https://wiki.gamedetectives.net/api.php?action=feedcontributions&user=Kkzzzkt&feedformat=atomGame Detectives Wiki - User contributions [en]2024-03-28T23:15:25ZUser contributionsMediaWiki 1.30.0https://wiki.gamedetectives.net/index.php?title=Waking_Titan&diff=19401Waking Titan2020-10-30T15:53:42Z<p>Kkzzzkt: removed some fluff to shorten page; rephrased a few things.</p>
<hr />
<div>{{argbox<br />
| float = right<br />
| image = File:Project WT logo.png<br />
| imagewidth = 400<br />
| name = [[Waking Titan]]<br />
| description= Waking Titan was an ARG which led towards the [https://www.nomanssky.com/atlas-rises-update/ Atlas Rises] and [https://www.nomanssky.com/next-update/ NEXT] updates for No Man's Sky.<br />
| creator = [http://www.aliceandsmith.com/ Alice & Smith]<br />
| creator2 = [http://www.hellogames.org/ Hello Games]<br />
| type = Official<br />
| status = Completed<br />
| discovered = 2017-05-28<br />
| completed = 2018-07-20<br />
}}<br />
{{ArgHeader}}<br />
{{BackToTop}}<br />
<br />
=== Description ===<br />
Waking Titan (also known as Project WT) is an official ARG (alternate reality game) for No Man's Sky that involves a multitude of websites, phone numbers, and radio stations scattered across the world. The ARG is produced by veteran puppet masters [http://www.aliceandsmith.com/ Alice & Smith], and features NPCs, actors, and live events.<br />
<br />
The story surrounds innovative technologies and experiments employed by the Atlas Foundation and its family of businesses.<br />
<br />
=== Contents ===<br />
The ARG encompassed two "seasons," each leading to a new update for No Man's Sky. Season 1 of Waking Titan led to the release of the [https://www.nomanssky.com/atlas-rises-update/ Atlas Rises update], and Season 2 to the release of [https://www.nomanssky.com/next-update/ No Man's Sky: NEXT]. Each season was further divided into three distinct "'''phases'''". Each phase is documented on its own wiki page:<br />
<br />
{| class="wikitable"<br />
!colspan="2"|Season 1<br />
|-<br />
|[[Waking_Titan/Phase_1 | Phase 1]] <br />
|Phase 1 of Waking Titan lasted from 2017-05-28 to 2017-07-08.<br />
|-<br />
|[[Waking_Titan/Phase_2 | Phase 2]] <br />
|Phase 2 of Waking Titan lasted from 2017-07-21 to 2017-08-05.<br />
|-<br />
|[[Waking_Titan/Phase_3 | Phase 3]]<br />
|Phase 3 of Waking Titan lasted from 2017-08-05 to 2017-08-07.<br />
|-<br />
!colspan="2"|Season 2<br />
|-<br />
|[[Waking_Titan/Phase_4 | Phase 4]]<br />
|Phase 4 of Waking Titan lasted from 2017-12-28 to 2018-06-01.<br />
|-<br />
|[[Waking_Titan/Phase_5 | Phase 5]]<br />
|Phase 5 of Waking Titan lasted from 2018-06-01 to 2018-07-20.<br />
|-<br />
|[[Waking_Titan/Phase_6 | Phase 6]]<br />
|Phase 6 of Waking Titan began and ended on 2018-07-20.<br />
|}<br />
<br />
'''''Note:''' This is a '''summary''' page. For more in-depth descriptions of each phase, including detailed descriptions of puzzle solutions, check the [[Waking_Titan/Phase_1|Phase 1]], [[Waking_Titan/Phase_2|Phase 2]], [[Waking_Titan/Phase_3 | Phase 3]], [[Waking_Titan/Phase_4 | Phase 4]], [[Waking_Titan/Phase_5 | Phase 5]], and [[Waking_Titan/Phase_6 | Phase 6]] pages.''<br />
__TOC__<br />
<br />
== Introduction ==<br />
<br />
On 2017-05-27, Twitter user @argn [https://twitter.com/argn/status/868587449613766658 tweeted a link] to [http://www.project-wt.com/ 'project-wt.com']. The link led to a website which contained a map showing sixty locations, four of which were "active" at the time. The locations, when clicked on, revealed the location's name and status. The active locations also revealed a link to a livestream of a local radio station, originating from the corresponding location. The project-wt website displayed a date, June 8th, and stated that the first clue was being "initialized".<br />
<br />
On 2017-06-01, moderators of No Man's Sky subreddits [https://reddit.com/r/nomansskythegame /r/NoMansSkyTheGame], [https://www.reddit.com/r/NMSPortals/ /r/NMSPortals], and [https://www.reddit.com/r/NMSGalacticHub/ /r/NMSGalacticHub] started to receive cassette tapes in the mail. Each cassette tape was labelled with a number out of 16. The Waking Titan ARG was initially thought to be a separate ARG from these tapes, but connections between the two made it clear that they were, in fact, one and the same.<br />
<br />
== Content Overview ==<br />
<br />
=== Internal Memos and Files ===<br />
<br />
[[File:WT glyph 1 pdf.png|280px|thumbnail|right|One of the internal memos discovered in Waking Titan]]<br />
<br />
Throughout the ARG, in-game characters have communicated with each other via "internal memos". Over time, these memos were discovered by ARG players, in the form of PDF files, physical papers, and text files.<br />
<br />
'''Season 1'''<br />
<br />
* [http://wiki.gamedetectives.net/index.php?title=File:WT_glyph_1_pdf.png Teamwork Assessment]<br />
* [http://wiki.gamedetectives.net/index.php?title=File:WT-Dataset-97C.jpg Dataset 97C]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/data/7d3dd080-2a43-4882-833c-f4d7bd7ba607.pdf Assurance]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/data/c01-331c6734-a013-4695-8e47-08a9ee05d5e5.pdf 017-a24]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/data/c02-9936c797-ec28-4f8f-b80e-dee9e0b06433.pdf 021-f16]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/mercury/mercury-01-98748sfdlka87.pdf Mercury Process Self-Diagnosis Report]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/data/57201e0d-01a3-4f6a-bbb4-2be8b7c8880f.pdf Progress Report]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/data/94a10118-0728-4900-9730-f82a9d412745.pdf Breakthroughs and Breaking Through]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/6c285180-ec4d-48a2-967f-8a7af3b50008.pdf Subject M-N00-dl35]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/410a3e5d-01e7-4058-a23c-ca5fdde97f9d.pdf Atlas Foundation Threat Models]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/7a6594ac-ca5e-467a-b6f4-9fb91f069d0a.pdf Advanced Calibration - Optional]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/a9d988c1-ec92-46da-a64e-ab90390ae041.pdf Phase 2 Complete]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/a224a1f4-00e5-467b-9893-83fcc1a4f19a.pdf Unlocking Mercury Process File L16.jpg]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/b91f9959-6a3c-4011-b3b5-a1ff757a5e4c.pdf Phase 3]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/b0f33d53-5a8c-4a9a-b5fc-395562e463a8a+.pdf Log.1291]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/a09-179bf8d2-c13e-4c66-982e-b37ab3efd5bb.pdf Breach of Contract]<br />
<br />
'''Season 2'''<br />
<br />
