombra-sombra.htm iTechPost - Overwatch Update: Are We Finally Getting Sombra?]<br />
<br />
'''11th Oct. 2016'''<br />
<br />
[EN] [https://www.kotaku.com.au/2016/10/overwatch-fans-hacked-actual-people-in-an-attempt-to-find-sombra/ Kotaku - Overwatch Fans Hacked Actual People In An Attempt To Find Sombra]<br />
<br />
'''17th Oct. 2016'''<br />
<br />
[EN] [https://telkomgaming.co.za/will-sombra-hack-her-way-into-blizzcon-2016/ TelKom Gaming - Will Sombra Hack Her Way Into BlizzCon 2016?]<br />
<br />
'''18th Oct. 2016'''<br />
<br />
[EN] [https://overwatchtips.info/overwatch-sombra-arg-everything-you-need-to-know/ OverwatchTips - Everything You NEED To Know (Sombra ARG)]<br />
<br />
'''26th Oct. 2016'''<br />
<br />
[EN] [https://mic.com/articles/157757/overwatch-sombra-arg-everything-we-know-about-the-countdown-and-rumored-nov-1-release#.UILrZHRiM Min Network - Everything we know about Blizzard's rumored Nov. 1 release]<br />
<br />
'''28th Oct. 2016'''<br />
<br />
[EN] [https://kotaku.com/imagining-horror-stories-for-a-never-ending-overwatch-a-1788324673 Kotaku - Imagining Horror Stories Of A Never-Ending Overwatch ARG]<br />
<br />
'''1st Nov. 2016'''<br />
<br />
[EN] [https://www.ign.com/videos/2016/11/01/will-overwatchs-sombra-be-at-blizzcon-2016 IGN - Will Sombra be at BlizzCon 2016?]<br />
<br />
'''8th Nov. 2016'''<br />
<br />
[EN] [https://mic.com/articles/158812/overwatch-sombra-arg-gameplay-emote-directly-references-one-of-the-wildest-fan-theories Mic Tech - 'Overwatch' Sombra ARG: Gameplay emote directly references one of the wildest fan theories]</div>Halke234https://wiki.gamedetectives.net/index.php?title=Sombra_ARG&diff=16616Sombra ARG2018-07-23T23:45:57Z<p>Halke234: /* The Hacked Bastion */</p>
<hr />
<div>{{argbox<br />
| float = right<br />
| name = Sombra ARG<br />
| image = File:Sombra_skull.png<br />
| description= The Sombra ARG - an ARG involving an unreleased Overwatch hero.<br />
| creator = [https://www.blizzard.com/ Blizzard Entertainment]<br />
| type = Official<br />
| status = Completed<br />
| discovered = 2016-06-12<br />
| completed = 2016-11-04<br />
}}<br />
<br />
{{ArgHeader|arg=Sombra ARG}}<br />
The Sombra ARG was an ARG for the first-person shooter [https://www.playoverwatch.com Overwatch], developed by [https://www.blizzard.com/ Blizzard Entertainment]. Sombra was the name of a then-unreleased Overwatch hero. The ARG was comprised of clues and ciphers referencing Sombra, which were found in various developer updates and short animations.<br />
<br />
At the game's release, there were numerous pieces of in-game information that appeared in the map Dorado, hinting at a character called Sombra. When the hero Ana was revealed, more Sombra clues appeared in Ana's origin video. In the weeks that followed, more clues were discovered, which led up to a character reveal animation at BlizzCon 2016.<br />
<br />
== Ana Videos ==<br />
<br />
=== Ana Origin Video ===<br />
<br />
On July 12, 2016, a [https://www.youtube.com/watch?v=TE0CXgpNxG0 video] for the new Overwatch hero named Ana was released. At the 1:16 mark, players discovered a set of hexidecmial values:<br />
<br />
[[File:Ana_Hex2.png|400px]]<br />
<br />
<pre><br />
2E 2E 2E 7B 76 20 66 62 72 20 63 7E 72 79 72 20 7B 76 20 7E<br />
79 71 78 65 7A 76 74 7E D4 A4 79 2C 20 63 7E 72 79 72 20 72<br />
7B 20 67 78 73 72 65 2E 2E 2E 7B 76 20 66 62 72 20 63 7E 72<br />
79 72 20 7B 76 20 7E 79 71 78 65 7A 76 74 7E D4 A4 79 2C 20<br />
63 7E 72 79 72 20 72 7B 20 67 78 73 72 65 2E 2E 2E 7B 76 20<br />
66 62 72 20 63 7E 72 79 72 20 7B 76 20 7E 79 71 78 65 7A 76<br />
74 7E D4 A4 79 2C 20 63 7E 72 79 72 20 72 7B 20 67 78 73 72<br />
65 2E 2E 2E 7B 76 20 66 62 72 20 63 7E 72 79 72 20 7B 76 20<br />
7E 79 71 78 65 7A 76 74 7E D4 A4 79 2C 20 63 7E 72 79 72 20<br />
72 7B 20 67 78 73 72 65 2E 2E 2E 64 78 7A 75<br />
</pre><br />
<br />
A hex to ASCII translation yielded the following:<br />
<br />
<pre><br />
...{v fbr c~ryr {v ~yqxezvt~Ô¤y, c~ryr r{ gxsre...{v fbr c~ryr {v ~yqxezvt~Ô¤y, c~ryr r{ gxsre...{v fbr c~ryr {v ~yqxezvt~Ô¤y, c~ryr r{ gxsre...{v fbr <br />
c~ryr {v ~yqxezvt~Ô¤y, c~ryr r{ gxsre...dxzu<br />
</pre><br />
<br />
Using an XOR Cipher with the constant 23 on the above text resulted in the following message:<br />
<br />
<pre><br />
..la que tiene la información; tiene el poder...la que tiene la información; tiene el poder...la que tiene la información; tiene el poder...la que tiene la <br />
información; tiene el poder...somb<br />
</pre><br />
<br />
This was a repeating phrase in Spanish, which translated to:<br />
<br />
<pre><br />
She who has the information, has the power...<br />
</pre><br />
<br />
Players then discovered a second set of hexidecimal values at the 2:11 mark:<br />
<br />
[[File:Ana Hex.png|400px]]<br />
<br />
<pre><br />
65 76 2E 2E 2E 7B 76 20 66 62 72 20 63 7E 72 79 72 20 7B 76<br />
20 7E 79 71 78 65 7A 76 74 7E D4 A4 79 2C 20 63 7E 72 79 72<br />
20 72 7B 20 67 78 73 72 65 2E 2E 2E 7B 76 20 66 62 72 20 63<br />
7E 72 79 72 20 7B 76 20 7E 79 71 78 65 7A 76 74 7E D4 A4 79<br />
2C 20 63 7E 72 79 72 20 72 7B 20 67 78 73 72 65 2E 2E 2E 7B<br />
76 20 66 62 72 20 63 7E 72 79 72 20 7B 76 20 7E 79 71 78 65<br />
7A 76 74 7E D4 A4 79 2C 20 63 7E 72 79 72 20 72 7B 20 67 78<br />
73 72 65 2E 2E 2E 7B 76 20 66 62 72 20 63 7E 72 79 72 20 7B<br />
76 20 7E 79 71 78 65 7A 76 74 7E D4 A4 79 2C 20 63 7E 72 79<br />
72 20 72 7B 20 67 78 73 72 65 2E 2E 2E<br />
</pre><br />
<br />
When put through the same process, the same string of Spanish was revealed, but with the letters <code>ra</code> at the beginning of the message. These letters were combined with <code>somb</code> from the first cipher to create the name <code>sombra</code>. No more clues were discovered until the release of the Dev Update video.<br />
<br />
=== Dev Update Video ===<br />
<br />
[[File:Sombra Barcodes.png|thumbnail|right|The vertical barcodes found at the end of the Ana Dev Update video]]<br />
<br />
On July 19, 2016, the first [https://www.youtube.com/watch?v=evghkilg2eQ Developer Update] was released for Ana. At the end of the video, players discovered a series of vertical barcodes. When scanned, players discovered a large set of hexidecimal values which where then converted to binary, a dump of which is available [https://gist.github.com/zapu/31165efab0d6264e2fd0fa75cc53b1aa here].<br />
<br />
Turning the ones and zeroes into black and white pixels formed a QR code:<br />
<br />
[[File:Sombra_QR_code.png|300px]]<br />
<br />
Scanning this QR code yielded the following message: <code>¿Estuvo eso facilito? Ahora que tengo su atención, déjenme se las pongo más difícil.</code> In English, the message reads: <code>Was that easy? Well, now that I have your attention, allow me to make things much more difficult.</code> After this, no more clues were discovered until the Summer Games video was released.<br />
<br />
== Welcome to the Summer Games Video ==<br />
<br />
=== Tracer Trail Cipher ===<br />
<br />
[[File:Base64_trail.jpg|thumbnail|right|The unsolved base64 cipher in the Summer Games video]]<br />
<br />
'''Note: The cipher described below remains unsolved.'''<br />
<br />
On August 2, 2016, players discovered another cipher in the [https://www.youtube.com/watch?v=qpcOD9tJM4k Welcome to the Summer Games trailer]:<br />
<br />
<pre><br />
U2FsdGVkX1+vupppZksvRf5pq5g5XjFRIipRkwB0K1Y96Qsv2L<br />
m+31cmzaAILwytX/z66ZVWEQM/ccf1g+9m5Ubu1+sit+A9cenD<br />
xxqkIaxbm4cMeh2oKhqIHhdaBKOi6XX2XDWpa6+P5o9MQw==<br />
</pre><br />
<br />
Players discovered this text to be base64 encryption. When decrypted, players received the following output:<br />
<br />
<pre><br />
Salted__���ifK/E�i��9^1Q�*Q�t+V=�<br />
/ع��W/<br />
�_����V��?q����f�F���"��=q�������[��<br />
z��*����Z����u�\5�k�C<br />
</pre><br />
<br />
''(Note: copy/pasting this string will not work; some of the characters are not printable and are not even displayed correctly on this page)''<br />
<br />
==== Decrypting the Cipher ====<br />
<br />
The "Salted__" header at the start of the string indicated to players that the remainder of the text was encrypted with the OpenSSL software library, which requires a password and the encryption cipher that was used. Salt is added by OpenSSL to ensure uniqueness of the key and the IV derived from the password and used for the encryption. However, due to the age of OpenSSL and its massive library, it was proven to be quite difficult for players to identify the encryption used.<br />
<br />
==== Narrowing Down Ciphers ====<br />
<br />
[[File:HexOfEncryptedMessage.png|thumbnail|right|Hex view of the encrypted string]]<br />
<br />
Players narrowed down the potential ciphers used by examining a hex dump of the encrypted string. There are two major types of ciphers, stream ciphers and block ciphers. Stream ciphers encrypt only the data fed into them, whereas block ciphers always encrypt a certain number of bytes at a time (a "chunk").<br />
<br />
A byte is roughly a single character, but special characters can take up multiple bytes. We know that OpenSSL Salted Encryption uses the first 8 bytes of the output for <code>Salted__</code> and the next 8 bytes for the actual salt. The rest of the information is the '''encrypted message'''.<br />
<br />
The immediately interesting thing here is that the '''encrypted message''' data stops 3 bytes short of a full chunk. This is a excellent indicator that the cipher used is a stream cipher (or a block cipher in CTR/OFB/CFB mode). This narrows the list of potential ciphers down significantly. This also means that the final string that Blizzard encrypted is less than 93 bytes!<br />
<br />
'''This cipher remains unsolved, but it's speculated that Blizzard moved past the cipher by creating alternate puzzles.'''<br />
<br />
=== Directions & Letters ===<br />
<br />
Players discovered that in the North American version of the Summer Games trailer there were repeated references to the cardinal directions, each associated with a particular hero. These references were conspicuously absent from other versions of the trailer. These references are shown below, with the relevant heroes and timestamps:<br />
<br />
<gallery mode="packed"><br />
File:Ow1.png|East - Mercy - Route 66 - 0:17<br />
File:Ow2.png|Center - D. Va - Temple of Anubis - 0:19<br />
File:Ow3.png|North - Torbjorn - Nepal - 0:21<br />
File:Ow4.png|South - Genji - Hanamura - 0:22<br />
File:Ow5.png|Southeast - McCree - Hollywood - 0:24<br />
File:Ow6.png|West - Symmetra - Watchpoint: Gibraltar - 0:30<br />
File:Ow7.png|Southwest - Bastion - Hollywood - 0:34<br />
File:Ow8.png|Northeast - Winston - Volskaya Industries - 0:46<br />
File:Ow9.png|Northwest - Tracer - King's Row - 0:47<br />
</gallery><br />
<br />
Screenshots of all the directions and their respective heroes can be found in an album [https://imgur.com/a/FQXmy here].<br />
<br />
[[File:Overwatch map.jpg|frameless]]<br />
<br />
These heroes, arranged in this particular order, provided a password that was used later in the ARG.<br />
<br />
== Dorado Photo ==<br />
<br />
At an unknown date, a new, "corrupted" photo of the [https://blzgdapipro-a.akamaihd.net/media/screenshot/dorado-screenshot-004.jpg Dorado attackers spawn point] was added to the Overwatch [https://playoverwatch.com/en-us/media/ media page]. Players discovered that the screenshot was "'''datamoshed'''", which means it concealed a hidden message while also taking on a distorted appearance. ([https://prntscr.com/c3dce7 Here] is an example of purposely data moshing the image manually to achieve similar effects.) <br />
<br />
<gallery mode="packed" heights=500px><br />
File:dorado-datamosh.jpg|The datamoshed image<br />
File:dorado-screenshot-005.jpg|The original image<br />
</gallery><br />
<br />
After comparing the images with difference checking tools, players found that certain English and Spanish characters were replaced with exclamation points. The missing characters produced the following Spanish phrase:<br />
<br />
<code>Por que estan mirando al cielo? La respuesta no esta sobre sus cabezas, esta detras de ustedes. A veces, necesitan analizar sus logros previos.</code><br />
<br />
Translated into English, this phrase read:<br />
<br />
<code>Why are you looking at the sky? The answer isn't over your heads, it's behind you. Sometimes, you need to analyze your previous achievements.</code><br />
<br />
The phrase "Why are you looking at the sky?" was most likely a reference to a strange artifact that was discovered in the sky of the Dorado map, dubbed the "Skycode". The Skycode ended up being a red herring, and was completely unrelated to the ARG.<br />
<br />
=== Analyzing Achievements ===<br />
<br />
[[File:achievements.png|thumbnail|right|"¿" Achievement, comment in source code]]<br />
<br />
The phrase "you need to analyze your previous achievements" led players to look at the achievements on the [https://www.playoverwatch.com Overwatch] website. It was noticed noticed that by logging in and viewing the achievements on a player profile, a mystery achievement appeared. Examining a hex dump of the image lead players to a new phrase:<br />
<br />
<pre><br />
Vientos, nada mal. No obstante, me aburro. Intentemos algo nuevo en la misma dirección.<br />
uczihriwgsxorxwunaarawryqhbrsfmeqrjjmu 5552E494 78T3 4VM9 OPL6 IS8208O913KRlrx<br />
</pre><br />
<br />
Translated, it said:<br />
<br />
<pre><br />
Damn, not bad. However, I'm getting bored. Let's try something new in the same direction.<br />
uczihriwgsxorxwunaarawryqhbrsfmeqrjjmu 5552E494 78T3 4VM9 OPL6 IS8208O913KRlrx<br />
</pre><br />
<br />
== Volskaya Datamosh ==<br />
<br />
After a long period of toying around, players discovered that the ciphertext <code> uczihriwgsxorxwunaarawryqhbrsfmeqrjjmu 5552E494 78T3 4VM9 OPL6 IS8208O913KRlrx</code> from the "?" achievement was a Vigenére cipher. Players discovered the key <code>tracertorbjornwinstonsymmetradvamercybastiongenjimccree</code> by ordering the heroes in the Summer Games trailer by the cardinal directions associated with each of them, as said further above. Once decoded, players received the following text: <br />
<pre>blzgdapiproaakamaihdnetmediascreenshot 5552E494 78B3 4CE9 ACF6 EF8208F913CFjpg</pre><br />
<br />
Players found this to be a [https://blzgdapipro-a.akamaihd.net/media/screenshot/5552E494-78B3-4CE9-ACF6-EF8208F913CF.jpg blzgdapipro-a.akamaihd.net/media/screenshot/5552E494-78B3-4CE9-ACF6-EF8208F913CF.jpg URL], which led players to a datamoshed screenshot of the Volskaya Industries map. ''(Editor's note: This link appears to now be dead)''. When players ran a difference check with the [https://blzgdapipro-a.akamaihd.net/media/screenshot/volskaya-screenshot-004.jpg original image], they received an interesting message.<br />
<br />