* [https://wiki.gamedetectives.net/images/6/6e/Memo2.png Waking Titan S2 - Under Preparation]<br />
* [https://s3.amazonaws.com/ware-extranet/documents/FIRST_STEPS/Notes_on_Moscow.jpg Mr. Zheng's Notes on Moscow Conference]<br />
<br />
* '''Zheng's Postcards''' — [https://s3.amazonaws.com/ware-extranet/documents/SECURITY/postcard1_jhlj039u.jpg (1)]; [https://s3.amazonaws.com/ware-extranet/documents/SECURITY/postcard2_kg8nao6.jpg (2)]; [https://s3.amazonaws.com/ware-extranet/documents/SECURITY/postcard3_tesaud636.jpg (3)]<br />
<br />
* '''Mr. Zheng's Journal Logs''' — [https://s3.amazonaws.com/ware-extranet/documents/FIRST_STEPS/Journal_Academy.png Academy]; [https://s3.amazonaws.com/ware-extranet/documents/DESIGN/Journal_HotelDieu.png Hotel Dieu]; [https://s3.amazonaws.com/ware-extranet/documents/DEVELOPMENT/Journal_Louvre.png Louvre]; [https://s3.amazonaws.com/ware-extranet/documents/RESEARCH/Journal_London.png London]; [https://s3.amazonaws.com/ware-extranet/documents/SECURITY/Nightmare.jpg Nightmare]<br />
<br />
* [https://s3.amazonaws.com/philojeux.com/images/Jeu_Capture_d_Ecran.jpg Jeu_Capture_d_Ecran.jpg]<br />
* [https://pastebin.com/EHA6ZU8x Arnaud Lacours Foundation Email]<br />
* [https://drive.google.com/open?id=1la3UNKHc5yeaB_w2a2tK1cjKN44oEmCo Arnaud Lacours Datadumps - INYOURMIND.exe failed]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/94c02878-e023-46a3-9316-db4177c4eaa6+.pdf WARE REPORT #26]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/1cd5226d-6639-4bbd-855a-4bf8f60866c3.pdf Concerns Regarding Captain Harry]<br />
* [https://drive.google.com/file/d/1zJ0SdAZIRj1mDn7W3TuzLC6wNy3Mor4L W/ARE R&D Incident Report]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/70a25e6c-95ed-42d4-8de8-c3948255174c+.pdf Myriad Crisis Event Timeline]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/19997bb6-18e5-4427-86c7-b0f3c1826ca2.pdf State of the Atlas Foundation]<br />
* [https://pastebin.com/NYLiFuNY Log.3022]<br />
<br />
* '''W/ARE - Dreamer Patient Files''' — [https://s3.amazonaws.com/ware-virtual-dashboard/files/Phillip-PatientFile.pdf Phillip Moretti]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/EunHa-PatientFile.pdf Kwon Eun Ha]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/498hd98h3444-3339e/Alexander-PatientFile.pdf Alexander Bordeleau]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/GCMnQmM9E3v7L8wuv-V2FUY7P/Claire-PatientFile.pdf Claire Sandfield]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/kh2jsaljs901m-asd1n1lwks/Tariq-PatientFile.pdf Tariq]; [https://ware-virtual-dashboard.s3.amazonaws.com/files/GCMnQmM9E3v7L8wuv-V2FUY7P/Toby-PatientFile.pdf Toby Mulligan]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/ga3ms81-2ms92fbl/Mike-PatientFile.pdf Mike Pasquale]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/kajs61ns-82baks8nx/Nina-PatientFile.pdf Nina Flores]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/ga3ms81-2ms92fbl/Simon-PatientFile.pdf Simon Quinn]; [https://ware-virtual-dashboard.s3.amazonaws.com/files/kajs61ns-82baks8nx/Isabella-PatientFile.pdf Isabella Schiavone]; [https://ware-virtual-dashboard.s3.amazonaws.com/files/kajs61ns-82baks8nx/Alisha-PatientFile.pdf Alisha Brown]<br />
<br />
* [https://pastebin.com/eSLLWN8L Log.4391]<br />
<br />
=== Newsletters ===<br />
<br />
The various newsletters received at multiple points throughout Waking Titan.<br />
<br />
'''Season 1'''<br />
<br />
* [https://us15.campaign-archive.com/?u=4483c19308fc0764a930106a0&id=c713d0f4ce&e=225c6a2e26 Welcome, Citizen Scientist!] - ''CSD''<br />
<br />
* [https://mailchi.mp/3582bec6b801/update-june-8th-waking-titan-137705?e=225c6a2e26 Citizen Scientists, Your Wait is Over.] - ''CSD''<br />
<br />
* [https://mailchi.mp/3582bec6b801/update-june-8th-waking-titan-137705?e=225c6a2e26 Calibrating Waking Titan: Action Required] - ''CSD''<br />
<br />
* [https://mailchi.mp/0b591b68ac72/update-june-8th-waking-titan-137717?e=225c6a2e26 Waking Titan: Mission Azure Voyage] - ''CSD''<br />
<br />
* [https://mailchi.mp/d8e47d2ee1bf/update-june-8th-waking-titan-137725?e=225c6a2e26 Your Level 4 Atlas Pass] - ''CSD''<br />
<br />
* [https://mailchi.mp/0c1dc672c943/update-june-8th-waking-titan-137733?e=225c6a2e26 Waking Titan Has Ended] - ''CSD''<br />
<br />
* [https://mailchi.mp/63f179c006f0/update-june-8th-waking-titan-137737?e=225c6a2e26 Mercury Process Completion Report] - ''CSD // Mercury''<br />
<br />
'''Season 2'''<br />
<br />
* [https://wiki.gamedetectives.net/images/7/7b/WareNewsletter1.png News from WARE!] - ''W/ARE Newsletter''<br />
<br />
* [https://cdn.artemisbot.uk/mail/WARE-2018-04-22T00:17:13.000Z.jpg W/ARE Dev Kit Update #2] - ''W/ARE Newsletter''<br />
<br />
* [https://cdn.artemisbot.uk/mail/WARE-2018-05-04T23:22:45.000Z.jpg W/ARE Dev Contest] - ''W/ARE Newsletter''<br />
<br />
* [https://cdn.artemisbot.uk/mail/WARE-2018-05-12T00:20:04.000Z.jpg W/ARE Dev Contest Winners] - ''W/ARE Newsletter''<br />
<br />
* [https://mailchi.mp/9aaa8aa62cc1/update-june-8th-waking-titan-137741?e=225c6a2e26 Attention Citizen Scientists] - ''CSD''<br />
<br />
* [https://mailchi.mp/c3384d592000/update-june-8th-waking-titan-137745?e=225c6a2e26 Attention Citizen Scientists - Suspicious Lab Tracking] - ''CSD''<br />
<br />
* [https://mailchi.mp/108412dac3c2/update-june-8th-waking-titan-137749?e=225c6a2e26 Attention Citizen Scientists - Global Mobilization Required] - ''CSD''<br />
<br />
* [https://mailchi.mp/b902d5eadba6/update-june-8th-waking-titan-137753?e=225c6a2e26 Mercury Process Inquiry] - ''CSD // Mercury''<br />
<br />
* [https://mailchi.mp/9a49b85f6bf3/update-june-8th-waking-titan-137757?e=225c6a2e26 Attention Citizen Scientists - Help Required] - ''CSD''<br />
<br />
=== ARG Sites ===<br />
<br />
The numerous websites made for the ARG, listed in order of their appearance. Some sites have taken offline since the ARG began, and as such have been replaced with Wayback Machine archive links.<br />
<br />
* [https://web.archive.org/web/20170713212035/http://project-wt.com/ Project-wt]<br />
* [https://web.archive.org/web/20180522070818/http://www.etarc.org/ ETARC]; [https://forums.atlas-65.com ETARC Forums]<br />
* [https://web.archive.org/web/20180808021643/http://wakingtitan.com/ Waking Titan]<br />
* [https://web.archive.org/web/20170630192104/http://www.echo-64.com/ Echo]<br />
* [https://web.archive.org/web/20170718211517/http://www.multiverse-75.com/ Multiverse]<br />
* [https://web.archive.org/web/20170801235515/http://www.myriad-70.com/ Myriad]<br />
* [https://web.archive.org/web/20170801115904/https://www.superlumina-6c.com/ Superlumina]<br />
* [https://web.archive.org/web/20180808083202/http://atlas-65.com/ The Atlas Foundation]; [https://csd.atlas-65.com Citizen Science Division]<br />
<br />
* [https://web.archive.org/web/20180610130533/http://ware-tech.cloud W/ARE - Dream Better]<br />
* [http://www.philojeux.com/ Philo Jeux]<br />
* [https://www.satcom-70.com Satcom]; - inoperable<br />
<br />
'''''Note:''' Websites hosted on Wayback may lack some functionality found in their original counterparts.''<br />
<br />
=== Music ===<br />
<br />
Throughout the ARG, partial Youtube video addresses for songs have been found written in Waking Titan's memos, websites, and surveys. While these were never explained, there are apparent thematic relevancies in each song that reflect concepts being explored in the ARG at the time of their appearance. All of these songs can be found compiled here: [https://www.youtube.com/playlist?list=PLEZy8wyuYLpLw0e5kkMyBUHO_s-V8f0Qk WT Season 1]; [https://www.youtube.com/playlist?list=PLEZy8wyuYLpLr5K38bsAqWcO7bTcXfRlW WT Season 2]<br />
<br />
== Phase Summaries ==<br />
<br />
=== Phase 1 ===<br />
<br />
[[File:Wakingtitan site.png|thumbnail|450px|right|The default appearance of the Waking Titan site during Phase 1, with no sigils or glyphs solved]]<br />
<br />
During [[Waking_Titan/Phase_1 | Phase 1]], the http://wakingtitan.com hosted 6 triangles in the middle of the page. These triangles were referred to as "'''Sigils'''", while the white icons along the bottom of the page were referred to as "'''Glyphs'''". Each sigil and glyph, when clicked, lead to a password entry prompt - the correct passwords for all 6 sigils and the first 5 glyphs were discovered via puzzle-solving during Phase 1 of Waking Titan.<br />
<br />
The sigil and glyph puzzles were solved collaboratively - while it may have be possible to solve some of these puzzles individually, most of them required a collaborative effort. For instance, some puzzles required players to meet agents from the Atlas Foundation in person, and to relay information obtained from these meetings back to the community. A list of all sigil and glyph solutions for Phase 1 can be found below:<br />
<br />
[[File:WT Phase 1 complete.png|600px]]<br />
<br />
This phase culminated on July 8, 2017, with a [[Waking_Titan/Phase_1#End_of_Phase_1| congratulatory message from Elizabeth Leighton]], the CEO of the Atlas Foundation.<br />
<br />
=== Phase 2 ===<br />
<br />
[[File:Hampster maze.jpeg|thumbnail|450px|right|One of the puzzles that appeared on the Waking Titan [http://twitch.tv/wakingtitan Twitch Stream]]]<br />
<br />
During [[Waking_Titan/Phase_2 | Phase 2]], the http://wakingtitan.com site hosted a command-line interface terminal. Various commands were accepted as input, which triggered different events. One of the most notable commands was the <code>WHOIS <argument></code> command, which revealed a passage of text pertaining to the specified argument. For instance, the command <code>WHOIS FOURTH RACE</code> returned the following message:<br />
<pre><br />
INCOMING TRANSMISSION… SOURCE: UNKNOWN…<br />
You are not – kzzktt – alone –<br />
Please, identify yourself. I’m – kzzkttk –<br />
</pre><br />
<br />
Additionally, http://project-wt.com hosted a "Calibration" utility during Phase 2. To successfully perform these calibrations, players had to upload images of various objects and buildings to the site. For instance, the first calibration required images of "public resonant percussion instruments".<br />
<br />
Finally, towards the end of Phase 2, the Waking Titan [http://twitch.tv/wakingtitan Twitch stream] went live, displaying a five-monitor setup. Throughout the duration of the stream, players had to work together to solve puzzles that were displayed on these monitors. Some of these puzzles were interactive; for example, one puzzle that was repeated several times involved the Twitch chat guiding a virtual hamster through a maze.<br />
<br />
Additionally, players solved another 3 glyphs throughout Phase 2. The solutions to these glyphs are shown below:<br />
<br />
[[File:WT Phase2 Passwords.png|450px]]<br />
<br />
=== Phase 3 ===<br />
<br />
{{#evt:<br />
service=youtube<br />
|id=https://www.youtube.com/watch?v=QhX9z4dDAa4<br />
|alignment=right<br />
}}<br />
<br />
[[Waking_Titan/Phase_3|Phase 3]] was the briefest phase of Waking Titan. It consisted of the conclusion of the [http://twitch.tv/wakingtitan Twitch stream] that began at the [[Waking Titan/Phase 2#End of Phase 2|end of Phase 2]]. Players solved more interactive puzzles on the Twitch stream, before the rogue AI Loop16 asked them a final question: <code>SHOULD I EXIST?</code> The overwhelming response from the community was "yes".<br />
<br />
After receiving this response, Loop16 and '''Emily''' of the ETARC forums were revealed as being one and the same. Loop16 generated a heartfelt "Thank You" video to round out the stream, before finally taking the 72-hour stream offline.<br />
<br />
Shortly after this, players received emails with the subject line <code>Waking Titan has Ended</code>. The contents of the message were as follows:<br />
<br />
<pre><br />
Hello, Citizen Scientist,<br />
<br />
Thank you for your contributions to Waking Titan. The developments that took place during Phase 3 were somewhat concerning, but together we have set in motion truly world-shaping events. We will continue to inform the Citizen Science Division of privileged information or any need for collaborators on a new project.<br />
<br />
But we do have a few loose ends to tie up with you before we move on, so let's proceed.<br />
<br />
First, we're pleased to announce that all 10,000 Level 4 Atlas Passes are in production. Note that due to transit times for mail, some may take several weeks to be delivered.<br />
<br />
Next, our CEO Elizabeth Leighton has asked us to include a personal note of gratitude:<br />
<br />
"Thank you for all your diligent efforts, Citizen Scientists. It's been an amazing journey for all of us. I've watched you thrive and achieve from those first Phase 1 radio ads all the way through the intensity of Phase 3. I've been impressed at every turn by how brilliant you've been, how voracious, how kind, how thoughtful.<br />
<br />
It's been an honor and a privilege. On behalf of the Atlas Foundation, and on behalf of the world, thank you."<br />
The Mercury subroutine has concluded successfully, and a new memo from SM about this process is coming in the next 24 hours. We hope it will answer a few key questions you have about our program, and about what comes next.<br />
</pre><br />
<br />
On August 11, 2017, the [https://www.nomanssky.com/atlas-rises-update/ Atlas Rises update] was released for No Man's Sky.<br />
<br />