<gallery mode="packed"><br />
File:volskaya-datamosh.jpg|The datamoshed image<br />
File:Volskaya-screenshot-004.jpg|The original image<br />
</gallery><br />
<br />
=== ASCII Skull #1 ===<br />
<br />
The diff from the datamoshed image resulted in the following output:<br />
<br />
<pre><br />
Parece que te gustan estos jueguitos... por que no jugamos uno de verdad?<br />
:PB@Bk:<br />
,jB@@B@B@B@BBL.<br />
7G@B@B@BMMMMMB@B@B@Nr<br />
:kB@B@@@MMOMOMOMOMMMM@B@B@B1,<br />
:5@B@B@B@BBMMOMOMOMOMOMOMM@@@B@B@BBu.<br />
70@@@B@B@B@BXBBOMOMOMOMOMOMMBMPB@B@B@B@B@Nr<br />
G@@@BJ iB@B@@ OBMOMOMOMOMOMOM@2 B@B@B. EB@B@S<br />
@@BM@GJBU. iSuB@OMOMOMOMOMOMM@OU1: .kBLM@M@B@<br />
B@MMB@B 7@BBMMOMOMOMOMOBB@: B@BMM@B<br />
@@@B@B 7@@@MMOMOMOMM@B@: @@B@B@<br />
@@OLB. BNB@MMOMOMM@BEB rBjM@B<br />
@@ @ M OBOMOMM@q M .@ @@<br />
@@OvB B:u@MMOMOMMBJiB .BvM@B<br />
@B@B@J 0@B@MMOMOMOMB@B@u q@@@B@<br />
B@MBB@v G@@BMMMMMMMMMMMBB@5 F@BMM@B<br />
@BBM@BPNi LMEB@OMMMM@B@MMOMM@BZM7 rEqB@MBB@<br />
B@@@BM B@B@B qBMOMB@B@B@BMOMBL B@B@B @B@B@M<br />
J@@@@PB@B@B@B7G@OMBB. ,@MMM@qLB@B@@@BqB@BBv<br />
iGB@,i0@M@B@MMO@E : M@OMM@@@B@Pii@@N:<br />
. B@M@B@MMM@B@B@B@MMM@@@M@B<br />
@B@B.i@MBB@B@B@@BM@::B@B@<br />
B@@@ .B@B.:@B@ :B@B @B@O<br />
:0 r@B@ B@@ .@B@: P:<br />
vMB :@B@ :BO7<br />
,B@B<br />
</pre><br />
<br />
'''Translation:'''<br />
<br />
<pre><br />
"It seems you like these little games... Why don't we play a real one?"<br />
</pre><br />
<br />
(''This is the python2 script to extract modified bytes from datamoshed Volskaya screenshot: https://gist.github.com/synap5e/27635d2ff6f0e3b15f0c902dca2974a9'')<br />
<br />
No further progress was made until August 23, 2016.<br />
<br />
== Overwatch Forums Glitching Page/ "Skycoder" ==<br />
<br />
On August 23rd, 2016, at an unknown time, an [https://us.battle.net/forums/en/overwatch/topic/20748794686 ominous post] by a user named "Skycoder" appeared on the official General Discussion forums for Overwatch. <br />
<br />
Players found that the name of the post, <code>00110010 00110011</code>, was binary for "23," which was a direct reference to Sombra being the 23rd hero in Overwatch. The age of the post started at 24 hours, and counted down rather than increasing. The post itself contained a single sentence in Spanish:<br />
<br />
<pre><br />
la que tiene la información; tiene el poder<br />
</pre><br />
<br />
Which, when translated to english, reads:<br />
<br />
<pre><br />
She who has the information, has the power.<br />
</pre><br />
<br />
After a short while, the post glitched and distorted, gradually turning a hue of purple. A text box then appeared, which printed the following ciphertext:<br />
<br />
<pre><br />
ICAgICAgICAgICAgICAgICAgICAgICAgICA6UEKPQms6CiAgICAgICAg<br />
ICAgICAgICAgICAgICAsakKIQEJAQkBCQEJCTC4KICAgICAgICAgICAg<br />
ICAgICAgIDdHlkKTQpVCTU1NTU1CQEJAQkBOcgogICAgICAgICAgICAg<br />
ICA6a0KSQpCIl01NT01PTU9NT01NTU2MQphCQEIxLAogICAgICAgICAg<br />
IDo1kUKNQphCiEJCTU1PTU9NT01PTU9NT01NipJuQm5CQEJCdS4KICAg<br />
ICAgICA3MG6GlUKIQpJClEJYQkJPTU9NT01PTU9NT01NQk1QQphCiEJA<br />
QkBCQE5yCiAgICAgIEeYlpdCSiBpQohCh4ggIE9CTU9NT01PTU9NT01P<br />
TZYyICBCj0JAQi4gRUJAQkBTCiAgICAgIJKWQk2HR0pCVS4gIGlTdUKI<br />
T01PTU9NT01PTU9NTZdPVTE6ICAua0JMTYhNhkKXCiAgICAgIEKMTU1C<br />
mUIgICAgICAgN4hCQk1NT01PTU9NT01PQkKWOiAgICAgICBCh0JNTYhC<br />
CiAgICAgII2YiEKKQiAgICAgICAgIDeSlkBNTU9NT01PTU1AQkA6ICAg<br />
ICAgICAgQEBCQEJACiAgICAgII+ST0xCLiAgICAgICAgICBCTkKPTU1P<br />
TU9NTY9CRUIgICAgICAgICAgckJqTYRCCiAgICAgIJBAICBAICAgICAg<br />
ICAgICBNICBPQk9NT01NQHEgIE0gICAgICAgICAgLkAgIEBACiAgICAg<br />
IISVT3ZCICAgICAgICAgICBCOnWMTU1PTU9NTUJKaUIgICAgICAgICAg<br />
LkJ2TUBCCiAgICAgIIRCkUKYSiAgICAgICAgIDCRQpdNTU9NT01PTUKV<br />
QkB1ICAgICAgICAgcUBAQEJACiAgICAgIEKETUJCjHYgICAgICAgR4+L<br />
Qk1NTU1NTU1NTU1NQkKINSAgICAgICBGhEJNTUBCCiAgICAgIIdCQk1/<br />
QlBOaSAgIExNRUKFT01NTU2PQoNNTU9NTYpCWk03ICAgckVxQodNQkKE<br />
CiAgICAgIEKYloRCTSAgQm1ChEIgIHFCTU9NQpBChUKEQk1PTUJMICBC<br />
QEJAQiAgQEJAQkBNCiAgICAgICBKlm2GhFBCj0KEQplCN0eIT01CQi4g<br />
ICAsQE1NTUBxTEJAQkBAQEJxQkBCQnYKICAgICAgICAgIGlHQpUsaTCE<br />
TZZCbk1NT4tFICA6ICBNQE9NTUBAQEJAUGlpQEBOOgogICAgICAgICAg<br />
ICAgLiAgIEKXTZBCj01NTUBCQEJAQkBNTU1AQEBNQEIKICAgICAgICAg<br />
ICAgICAgICBAQkBCLmlATUJCQEJAQkBAQk1AOjpCQEJACiAgICAgICAg<br />
ICAgICAgICAgQkBAQCAuQkBCLjpAQkAgOkJAQiAgQEJATwogICAgICAg<br />
ICAgICAgICAgICAgOjAgckBCQCAgQkBAIC5AQkA6IFA6CiAgICAgICAg<br />
ICAgICAgICAgICAgICAgdk1CIDpAQkAgOkJPNwogICAgICAgICAgICAg<br />
ICAgICAgICAgICAgICAsQkBCCg==<br />
</pre><br />
<br />
=== ASCII Skull #2 ===<br />
<br />
Players discovered that this was Base64 and, once decrypted, resulted in another ASCII skull:<br />
<br />
<pre><br />
:PB.Bk: <br />
,jBˆ@B@B@B@BBL. <br />
7G–B“B•BMMMMMB@B@B@Nr <br />
:kB’B.ˆ—MMOMOMOMOMMMMŒB˜B@B1, <br />
:5‘B.B˜BˆBBMMOMOMOMOMOMOMMŠ’nBnB@BBu. <br />
70n†•BˆB’B”BXBBOMOMOMOMOMOMMBMPB˜BˆB@B@B@Nr <br />
G˜–—BJ iBˆB‡ˆ OBMOMOMOMOMOMOM–2 B.B@B. EB@B@S <br />
’–BM‡GJBU. iSuBˆOMOMOMOMOMOMM—OU1: .kBLMˆM†B— <br />
BŒMMB™B 7ˆBBMMOMOMOMOMOBB–: B‡BMMˆB <br />
.˜ˆBŠB 7’–@MMOMOMOMM@B@: @@B@B@ <br />
.’OLB. BNB.MMOMOMM.BEB rBjM„B <br />
.@ @ M OBOMOMM@q M .@ @@ <br />
„•OvB B:uŒMMOMOMMBJiB .BvM@B <br />
„B‘B˜J 0‘B—MMOMOMOMB•B@u q@@@B@ <br />
B„MBBŒv G.‹BMMMMMMMMMMMBBˆ5 F„BMM@B <br />
‡BBM.BPNi LMEB…OMMMM.BƒMMOMMŠBZM7 rEqB‡MBB„ <br />
B˜–„BM BmB„B qBMOMB.B…B„BMOMBL B@B@B @B@B@M <br />
J–m†„PB.B„B™B7GˆOMBB. ,@MMM@qLB@B@@@BqB@BBv <br />
iGB•,i0„M–BnMMO‹E : M@OMM@@@B@Pii@@N: <br />
. B—M.B.MMM@B@B@B@MMM@@@M@B <br />
@B@B.i@MBB@B@B@@BM@::B@B@ <br />
B@@@ .B@B.:@B@ :B@B @B@O <br />
:0 r@B@ B@@ .@B@: P: <br />
vMB :@B@ :BO7 <br />
,B@B <br />
</pre><br />
<br />
Players discovered that, once both skulls had been stripped of spaces, the bytes of each skull that aren't equal to 0 could be subtracted using [https://pastebin.com/g3kA1Pif a script]. Once compiled, players received the following string:<br />
<br />
<pre><br />
OHVSURPHWLXQMXHJR...FUHRTXHXVWHGHVORVGHWHFWLYHVGHMXHJRVOROODPDULDQXQWUDLOKHDG?EOCJGDXVD-DPEDV-FDODYHUDV.KWPO<br />
</pre><br />
<br />
Players discovered that this was a caesar cipher. After shifting the string forward 23 places, it resulted in:<br />
<br />
<pre><br />
LESPROMETIUNJUEGO...CREOQUEUSTEDESLOSDETECTIVESDEJUEGOSLOLLAMARIANUNTRAILHEAD?BLZGDAUSA-AMBAS-CALAVERAS.HTML<br />
</pre><br />
<br />
When cleaned up, the message read:<br />
<br />
<pre><br />
Les prometi un juego...creo que ustedes los Detectives de Juegos lo llamarían un trailhead? BLZGDUSA-AMBAS-CALAVERAS.HTML<br />
</pre><br />
<br />
When translated from Spanish to English:<br />
<br />
<pre><br />
I promised you a game...I believe you Game Detectives would call it a trailhead? BLZGDAUSA-AMBAS-CALAVERAS.HTML<br />
</pre><br />
<br />
<code>USA-AMBAS-CALAVERAS</code> translated to <code>USE-BOTH-SKULLS</code>, and the <code>.HTML</code> extension hinted at a URL.<br />
<br />
=== Skull Video ===<br />
<br />
BLZGDA refers to the servers that Blizzard uses to host media on their website. As such, this led players to [ https://blzgdapipro-a.akamaihd.net/media/screenshot/usa-ambas-calaveras.html this page], which contains a video of a vitals screen depicting a skull and some other medical information. In addition, it also contained a graphic of one of the ASCII skulls. An Imgur mirror can be found [https://i.imgur.com/6Pk69LX.png here].<br />
<br />
Within the properties of the video, players found another comment in Spanish:<br />
<br />
<pre><br />
Parecen estar muy interesados en estos "héroes". ¿Tal vez les interese conocer algunos detallitos que he averiguado sobre ellos?<br />
</pre><br />
<br />
In English:<br />
<br />
<pre><br />
You seem to be very interested in these "heroes". Maybe interested to know some details that I found out about them?<br />
</pre><br />
<br />
In addition, the video contains a heartbeat monitor, and a series of 26 lines above it. When players assigned the letters of the alphabet to the 26 lines, and used the "pings" of the heartbeat to determine what letters to use, the following string was found:<br />
<br />
<pre><br />
momentincrime<br />
</pre><br />
<br />
=== amomentincrime E-mail ===<br />
<br />
'momentincrime' appeared to refer to the in-universe TV show "A Moment in Crime," which can be seen in the Roadhog and Junkrat [https://www.youtube.com/watch?v=l5kTATxt7bE video] that came out months before the release of Overwatch. However, players also discovered a website, [https://amomentincrime.com amomentincrime.com], and displayed the following text:<br />
<br />
<pre><br />
...Estableciendo conexión...<br />
...Protocolo Sombra v1.3 iniciado...<br />
<br />
...Infiltrando la respuesta automática del email de pistas...<br />
<br />
...Terminando conexión...<br />
</pre><br />
<br />
Players discovered that sending an e-mail to tips@amomentincrime.com resulted in an automated email response:<br />
<br />
<pre><br />
Thank you for contacting A Moment in Crime's anonymous crime line!<br />
<br />
We have analyzed your submission and forwarded the information to the relevant parties. Your help could be vital in apprehending these cri<br />
<br />
...Estableciendo conexión...<br />
...Protocolo Sombra v1.7 iniciado...<br />
<br />
<br />
01:07:47 02:02:02 01:08:06 02:13:43 01:18:32<br />
01:18:21 02:10:19 01:06:21 02:05:18 01:04:02<br />
01:07:08 02:18:25 01:13:04 02:19:20 01:23:02<br />
01:16:40 02:16:35 01:23:04 02:17:16 01:06:42<br />
01:13:29 02:18:06 01:05:02 02:15:41 01:08:34<br />
<br />
j.7F57O,NLv:qj.7B:,1qv@B1j5ivB:,<br />
<br />
...Terminando conexión...<br />
<br />
minals and bringing them to justice. These fugitives are responsible for a string of robberies, arson, and other crimes stretching from Sydney to King's Row.<br />
<br />
Authorities believe that they have set their sights on crossing the Atlantic to America.<br />
</pre><br />
<br />
Players discovered that, if the sets of numbers were taken as AA:BB:CC, where AA was the number of skull (in order of discovery), BB was the row and CC was the column (as seen [https://i.imgur.com/ZgN2MVQ.png here]), and organized into a 5x5 matrix, it would result in:<br />
<br />
<pre><br />
S j G B L <br />
. @ M O k <br />
i , v : 0 <br />
E 7 r q N <br />
J P 5 F 1<br />
</pre><br />
<br />
Players discovered that this Matrix could be used as a bifid key to decode the text underneath the table of numbers in the email, as shown below:<br />
<pre><br />
j . 7 F 5 7 O , N L v : q j . 7 B : , 1 q v @ B 1 j 5 i v B : ,<br />
12 21 42 54 53 42 24 32 45 15 33 34 44 12 21 42 14 34 32 55 44 33 22 14 55 12 53 31 33 14 34 32<br />
<br />
1 2 2 1 4 2 5 4 5 3 4 2 2 4 3 2 4 5 1 5 3 3 3 4 4 4 1 2 2 1 4 2<br />
1 4 3 4 3 2 5 5 4 4 3 3 2 2 1 4 5 5 1 2 5 3 3 1 3 3 1 4 3 4 3 2<br />
<br />
11 24 23 14 43 22 55 45 54 34 43 23 22 42 31 24 45 55 11 52 35 33 33 41 43 43 11 24 23 14 43 22<br />
</pre><br />
<br />
This gave players the following string:<br />
<br />
SOMBr@1NF:rM@7iON1SP0vvErrSOMBr@<br />
This phrase was found to be leet-speak, and was translated to:<br />
<br />
<pre><br />
Sombra Information is power Sombra<br />
</pre><br />
<br />
The string <code>SOMBr@1NF:rM@7iON1SP0vvErrSOMBr@</code> was used as a password later on in the ARG.<br />
<br />
== A Moment in Crime Transmission ==<br />
<br />
[[File:Momentincrime.png|thumbnail|right|amomentincrime.com as of August 24th, 2016]]<br />
<br />
Once the 23-hour countdown on the Skycoder forum post reached zero, [https://amomentincrime.com amomentincrime.com] was updated. It now read:<br />
<br />
<pre><br />
...Estableciendo conexión...<br />
...Protocolo Sombra v1.9 iniciado...<br />
<br />
...Transmitiendo información a ómnicos activos... 2%<br />
<br />
...Terminando conexión...<br />
</pre><br />
<br />
Translated from Spanish to English:<br />
<br />
<pre><br />
...Establishing connection...<br />
...Sombra Protocol v1.9 initiated...<br />
...Transmitting information to active omnics... 2%<br />
<br />
...Ending connection...<br />
</pre><br />
<br />
A comment was also added to the source code:<br />
<br />
<pre><br />
Bien hecho, ya tienen mi clave. Hackear este programa de televisión no tuvo chiste. Espérense a lo que sigue.<br />
</pre><br />
<br />
When translated:<br />
<br />
<pre><br />
Well done, you have my password. Hacking this television program was meaningless. Wait for what is coming.<br />
</pre><br />
<br />
The percent on the amomentincrime.com slowly increased over time. Once the 5% milestone was hit, the Sombra Protocol version number changed to to v1.95. Afterwards, the percentage increased by 0.0038% every 3 minutes in real time.<br />
<br />
In addition, another comment was added:<br />
<br />
<pre><br />
Parece que se están calentando un poco las cosas... tendré que pasar desapercibida mientras esto se finaliza.<br />
</pre><br />
<br />
Translated:<br />
<br />
<pre><br />
It seems things are heating up a bit... I'll have to go unnoticed while this is finishing.<br />
</pre><br />
<br />
On 18th October at 19:02 GMT the site reached 100%, and the site updated with the following message:<br />
<br />
<pre><br />
...Transmisión finalizada - finalizando carga... <br />
...Carga finalizada. Unidad Bastion E-54 comprometida...<br />
</pre><br />
<br />
Which roughly translates to:<br />
<br />
<pre><br />
...Transmission complete - finishing upload...<br />
...Upload finished. Unit Bastion E-54 engaged...<br />
</pre><br />
<br />
Hidden in the source code of the site was the text <code>v1.4.0.2.324??</code>. Players then correctly assumed that this referred to a future build of Overwatch itself.<br />
<br />
== Sombra vs. LumériCo ==<br />
<br />
=== The Hacked Bastion ===<br />
<br />
On October 19, 2016, a new Overwatch version was released - version 1.4.0.2.32448. Shortly afterwards, the version number in the source code of the amomentincrime site updated to the same version number. After the build launched, players discovered that the hero Bastion had a strange interaction when near the "SOMBRA PROTOCOL" monitors on Dorado, and would emit a message in morse code, which can be heard [https://www.youtube.com/watch?v=Hkd__ceYm-Y here]. When the morse was decoded, players received the following string:<br />
<pre><br />
SQOFJFBNITIZWGDXSDO<br />
</pre><br />
<br />
Players discovered that this was a Vigenere cipher, and the key consisted of the alphabetic characters from the<br />
<code>SOMBr@1NF:rM@7iON1SP0vvErrSOMBr@</code> string, it was decoded to read:<br />
<br />
<pre><br />
ACCESSWWWLUMERICOMX<br />
</pre><br />
<br />
This led players to the [https://lumerico.mx/ LumeriCo website]. ''(Editor's note: as of 2018, this site appears to be inactive.)''<br />
<br />
=== LuméReaction ===<br />
<br />
[[File:Lumerico.png|thumbnail|right|The homepage of https://lumerico.mx]]<br />
<br />