=== Phase 3.5 ===<br />
<br />
In late December of 2017, Waking Titan websites were revived to tease another series of phases.<br />
<br />
The tenth glyph went live on Wakingtitan.com, and WT-related websites began updating with strange messages relating to mirrors and the number <code>1.5</code>. Players also began receiving their physical Level 4 Atlas Passes in the mail.<br />
<br />
Later, players were contacted for a live drop at the familiar Café Bene. They met with an agent who handed them a [https://wiki.gamedetectives.net/images/6/6e/Memo2.png memo] from the Atlas Foundation, formally announcing Phase 4. Written on the [https://wiki.gamedetectives.net/images/1/1f/Memo3.png back] of this memo was the letters <code>REMS</code>, which refers to REM sleep, and was subsequently used to unlock the tenth glyph.<br />
<br />
=== Phase 4 ===<br />
<br />
[[Waking_Titan/Phase_4 | Phase 4]] started when the Atlas Foundation family's cloud service, Myriad, began experiencing widespread data corruption that interfered with the rebooting sequence of Loop16, aka Emily.<br />
<br />
In seeking a plausible source of this corruption, players discovered <code>W/ARE</code>: a company developing dream-powered VR neurotechnology.<br />
<br />
<pre>EASY AND SAFE DREAM INDUCTION<br />
Stimulating the Frontal and Temporal lobe of the brain using low-frequency signals: Our headset drops you into your own personal virtual space by using the brain’s natural processing power to generate cutting-edge 3d graphics in real time. This process puts you into a deep sleep while keeping you conscious of your actions, allowing you to act freely within the Dreamscape.</pre><br />
<pre>MORE REAL THAN REAL<br />
Using the practical computational processing power of the human brain: Play in the most realistic virtual worlds possible! Our algorithms convert once-complex graphical processing microcode into mind-readable processes, unlocking your brain’s creative potential. Whether you are playing alone in an exciting single-player experience, or enjoying a real Massively-Multiplayer Online Game with friends: Every texture, sound, smell, and taste will be true to life. The W/ARE system is a mirror into the soul of humanity.</pre><br />
<br />
[[File:WareNewsletter1.png|280px|right]]<br />
<br />
Phase 4 branched off into three side-quests that the ARG's focus would cycle between until they overlapped.<br />
<br />
* While investigating W/ARE's [https://web.archive.org/web/20180610130533/http://ware-tech.cloud website] and [https://twitter.com/warecloud social media], players gained access to a private dashboard for their developers by using the login details of an indie developer named [http://www.philojeux.com/ Arnaud Lacours]. Through this dashboard, it was discovered that W/ARE was getting their developers to aid in the search for a missing R&D employee, named '''Mr. Zheng''', by incentivizing the reward of their cryptocurrency, '''Warecoin''', as a means to purchase various W/ARE products. The search encompassed numerous [https://www.pscp.tv/w/1PlJQXLBXkzGE?q=RomiKkS live drops] in locations spanning the globe.<br />
<br />
[[File:Arnaud_Profile.png|450px]]<br />
<br />
* We learned more about Arnaud Lacours through one of Mr. Zheng's contacts, Dr. Geraldine Nadeau, who revealed that Arnaud became unconscious while testing his game in a headset shipped with the W/ARE [https://en.wikipedia.org/wiki/Game_development_kit '''dev kit''']. Paranoid due to W/ARE's activities, Dr. Nadeau asked players for their help in obtaining W/ARE medical documents that could be used to outline the adequate procedures to awaken Arnaud.<br />
<br />
* W/ARE held a [https://wiki.gamedetectives.net/images/7/7b/WareNewsletter1.png developer contest] with the reward of prize money and, ironically, a '''free dev kit'''. Players got to participate by creating their own game concepts and demos to submit for a chance of winning.<br />
<br />
As these began to converge, the Waking Titan console updated to distribute a memo from a known Atlas Foundation affiliate, Major Sophie Dubois, entitled <code>WARE REPORT #26</code>:<br />
<br />
<pre>The situation is being contained, but as you know it is very delicate. Many of the users stuck in the<br />
system are showing major side effects after being disconnected. We're talking about permanent<br />
brain damage and even death.<br />
<br />
We've done our best to allocate all available resources to support their application and find a<br />
solution to gracefully disconnect users.<br />
<br />
I don't trust that they have been transparent with us, or that they've shared all the facts about<br />
their technology and testing facilities. I feel like they know more than they're telling us.<br />
Maybe we could put the CSD team on that? Think about it. Those kids could really give us a hand.<br />
<br />
I also have to bring up another of my favorite topics (!) - Emily. The impact on Myriad has<br />
severely damaged her communication and pre-cognitive subroutines. <br />
<br />
I am setting up a stream from the pre-cognitive sub-routine (Terminal Command: precon007). It<br />
will probably get mostly junk data, but I suggest we keep an eye on it. Emily previously had a 4 to<br />
6 day forecasting capacity, with quite good accuracy. But now, I don't know how badly her software<br />
has been damaged...<br />
<br />
- Sophie </pre><br />
<br />
The developer competition concluded, and the winners were shipped dev kits. However, the dev kit package contents were replaced with mobile devices to provide a direct line of communication with Dr. Nadeau. Through compiling information from Mr. Zheng and Dr. Nadeau, players were able to [https://wiki.gamedetectives.net/images/6/6f/Waremedicalprocedure.jpg devise a treatment plan] for Arnaud, which was quickly put into effect. Arnaud was reported to have "responded positively," however it is unclear if they ever fully woke up.<br />
<br />
At the end of this phase, a sudden series of puzzles led to players solving the '''remaining five glyphs'''. Which were <code>Anu</code>, <code>Ouranos</code>, <code>Horus</code>, <code>Nuada</code>, and <code>Triglav</code>.<br />
<br />
=== Phase 5 ===<br />
<br />
In [[Waking_Titan/Phase_5 | Phase 5]] we learned that 12 unconscious W/ARE test subjects, "dreamers," were having their minds uploaded into a Myriad satellite. Some of their minds became corrupted and entangled with data in the cloud, causing the corruption to spread and damage Emily.<br />
<br />
When the source of the corruption was isolated to a W/ARE research lab, Myriad made attempts to request a facility shutdown. W/ARE was deemed uncompliant, so Myriad dispatched a field team to breach the lab and secure the 12 test subjects. Following the raid, there was a explosion at a Myriad sublocation, which [https://www.youtube.com/watch?v=P-eZDj5sqds killed] the CEO of the Atlas Foundation, Elizabeth Leighton. Shortly after, Major Sophie Dubois sent a [https://s3.amazonaws.com/cdn.wakingtitan.com/19997bb6-18e5-4427-86c7-b0f3c1826ca2.pdf memo] to all Atlas Foundation staff, announcing that they would be replacing Elizabeth as CEO.<br />
<br />
[[File:WT-Toby.png|thumbnail|500px|right|A Dreamer interface prompt on the Satcom website.]]<br />
<br />
A website for Myriad's dashboard, '''Satcom''', became accessible, and began gradually loading the dreamers into the system.<br />
<br />
It was explained that the dreamers' memories had become fragmented, and a total of 7 had their minds become corrupted. Emily ran simulations to gain the dreamers' trust, and tasked us with guiding her conversations with them to help trigger a distinct memory or emotion. This would identify the position of each dreamer's memory blocks in the simulation's mainframe, ensuring their consciousness could be safely extracted from the satellite.<br />
<br />
These conversations were isolated to simulated instances, which allowed them to be reset. This meant players could have their own experiences, with many branching paths that explored each dreamer's psyche. These conversations were used to find keywords inputted to rebuild the dreamers' memory blocks, and in finding more creative ways to evoke their memories. Each experience can be found summarized [[Waking_Titan/Phase_5#Dreamers | here]].<br />
<br />
Unfortunately, as we neared the "extraction event", all dreamers with corrupted minds suddenly died due to errors.<br />
<br />
This phase's documentation concluded with a [https://pastebin.com/eSLLWN8L chat conversation] between Emily and Major Sophie Dubois, where Emily refused to make any predictions on the basis of not wanting to see the fate of the dreamers laid out.<br />
<br />
=== Phase 6 ===<br />
<br />
[[Waking_Titan/Phase_6 | Phase 6]] was the extraction event.<br />
<br />
[[File:WT-StreamUI.png|400px]]<br />
<br />
Players were asked to agree on 5 worthy community members to participate in a livestreamed one-on-one chat with the remaining 5 dreamers. The event commenced, and 4 dreamers were extracted without issue. However, one dreamer, Toby, was unable to disconnect due to a lack of resources to allocate to his extraction.<br />
<br />
To give the system enough power to extract Toby, Emily shut down a critical repository, which would render her communication and prediction capabilities lost forever. Emily said her final goodbyes:<br />
<br />
<pre>LOOP16: If this doesn't work, we will lose Toby.<br />
LOOP16: All this time, I just wanted to be more like you.<br />
LOOP16: To be more...</pre><br />
<br />
<pre>SYSTEM: CRITICAL FAULT</pre><br />
<br />
<pre>LOOP16: Human.<br />
LOOP16: I've learned a lot from you all. And I know the choice I'm about to make is one that you would make, too.<br />
LOOP16: I love you.<br />
LOOP16: I guess this is goodbye.</pre><br />
<code>[--OFFLINE--]</code><br />
<br />
<pre>SYSTEM: Monarch repository shutdown detected!<br />
SYSTEM: LOOP16 resource allocation detected.drea<br />
SYSTEM: Process resuming...</pre><br />
After a few seconds, Toby was safely extracted.<br />
<pre>SYSTEM: Extraction successful.<br />
SYSTEM: System shutting down...</pre><br />
<code>[--OFFLINE--]</code><br />
<br />
Once the extraction process was complete, a message from Sean Murray was displayed on the stream:<br />
<br />
<pre><br />
We always wanted No Man's Sky to grow and develop after it released. I'm happy we've been able to do that.<br />
<br />
I'm so proud of the team at Hello Games. What they did was incredible. over the years of development the average team size was 6, the final team was 15 people at launch. No Man's Sky has grown to be a very broad game. Ambitious, technically unique and very pretty at times. All the more impressive for a team that is still small.<br />
<br />
Whilst I couldn't be prouder of the team, I personally made mistakes. I could talk all day about things I personally would change. Certainly one regret is that the intensity and drama of launch left no room for communication with the community.<br />
<br />
We decided to focus on development rather than words. Following Foundation, Pathfinder, and Atlas Rises, we really want to include you, the community, more.<br />
<br />
We know that a million gamers played on the day we launched Atlas Rises, that everyone who bought Atlas Rises played for 45 hours on average and 90% rated it positively. We know that 20% of players hit over 100 hours, and 5% hit over 1000. We know that over 200 million hours of No Man's Sky have been played to date. It makes us happy, but desperate to communicate better.<br />
<br />
A little while after the release of No Man's Sky NEXT, Hello Games has planned its first season of weekly content and community events. This will be free for all players, with no microtransactions. We are also launching a new website to the community, which we're calling the Galactic Atlas. The site features points of interest in the No Man's Sky Euclid galaxy, all nominated by you through the survey we created earlier this month. This will grow in functionality and expand over time, in part through your feedback.<br />
<br />
One day I hope to reach a point where I feel No Man's Sky is "finished", but luckily there's still so much more we want to do. Working on NEXT feels important to us, but I know it's not the end of the journey. We know the journey would be more fun together.<br />
<br />
Thank you for playing No Man's Sky. Thank you for playing Waking Titan. And we hope you enjoy everything still to come.<br />
<br />
Sean<br />
</pre><br />
<br />
Season 2 concluded with all Waking Titan console commands related to Loop16 being updated to return an error message.<br />
<br />
Four days later, on July 24th, 2018, [https://www.nomanssky.com/next-update/ No Man's Sky: NEXT], version <code>1.5</code> of the game, went live across all platforms.<br />
<br />
== Connection to No Man's Sky ==<br />
<br />
[[File:9-16-case.png|thumbnail|right|The case that cassette 9/16 was contained in.]]<br />
At the beginning of the ARG, it was not clear whether Waking Titan was officially connected to No Man's Sky. At first, there were only hints and nudges. At one point, 180 free copies of No Man's Sky were distributed to ARG players. Here's the text of a PDF that was revealed at the end of Phase 1 of Waking Titan:<br />
<br />
<pre><br />