The LumeriCo website was for fictional Mexican company LumériCo, who had built several reactors in Dorado. The website had a [https://lumerico.mx/news news page], noting the imminent opening of a new reactor on November 1 as well as a recent attack on the construction site. There were also [https://lumerico.mx/about About] and [https://lumerico.mx/login Login] pages.<br />
<br />
A few extra text files were found, none of them serving any apparent purpose or relevance:<br />
<br />
* https://lumerico.mx/robots.txt <br />
<br />
Allow: omnics<br />
<br />
This file is merely a joke about the [https://en.wikipedia.org/wiki/Robots_exclusion_standard Robots exclusion standard], a txt file usually included to tell bots accessing the site what they should and should not do - a common usage is telling Googlebot not to index the site on Google. However, Blizzard have instead chosen to allow Omnics, the fictional race of robots in the Overwatch universe, to access the site.<br />
<br />
* https://lumerico.mx/omnics.txt<br />
<br />
Allow: ??<br />
Allow: ???<br />
<br />
This seemed to be another joke about the Robots exclusion standard.<br />
<br />
* https://lumerico.mx/api<br />
<br />
{"message":"thanks for calling the api"}<br />
<br />
One final joke - this so-called "API" has no practical purpose.<br />
<br />
=== Phone Number ===<br />
<br />
At the bottom of the Lumerico website, a phone number was discovered: (510) 766-2726. ARG players called the phone number to hear [https://soundcloud.com/jackwilsdon/510-766-2726a a woman speaking in Spanish]. She says a string of numbers: <code>5-2-4-1-3 (pause) 23-4-14-8-6-18-17-23-21-18-15</code><br />
<br />
The second part translates (a=1, b=2, etc) to '''WDNHFRQWURO'''. After rotating 23 times (ROT-23 cipher) this becomes '''TAKECONTROL'''.<br />
<br />
=== Take Control ===<br />
<br />
The phone message lead to a more significant page on the site: https://lumerico.mx/TAKECONTROL/index.html. It was styled the same way as amomentincrime.com and featured [https://lumerico.mx/calavera.png an image of Sombra's skull icon], named "calavera.png" (a [https://en.wikipedia.org/wiki/Calavera Spanish name] for "skull" associated with the Mexican Day of the Dead). There was also text on the page:<br />
<br />
<pre style="word-break:break-all;word-wrap: break-word;"><br />
ethldtíoíesnoemfetuylm.bnlsssqtann)hcnslararuCpdGeoopéqubdsroaan.arnasdmdor1vrsmerñerlsdacnnnoaexedsidcn.iarsgcyi,iqeqnd.pooitoaeaaransterLetéáedasodocMrnseeiuCsimnosetlójnueodacapsadcoanfasest.rnucaodacadmdoemoipíogPoipbehaSussai.,yccandin.reueatenaoiorneoeetaoéyenimt¿rPehec,uurobudeílrysriteenasni,adngpjrálireecgrolsmhYnao?nmonomepeldezmapcpunoaulrrruCstmeitltetlróesoapsdéyufcuascaa,rensbuinergnqedlmvlbpdtaz.enebuineuldoerecrGefqfirrasulrbeatHsilnbaúaeeaaooassraooa,ioedo:aLiuielPr ursmoootlnielteeánlosulobeauaanopearrúiesltéyrosssisuaaeaenremsieaismdjmolrsspebiecdéyusittnvrcacp.taebrtLiunróporner<br />
<br />
eúcrneuyraarsettsyrseen.aaPnrneuyraeastuCpnhl/wLloaloa.qartlsyuínreute.evgdpiuábdmPooucvdeccmoreurr.o?unriorydbaSnalegeáezadienáutalaaioeemfcbgdinableoc¿éppoeocelsumuoaHearsosqadrrrftuLiorannnoneneriiatcnlomoqnaqdunrcno,enmerosaereisloabolii.e.dormerosepopdé,eo:r#5scoegaqoeaibs(edioraamtdírnlyoetjcgratmnrrobnrsstloeYqoeocicpnómlpernmaepogenmodqamubodnaeasuaenMoolloupeqvgrLtúr<br />
<br />
tsosrdvoeaerroaeusdmaauamoMobsnaeanraunnt,roierbeoiemaodbmantursotñauoureeuoerreopc.etlr<br />
<br />
sotñneerLimeaFsNJ<br />
</pre><br />
<br />
This is a column order transposition cipher with the key <code>5 2 4 1 3</code>, which was obtained in the phone call. The result is: (spaced out for clarity)<br />
<br />
Los felicito por haber llegado hasta aquí. Solo quería saber si estaban listos. (Hey, es muy difícil encontrar buena ayuda últimamente...deberían ver algunos de los payasitos que están trabajando conmigo) Por ahora, continuemos con el verdadero reto: acabar con LumériCo y su president e Guillermo Portero. ¿Y porqué? Porque es un hombre codicioso, corrupto y un ladrón abominable. Su plan de traer en línea el más grande y el más poderoso zigurat el 1 de noviembre no es nada más que una artimaña, un elaborado plan designado para ejercer aún más influencia sobre la gente de México y en gordar los bolsillos de sus compinches. ¿Y quién va a pagar por eso? La gente común y corriente, los mismos que siempre quedan olvidados.<br />
<br />
He empezado a mejorar mis protocolos para que sean usados para derrumbar la infraestructura de LumériCo y Los Muertos también están intentando levantarse en contra de la corrupción. Mientras tanto, escarben por el sitio de LumériCo y busquen información que podamos usar en contra del cabrón, mejor aún, encuentren su nombre de usuario y contraseña para asegurarnos de que ciertos detalles no muy favorables sobre el presidentito...aparezcan...<br />
<br />
Pude encontrar el nombre de usuario y contraseña de un empleado de soporte de LumériCo, empiecen por ahí:<br />
<br />
GFlores/g#fNwP5qJ<br />
<br />
Translated:<br />
<br />
I'm congratulating you for getting in here. I only wanted to know if you were ready or not. (Hey, it's really difficult to get good help lately... you should see some of the clowns I'm working with). For now, let's continue with the true challenge: taking down Lumerico Corp president Guillermo Portero. Why? Because he's a greedy and corrupt man, and an abominable thief. His plan of bringing in line the most powerful and biggest zigurat the 1st of november us nothing more than a deceit, an elaborate plan by his gang to become even more influential in the people of Mexico and get more money. And who's gonna pay for that? Common people, the ones that are always forgotten.<br />
<br />
I've started upgrading my protocols so that they are used to take down the Lumerico Corp infraestructure and Los Muertos are also trying to go against the corruption. Meanwhile, search the Lumerico Corp site for info we can use against the bastard, or better, get his username and password so that hundreds "not so favorable" facts about the president start popping up.<br />
<br />
I was able to get the username and pass of a Lumerico Corp employee, start here:<br />
<br />
GFlores/g#fNwP5qJ<br />
<br />
=== Presidential Login ===<br />
<br />
Using the credentials obtained through the message above on the https://lumerico.mx/login Lumerico login page], players accessed the account of Gonzalo Flores, including [https://lumerico.mx/email his emails]. Transcripts of these emails are archived [https://docs.google.com/spreadsheets/d/1zh7OU2dEOnD4X43ImvZBNpS75FLkj-rL75pXJ2l3TuQ/htmlview?sle=true# here].<br />
<br />
Here is the only email that held relevance to the ARG:<br />
<br />
<pre><br />
De:Valeria Valderrama<VValderama@lumerico.mx><br />
Para:Gonzalo Flores<GFlores@lumerico.mx><br />
Asunto:Página de Guillermo<br />
<br />
Hola, Gonzo:<br />
¿Puedes ver el tráfico de https://lumerico.mx/president-bypass? Guillermo debería ser el único accediendo desde su página de inicio privada, pero parece que está teniendo mucho tráfico. Tal vez tengamos que escalar esto a<br />
la señorita Jiménez, pero quiero estar segura de que es digno de su tiempo.<br />
<br />
Valeria Valderrama<br />
</pre><br />
<br />
The email references a lot of traffic to the [https://lumerico.mx/president-bypass President Bypass Link]. That page displays an "access denied" message, but there is a <code>President Auth-Bypass Revision 1.02: /.git/</code> line in the source code.<br />
<br />
This line led players to [https://github.com/internetwache/GitTools/tree/master/Dumper dump the data] from the [https://lumerico.mx/president-bypass/.git/ /.git/ subpage] with git protocol and upload it to [https://gist.github.com/anonymous/987beb6a5c817b53da820562854bdebe Github]. That were codebehind files for the website, including a '''class.authentication.php''' file containing an encryption function and '''class.president-bypass.php''' file containing the president's (Guillermo Portero) username <code>GPortero</code> and encrypted password <code>?MzY:MTI5:?AzY:OWM?:?EDO:ZGU?:jVTM:MTJm:2ITM:MTUw:?QjY:OWY?:?kTO:MTQx:?MzY</code>.<br />
<br />
ARG players with technical knowledge wrote a function that reversed the encryption from class.authentication.php and used it on the encrypted password. The resulting password was <code>Xy@4+Bkuqd<53uJ</code>.<br />
<br />
After logging in to the President's account, players were able to read his emails. After 30 minutes, another email appeared in the President's inbox, from Sombra herself:<br />
<br />
<pre><br />
Veo que se han podido infiltrar en su correo.<br />
No se preocupen, él no puede ver este correo, lo he ocultado de su vista si se conecta desde una de sus direcciones conocidas de IP.<br />
Necesito un poco más de tiempo para establecer el próximo grupo de potocolos. Manténganse atentos a principios de la otra semana. Le echaré unos cuantos trapitos sucios en sus correos para que se filtren al público<br />
"accidentalmente". Ya veremos como reaccionan los medios de comunicación.<br />
</pre><br />
<br />
The rough translation is:<br />
<br />
<pre><br />
I see you have been able to infiltrate into his mail.<br />
Don't worry, he cannot see this email, I've hidden it from his sight if he connects from one of his known IP addresses.<br />
I need a little bit of time to establish the next set of protocols. Stay alert early next week. I'll throw some dirty laundry in his emails that can "accidentally" leak to the public. We'll see how the media will react to that.<br />
</pre><br />
<br />
=== Admin Access ===<br />
<br />
[[File:Lumerico admin panel.png|thumbnail|right|The admin panel of the Lumerico site, only accessible by logging in as MJimenez]]<br />
<br />
On October 25, new emails were discovered in the GFlores account, but they had no immediate significance to the ARG. In addition, omnics.txt was updated:<br />
<br />
<pre><br />
Allow: Tzolk'in<br />
Allow: Imix ChikchanManik Imix ChikchanImixChikchanImix Manik Chikchan Imix Kimi Chikchan Chikchan Kimi ChikchanImixChikchanImix ChikchanKimi<br />
</pre><br />
<br />
Tzolk'in is the name of a [[Wikipedia:Maya calendar#Tzolk'in|Mayan Calendar]], and the second line was a series of animals from it in the Tzolk'in dialect. Imix stands for Day 1, Chikchan — 5, Manik — 7 and Kimi — 6. Turned into numbers, the string reads <code>1 57 1 5151 7 5 1 6 5 5 6 5151 56</code>. These digits turned into pictograms of [[Wikipedia:Maya numerals|Maya numerals]] (one by one, not numbers as a whole) written horizontally become <code>. -..- . -.-. ..- - . .- - - .- -.-. -.-</code> That is a morse code, which decodes to <code>EXECUTEATTACK</code>.<br />
<br />
This led us to https://lumerico.mx/EXECUTEATTACK/index.html, where the following text was discovered:<br />
<br />
<pre><br />
Ha llegado el momento. Esos correos expuestos la verdad sobre Portero, iniciado la revuelta, y hemos convencido a la gente de México a apoyar nuestra causa. Ahora es el momento para el golpe. Convertiremos su preciada inauguración el 1 de noviembre en un gran movimiento en su contra. Necesito que hagan una cosa:<br />
Consigan acceso al correo del jefa de seguridad y busquen alguna forma de ayudarme en el ataque. Es posible que lo vean contactando a Portero pronto. He cambiado su contraseña a: d0r*NuLw9<br />
</pre><br />
<br />
Translated to English:<br />
<br />
<pre><br />
The moment has come. These emails exposed the truth about Portero, initiated the revolt, and have convinced people of Mexico to support our cause. Now is the time to strike. Convert his precious inauguration on November 1 to a large movement against it. I need you to do one thing:<br />
Get access to the email security chief and seek some form of help in the attack. You may see her contacting Portero soon. I've changed her password: d0r*NuLw9<br />
</pre><br />
<br />
Logging in with the credentials <code>MJimenez / d0r*NuLw9</code> gave us access to the [https://lumerico.mx/admin admin panel] of Lumerico. Until 01 Nov. 2016 it stayed inactive and any command was answered with the same message saying the terminal disconnected.<br />
<br />
=== The Terminal ===<br />
Once the console became usable, players could type <code>help</code> to see a list of commands:<br />
<br />
'''override''' Engineer safety mode override<br />
'''help''' Provides help information about commands<br />
'''version''' Displays system version information<br />
'''about''' Displays information about the system<br />
'''grep''' Search output by string<br />
<br />
In the MJimenez email account, there was an email labeled <code>Corrupción de correo electrónico</code> with highlighted text in side of it, specifically <code>/ter/</code>. After some hard thinking, people discovered that doing <code>about | grep 'ter'</code> (in linux this is a command to list all the lines from the ''about'' that have a substring ''ter'') returns this text:<br />
<br />
'''Open''' source lightweight shell for any terminal.<br />
'''Anything''' with a terminal<br />
'''1.1.0''' - expanded terminal support<br />
<br />
The first word of every line given from the output was boldened and purple. Putting the words together, we got <code>OpenAnything1.1.0</code>, which was a solution which was used shortly.<br />
<br />
Another available command for the terminal was <code>override</code>. After typing <code>override</code>, the console prompted ARG players with three security questions:<br />
<br />
# '''Favorite Movie'''. The answer to the prompt is <code>some like it bot</code>, a movie from the Overwatch universe.<br />
# '''Favorite Cookie Flavor'''. The answer being <code>nuevas sabor delicias</code>, a flavor referenced in an email in the MJimenez account.<br />
# '''Secret'''. The answer to this prompt is <code>OpenAnything1.1.0</code>.<br />
<br />
This returned <code>OK</code>, gave players admin access, and enabled a new set of commands: <br />
<br />
'''ls''' Lists files by path<br />
'''cat''' Read file by path<br />
'''exec''' Execute a file <br />
<br />
Typing <code>ls</code> listed two files: <code>payload</code> and <code>d_ilqh_nhb.html</code> (the file name is a ROT23 for ''a_fine_key'').<br />
<br />
[[Image:A fine key.png|thumb|right|a_fine_key.html]] Reading the second file with <code>cat mnt/d_ilqh_nhb.html</code> yielded a text where ASCII characters (repeating string <code>vhnl tldv xyl vcxelo xv qhrtv. zkolg[nl]</code>) were in a shape of a key. Deciphering it using the Affine cipher (A=23, B=23) yielded the following string: <code>some keys are shaped as locks. index[me]</code>. It is assumed that ''some keys are shaped as locks'' line alluded to the [[#Tracer_Trail_Cipher|Tracer Trail]] ciphertext being used as a key.<br />
<br />
Simultaneously, entering <code>exec payload</code> presented players with a prompt — the answer to which is the [[#Tracer_Trail_Cipher|Tracer Trail]]. When inputted, players were given a message that looked quite similar to what was previously seen at amomentincrime.com. The counter shown in the top right is then incremented.<br />
<br />
[[Image:LumericoTerminalTracerEntered.jpg|850px]]<br />
<br />
=== Misdirection ===<br />
<br />
[[Image:LumericoHacked.jpg|thumb|right|lumerico.mx website hacked by Sombra]]<br />
<br />
On October 1, 2016, the lumerico.mx home page changed to show "glitches" and the black overlay with a message under the purple skull, while a string <code>&lt;!-- MISDIRECTION --></code> was also added to the source of the page.<br />
<br />
The message says: <br />
<br />
<pre><br />
Buen trabajo, amigos. No lo hubiera logrado sin su ayuda. En fin, me consiguieron los recursos que necesitaba para mi siguiente golpe – les encantará.<br />
Esperen noticias de mí en los próximos días...<br />
Les voy a mandar algo para agradecerles… Ojalá lo puedan aprovechar.<br />
Dasvidanya amigos<br />
</pre><br />
<br />
Translated:<br />
<br />
</pre><br />
Good job, folks. I would not have done it without your help. Anyway, I got the resources needed for my next hit - you'll love it.<br />
Expect to hear from me in the coming days...<br />
I'm going to send something to thank you ... Hopefully you can use it.<br />
Dasvidanya friends<br />
</pre><br />
<br />
[[File:Dia de los muertos spray.jpg|thumbnail|right|The Día de Los Muertos spray that was added to the game after Sombra hacked the Lumerico site]]<br />
<br />
Note that ''Dasvidanya'' is a phonetic transliteration of ''до свиданья'' — a russian phrase for "goodbye". The thing that Sombra sent as a ''thank you'' was a new spray, named "Día de Los Muertos" after the Mexican festival that took place at the same time as the ARG. The spray is currently only available on the PC version of the game.<br />
<br />
The '''MISDIRECTION''' string lead to the page [https://lumerico.mx/MISDIRECTION/index.html https://lumerico.mx/MISDIRECTION/index.html] containing:<br />
<br />
...Estableciendo conexiуn...<br />
...Protocolo Sombra v2.3 iniciado...<br />
<br />
...Desviando datos del zigurat de LumériCo hacia el objetivo...<br />
...Descifrando contraseсas del objetivo...<br />
...Acceso otorgado al directorio de volskayaindustries.com...<br />
<br />
...boop ;)...<br />
...Terminando conexión...<br />
<br />
Translated: <br />
<br />
...Establishing connection...<br />
...Sombra Protocol v2.3 initiated...<br />
<br />
...Forwarding the data from the LumériCo ziggurat to the target...<br />
...Deciphering the target passwords...<br />
...Access Granted to the directory of volskayaindustries.com...<br />
<br />
...boop ;)...<br />
...Ending connection..<br />
<br />
== Blizzcon ==<br />
<br />
Blizzcon 2016 opened with the [https://www.youtube.com/watch?v=Og5-Pm4HNlI Overwatch short "Infiltration"], a short depicting Reaper, Widowmaker, and Sombra on Volskaya Industries. During the showing of the short, Sombra's [https://playoverwatch.com/en-us/heroes/sombra hero page] went live, showcasing her abilities and character backstory.<br />
<br />
[[File:SombraBG.jpg|center|500px]]<br />
<br />
== References ==<br />
<br />
=== Community Resources ===<br />
<br />
A collection of tools and resources made by the Game Detectives Discord community for use in the ARG.<br />
<br />
==== ASCII Skull ====<br />
<br />
'''ASCII Skull Analysis:''' https://github.com/bahamas10/sombra<br />
<br />
'''Removing SOMBR@ Analysis:''' https://pastebin.com/15u27YTC<br />
<br />
'''ASCII Skull Eye Analysys:''' https://docs.google.com/spreadsheets/d/1-JQpWyitMKYhP-4l8ZDFiJI3NjqRrvoEnRdFQawike8<br />
<br />
==== Google Docs ====<br />
<br />
'''Observations and Speculations Spreadsheet:''' https://docs.google.com/spreadsheets/d/1rI08baFQmAwaqHC-9GF9VNGCYjuRE-q4LN9k4ottjuQ/pubhtml<br />
<br />
'''LumériCo Emails and Translations Spreadsheet:''' https://goo.gl/cQgdIJ (Courtesy of UberPilot)<br />
<br />
==== Tracer Code ====<br />
<br />
'''GOL! Guesser:''' https://axxim.net/ow/gol-guesser/<br />
<br />
'''Uber GOL! Guesser:''' https://axxim.net/ow/gol-guesser/uber/<br />
<br />
The Uber GOL! Guesser only prints out UTF-8 compliant results, which makes it easier to identify potentially correct answers.<br />
<br />
'''Bruteforcing tool:''' https://github.com/glv2/bruteforce-salted-openssl<br />
<br />
=== Third-Party Resources ===<br />
<br />
A collection of third-party tools and resources that the Game Detectives Discord community has used in the ARG.<br />
<br />
==== Image of Reaper ====<br />
<br />
'''stegdetect (Linux):''' https://github.com/abeluck/stegdetect<br />
<br />
stegdetect is a Linux utility used to determine if a given image may contain encoded information.<br />
<br />
'''JPHide & JPSeek:''' https://linux01.gwdg.de/~alatham/stego.html<br><br />
'''iSteg (Mac OSX):''' https://www.hanynet.com/isteg/<br />
<br />
JPHide & JPSeek is used to hide and find, respectively, a file inside a JPEG image.<br><br />
iSteg works similarly to JPHide on the Mac OSX platform.<br />
<br />
'''stegbreak (Linux):''' https://linux.die.net/man/1/stegbreak<br />
<br />
stegbreak is used to do brute-force dictionary attacks on JPEG images.<br />
<br />
=== Easter Eggs ===<br />
<br />
The following are collection of references and Easter Eggs encountered throughout the ARG.<br />
<br />
==== In-Game ====<br />
<br />
'''Sombra's "Amused" Emote'''<br />
<br />
This character emote features the [[Sombra_ARG_False_Leads | Skycode]], accompanied by soft music resembling the [https://www.reddit.com/r/Overwatch/comments/4w7ey1/the_sombra_skysong/ Skysong]. Sombra's expression is one of amusement, and it's a nod to the community's prolonged creative attempts to solving an nonexistent puzzle.<br />
<br />
[[File:EmoteSkycode.png|200px]]<br />
<br />
'''Skycode Spray'''<br />
<br />
This character spray features Sombra's iconic skull in front of a compass rose and the [[Sombra_ARG_False_Leads | Skycode]]. This is a reference to both the [[#Directions_&_Letters|cardinal directions]] used in one of the puzzles and to the Skycode, which is considered the most significant false lead that solvers encountered.<br />
<br />
[[File:SkycodeSpray.png|200px]]<br />
<br />
==== In-ARG ====<br />
<br />
'''Espresso Command'''<br />
<br />
There was a hidden command in LumériCo's [[#The_Terminal | admin terminal]]. Inputting the word <code>espresso</code> returned the following message: <code>Coffee Pot Status: Brewed approximately 23 hours ago, currently 0% full</code><br />
This is referencing a variety of [https://goo.gl/cQgdIJ emails] found in the LumériCo site involving broken espresso machines and incompetent coffee brewing, which caught the attention of the community and gave way to a vast variety of mediocre jokes. Furthermore, "23 hours" makes reference to the number 23, which was believed by many to possess some sort of significance to the ARG, as Sombra would be the 23rd character in Overwatch. Finally, "0%" references the ARG's notable waiting periods that have been widely criticized by the community, specifically [[#A_Moment_in_Crime_Transmission | A Moment in Crime's upload percentage]].<br />
Due to the iconic purple text it is believed that this hidden command was created by Sombra herself.<br />
<br />
[[File:EspressoCommand.png]]<br />
<br />
=== Media Appearances ===<br />
<br />
'''3rd Aug. 2016'''<br />
<br />
[EN] [https://kotaku.com/overwatch-fans-find-new-clues-about-the-mysterious-hero-1784767759 Kotaku - Overwatch Fans Find New Clues About The Mysterious Hero Sombra]<br />
<br />
[EN] [https://www.polygon.com/2016/8/3/12369144/overwatch-summer-games-sombra-arg-blizzard?utm_campaign=polygon&utm_content=chorus&utm_medium=social&utm_source=twitter Polygon - Overwatch fans are trying to crack the latest mystery about Sombra]<br />
<br />
[EN] [https://www.pcgamesn.com/overwatch/overwatch-sombra PCGamesN - Overwatch's Sombra ARG continues with new clues, but no solutions]<br />
<br />
[EN] [https://team-dignitas.net/articles/blogs/overwatch/9989/who-is-sombra-all-facts-and-clues-about-sombra Team-Dignitas - Who is Sombra? All facts and clues about Sombra]<br />
<br />
[FR] [https://overwatch.gamewave.fr/un-nouveau-code-cache-dans-la-derniere-cinematique-d-overwatch/ Gamewave - UN NOUVEAU CODE CACHÉ DANS LA DERNIÈRE CINÉMATIQUE D'OVERWATCH!]<br />
<br />
[EN] [https://www.follownews.com/overwatch-fans-find-new-clues-about-the-mysterious-hero-sombra-1nhqt FollowNews - Overwatch Fans Find New Clues About The Mysterious Hero Sombra]<br />
<br />
'''4th Aug. 2016'''<br />
<br />
[EN] [https://www.pcgamer.com/overwatch-summer-games-trailer-hides-a-mysterious-secret/ PCGamer - Overwatch Summer Games trailer hides a mysterious secret]<br />
<br />
[SK] [https://www.sector.sk/novinka/121273/nove-overwatch-video-obsahuje-dalsie-tajomstva.htm Sector - Nové Overwatch video obsahuje ďalšie tajomstvá]<br />
<br />
[EN] [https://www.techinsider.io/overwatch-sombra-character-2016-8 Techinsider - 'Overwatch' players are going to insane lengths to solve a mystery that Blizzard's teased for months]<br />
<br />
[EN] [https://gamerant.com/overwatch-sombra-clues/ Gamerant - Overwatch Players Uncover More ‘Sombra’ Clues]<br />
<br />
[HU] [https://www.gamestar.hu/hir/overwatch-sombra-karakter-214739.html Gamestar - Overwatch - újabb nyomok utalnak a még be nem jelentett hősre]<br />
<br />
'''5th Aug. 2016'''<br />
<br />
[EN] [https://kotaku.com/days-later-overwatch-fans-cant-figure-out-the-sky-cod-1784872143 Kotaku - Days Later, Overwatch Fans Can't Figure Out The 'Sky Code' Mystery]<br />
<br />
[NL] [https://www.gamersnet.nl/nieuws/201608/cryptische_speurtocht_naar_overwatch_nieuwe_heldin_sombra_gaat_bizar_diep/ Gamersnet - Cryptische speurtocht naar Overwatch' nieuwe heldin Sombra gaat bizar diep]<br />
<br />
[ES] [https://www.alfabetajuega.com/noticia/overwatch-el-enigma-de-sombra-sigue-ofreciendo-nuevos-detalles-n-71772 Alfa Beta Jeuga - Overwatch: El enigma de Sombra sigue ofreciendo nuevos detalles]<br />
<br />
[EN] [https://www.youtube.com/watch?v=5ROjN-_F0ZU&feature=youtu.be&t=4m22s IGN (Video) - Sombra: Overwatch's Secret New Hero - Overwatch HQ]<br />
<br />
'''7th Aug. 2016'''<br />
<br />
[EN] [https://www.gamespresso.com/2016/08/summary-state-sombras-arg-overwatch/ Gamespresso - Summary of the state of sombra's ARG in Overwatch]<br />
<br />
'''8th Aug. 2016'''<br />
<br />
[EN/CN] [https://www.zhentoo.com/doc92368 Zhentoo - Overwatch new hero Secret Dorado hidden mystery] <br />
<br />
[EN] [https://www.technewstoday.com/30880-overwatch-sombra-continues-to-elude-detectives/ TechNewsToday - Overwatch: Sombra Continues to Elude Detectives]<br />
<br />
'''11th Aug. 2016'''<br />
<br />
[EN] [https://www.youtube.com/watch?v=IZR-pa0it4Q The Know - New Overwatch Hero Hints]<br />
<br />
'''12th Aug. 2016'''<br />
<br />
[EN] [https://kotaku.com/after-two-weeks-overwatch-fans-sombra-investigation-re-1785204389 Kotaku - Overwatch Fans' Sombra Investigation Reaps A Skull Code]<br />
<br />
'''14th Aug. 2016'''<br />
<br />
[EN] [https://gamerant.com/overwatch-sombra-skull-code/ Gamerant - Skull Code is Latest Clue in Overwatch’s Sombra Investigation]<br />
<br />
'''16th Aug. 2016'''<br />
<br />
[EN] [https://www.christiantoday.com/article/overwatch.dlc.update.skull.code.the.latest.clue.for.sombra.investigation/93197.htm Christian Today - 'Overwatch' DLC update: Skull Code the latest clue for Sombra investigation]<br />
<br />
[EN] [https://en.yibada.com/articles/151811/20160816/overwatch-dlc-update.htm Yibada - 'Overwatch' DLC update: New clues on Sombra's inclusion to the roster revealed]<br />
<br />
'''23rd Aug. 2016'''<br />
<br />
[EN] [https://www.technewstoday.com/31129-overwatch-all-we-know-about-the-sombra-arg/ Tech News Today - Overwatch: All We Know About the Sombra ARG]<br />
<br />
'''24th Aug. 2016'''<br />
<br />
[EN] [https://gamerant.com/overwatch-forums-sombra-message/ Gamerant - Overwatch Forums Glitch Out, Reveals Hidden Message From Sombra]<br />
<br />
[EN] [https://gamerant.com/overwatch-sombra-clue-website/ Gamerant - New Website Counts Down To Next Clue For Overwatch’s Sombra]<br />
<br />
[EN] [https://www.polygon.com/2016/8/24/12623736/overwatch-sombra-arg-clues-skycoder Polygon - Overwatch's Sombra mystery appears to be coming to a close]<br />
<br />
[EN] [https://www.vg247.com/2016/08/24/overwatch-forums-glitch-out-reveal-a-message-from-the-mysterious-sombra/ VG247 - Overwatch forums glitch out, reveal a message from the mysterious Sombra]<br />
<br />
[EN] [https://www.technewstoday.com/31151-sombra-hacks-into-overwatch-forums/ Tech News Today - Sombra Hacks Into Overwatch Forums]<br />
<br />
[EN] [https://www.ign.com/articles/2016/08/24/overwatch-mystery-character-sombra-could-be-revealed-today IGN - Overwatch Mystery Character Sombra Could Be Revealed Today]<br />
<br />
'''25th Aug. 2016'''<br />
<br />
[EN] [https://kotaku.com/overwatch-players-are-getting-fed-up-with-the-sombra-ar-1785765307 Kotaku - Overwatch Players Are Getting Sick Of The Sombra ARG]<br />
<br />
[EN] [https://www.ign.com/articles/2016/08/25/overwatch-made-the-internet-lose-its-mind-last-night-and-i-had-a-front-row-seat IGN - Overwatch Made the Internet Lose its Mind Last Night, And I Had a Front-Row Seat]<br />
<br />
[EN] [https://www.technewstoday.com/31182-overwatch-countdown-to-sombra/ Tech News Today - Overwatch: Countdown to Sombra]<br />
<br />
<br />
'''30th Aug. 2016'''<br />
<br />
[EN] [https://www.pcgamer.com/overwatch-sombra-arg-mystery/ PC Gamer - Overwatch's Sombra riddle begins to irritate the players trying to solve it]<br />
<br />
'''3rd Oct. 2016'''<br />
<br />
[EN] [https://www.mobilenapps.com/articles/19398/20161003/overwatch-update-sombra-blizzcon-halloween-event-leak.htm Mobile & Apps - Sombra To Be Revealed At Blizzcon? Halloween Event Confirmed In Data Leak]<br />
<br />
'''4th Oct. 2016'''<br />
<br />
[EN] [https://www.itechpost.com/articles/36011/20161004/overwatch-overwatch-update-overwatch-finally-getting-sombra-overwatch-sombra-sombra.htm iTechPost - Overwatch Update: Are We Finally Getting Sombra?]<br />
<br />
'''11th Oct. 2016'''<br />
<br />
[EN] [https://www.kotaku.com.au/2016/10/overwatch-fans-hacked-actual-people-in-an-attempt-to-find-sombra/ Kotaku - Overwatch Fans Hacked Actual People In An Attempt To Find Sombra]<br />
<br />
'''17th Oct. 2016'''<br />
<br />
[EN] [https://telkomgaming.co.za/will-sombra-hack-her-way-into-blizzcon-2016/ TelKom Gaming - Will Sombra Hack Her Way Into BlizzCon 2016?]<br />
<br />
'''18th Oct. 2016'''<br />
<br />
[EN] [https://overwatchtips.info/overwatch-sombra-arg-everything-you-need-to-know/ OverwatchTips - Everything You NEED To Know (Sombra ARG)]<br />
<br />
'''26th Oct. 2016'''<br />
<br />