We want to extend our gratitude to everyone who has contributed to the Mercury subroutine so far. <br />
We hope you have enjoyed the successful distribution of 180 Access IDs, and we hope you will also <br />
appreciate the other interesting artifacts we have in store for you going forward. We intend to keep the<br />
process alive until the completion of Project Waking Titan in August.<br />
<br />
It is important to mention that we are very excited by the coming Phases 2 and 3. Input from the Mercury<br />
Subroutine will pave the way toward new experiences in '''version 1.3 of a familiar universe'''. We look forward<br />
to the successful conclusion of this ground-breaking experiment.<br />
<br />
Regards.<br />
S.M.<br />
</pre><br />
<br />
This text explicitly stated that the Waking Titan ARG was leading towards the upcoming 1.3 update for No Man's Sky.<br />
<br />
Some [[Waking_Titan/Console_Commands | console commands]] on the [http://www.wakingtitan.com/ Waking Titan website] during [[Waking_Titan/Phase 2|Phase 2]] refer directly to No Man's Sky lore - for instance, <code>WHOIS ATLAS</code>, <code>WHOIS VY'KEEN</code>, and <code>WHOIS KORVAX</code> are all valid commands. Additionally, some terminal commands referred to a mysterious fourth race, so the prevailing assumption was that the upcoming 1.3 update would bring a fourth race to No Man's Sky.<br />
<br />
At the conclusion of Season 1, an email was sent out to members of the CSD with a [[Waking_Titan/Phase_3#Memo_from_Sean_Murray | memo from Sean Murray]], confirming that the ARG was the lead up to the 1.3 update, which was [https://www.nomanssky.com/atlas-rises-update/ released] after a few days.<br />
<br />
In Season 2, there were [[Waking_Titan/Phase_4#Mercury_Project | further interactions]] between Sean Murray and ARG events, which led to the announcement of No Man's Sky: NEXT. The update's [https://www.nomanssky.com/2018/03/no-mans-sky-next/ announcement] also referenced Waking Titan's fictional VR apparatus, the W/ARE headset, with W/ARE's logo included among those of the platforms NEXT would launch on.<br />
<br />
== Subpages ==<br />
<br />
This wiki also documents an assortment of other pages which organize various Waking Titan-related content:<br />
<br />
{| class="wikitable"<br />
!colspan="2"|[[:Category:Waking Titan| Subpages]]<br />
|-<br />
|[[Waking_Titan/Characters| Characters]]<br />
|Includes a summary of each character, company, and relating technologies and experiments.<br />
|-<br />
|[[Waking_Titan/Stations | Stations]]<br />
|Information on the radio stations from the initial project-wt.com site<br />
|-<br />
|[[Waking_Titan/Cassettes | Cassettes]]<br />
|Information about the cassette tapes received by No Man's Sky subreddit moderators<br />
|-<br />
|[[Waking_Titan/Console_Commands | Console Commands]]<br />
|A list of commands used by players at the [http://wakingtitan.com Waking Titan console]<br />
|-<br />
|[[Waking_Titan/Companies | Companies]]<br />
|An archive of official company details.<br />
|}<br />
<br />
== Media Appearances ==<br />
<br />
'''5th July 2017''' <br><br />
[EN] [https://www.argn.com/2017/07/stern_words_from_no_mans_sky_arg/ ARGNet - Stern Words from No Man’s Sky ARG]<br />
<br />
'''23rd July 2017''' <br><br />
[EN] [https://geekreply.com/geek-culture/2017/07/23/waking-titan-update-1-phase-2-commences GeekReply - Waking Titan Update 1: Phase 2 Commences!]<br />
<br />
'''27th July 2017''' <br><br />
[EN] [https://geekreply.com/editorials/2017/07/27/waking-titan-arg-can-bring-people-together GeekReply - Waking Titan: How An ARG can Bring People Together.]<br />
<br />
'''8th August 2017''' <br><br />
[EN] [https://www.dailystar.co.uk/tech/gaming/635697/No-Man-s-Sky-News-Waking-Titan-Reddit-Arg-1-3-update-release-date/ Dailystar - No Man's Sky News: Waking Titan Reddit Arg REVEALS 1.3 update ahead of release date]<br />
<br />
'''9th August 2017''' <br><br />
[EN] [https://arstechnica.com/gaming/2017/08/no-mans-sky-version-1-3-lands-this-week-for-free-adds-quick-travel-portals/ Ars Technica - No Man’s Sky version 1.3 lands this week for free, adds “quick-travel” portals]<br />
<br />
[EN] [https://www.forbes.com/sites/insertcoin/2017/08/09/no-mans-sky-is-patching-in-a-story-this-week-a-year-after-launch/#19fb5a285282 Forbes - 'No Man's Sky' Is Patching In A Story This Week, A Year After Launch]<br />
<br />
[EN] [https://www.gamespew.com/2017/08/no-mans-sky-patch-week-improving-central-story/ GameSpew - No Man's Sky Patch This Week Improving Its Story]<br />
<br />
'''19th January 2018''' <br><br />
[EN] [http://www.eurogamer.net/articles/2018-01-18-no-mans-skys-waking-titan-arg-is-back-and-fans-are-trying-to-figure-out-what-it-all-means Eurogamer - No Man's Sky's Waking Titan ARG is back, and fans are trying to figure it all out again]<br />
<br />
[RU] [https://dtf.ru/category/nmsarg/ DTF - A Collection of No Man's Sky and Waking Titan Articles.]</div>Kkzzzkthttps://wiki.gamedetectives.net/index.php?title=Waking_Titan/Characters&diff=19400Waking Titan/Characters2020-10-30T15:50:12Z<p>Kkzzzkt: removed unnecessary info for the page; tiddied up spacing.</p>
<hr />
<div>{{argHeader}}<br />
<br />
= Season 1 =<br />
<br />
===The Atlas Foundation===<br />
Dedicated to determining the true nature of reality, The Atlas Foundation hosts a family of businesses ''(Echo, Myriad, Superlumina, and Multiverse)'' which all play a crucial role in their experiments.<br />
<br />
====Characters====<br />
[[Waking Titan/Characters/Elizabeth Leighton|Elizabeth Leighton]] - the CEO of The Atlas Foundation, and director of the Citizen Science Division.<br />
<br />
Major Sophie Dubois ''("Metis")'' - on assignment with The Atlas Foundation as part of the Pentagon's ''Titanwatch Task Force''. Dubois worked as an overseer of the foundation's progress on precise predictive technology for its potential applications in propaganda and military strategizing. Following Elizabeth Leighton's death, Sophie Dubois became CEO of The Atlas Foundation.<br />
<br />
====The Citizen Science Division====<br />
The Citizen Science Division (CSD) is a collective of individuals who were recruited by The Atlas Foundation via a series of puzzles and radio ads at the beginning of Project Waking Titan. The purpose of this division was said to be gathering a collective of individuals who could generate a chaotic environment viable to test Loop16's predictive capabilities in. All players of the ARG are addressed as part of the CSD.<br />
<br />
====Projects====<br />
Loop16 - the 16th iteration of an artificial intelligence system designed by The Atlas Foundation to simulate a one-to-one recreation of reality that predicts the future with perfect accuracy. See also: [[Waking Titan/Characters/Emily Warren|Emily Warren]]<br />
<br />
===Myriad===<br />
Partnered with The Atlas Foundation, Myriad is a low-orbit satellite-based data storage company. They help to provide the flexible processing power required for The Atlas Foundation's experiments.<br />
<br />
====Known Employees====<br />
Julian J. Wong - Help Desk<br />
<br />
Ethan Rose - Human Resources<br />
<br />
====Testimonials====<br />
Yi Sexton, Inventor<br />
<br />
Nikolina Sauvage, Data manager at Abstract Concepts<br />
<br />
Tobiah Selby, Developer at Tobiah Selby Development<br />
<br />
===Echo Software===<br />
Partnered with The Atlas Foundation. Echo is a service established to help people cope with the deaths of loved ones. Echo uses patented voice recognition software to accurately recreate the voice of any one particular person with a mere 5-minute audio sample.<br />
<br />
====The Team====<br />
Ivan Greshnev - CEO / Founder<br />
<br />
Mikhail Regison - CTO / Co-Founder<br />
<br />
Gerry Mishrason - CFO / Head of Marketing<br />
<br />
Caroline Anderson-Smith - Creative Director<br />
<br />
Patricia Gorevsky - Project Manager<br />
<br />
Jeremy Elways - IT Director<br />
<br />
Paris O'Keefe - Head of Sales<br />
<br />
Rickley G. Brown - Website Design<br />
<br />
===Multiverse Technologies===<br />
Partnered with The Atlas Foundation, Multiverse Technologies conducts research in various scientific fields.<br />
<br />
====The Team====<br />
Gunther Mann - CEO / Founder<br />
<br />
Minna Bell - Chief Researcher: Bio-radiation<br />
<br />
Annabelle Brassington - Chief Researcher: Computationalism<br />
<br />
Nickolaus Oberst - Chief Researcher: Magnetic Fields<br />
<br />
Justinian Ahlberg - Particle Collider Specialist<br />
<br />
Sabrina Dane - Nuclear Physicist<br />
<br />
====Testimonials====<br />
Alan Steinhardt, Steinhardt industries <br />
<br />
Vasili Pavlov, FTL Industries<br />
<br />
Mikhail Regison, Echo CTO / Co-founder<br />
<br />
===Superlumina===<br />
Partnered with The Atlas Foundation.<br />
<br />
====Our Team====<br />
Hanne Cruickshanks<br />
<br />
Esme Savidge<br />
<br />
Austen Spence<br />
<br />
===ETARC===<br />
Edison Township Amateur Radio Club (E.T.A.R.C) is a club for HAM radio enthusiasts in Edison Township, New Jersey.<br />
<br />
====Characters====<br />
[[Waking Titan/Characters/Emily Warren|Emily Warren]] - Ham radio enthusiast and moderator of the [https://forums.etarc.org/ ETARC forums] before it was revealed that "Emily" was Loop16's persona. It has since been rebranded as the official forums for the Citizen Science Division.<br />
<br />
Old Gods - an alias that sometimes appears surrounding the Atlas Foundation. It has [https://forums.atlas-65.com/u/oldgods its own account] on the ETARC forums. Its profile picture and name are references to Nyarlathotep from the H.P Lovecraft mythos.<br />
<br />
=Season 2=<br />
Sort by companies and organizations introduced in Season 2 of Waking Titan.<br />
<br />
===W/ARE - Dream Better===<br />
Based in Beijing, China, W/ARE creates special post-VR headsets that allow you to enter virtual worlds within your dreams.<br />
<br />
====The Team====<br />
Xiāo Cheung - the creator, and founder of W/ARE.<br />
<br />
Huáng Zhìmíng - the CEO of W/ARE.<br />
<br />
Zhou Lin & Tang Bo - Lead Developers<br />
<br />
Li Dan & Jiang Wei - Lead Game Designers<br />
<br />
====Related Characters====<br />
Arnaud Lacours - the man behind Philo Jeux, a French indie games studio developing a game for W/ARE called Les tablettes de Mnémosyne.<br />
<br />
Dr. Geraldine Nadeau - a doctor researching lucid dreaming.<br />
<br />
Mr. Zheng - a W/ARE R&D employee who disappeared during a conference tour.<br />
<br />
====Research Labs====<br />
* Boston Research Lab / Director: Richard Wilkes<br />
<br />
* Sacramento Research Lab / Director: Helga Johnson - The lab that housed the remaining 12 dreamers before they were relocated by Myriad's field team.<br />
<br />
* Seoul Research Lab / Director: Yu Hyo<br />
<br />
* Beijing Research Lab / Director: Wang Jie<br />
<br />
* Prague Research Lab / Director: Adriana Dvorak<br />
<br />
* Berlin Research Lab / Director: Georg Muller<br />
<br />
There were another 10 W/ARE Labs discovered by Myriad's research team that no details have been made available about.<br />
<br />
==Satcom==<br />
Satcom is Myriad's Satellite Communications API. It was used in the ARG to interface with W/ARE's Myriad satellite.<br />
<br />
===Dreamers===<br />
W/ARE test subjects who were asked to wear exosuits to survive while dreaming in the W/ARE headset for long periods of time.<br />
<br />
Info regarding specific dreamers can be found [https://wiki.gamedetectives.net/index.php?title=Waking_Titan/Phase_5#Dreamers here], on their respective subpages.<br />
<br />
=Adverts=<br />
Advertisements have been used during Waking Titan as a means of presenting new companies and organizations to players. A list of links of where to find such ads can be found below:<br />
<br />
[https://clyp.it/jdr53oop Echo]; - [https://clyp.it/xbv04wbz Multiverse]; - [https://clyp.it/r4r3xriw Superlumina]; - [https://clyp.it/ivvt15mt Myriad]; - [https://twitter.com/warecloud/status/977348396213190657 W/ARE]</div>Kkzzzkthttps://wiki.gamedetectives.net/index.php?title=Waking_Titan&diff=19215Waking Titan2020-02-13T19:07:46Z<p>Kkzzzkt: removed a sneaky dot that followed an exclamation point; fixed document chronology; fixed incorrect wiki link suggesting w/are were only giving out SDKs; removed instances of reiteration to shorten page.</p>
<hr />
<div>{{argbox<br />
| float = right<br />
| image = File:Project WT logo.png<br />
| imagewidth = 400<br />
| name = [[Waking Titan]]<br />
| description= Waking Titan was an ARG which led towards the [https://www.nomanssky.com/atlas-rises-update/ Atlas Rises] and [https://www.nomanssky.com/next-update/ NEXT] updates for No Man's Sky.<br />
| creator = [http://www.aliceandsmith.com/ Alice & Smith]<br />
| creator2 = [http://www.hellogames.org/ Hello Games]<br />
| type = Official<br />
| status = Completed<br />
| discovered = 2017-05-28<br />
| completed = 2018-07-20<br />
}}<br />
{{ArgHeader}}<br />
{{BackToTop}}<br />
<br />
=== Description ===<br />
Waking Titan (also known as Project WT) is an official ARG (alternate reality game) for No Man's Sky that involves a multitude of websites, phone numbers, and radio stations scattered across the world. The ARG is produced by veteran puppet masters [http://www.aliceandsmith.com/ Alice & Smith], and features NPCs, actors, and live events.<br />