[EN] [https://mic.com/articles/157757/overwatch-sombra-arg-everything-we-know-about-the-countdown-and-rumored-nov-1-release#.UILrZHRiM Min Network - Everything we know about Blizzard's rumored Nov. 1 release]<br />
<br />
'''28th Oct. 2016'''<br />
<br />
[EN] [https://kotaku.com/imagining-horror-stories-for-a-never-ending-overwatch-a-1788324673 Kotaku - Imagining Horror Stories Of A Never-Ending Overwatch ARG]<br />
<br />
'''1st Nov. 2016'''<br />
<br />
[EN] [https://www.ign.com/videos/2016/11/01/will-overwatchs-sombra-be-at-blizzcon-2016 IGN - Will Sombra be at BlizzCon 2016?]<br />
<br />
'''8th Nov. 2016'''<br />
<br />
[EN] [https://mic.com/articles/158812/overwatch-sombra-arg-gameplay-emote-directly-references-one-of-the-wildest-fan-theories Mic Tech - 'Overwatch' Sombra ARG: Gameplay emote directly references one of the wildest fan theories]</div>Halke234https://wiki.gamedetectives.net/index.php?title=Sombra_ARG&diff=16615Sombra ARG2018-07-23T23:37:59Z<p>Halke234: /* A Moment in Crime Transmission */</p>
<hr />
<div>{{argbox<br />
| float = right<br />
| name = Sombra ARG<br />
| image = File:Sombra_skull.png<br />
| description= The Sombra ARG - an ARG involving an unreleased Overwatch hero.<br />
| creator = [https://www.blizzard.com/ Blizzard Entertainment]<br />
| type = Official<br />
| status = Completed<br />
| discovered = 2016-06-12<br />
| completed = 2016-11-04<br />
}}<br />
<br />
{{ArgHeader|arg=Sombra ARG}}<br />
The Sombra ARG was an ARG for the first-person shooter [https://www.playoverwatch.com Overwatch], developed by [https://www.blizzard.com/ Blizzard Entertainment]. Sombra was the name of a then-unreleased Overwatch hero. The ARG was comprised of clues and ciphers referencing Sombra, which were found in various developer updates and short animations.<br />
<br />
At the game's release, there were numerous pieces of in-game information that appeared in the map Dorado, hinting at a character called Sombra. When the hero Ana was revealed, more Sombra clues appeared in Ana's origin video. In the weeks that followed, more clues were discovered, which led up to a character reveal animation at BlizzCon 2016.<br />
<br />
== Ana Videos ==<br />
<br />
=== Ana Origin Video ===<br />
<br />
On July 12, 2016, a [https://www.youtube.com/watch?v=TE0CXgpNxG0 video] for the new Overwatch hero named Ana was released. At the 1:16 mark, players discovered a set of hexidecmial values:<br />
<br />
[[File:Ana_Hex2.png|400px]]<br />
<br />
<pre><br />
2E 2E 2E 7B 76 20 66 62 72 20 63 7E 72 79 72 20 7B 76 20 7E<br />
79 71 78 65 7A 76 74 7E D4 A4 79 2C 20 63 7E 72 79 72 20 72<br />
7B 20 67 78 73 72 65 2E 2E 2E 7B 76 20 66 62 72 20 63 7E 72<br />
79 72 20 7B 76 20 7E 79 71 78 65 7A 76 74 7E D4 A4 79 2C 20<br />
63 7E 72 79 72 20 72 7B 20 67 78 73 72 65 2E 2E 2E 7B 76 20<br />
66 62 72 20 63 7E 72 79 72 20 7B 76 20 7E 79 71 78 65 7A 76<br />
74 7E D4 A4 79 2C 20 63 7E 72 79 72 20 72 7B 20 67 78 73 72<br />
65 2E 2E 2E 7B 76 20 66 62 72 20 63 7E 72 79 72 20 7B 76 20<br />
7E 79 71 78 65 7A 76 74 7E D4 A4 79 2C 20 63 7E 72 79 72 20<br />
72 7B 20 67 78 73 72 65 2E 2E 2E 64 78 7A 75<br />
</pre><br />
<br />
A hex to ASCII translation yielded the following:<br />
<br />
<pre><br />
...{v fbr c~ryr {v ~yqxezvt~Ô¤y, c~ryr r{ gxsre...{v fbr c~ryr {v ~yqxezvt~Ô¤y, c~ryr r{ gxsre...{v fbr c~ryr {v ~yqxezvt~Ô¤y, c~ryr r{ gxsre...{v fbr <br />
c~ryr {v ~yqxezvt~Ô¤y, c~ryr r{ gxsre...dxzu<br />
</pre><br />
<br />
Using an XOR Cipher with the constant 23 on the above text resulted in the following message:<br />
<br />
<pre><br />
..la que tiene la información; tiene el poder...la que tiene la información; tiene el poder...la que tiene la información; tiene el poder...la que tiene la <br />
información; tiene el poder...somb<br />
</pre><br />
<br />
This was a repeating phrase in Spanish, which translated to:<br />
<br />
<pre><br />
She who has the information, has the power...<br />
</pre><br />
<br />
Players then discovered a second set of hexidecimal values at the 2:11 mark:<br />
<br />
[[File:Ana Hex.png|400px]]<br />
<br />
<pre><br />
65 76 2E 2E 2E 7B 76 20 66 62 72 20 63 7E 72 79 72 20 7B 76<br />
20 7E 79 71 78 65 7A 76 74 7E D4 A4 79 2C 20 63 7E 72 79 72<br />
20 72 7B 20 67 78 73 72 65 2E 2E 2E 7B 76 20 66 62 72 20 63<br />
7E 72 79 72 20 7B 76 20 7E 79 71 78 65 7A 76 74 7E D4 A4 79<br />
2C 20 63 7E 72 79 72 20 72 7B 20 67 78 73 72 65 2E 2E 2E 7B<br />
76 20 66 62 72 20 63 7E 72 79 72 20 7B 76 20 7E 79 71 78 65<br />
7A 76 74 7E D4 A4 79 2C 20 63 7E 72 79 72 20 72 7B 20 67 78<br />
73 72 65 2E 2E 2E 7B 76 20 66 62 72 20 63 7E 72 79 72 20 7B<br />
76 20 7E 79 71 78 65 7A 76 74 7E D4 A4 79 2C 20 63 7E 72 79<br />
72 20 72 7B 20 67 78 73 72 65 2E 2E 2E<br />
</pre><br />
<br />
When put through the same process, the same string of Spanish was revealed, but with the letters <code>ra</code> at the beginning of the message. These letters were combined with <code>somb</code> from the first cipher to create the name <code>sombra</code>. No more clues were discovered until the release of the Dev Update video.<br />
<br />
=== Dev Update Video ===<br />
<br />
[[File:Sombra Barcodes.png|thumbnail|right|The vertical barcodes found at the end of the Ana Dev Update video]]<br />
<br />
On July 19, 2016, the first [https://www.youtube.com/watch?v=evghkilg2eQ Developer Update] was released for Ana. At the end of the video, players discovered a series of vertical barcodes. When scanned, players discovered a large set of hexidecimal values which where then converted to binary, a dump of which is available [https://gist.github.com/zapu/31165efab0d6264e2fd0fa75cc53b1aa here].<br />
<br />
Turning the ones and zeroes into black and white pixels formed a QR code:<br />
<br />
[[File:Sombra_QR_code.png|300px]]<br />
<br />
Scanning this QR code yielded the following message: <code>¿Estuvo eso facilito? Ahora que tengo su atención, déjenme se las pongo más difícil.</code> In English, the message reads: <code>Was that easy? Well, now that I have your attention, allow me to make things much more difficult.</code> After this, no more clues were discovered until the Summer Games video was released.<br />
<br />
== Welcome to the Summer Games Video ==<br />
<br />
=== Tracer Trail Cipher ===<br />
<br />
[[File:Base64_trail.jpg|thumbnail|right|The unsolved base64 cipher in the Summer Games video]]<br />
<br />
'''Note: The cipher described below remains unsolved.'''<br />
<br />
On August 2, 2016, players discovered another cipher in the [https://www.youtube.com/watch?v=qpcOD9tJM4k Welcome to the Summer Games trailer]:<br />
<br />
<pre><br />
U2FsdGVkX1+vupppZksvRf5pq5g5XjFRIipRkwB0K1Y96Qsv2L<br />
m+31cmzaAILwytX/z66ZVWEQM/ccf1g+9m5Ubu1+sit+A9cenD<br />
xxqkIaxbm4cMeh2oKhqIHhdaBKOi6XX2XDWpa6+P5o9MQw==<br />
</pre><br />
<br />
Players discovered this text to be base64 encryption. When decrypted, players received the following output:<br />
<br />
<pre><br />
Salted__���ifK/E�i��9^1Q�*Q�t+V=�<br />
/ع��W/<br />
�_����V��?q����f�F���"��=q�������[��<br />
z��*����Z����u�\5�k�C<br />
</pre><br />
<br />
''(Note: copy/pasting this string will not work; some of the characters are not printable and are not even displayed correctly on this page)''<br />
<br />
==== Decrypting the Cipher ====<br />
<br />
The "Salted__" header at the start of the string indicated to players that the remainder of the text was encrypted with the OpenSSL software library, which requires a password and the encryption cipher that was used. Salt is added by OpenSSL to ensure uniqueness of the key and the IV derived from the password and used for the encryption. However, due to the age of OpenSSL and its massive library, it was proven to be quite difficult for players to identify the encryption used.<br />
<br />
==== Narrowing Down Ciphers ====<br />
<br />
[[File:HexOfEncryptedMessage.png|thumbnail|right|Hex view of the encrypted string]]<br />
<br />
Players narrowed down the potential ciphers used by examining a hex dump of the encrypted string. There are two major types of ciphers, stream ciphers and block ciphers. Stream ciphers encrypt only the data fed into them, whereas block ciphers always encrypt a certain number of bytes at a time (a "chunk").<br />
<br />
A byte is roughly a single character, but special characters can take up multiple bytes. We know that OpenSSL Salted Encryption uses the first 8 bytes of the output for <code>Salted__</code> and the next 8 bytes for the actual salt. The rest of the information is the '''encrypted message'''.<br />
<br />
The immediately interesting thing here is that the '''encrypted message''' data stops 3 bytes short of a full chunk. This is a excellent indicator that the cipher used is a stream cipher (or a block cipher in CTR/OFB/CFB mode). This narrows the list of potential ciphers down significantly. This also means that the final string that Blizzard encrypted is less than 93 bytes!<br />
<br />
'''This cipher remains unsolved, but it's speculated that Blizzard moved past the cipher by creating alternate puzzles.'''<br />
<br />
=== Directions & Letters ===<br />
<br />
Players discovered that in the North American version of the Summer Games trailer there were repeated references to the cardinal directions, each associated with a particular hero. These references were conspicuously absent from other versions of the trailer. These references are shown below, with the relevant heroes and timestamps:<br />
<br />
<gallery mode="packed"><br />
File:Ow1.png|East - Mercy - Route 66 - 0:17<br />
File:Ow2.png|Center - D. Va - Temple of Anubis - 0:19<br />
File:Ow3.png|North - Torbjorn - Nepal - 0:21<br />
File:Ow4.png|South - Genji - Hanamura - 0:22<br />
File:Ow5.png|Southeast - McCree - Hollywood - 0:24<br />
File:Ow6.png|West - Symmetra - Watchpoint: Gibraltar - 0:30<br />
File:Ow7.png|Southwest - Bastion - Hollywood - 0:34<br />
File:Ow8.png|Northeast - Winston - Volskaya Industries - 0:46<br />
File:Ow9.png|Northwest - Tracer - King's Row - 0:47<br />
</gallery><br />
<br />
Screenshots of all the directions and their respective heroes can be found in an album [https://imgur.com/a/FQXmy here].<br />
<br />
[[File:Overwatch map.jpg|frameless]]<br />
<br />
These heroes, arranged in this particular order, provided a password that was used later in the ARG.<br />
<br />
== Dorado Photo ==<br />
<br />
At an unknown date, a new, "corrupted" photo of the [https://blzgdapipro-a.akamaihd.net/media/screenshot/dorado-screenshot-004.jpg Dorado attackers spawn point] was added to the Overwatch [https://playoverwatch.com/en-us/media/ media page]. Players discovered that the screenshot was "'''datamoshed'''", which means it concealed a hidden message while also taking on a distorted appearance. ([https://prntscr.com/c3dce7 Here] is an example of purposely data moshing the image manually to achieve similar effects.) <br />
<br />
<gallery mode="packed" heights=500px><br />
File:dorado-datamosh.jpg|The datamoshed image<br />
File:dorado-screenshot-005.jpg|The original image<br />
</gallery><br />
<br />
After comparing the images with difference checking tools, players found that certain English and Spanish characters were replaced with exclamation points. The missing characters produced the following Spanish phrase:<br />
<br />
<code>Por que estan mirando al cielo? La respuesta no esta sobre sus cabezas, esta detras de ustedes. A veces, necesitan analizar sus logros previos.</code><br />
<br />
Translated into English, this phrase read:<br />
<br />
<code>Why are you looking at the sky? The answer isn't over your heads, it's behind you. Sometimes, you need to analyze your previous achievements.</code><br />
<br />
The phrase "Why are you looking at the sky?" was most likely a reference to a strange artifact that was discovered in the sky of the Dorado map, dubbed the "Skycode". The Skycode ended up being a red herring, and was completely unrelated to the ARG.<br />
<br />
=== Analyzing Achievements ===<br />
<br />
[[File:achievements.png|thumbnail|right|"¿" Achievement, comment in source code]]<br />
<br />
The phrase "you need to analyze your previous achievements" led players to look at the achievements on the [https://www.playoverwatch.com Overwatch] website. It was noticed noticed that by logging in and viewing the achievements on a player profile, a mystery achievement appeared. Examining a hex dump of the image lead players to a new phrase:<br />
<br />
<pre><br />
Vientos, nada mal. No obstante, me aburro. Intentemos algo nuevo en la misma dirección.<br />
uczihriwgsxorxwunaarawryqhbrsfmeqrjjmu 5552E494 78T3 4VM9 OPL6 IS8208O913KRlrx<br />
</pre><br />
<br />
Translated, it said:<br />
<br />
<pre><br />
Damn, not bad. However, I'm getting bored. Let's try something new in the same direction.<br />
uczihriwgsxorxwunaarawryqhbrsfmeqrjjmu 5552E494 78T3 4VM9 OPL6 IS8208O913KRlrx<br />
</pre><br />
<br />
== Volskaya Datamosh ==<br />
<br />
After a long period of toying around, players discovered that the ciphertext <code> uczihriwgsxorxwunaarawryqhbrsfmeqrjjmu 5552E494 78T3 4VM9 OPL6 IS8208O913KRlrx</code> from the "?" achievement was a Vigenére cipher. Players discovered the key <code>tracertorbjornwinstonsymmetradvamercybastiongenjimccree</code> by ordering the heroes in the Summer Games trailer by the cardinal directions associated with each of them, as said further above. Once decoded, players received the following text: <br />
<pre>blzgdapiproaakamaihdnetmediascreenshot 5552E494 78B3 4CE9 ACF6 EF8208F913CFjpg</pre><br />
<br />
Players found this to be a [https://blzgdapipro-a.akamaihd.net/media/screenshot/5552E494-78B3-4CE9-ACF6-EF8208F913CF.jpg blzgdapipro-a.akamaihd.net/media/screenshot/5552E494-78B3-4CE9-ACF6-EF8208F913CF.jpg URL], which led players to a datamoshed screenshot of the Volskaya Industries map. ''(Editor's note: This link appears to now be dead)''. When players ran a difference check with the [https://blzgdapipro-a.akamaihd.net/media/screenshot/volskaya-screenshot-004.jpg original image], they received an interesting message.<br />
<br />
<gallery mode="packed"><br />
File:volskaya-datamosh.jpg|The datamoshed image<br />
File:Volskaya-screenshot-004.jpg|The original image<br />
</gallery><br />
<br />
=== ASCII Skull #1 ===<br />
<br />
The diff from the datamoshed image resulted in the following output:<br />
<br />
<pre><br />
Parece que te gustan estos jueguitos... por que no jugamos uno de verdad?<br />
:PB@Bk:<br />
,jB@@B@B@B@BBL.<br />
7G@B@B@BMMMMMB@B@B@Nr<br />
:kB@B@@@MMOMOMOMOMMMM@B@B@B1,<br />
:5@B@B@B@BBMMOMOMOMOMOMOMM@@@B@B@BBu.<br />
70@@@B@B@B@BXBBOMOMOMOMOMOMMBMPB@B@B@B@B@Nr<br />
G@@@BJ iB@B@@ OBMOMOMOMOMOMOM@2 B@B@B. EB@B@S<br />
@@BM@GJBU. iSuB@OMOMOMOMOMOMM@OU1: .kBLM@M@B@<br />
B@MMB@B 7@BBMMOMOMOMOMOBB@: B@BMM@B<br />
@@@B@B 7@@@MMOMOMOMM@B@: @@B@B@<br />
@@OLB. BNB@MMOMOMM@BEB rBjM@B<br />
@@ @ M OBOMOMM@q M .@ @@<br />
@@OvB B:u@MMOMOMMBJiB .BvM@B<br />
@B@B@J 0@B@MMOMOMOMB@B@u q@@@B@<br />
B@MBB@v G@@BMMMMMMMMMMMBB@5 F@BMM@B<br />
@BBM@BPNi LMEB@OMMMM@B@MMOMM@BZM7 rEqB@MBB@<br />
B@@@BM B@B@B qBMOMB@B@B@BMOMBL B@B@B @B@B@M<br />
J@@@@PB@B@B@B7G@OMBB. ,@MMM@qLB@B@@@BqB@BBv<br />
iGB@,i0@M@B@MMO@E : M@OMM@@@B@Pii@@N:<br />
. B@M@B@MMM@B@B@B@MMM@@@M@B<br />
@B@B.i@MBB@B@B@@BM@::B@B@<br />
B@@@ .B@B.:@B@ :B@B @B@O<br />
:0 r@B@ B@@ .@B@: P:<br />
vMB :@B@ :BO7<br />
,B@B<br />
</pre><br />
<br />
'''Translation:'''<br />
<br />
<pre><br />
"It seems you like these little games... Why don't we play a real one?"<br />
</pre><br />
<br />
(''This is the python2 script to extract modified bytes from datamoshed Volskaya screenshot: https://gist.github.com/synap5e/27635d2ff6f0e3b15f0c902dca2974a9'')<br />
<br />
No further progress was made until August 23, 2016.<br />
<br />
== Overwatch Forums Glitching Page/ "Skycoder" ==<br />
<br />
On August 23rd, 2016, at an unknown time, an [https://us.battle.net/forums/en/overwatch/topic/20748794686 ominous post] by a user named "Skycoder" appeared on the official General Discussion forums for Overwatch. <br />
<br />
Players found that the name of the post, <code>00110010 00110011</code>, was binary for "23," which was a direct reference to Sombra being the 23rd hero in Overwatch. The age of the post started at 24 hours, and counted down rather than increasing. The post itself contained a single sentence in Spanish:<br />
<br />
<pre><br />
la que tiene la información; tiene el poder<br />
</pre><br />
<br />
Which, when translated to english, reads:<br />
<br />
<pre><br />
She who has the information, has the power.<br />
</pre><br />
<br />
After a short while, the post glitched and distorted, gradually turning a hue of purple. A text box then appeared, which printed the following ciphertext:<br />
<br />
<pre><br />
ICAgICAgICAgICAgICAgICAgICAgICAgICA6UEKPQms6CiAgICAgICAg<br />
ICAgICAgICAgICAgICAsakKIQEJAQkBCQEJCTC4KICAgICAgICAgICAg<br />
ICAgICAgIDdHlkKTQpVCTU1NTU1CQEJAQkBOcgogICAgICAgICAgICAg<br />
ICA6a0KSQpCIl01NT01PTU9NT01NTU2MQphCQEIxLAogICAgICAgICAg<br />
IDo1kUKNQphCiEJCTU1PTU9NT01PTU9NT01NipJuQm5CQEJCdS4KICAg<br />
ICAgICA3MG6GlUKIQpJClEJYQkJPTU9NT01PTU9NT01NQk1QQphCiEJA<br />
QkBCQE5yCiAgICAgIEeYlpdCSiBpQohCh4ggIE9CTU9NT01PTU9NT01P<br />
TZYyICBCj0JAQi4gRUJAQkBTCiAgICAgIJKWQk2HR0pCVS4gIGlTdUKI<br />
T01PTU9NT01PTU9NTZdPVTE6ICAua0JMTYhNhkKXCiAgICAgIEKMTU1C<br />
mUIgICAgICAgN4hCQk1NT01PTU9NT01PQkKWOiAgICAgICBCh0JNTYhC<br />
CiAgICAgII2YiEKKQiAgICAgICAgIDeSlkBNTU9NT01PTU1AQkA6ICAg<br />
ICAgICAgQEBCQEJACiAgICAgII+ST0xCLiAgICAgICAgICBCTkKPTU1P<br />
TU9NTY9CRUIgICAgICAgICAgckJqTYRCCiAgICAgIJBAICBAICAgICAg<br />
ICAgICBNICBPQk9NT01NQHEgIE0gICAgICAgICAgLkAgIEBACiAgICAg<br />
IISVT3ZCICAgICAgICAgICBCOnWMTU1PTU9NTUJKaUIgICAgICAgICAg<br />
LkJ2TUBCCiAgICAgIIRCkUKYSiAgICAgICAgIDCRQpdNTU9NT01PTUKV<br />
QkB1ICAgICAgICAgcUBAQEJACiAgICAgIEKETUJCjHYgICAgICAgR4+L<br />
Qk1NTU1NTU1NTU1NQkKINSAgICAgICBGhEJNTUBCCiAgICAgIIdCQk1/<br />
QlBOaSAgIExNRUKFT01NTU2PQoNNTU9NTYpCWk03ICAgckVxQodNQkKE<br />
CiAgICAgIEKYloRCTSAgQm1ChEIgIHFCTU9NQpBChUKEQk1PTUJMICBC<br />
QEJAQiAgQEJAQkBNCiAgICAgICBKlm2GhFBCj0KEQplCN0eIT01CQi4g<br />
ICAsQE1NTUBxTEJAQkBAQEJxQkBCQnYKICAgICAgICAgIGlHQpUsaTCE<br />
TZZCbk1NT4tFICA6ICBNQE9NTUBAQEJAUGlpQEBOOgogICAgICAgICAg<br />
ICAgLiAgIEKXTZBCj01NTUBCQEJAQkBNTU1AQEBNQEIKICAgICAgICAg<br />
ICAgICAgICBAQkBCLmlATUJCQEJAQkBAQk1AOjpCQEJACiAgICAgICAg<br />
ICAgICAgICAgQkBAQCAuQkBCLjpAQkAgOkJAQiAgQEJATwogICAgICAg<br />
ICAgICAgICAgICAgOjAgckBCQCAgQkBAIC5AQkA6IFA6CiAgICAgICAg<br />
ICAgICAgICAgICAgICAgdk1CIDpAQkAgOkJPNwogICAgICAgICAgICAg<br />
ICAgICAgICAgICAgICAsQkBCCg==<br />
</pre><br />
<br />
=== ASCII Skull #2 ===<br />
<br />
Players discovered that this was Base64 and, once decrypted, resulted in another ASCII skull:<br />
<br />
<pre><br />
:PB.Bk: <br />
,jBˆ@B@B@B@BBL. <br />
7G–B“B•BMMMMMB@B@B@Nr <br />
:kB’B.ˆ—MMOMOMOMOMMMMŒB˜B@B1, <br />
:5‘B.B˜BˆBBMMOMOMOMOMOMOMMŠ’nBnB@BBu. <br />
70n†•BˆB’B”BXBBOMOMOMOMOMOMMBMPB˜BˆB@B@B@Nr <br />
G˜–—BJ iBˆB‡ˆ OBMOMOMOMOMOMOM–2 B.B@B. EB@B@S <br />
’–BM‡GJBU. iSuBˆOMOMOMOMOMOMM—OU1: .kBLMˆM†B— <br />
BŒMMB™B 7ˆBBMMOMOMOMOMOBB–: B‡BMMˆB <br />
.˜ˆBŠB 7’–@MMOMOMOMM@B@: @@B@B@ <br />
.’OLB. BNB.MMOMOMM.BEB rBjM„B <br />
.@ @ M OBOMOMM@q M .@ @@ <br />
„•OvB B:uŒMMOMOMMBJiB .BvM@B <br />
„B‘B˜J 0‘B—MMOMOMOMB•B@u q@@@B@ <br />
B„MBBŒv G.‹BMMMMMMMMMMMBBˆ5 F„BMM@B <br />
‡BBM.BPNi LMEB…OMMMM.BƒMMOMMŠBZM7 rEqB‡MBB„ <br />
B˜–„BM BmB„B qBMOMB.B…B„BMOMBL B@B@B @B@B@M <br />
J–m†„PB.B„B™B7GˆOMBB. ,@MMM@qLB@B@@@BqB@BBv <br />
iGB•,i0„M–BnMMO‹E : M@OMM@@@B@Pii@@N: <br />
. B—M.B.MMM@B@B@B@MMM@@@M@B <br />
@B@B.i@MBB@B@B@@BM@::B@B@ <br />
B@@@ .B@B.:@B@ :B@B @B@O <br />
:0 r@B@ B@@ .@B@: P: <br />
vMB :@B@ :BO7 <br />
,B@B <br />
</pre><br />
<br />
Players discovered that, once both skulls had been stripped of spaces, the bytes of each skull that aren't equal to 0 could be subtracted using [https://pastebin.com/g3kA1Pif a script]. Once compiled, players received the following string:<br />
<br />
<pre><br />
OHVSURPHWLXQMXHJR...FUHRTXHXVWHGHVORVGHWHFWLYHVGHMXHJRVOROODPDULDQXQWUDLOKHDG?EOCJGDXVD-DPEDV-FDODYHUDV.KWPO<br />
</pre><br />
<br />
Players discovered that this was a caesar cipher. After shifting the string forward 23 places, it resulted in:<br />
<br />
<pre><br />
LESPROMETIUNJUEGO...CREOQUEUSTEDESLOSDETECTIVESDEJUEGOSLOLLAMARIANUNTRAILHEAD?BLZGDAUSA-AMBAS-CALAVERAS.HTML<br />
</pre><br />
<br />
When cleaned up, the message read:<br />
<br />
<pre><br />
Les prometi un juego...creo que ustedes los Detectives de Juegos lo llamarían un trailhead? BLZGDUSA-AMBAS-CALAVERAS.HTML<br />
</pre><br />
<br />
When translated from Spanish to English:<br />
<br />
<pre><br />
I promised you a game...I believe you Game Detectives would call it a trailhead? BLZGDAUSA-AMBAS-CALAVERAS.HTML<br />
</pre><br />
<br />
<code>USA-AMBAS-CALAVERAS</code> translated to <code>USE-BOTH-SKULLS</code>, and the <code>.HTML</code> extension hinted at a URL.<br />
<br />
=== Skull Video ===<br />
<br />
BLZGDA refers to the servers that Blizzard uses to host media on their website. As such, this led players to [ https://blzgdapipro-a.akamaihd.net/media/screenshot/usa-ambas-calaveras.html this page], which contains a video of a vitals screen depicting a skull and some other medical information. In addition, it also contained a graphic of one of the ASCII skulls. An Imgur mirror can be found [https://i.imgur.com/6Pk69LX.png here].<br />
<br />
Within the properties of the video, players found another comment in Spanish:<br />
<br />
<pre><br />
Parecen estar muy interesados en estos "héroes". ¿Tal vez les interese conocer algunos detallitos que he averiguado sobre ellos?<br />
</pre><br />
<br />
In English:<br />
<br />
<pre><br />
You seem to be very interested in these "heroes". Maybe interested to know some details that I found out about them?<br />
</pre><br />
<br />
In addition, the video contains a heartbeat monitor, and a series of 26 lines above it. When players assigned the letters of the alphabet to the 26 lines, and used the "pings" of the heartbeat to determine what letters to use, the following string was found:<br />
<br />
<pre><br />
momentincrime<br />
</pre><br />
<br />
=== amomentincrime E-mail ===<br />
<br />
'momentincrime' appeared to refer to the in-universe TV show "A Moment in Crime," which can be seen in the Roadhog and Junkrat [https://www.youtube.com/watch?v=l5kTATxt7bE video] that came out months before the release of Overwatch. However, players also discovered a website, [https://amomentincrime.com amomentincrime.com], and displayed the following text:<br />
<br />
<pre><br />
...Estableciendo conexión...<br />
...Protocolo Sombra v1.3 iniciado...<br />
<br />
...Infiltrando la respuesta automática del email de pistas...<br />
<br />
...Terminando conexión...<br />
</pre><br />
<br />
Players discovered that sending an e-mail to tips@amomentincrime.com resulted in an automated email response:<br />
<br />
<pre><br />
Thank you for contacting A Moment in Crime's anonymous crime line!<br />
<br />
We have analyzed your submission and forwarded the information to the relevant parties. Your help could be vital in apprehending these cri<br />
<br />
...Estableciendo conexión...<br />
...Protocolo Sombra v1.7 iniciado...<br />
<br />
<br />
01:07:47 02:02:02 01:08:06 02:13:43 01:18:32<br />
01:18:21 02:10:19 01:06:21 02:05:18 01:04:02<br />
01:07:08 02:18:25 01:13:04 02:19:20 01:23:02<br />
01:16:40 02:16:35 01:23:04 02:17:16 01:06:42<br />
01:13:29 02:18:06 01:05:02 02:15:41 01:08:34<br />
<br />
j.7F57O,NLv:qj.7B:,1qv@B1j5ivB:,<br />
<br />
...Terminando conexión...<br />
<br />
minals and bringing them to justice. These fugitives are responsible for a string of robberies, arson, and other crimes stretching from Sydney to King's Row.<br />
<br />
Authorities believe that they have set their sights on crossing the Atlantic to America.<br />
</pre><br />
<br />
Players discovered that, if the sets of numbers were taken as AA:BB:CC, where AA was the number of skull (in order of discovery), BB was the row and CC was the column (as seen [https://i.imgur.com/ZgN2MVQ.png here]), and organized into a 5x5 matrix, it would result in:<br />
<br />
<pre><br />
S j G B L <br />
. @ M O k <br />
i , v : 0 <br />
E 7 r q N <br />
J P 5 F 1<br />
</pre><br />
<br />
Players discovered that this Matrix could be used as a bifid key to decode the text underneath the table of numbers in the email, as shown below:<br />
<pre><br />
j . 7 F 5 7 O , N L v : q j . 7 B : , 1 q v @ B 1 j 5 i v B : ,<br />
12 21 42 54 53 42 24 32 45 15 33 34 44 12 21 42 14 34 32 55 44 33 22 14 55 12 53 31 33 14 34 32<br />
<br />
1 2 2 1 4 2 5 4 5 3 4 2 2 4 3 2 4 5 1 5 3 3 3 4 4 4 1 2 2 1 4 2<br />
1 4 3 4 3 2 5 5 4 4 3 3 2 2 1 4 5 5 1 2 5 3 3 1 3 3 1 4 3 4 3 2<br />
<br />
11 24 23 14 43 22 55 45 54 34 43 23 22 42 31 24 45 55 11 52 35 33 33 41 43 43 11 24 23 14 43 22<br />
</pre><br />
<br />
This gave players the following string:<br />
<br />
SOMBr@1NF:rM@7iON1SP0vvErrSOMBr@<br />
This phrase was found to be leet-speak, and was translated to:<br />
<br />
<pre><br />
Sombra Information is power Sombra<br />
</pre><br />
<br />
The string <code>SOMBr@1NF:rM@7iON1SP0vvErrSOMBr@</code> was used as a password later on in the ARG.<br />
<br />
== A Moment in Crime Transmission ==<br />
<br />
[[File:Momentincrime.png|thumbnail|right|amomentincrime.com as of August 24th, 2016]]<br />
<br />
Once the 23-hour countdown on the Skycoder forum post reached zero, [https://amomentincrime.com amomentincrime.com] was updated. It now read:<br />
<br />
<pre><br />
...Estableciendo conexión...<br />
...Protocolo Sombra v1.9 iniciado...<br />
<br />
...Transmitiendo información a ómnicos activos... 2%<br />
<br />
...Terminando conexión...<br />
</pre><br />
<br />
Translated from Spanish to English:<br />
<br />
<pre><br />
...Establishing connection...<br />
...Sombra Protocol v1.9 initiated...<br />
...Transmitting information to active omnics... 2%<br />
<br />
...Ending connection...<br />
</pre><br />
<br />
A comment was also added to the source code:<br />
<br />
<pre><br />
Bien hecho, ya tienen mi clave. Hackear este programa de televisión no tuvo chiste. Espérense a lo que sigue.<br />
</pre><br />
<br />
When translated:<br />
<br />
<pre><br />
Well done, you have my password. Hacking this television program was meaningless. Wait for what is coming.<br />
</pre><br />
<br />
The percent on the amomentincrime.com slowly increased over time. Once the 5% milestone was hit, the Sombra Protocol version number changed to to v1.95. Afterwards, the percentage increased by 0.0038% every 3 minutes in real time.<br />
<br />
In addition, another comment was added:<br />
<br />
<pre><br />
Parece que se están calentando un poco las cosas... tendré que pasar desapercibida mientras esto se finaliza.<br />
</pre><br />
<br />
Translated:<br />
<br />
<pre><br />
It seems things are heating up a bit... I'll have to go unnoticed while this is finishing.<br />
</pre><br />
<br />
On 18th October at 19:02 GMT the site reached 100%, and the site updated with the following message:<br />
<br />
<pre><br />
...Transmisión finalizada - finalizando carga... <br />
...Carga finalizada. Unidad Bastion E-54 comprometida...<br />
</pre><br />
<br />
Which roughly translates to:<br />
<br />
<pre><br />
...Transmission complete - finishing upload...<br />
...Upload finished. Unit Bastion E-54 engaged...<br />
</pre><br />
<br />
Hidden in the source code of the site was the text <code>v1.4.0.2.324??</code>. Players then correctly assumed that this referred to a future build of Overwatch itself.<br />
<br />
== Sombra vs. LumériCo ==<br />
<br />
=== The Hacked Bastion ===<br />
<br />
On 2016-10-19, a new Overwatch version was released - version 1.4.0.2.32448. The source code for https://www.amomentincrime.com was shortly updated to change the two <code>?</code>s to the same numbers. Users discovered that Bastion had a strange interaction on the Dorado map - when next to one of the SOMBRA PROTOCOL terminals, [https://www.youtube.com/watch?v=Hkd__ceYm-Y he would emit a series of beeps].<br />
<br />
The beeps were, in fact, Morse code, which decoded to the following:<br />
<br />
<pre><br />
SQOFJFBNITIZWGDXSDO<br />
</pre><br />
<br />
By using the letters from the string string <code>SOMBr@1NF:rM@7iON1SP0vvErrSOMBr@</code> as a key (<code>SOMBrNFrMiONSPvvErr</code>) for a Vigenere cipher, the string was decoded to read:<br />
<br />
<pre><br />
ACCESSWWWLUMERICOMX<br />
</pre><br />
<br />
This led to the website https://lumerico.mx/.<br />
<br />
=== LuméReaction ===<br />
<br />
[[File:Lumerico.png|thumbnail|right|The homepage of https://lumerico.mx]]<br />
<br />
The LumeriCo website was for fictional Mexican company LumériCo, who had built several reactors in Dorado. The website had a [https://lumerico.mx/news news page], noting the imminent opening of a new reactor on November 1 as well as a recent attack on the construction site. There were also [https://lumerico.mx/about About] and [https://lumerico.mx/login Login] pages.<br />
<br />
A few extra text files were found, none of them serving any apparent purpose or relevance:<br />
<br />
* https://lumerico.mx/robots.txt <br />
<br />
Allow: omnics<br />
<br />
This file is merely a joke about the [https://en.wikipedia.org/wiki/Robots_exclusion_standard Robots exclusion standard], a txt file usually included to tell bots accessing the site what they should and should not do - a common usage is telling Googlebot not to index the site on Google. However, Blizzard have instead chosen to allow Omnics, the fictional race of robots in the Overwatch universe, to access the site.<br />
<br />
* https://lumerico.mx/omnics.txt<br />
<br />
Allow: ??<br />
Allow: ???<br />
<br />
This seemed to be another joke about the Robots exclusion standard.<br />
<br />
* https://lumerico.mx/api<br />
<br />
{"message":"thanks for calling the api"}<br />
<br />
One final joke - this so-called "API" has no practical purpose.<br />
<br />
=== Phone Number ===<br />
<br />
At the bottom of the Lumerico website, a phone number was discovered: (510) 766-2726. ARG players called the phone number to hear [https://soundcloud.com/jackwilsdon/510-766-2726a a woman speaking in Spanish]. She says a string of numbers: <code>5-2-4-1-3 (pause) 23-4-14-8-6-18-17-23-21-18-15</code><br />
<br />
The second part translates (a=1, b=2, etc) to '''WDNHFRQWURO'''. After rotating 23 times (ROT-23 cipher) this becomes '''TAKECONTROL'''.<br />
<br />
=== Take Control ===<br />
<br />
The phone message lead to a more significant page on the site: https://lumerico.mx/TAKECONTROL/index.html. It was styled the same way as amomentincrime.com and featured [https://lumerico.mx/calavera.png an image of Sombra's skull icon], named "calavera.png" (a [https://en.wikipedia.org/wiki/Calavera Spanish name] for "skull" associated with the Mexican Day of the Dead). There was also text on the page:<br />
<br />
<pre style="word-break:break-all;word-wrap: break-word;"><br />
ethldtíoíesnoemfetuylm.bnlsssqtann)hcnslararuCpdGeoopéqubdsroaan.arnasdmdor1vrsmerñerlsdacnnnoaexedsidcn.iarsgcyi,iqeqnd.pooitoaeaaransterLetéáedasodocMrnseeiuCsimnosetlójnueodacapsadcoanfasest.rnucaodacadmdoemoipíogPoipbehaSussai.,yccandin.reueatenaoiorneoeetaoéyenimt¿rPehec,uurobudeílrysriteenasni,adngpjrálireecgrolsmhYnao?nmonomepeldezmapcpunoaulrrruCstmeitltetlróesoapsdéyufcuascaa,rensbuinergnqedlmvlbpdtaz.enebuineuldoerecrGefqfirrasulrbeatHsilnbaúaeeaaooassraooa,ioedo:aLiuielPr ursmoootlnielteeánlosulobeauaanopearrúiesltéyrosssisuaaeaenremsieaismdjmolrsspebiecdéyusittnvrcacp.taebrtLiunróporner<br />
<br />
eúcrneuyraarsettsyrseen.aaPnrneuyraeastuCpnhl/wLloaloa.qartlsyuínreute.evgdpiuábdmPooucvdeccmoreurr.o?unriorydbaSnalegeáezadienáutalaaioeemfcbgdinableoc¿éppoeocelsumuoaHearsosqadrrrftuLiorannnoneneriiatcnlomoqnaqdunrcno,enmerosaereisloabolii.e.dormerosepopdé,eo:r#5scoegaqoeaibs(edioraamtdírnlyoetjcgratmnrrobnrsstloeYqoeocicpnómlpernmaepogenmodqamubodnaeasuaenMoolloupeqvgrLtúr<br />
<br />
tsosrdvoeaerroaeusdmaauamoMobsnaeanraunnt,roierbeoiemaodbmantursotñauoureeuoerreopc.etlr<br />
<br />
sotñneerLimeaFsNJ<br />
</pre><br />
<br />
This is a column order transposition cipher with the key <code>5 2 4 1 3</code>, which was obtained in the phone call. The result is: (spaced out for clarity)<br />
<br />
Los felicito por haber llegado hasta aquí. Solo quería saber si estaban listos. (Hey, es muy difícil encontrar buena ayuda últimamente...deberían ver algunos de los payasitos que están trabajando conmigo) Por ahora, continuemos con el verdadero reto: acabar con LumériCo y su president e Guillermo Portero. ¿Y porqué? Porque es un hombre codicioso, corrupto y un ladrón abominable. Su plan de traer en línea el más grande y el más poderoso zigurat el 1 de noviembre no es nada más que una artimaña, un elaborado plan designado para ejercer aún más influencia sobre la gente de México y en gordar los bolsillos de sus compinches. ¿Y quién va a pagar por eso? La gente común y corriente, los mismos que siempre quedan olvidados.<br />
<br />
He empezado a mejorar mis protocolos para que sean usados para derrumbar la infraestructura de LumériCo y Los Muertos también están intentando levantarse en contra de la corrupción. Mientras tanto, escarben por el sitio de LumériCo y busquen información que podamos usar en contra del cabrón, mejor aún, encuentren su nombre de usuario y contraseña para asegurarnos de que ciertos detalles no muy favorables sobre el presidentito...aparezcan...<br />
<br />
Pude encontrar el nombre de usuario y contraseña de un empleado de soporte de LumériCo, empiecen por ahí:<br />
<br />
GFlores/g#fNwP5qJ<br />
<br />
Translated:<br />
<br />
I'm congratulating you for getting in here. I only wanted to know if you were ready or not. (Hey, it's really difficult to get good help lately... you should see some of the clowns I'm working with). For now, let's continue with the true challenge: taking down Lumerico Corp president Guillermo Portero. Why? Because he's a greedy and corrupt man, and an abominable thief. His plan of bringing in line the most powerful and biggest zigurat the 1st of november us nothing more than a deceit, an elaborate plan by his gang to become even more influential in the people of Mexico and get more money. And who's gonna pay for that? Common people, the ones that are always forgotten.<br />
<br />
I've started upgrading my protocols so that they are used to take down the Lumerico Corp infraestructure and Los Muertos are also trying to go against the corruption. Meanwhile, search the Lumerico Corp site for info we can use against the bastard, or better, get his username and password so that hundreds "not so favorable" facts about the president start popping up.<br />
<br />
I was able to get the username and pass of a Lumerico Corp employee, start here:<br />
<br />
GFlores/g#fNwP5qJ<br />
<br />
=== Presidential Login ===<br />
<br />
Using the credentials obtained through the message above on the https://lumerico.mx/login Lumerico login page], players accessed the account of Gonzalo Flores, including [https://lumerico.mx/email his emails]. Transcripts of these emails are archived [https://docs.google.com/spreadsheets/d/1zh7OU2dEOnD4X43ImvZBNpS75FLkj-rL75pXJ2l3TuQ/htmlview?sle=true# here].<br />
<br />
Here is the only email that held relevance to the ARG:<br />
<br />
<pre><br />
De:Valeria Valderrama<VValderama@lumerico.mx><br />
Para:Gonzalo Flores<GFlores@lumerico.mx><br />
Asunto:Página de Guillermo<br />
<br />
Hola, Gonzo:<br />
¿Puedes ver el tráfico de https://lumerico.mx/president-bypass? Guillermo debería ser el único accediendo desde su página de inicio privada, pero parece que está teniendo mucho tráfico. Tal vez tengamos que escalar esto a<br />
la señorita Jiménez, pero quiero estar segura de que es digno de su tiempo.<br />
<br />
Valeria Valderrama<br />
</pre><br />
<br />
The email references a lot of traffic to the [https://lumerico.mx/president-bypass President Bypass Link]. That page displays an "access denied" message, but there is a <code>President Auth-Bypass Revision 1.02: /.git/</code> line in the source code.<br />
<br />
This line led players to [https://github.com/internetwache/GitTools/tree/master/Dumper dump the data] from the [https://lumerico.mx/president-bypass/.git/ /.git/ subpage] with git protocol and upload it to [https://gist.github.com/anonymous/987beb6a5c817b53da820562854bdebe Github]. That were codebehind files for the website, including a '''class.authentication.php''' file containing an encryption function and '''class.president-bypass.php''' file containing the president's (Guillermo Portero) username <code>GPortero</code> and encrypted password <code>?MzY:MTI5:?AzY:OWM?:?EDO:ZGU?:jVTM:MTJm:2ITM:MTUw:?QjY:OWY?:?kTO:MTQx:?MzY</code>.<br />
<br />
ARG players with technical knowledge wrote a function that reversed the encryption from class.authentication.php and used it on the encrypted password. The resulting password was <code>Xy@4+Bkuqd<53uJ</code>.<br />
<br />
After logging in to the President's account, players were able to read his emails. After 30 minutes, another email appeared in the President's inbox, from Sombra herself:<br />
<br />
<pre><br />
Veo que se han podido infiltrar en su correo.<br />
No se preocupen, él no puede ver este correo, lo he ocultado de su vista si se conecta desde una de sus direcciones conocidas de IP.<br />
Necesito un poco más de tiempo para establecer el próximo grupo de potocolos. Manténganse atentos a principios de la otra semana. Le echaré unos cuantos trapitos sucios en sus correos para que se filtren al público<br />
"accidentalmente". Ya veremos como reaccionan los medios de comunicación.<br />
</pre><br />
<br />
The rough translation is:<br />
<br />
<pre><br />
I see you have been able to infiltrate into his mail.<br />
Don't worry, he cannot see this email, I've hidden it from his sight if he connects from one of his known IP addresses.<br />
I need a little bit of time to establish the next set of protocols. Stay alert early next week. I'll throw some dirty laundry in his emails that can "accidentally" leak to the public. We'll see how the media will react to that.<br />
</pre><br />
<br />
=== Admin Access ===<br />
<br />
[[File:Lumerico admin panel.png|thumbnail|right|The admin panel of the Lumerico site, only accessible by logging in as MJimenez]]<br />
<br />
On October 25, new emails were discovered in the GFlores account, but they had no immediate significance to the ARG. In addition, omnics.txt was updated:<br />
<br />
<pre><br />
Allow: Tzolk'in<br />
Allow: Imix ChikchanManik Imix ChikchanImixChikchanImix Manik Chikchan Imix Kimi Chikchan Chikchan Kimi ChikchanImixChikchanImix ChikchanKimi<br />
</pre><br />
<br />
Tzolk'in is the name of a [[Wikipedia:Maya calendar#Tzolk'in|Mayan Calendar]], and the second line was a series of animals from it in the Tzolk'in dialect. Imix stands for Day 1, Chikchan — 5, Manik — 7 and Kimi — 6. Turned into numbers, the string reads <code>1 57 1 5151 7 5 1 6 5 5 6 5151 56</code>. These digits turned into pictograms of [[Wikipedia:Maya numerals|Maya numerals]] (one by one, not numbers as a whole) written horizontally become <code>. -..- . -.-. ..- - . .- - - .- -.-. -.-</code> That is a morse code, which decodes to <code>EXECUTEATTACK</code>.<br />
<br />
This led us to https://lumerico.mx/EXECUTEATTACK/index.html, where the following text was discovered:<br />
<br />
<pre><br />
Ha llegado el momento. Esos correos expuestos la verdad sobre Portero, iniciado la revuelta, y hemos convencido a la gente de México a apoyar nuestra causa. Ahora es el momento para el golpe. Convertiremos su preciada inauguración el 1 de noviembre en un gran movimiento en su contra. Necesito que hagan una cosa:<br />
Consigan acceso al correo del jefa de seguridad y busquen alguna forma de ayudarme en el ataque. Es posible que lo vean contactando a Portero pronto. He cambiado su contraseña a: d0r*NuLw9<br />
</pre><br />
<br />
Translated to English:<br />
<br />
<pre><br />
The moment has come. These emails exposed the truth about Portero, initiated the revolt, and have convinced people of Mexico to support our cause. Now is the time to strike. Convert his precious inauguration on November 1 to a large movement against it. I need you to do one thing:<br />
Get access to the email security chief and seek some form of help in the attack. You may see her contacting Portero soon. I've changed her password: d0r*NuLw9<br />
</pre><br />
<br />
Logging in with the credentials <code>MJimenez / d0r*NuLw9</code> gave us access to the [https://lumerico.mx/admin admin panel] of Lumerico. Until 01 Nov. 2016 it stayed inactive and any command was answered with the same message saying the terminal disconnected.<br />
<br />
=== The Terminal ===<br />
Once the console became usable, players could type <code>help</code> to see a list of commands:<br />
<br />
'''override''' Engineer safety mode override<br />
'''help''' Provides help information about commands<br />
'''version''' Displays system version information<br />
'''about''' Displays information about the system<br />
'''grep''' Search output by string<br />
<br />
In the MJimenez email account, there was an email labeled <code>Corrupción de correo electrónico</code> with highlighted text in side of it, specifically <code>/ter/</code>. After some hard thinking, people discovered that doing <code>about | grep 'ter'</code> (in linux this is a command to list all the lines from the ''about'' that have a substring ''ter'') returns this text:<br />
<br />
'''Open''' source lightweight shell for any terminal.<br />
'''Anything''' with a terminal<br />
'''1.1.0''' - expanded terminal support<br />
<br />
The first word of every line given from the output was boldened and purple. Putting the words together, we got <code>OpenAnything1.1.0</code>, which was a solution which was used shortly.<br />
<br />
Another available command for the terminal was <code>override</code>. After typing <code>override</code>, the console prompted ARG players with three security questions:<br />
<br />
# '''Favorite Movie'''. The answer to the prompt is <code>some like it bot</code>, a movie from the Overwatch universe.<br />
# '''Favorite Cookie Flavor'''. The answer being <code>nuevas sabor delicias</code>, a flavor referenced in an email in the MJimenez account.<br />
# '''Secret'''. The answer to this prompt is <code>OpenAnything1.1.0</code>.<br />
<br />
This returned <code>OK</code>, gave players admin access, and enabled a new set of commands: <br />
<br />
'''ls''' Lists files by path<br />
'''cat''' Read file by path<br />
'''exec''' Execute a file <br />
<br />
Typing <code>ls</code> listed two files: <code>payload</code> and <code>d_ilqh_nhb.html</code> (the file name is a ROT23 for ''a_fine_key'').<br />
<br />
[[Image:A fine key.png|thumb|right|a_fine_key.html]] Reading the second file with <code>cat mnt/d_ilqh_nhb.html</code> yielded a text where ASCII characters (repeating string <code>vhnl tldv xyl vcxelo xv qhrtv. zkolg[nl]</code>) were in a shape of a key. Deciphering it using the Affine cipher (A=23, B=23) yielded the following string: <code>some keys are shaped as locks. index[me]</code>. It is assumed that ''some keys are shaped as locks'' line alluded to the [[#Tracer_Trail_Cipher|Tracer Trail]] ciphertext being used as a key.<br />
<br />
Simultaneously, entering <code>exec payload</code> presented players with a prompt — the answer to which is the [[#Tracer_Trail_Cipher|Tracer Trail]]. When inputted, players were given a message that looked quite similar to what was previously seen at amomentincrime.com. The counter shown in the top right is then incremented.<br />
<br />
[[Image:LumericoTerminalTracerEntered.jpg|850px]]<br />
<br />
=== Misdirection ===<br />
<br />
[[Image:LumericoHacked.jpg|thumb|right|lumerico.mx website hacked by Sombra]]<br />
<br />
On October 1, 2016, the lumerico.mx home page changed to show "glitches" and the black overlay with a message under the purple skull, while a string <code>&lt;!-- MISDIRECTION --></code> was also added to the source of the page.<br />
<br />
The message says: <br />
<br />
<pre><br />
Buen trabajo, amigos. No lo hubiera logrado sin su ayuda. En fin, me consiguieron los recursos que necesitaba para mi siguiente golpe – les encantará.<br />
Esperen noticias de mí en los próximos días...<br />
Les voy a mandar algo para agradecerles… Ojalá lo puedan aprovechar.<br />
Dasvidanya amigos<br />
</pre><br />
<br />
Translated:<br />
<br />
</pre><br />
Good job, folks. I would not have done it without your help. Anyway, I got the resources needed for my next hit - you'll love it.<br />
Expect to hear from me in the coming days...<br />
I'm going to send something to thank you ... Hopefully you can use it.<br />
Dasvidanya friends<br />
</pre><br />
<br />
[[File:Dia de los muertos spray.jpg|thumbnail|right|The Día de Los Muertos spray that was added to the game after Sombra hacked the Lumerico site]]<br />
<br />
Note that ''Dasvidanya'' is a phonetic transliteration of ''до свиданья'' — a russian phrase for "goodbye". The thing that Sombra sent as a ''thank you'' was a new spray, named "Día de Los Muertos" after the Mexican festival that took place at the same time as the ARG. The spray is currently only available on the PC version of the game.<br />
<br />
The '''MISDIRECTION''' string lead to the page [https://lumerico.mx/MISDIRECTION/index.html https://lumerico.mx/MISDIRECTION/index.html] containing:<br />
<br />
...Estableciendo conexiуn...<br />
...Protocolo Sombra v2.3 iniciado...<br />
<br />
...Desviando datos del zigurat de LumériCo hacia el objetivo...<br />
...Descifrando contraseсas del objetivo...<br />
...Acceso otorgado al directorio de volskayaindustries.com...<br />
<br />
...boop ;)...<br />
...Terminando conexión...<br />
<br />
Translated: <br />
<br />
...Establishing connection...<br />
...Sombra Protocol v2.3 initiated...<br />
<br />
...Forwarding the data from the LumériCo ziggurat to the target...<br />
...Deciphering the target passwords...<br />
...Access Granted to the directory of volskayaindustries.com...<br />
<br />
...boop ;)...<br />
...Ending connection..<br />
<br />
== Blizzcon ==<br />
<br />
Blizzcon 2016 opened with the [https://www.youtube.com/watch?v=Og5-Pm4HNlI Overwatch short "Infiltration"], a short depicting Reaper, Widowmaker, and Sombra on Volskaya Industries. During the showing of the short, Sombra's [https://playoverwatch.com/en-us/heroes/sombra hero page] went live, showcasing her abilities and character backstory.<br />
<br />
[[File:SombraBG.jpg|center|500px]]<br />
<br />
== References ==<br />
<br />
=== Community Resources ===<br />
<br />
A collection of tools and resources made by the Game Detectives Discord community for use in the ARG.<br />
<br />
==== ASCII Skull ====<br />
<br />
'''ASCII Skull Analysis:''' https://github.com/bahamas10/sombra<br />
<br />
'''Removing SOMBR@ Analysis:''' https://pastebin.com/15u27YTC<br />
<br />
'''ASCII Skull Eye Analysys:''' https://docs.google.com/spreadsheets/d/1-JQpWyitMKYhP-4l8ZDFiJI3NjqRrvoEnRdFQawike8<br />
<br />
==== Google Docs ====<br />
<br />
'''Observations and Speculations Spreadsheet:''' https://docs.google.com/spreadsheets/d/1rI08baFQmAwaqHC-9GF9VNGCYjuRE-q4LN9k4ottjuQ/pubhtml<br />
<br />
'''LumériCo Emails and Translations Spreadsheet:''' https://goo.gl/cQgdIJ (Courtesy of UberPilot)<br />
<br />
==== Tracer Code ====<br />
<br />
'''GOL! Guesser:''' https://axxim.net/ow/gol-guesser/<br />
<br />
'''Uber GOL! Guesser:''' https://axxim.net/ow/gol-guesser/uber/<br />
<br />
The Uber GOL! Guesser only prints out UTF-8 compliant results, which makes it easier to identify potentially correct answers.<br />
<br />
'''Bruteforcing tool:''' https://github.com/glv2/bruteforce-salted-openssl<br />
<br />
=== Third-Party Resources ===<br />
<br />
A collection of third-party tools and resources that the Game Detectives Discord community has used in the ARG.<br />
<br />
==== Image of Reaper ====<br />
<br />
'''stegdetect (Linux):''' https://github.com/abeluck/stegdetect<br />
<br />
stegdetect is a Linux utility used to determine if a given image may contain encoded information.<br />
<br />
'''JPHide & JPSeek:''' https://linux01.gwdg.de/~alatham/stego.html<br><br />
'''iSteg (Mac OSX):''' https://www.hanynet.com/isteg/<br />
<br />
JPHide & JPSeek is used to hide and find, respectively, a file inside a JPEG image.<br><br />
iSteg works similarly to JPHide on the Mac OSX platform.<br />
<br />
'''stegbreak (Linux):''' https://linux.die.net/man/1/stegbreak<br />
<br />
stegbreak is used to do brute-force dictionary attacks on JPEG images.<br />
<br />
=== Easter Eggs ===<br />
<br />
The following are collection of references and Easter Eggs encountered throughout the ARG.<br />
<br />
==== In-Game ====<br />
<br />
'''Sombra's "Amused" Emote'''<br />
<br />
This character emote features the [[Sombra_ARG_False_Leads | Skycode]], accompanied by soft music resembling the [https://www.reddit.com/r/Overwatch/comments/4w7ey1/the_sombra_skysong/ Skysong]. Sombra's expression is one of amusement, and it's a nod to the community's prolonged creative attempts to solving an nonexistent puzzle.<br />
<br />
[[File:EmoteSkycode.png|200px]]<br />
<br />
'''Skycode Spray'''<br />
<br />
This character spray features Sombra's iconic skull in front of a compass rose and the [[Sombra_ARG_False_Leads | Skycode]]. This is a reference to both the [[#Directions_&_Letters|cardinal directions]] used in one of the puzzles and to the Skycode, which is considered the most significant false lead that solvers encountered.<br />
<br />
[[File:SkycodeSpray.png|200px]]<br />
<br />
==== In-ARG ====<br />
<br />
'''Espresso Command'''<br />
<br />
There was a hidden command in LumériCo's [[#The_Terminal | admin terminal]]. Inputting the word <code>espresso</code> returned the following message: <code>Coffee Pot Status: Brewed approximately 23 hours ago, currently 0% full</code><br />
This is referencing a variety of [https://goo.gl/cQgdIJ emails] found in the LumériCo site involving broken espresso machines and incompetent coffee brewing, which caught the attention of the community and gave way to a vast variety of mediocre jokes. Furthermore, "23 hours" makes reference to the number 23, which was believed by many to possess some sort of significance to the ARG, as Sombra would be the 23rd character in Overwatch. Finally, "0%" references the ARG's notable waiting periods that have been widely criticized by the community, specifically [[#A_Moment_in_Crime_Transmission | A Moment in Crime's upload percentage]].<br />
Due to the iconic purple text it is believed that this hidden command was created by Sombra herself.<br />
<br />
[[File:EspressoCommand.png]]<br />
<br />
=== Media Appearances ===<br />
<br />
'''3rd Aug. 2016'''<br />
<br />
[EN] [https://kotaku.com/overwatch-fans-find-new-clues-about-the-mysterious-hero-1784767759 Kotaku - Overwatch Fans Find New Clues About The Mysterious Hero Sombra]<br />
<br />
[EN] [https://www.polygon.com/2016/8/3/12369144/overwatch-summer-games-sombra-arg-blizzard?utm_campaign=polygon&utm_content=chorus&utm_medium=social&utm_source=twitter Polygon - Overwatch fans are trying to crack the latest mystery about Sombra]<br />
<br />
[EN] [https://www.pcgamesn.com/overwatch/overwatch-sombra PCGamesN - Overwatch's Sombra ARG continues with new clues, but no solutions]<br />
<br />
[EN] [https://team-dignitas.net/articles/blogs/overwatch/9989/who-is-sombra-all-facts-and-clues-about-sombra Team-Dignitas - Who is Sombra? All facts and clues about Sombra]<br />
<br />
[FR] [https://overwatch.gamewave.fr/un-nouveau-code-cache-dans-la-derniere-cinematique-d-overwatch/ Gamewave - UN NOUVEAU CODE CACHÉ DANS LA DERNIÈRE CINÉMATIQUE D'OVERWATCH!]<br />
<br />
[EN] [https://www.follownews.com/overwatch-fans-find-new-clues-about-the-mysterious-hero-sombra-1nhqt FollowNews - Overwatch Fans Find New Clues About The Mysterious Hero Sombra]<br />
<br />
'''4th Aug. 2016'''<br />
<br />
[EN] [https://www.pcgamer.com/overwatch-summer-games-trailer-hides-a-mysterious-secret/ PCGamer - Overwatch Summer Games trailer hides a mysterious secret]<br />
<br />
[SK] [https://www.sector.sk/novinka/121273/nove-overwatch-video-obsahuje-dalsie-tajomstva.htm Sector - Nové Overwatch video obsahuje ďalšie tajomstvá]<br />
<br />
[EN] [https://www.techinsider.io/overwatch-sombra-character-2016-8 Techinsider - 'Overwatch' players are going to insane lengths to solve a mystery that Blizzard's teased for months]<br />
<br />
[EN] [https://gamerant.com/overwatch-sombra-clues/ Gamerant - Overwatch Players Uncover More ‘Sombra’ Clues]<br />
<br />
[HU] [https://www.gamestar.hu/hir/overwatch-sombra-karakter-214739.html Gamestar - Overwatch - újabb nyomok utalnak a még be nem jelentett hősre]<br />
<br />
'''5th Aug. 2016'''<br />
<br />
[EN] [https://kotaku.com/days-later-overwatch-fans-cant-figure-out-the-sky-cod-1784872143 Kotaku - Days Later, Overwatch Fans Can't Figure Out The 'Sky Code' Mystery]<br />
<br />
[NL] [https://www.gamersnet.nl/nieuws/201608/cryptische_speurtocht_naar_overwatch_nieuwe_heldin_sombra_gaat_bizar_diep/ Gamersnet - Cryptische speurtocht naar Overwatch' nieuwe heldin Sombra gaat bizar diep]<br />
<br />
[ES] [https://www.alfabetajuega.com/noticia/overwatch-el-enigma-de-sombra-sigue-ofreciendo-nuevos-detalles-n-71772 Alfa Beta Jeuga - Overwatch: El enigma de Sombra sigue ofreciendo nuevos detalles]<br />
<br />
[EN] [https://www.youtube.com/watch?v=5ROjN-_F0ZU&feature=youtu.be&t=4m22s IGN (Video) - Sombra: Overwatch's Secret New Hero - Overwatch HQ]<br />
<br />
'''7th Aug. 2016'''<br />
<br />
[EN] [https://www.gamespresso.com/2016/08/summary-state-sombras-arg-overwatch/ Gamespresso - Summary of the state of sombra's ARG in Overwatch]<br />
<br />
'''8th Aug. 2016'''<br />
<br />
[EN/CN] [https://www.zhentoo.com/doc92368 Zhentoo - Overwatch new hero Secret Dorado hidden mystery] <br />
<br />
[EN] [https://www.technewstoday.com/30880-overwatch-sombra-continues-to-elude-detectives/ TechNewsToday - Overwatch: Sombra Continues to Elude Detectives]<br />
<br />
'''11th Aug. 2016'''<br />
<br />
[EN] [https://www.youtube.com/watch?v=IZR-pa0it4Q The Know - New Overwatch Hero Hints]<br />
<br />
'''12th Aug. 2016'''<br />
<br />
[EN] [https://kotaku.com/after-two-weeks-overwatch-fans-sombra-investigation-re-1785204389 Kotaku - Overwatch Fans' Sombra Investigation Reaps A Skull Code]<br />
<br />
'''14th Aug. 2016'''<br />
<br />
[EN] [https://gamerant.com/overwatch-sombra-skull-code/ Gamerant - Skull Code is Latest Clue in Overwatch’s Sombra Investigation]<br />
<br />
'''16th Aug. 2016'''<br />
<br />
[EN] [https://www.christiantoday.com/article/overwatch.dlc.update.skull.code.the.latest.clue.for.sombra.investigation/93197.htm Christian Today - 'Overwatch' DLC update: Skull Code the latest clue for Sombra investigation]<br />
<br />
[EN] [https://en.yibada.com/articles/151811/20160816/overwatch-dlc-update.htm Yibada - 'Overwatch' DLC update: New clues on Sombra's inclusion to the roster revealed]<br />
<br />
'''23rd Aug. 2016'''<br />
<br />
[EN] [https://www.technewstoday.com/31129-overwatch-all-we-know-about-the-sombra-arg/ Tech News Today - Overwatch: All We Know About the Sombra ARG]<br />
<br />
'''24th Aug. 2016'''<br />
<br />
[EN] [https://gamerant.com/overwatch-forums-sombra-message/ Gamerant - Overwatch Forums Glitch Out, Reveals Hidden Message From Sombra]<br />
<br />
[EN] [https://gamerant.com/overwatch-sombra-clue-website/ Gamerant - New Website Counts Down To Next Clue For Overwatch’s Sombra]<br />
<br />
[EN] [https://www.polygon.com/2016/8/24/12623736/overwatch-sombra-arg-clues-skycoder Polygon - Overwatch's Sombra mystery appears to be coming to a close]<br />
<br />
[EN] [https://www.vg247.com/2016/08/24/overwatch-forums-glitch-out-reveal-a-message-from-the-mysterious-sombra/ VG247 - Overwatch forums glitch out, reveal a message from the mysterious Sombra]<br />
<br />
[EN] [https://www.technewstoday.com/31151-sombra-hacks-into-overwatch-forums/ Tech News Today - Sombra Hacks Into Overwatch Forums]<br />
<br />
[EN] [https://www.ign.com/articles/2016/08/24/overwatch-mystery-character-sombra-could-be-revealed-today IGN - Overwatch Mystery Character Sombra Could Be Revealed Today]<br />
<br />
'''25th Aug. 2016'''<br />
<br />
[EN] [https://kotaku.com/overwatch-players-are-getting-fed-up-with-the-sombra-ar-1785765307 Kotaku - Overwatch Players Are Getting Sick Of The Sombra ARG]<br />
<br />
[EN] [https://www.ign.com/articles/2016/08/25/overwatch-made-the-internet-lose-its-mind-last-night-and-i-had-a-front-row-seat IGN - Overwatch Made the Internet Lose its Mind Last Night, And I Had a Front-Row Seat]<br />
<br />
[EN] [https://www.technewstoday.com/31182-overwatch-countdown-to-sombra/ Tech News Today - Overwatch: Countdown to Sombra]<br />
<br />
<br />
'''30th Aug. 2016'''<br />
<br />
[EN] [https://www.pcgamer.com/overwatch-sombra-arg-mystery/ PC Gamer - Overwatch's Sombra riddle begins to irritate the players trying to solve it]<br />
<br />
'''3rd Oct. 2016'''<br />
<br />
[EN] [https://www.mobilenapps.com/articles/19398/20161003/overwatch-update-sombra-blizzcon-halloween-event-leak.htm Mobile & Apps - Sombra To Be Revealed At Blizzcon? Halloween Event Confirmed In Data Leak]<br />
<br />
'''4th Oct. 2016'''<br />
<br />
[EN] [https://www.itechpost.com/articles/36011/20161004/overwatch-overwatch-update-overwatch-finally-getting-sombra-overwatch-sombra-sombra.htm iTechPost - Overwatch Update: Are We Finally Getting Sombra?]<br />
<br />
'''11th Oct. 2016'''<br />
<br />
[EN] [https://www.kotaku.com.au/2016/10/overwatch-fans-hacked-actual-people-in-an-attempt-to-find-sombra/ Kotaku - Overwatch Fans Hacked Actual People In An Attempt To Find Sombra]<br />
<br />
'''17th Oct. 2016'''<br />
<br />
[EN] [https://telkomgaming.co.za/will-sombra-hack-her-way-into-blizzcon-2016/ TelKom Gaming - Will Sombra Hack Her Way Into BlizzCon 2016?]<br />
<br />
'''18th Oct. 2016'''<br />
<br />
[EN] [https://overwatchtips.info/overwatch-sombra-arg-everything-you-need-to-know/ OverwatchTips - Everything You NEED To Know (Sombra ARG)]<br />
<br />
'''26th Oct. 2016'''<br />
<br />
[EN] [https://mic.com/articles/157757/overwatch-sombra-arg-everything-we-know-about-the-countdown-and-rumored-nov-1-release#.UILrZHRiM Min Network - Everything we know about Blizzard's rumored Nov. 1 release]<br />
<br />
'''28th Oct. 2016'''<br />
<br />
[EN] [https://kotaku.com/imagining-horror-stories-for-a-never-ending-overwatch-a-1788324673 Kotaku - Imagining Horror Stories Of A Never-Ending Overwatch ARG]<br />
<br />
'''1st Nov. 2016'''<br />
<br />
[EN] [https://www.ign.com/videos/2016/11/01/will-overwatchs-sombra-be-at-blizzcon-2016 IGN - Will Sombra be at BlizzCon 2016?]<br />
<br />
'''8th Nov. 2016'''<br />
<br />
[EN] [https://mic.com/articles/158812/overwatch-sombra-arg-gameplay-emote-directly-references-one-of-the-wildest-fan-theories Mic Tech - 'Overwatch' Sombra ARG: Gameplay emote directly references one of the wildest fan theories]</div>Halke234