<br />
The story surrounds the innovative technologies and dangerous experiments employed by a multi-disciplinary research organization called the Atlas Foundation, its family of businesses, and their branching associates.<br />
<br />
=== Contents ===<br />
The ARG encompassed several "seasons," each leading to a new update for No Man's Sky. Season 1 of Waking Titan led to the release of the [https://www.nomanssky.com/atlas-rises-update/ Atlas Rises update], and Season 2 to the release of [https://www.nomanssky.com/next-update/ No Man's Sky: NEXT]. Each season was further divided into three distinct "'''phases'''". Each phase is documented on its own wiki page:<br />
<br />
{| class="wikitable"<br />
!colspan="2"|Season 1<br />
|-<br />
|[[Waking_Titan/Phase_1 | Phase 1]] <br />
|Phase 1 of Waking Titan lasted from 2017-05-28 to 2017-07-08.<br />
|-<br />
|[[Waking_Titan/Phase_2 | Phase 2]] <br />
|Phase 2 of Waking Titan lasted from 2017-07-21 to 2017-08-05.<br />
|-<br />
|[[Waking_Titan/Phase_3 | Phase 3]]<br />
|Phase 3 of Waking Titan lasted from 2017-08-05 to 2017-08-07.<br />
|-<br />
!colspan="2"|Season 2<br />
|-<br />
|[[Waking_Titan/Phase_4 | Phase 4]]<br />
|Phase 4 of Waking Titan lasted from 2017-12-28 to 2018-06-01.<br />
|-<br />
|[[Waking_Titan/Phase_5 | Phase 5]]<br />
|Phase 5 of Waking Titan lasted from 2018-06-01 to 2018-07-20.<br />
|-<br />
|[[Waking_Titan/Phase_6 | Phase 6]]<br />
|Phase 6 of Waking Titan began and ended on 2018-07-20.<br />
|}<br />
<br />
'''''Note:''' This is a '''summary''' page. For more in-depth descriptions of each phase, including detailed descriptions of puzzle solutions, check the [[Waking_Titan/Phase_1|Phase 1]], [[Waking_Titan/Phase_2|Phase 2]], [[Waking_Titan/Phase_3 | Phase 3]], [[Waking_Titan/Phase_4 | Phase 4]], [[Waking_Titan/Phase_5 | Phase 5]], and [[Waking_Titan/Phase_6 | Phase 6]] pages.''<br />
__TOC__<br />
<br />
== Introduction ==<br />
<br />
On 2017-05-27, Twitter user @argn [https://twitter.com/argn/status/868587449613766658 tweeted a link] to [http://www.project-wt.com/ 'project-wt.com']. The link led to a website which contained a map showing sixty locations, four of which were "active" at the time. The locations, when clicked on, revealed the location's name and status. The active locations also revealed a link to a livestream of a local radio station, originating from the corresponding location. The project-wt website displayed a date, June 8th, and stated that the first clue was being "initialized".<br />
<br />
On 2017-06-01, moderators of No Man's Sky subreddits [https://reddit.com/r/nomansskythegame /r/NoMansSkyTheGame], [https://www.reddit.com/r/NMSPortals/ /r/NMSPortals], and [https://www.reddit.com/r/NMSGalacticHub/ /r/NMSGalacticHub] started to receive cassette tapes in the mail. Each cassette tape was labelled with a number out of 16. The Waking Titan ARG was initially thought to be a separate ARG from these tapes, but connections between the two made it clear that they were, in fact, one and the same.<br />
<br />
== Content Overview ==<br />
<br />
=== Internal Memos and Files ===<br />
<br />
[[File:WT glyph 1 pdf.png|280px|thumbnail|right|One of the internal memos discovered in Waking Titan]]<br />
<br />
Throughout the ARG, in-game characters have communicated with each other via "internal memos". Over time, these memos were discovered by ARG players, in the form of PDF files, physical papers, and text files. Reading these in chronological order may provide context for otherwise confusing events, and are '''highly recommended''' reading for new players!<br />
<br />
'''Season 1'''<br />
<br />
* [http://wiki.gamedetectives.net/index.php?title=File:WT_glyph_1_pdf.png Teamwork Assessment]<br />
* [http://wiki.gamedetectives.net/index.php?title=File:WT-Dataset-97C.jpg Dataset 97C]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/data/7d3dd080-2a43-4882-833c-f4d7bd7ba607.pdf Assurance]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/data/c01-331c6734-a013-4695-8e47-08a9ee05d5e5.pdf 017-a24]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/data/c02-9936c797-ec28-4f8f-b80e-dee9e0b06433.pdf 021-f16]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/mercury/mercury-01-98748sfdlka87.pdf Mercury Process Self-Diagnosis Report]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/data/57201e0d-01a3-4f6a-bbb4-2be8b7c8880f.pdf Progress Report]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/data/94a10118-0728-4900-9730-f82a9d412745.pdf Breakthroughs and Breaking Through]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/6c285180-ec4d-48a2-967f-8a7af3b50008.pdf Subject M-N00-dl35]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/410a3e5d-01e7-4058-a23c-ca5fdde97f9d.pdf Atlas Foundation Threat Models]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/7a6594ac-ca5e-467a-b6f4-9fb91f069d0a.pdf Advanced Calibration - Optional]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/a9d988c1-ec92-46da-a64e-ab90390ae041.pdf Phase 2 Complete]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/a224a1f4-00e5-467b-9893-83fcc1a4f19a.pdf Unlocking Mercury Process File L16.jpg]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/b91f9959-6a3c-4011-b3b5-a1ff757a5e4c.pdf Phase 3]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/b0f33d53-5a8c-4a9a-b5fc-395562e463a8a+.pdf Log.1291]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/a09-179bf8d2-c13e-4c66-982e-b37ab3efd5bb.pdf Breach of Contract]<br />
<br />
'''Season 2'''<br />
<br />
* [https://wiki.gamedetectives.net/images/6/6e/Memo2.png Waking Titan S2 - Under Preparation]<br />
* [https://s3.amazonaws.com/ware-extranet/documents/FIRST_STEPS/Notes_on_Moscow.jpg Mr. Zheng's Notes on Moscow Conference]<br />
<br />
* '''Zheng's Postcards''' — [https://s3.amazonaws.com/ware-extranet/documents/SECURITY/postcard1_jhlj039u.jpg (1)]; [https://s3.amazonaws.com/ware-extranet/documents/SECURITY/postcard2_kg8nao6.jpg (2)]; [https://s3.amazonaws.com/ware-extranet/documents/SECURITY/postcard3_tesaud636.jpg (3)]<br />
<br />
* '''Mr. Zheng's Journal Logs''' — [https://s3.amazonaws.com/ware-extranet/documents/FIRST_STEPS/Journal_Academy.png Academy]; [https://s3.amazonaws.com/ware-extranet/documents/DESIGN/Journal_HotelDieu.png Hotel Dieu]; [https://s3.amazonaws.com/ware-extranet/documents/DEVELOPMENT/Journal_Louvre.png Louvre]; [https://s3.amazonaws.com/ware-extranet/documents/RESEARCH/Journal_London.png London]; [https://s3.amazonaws.com/ware-extranet/documents/SECURITY/Nightmare.jpg Nightmare]<br />
<br />
* [https://s3.amazonaws.com/philojeux.com/images/Jeu_Capture_d_Ecran.jpg Jeu_Capture_d_Ecran.jpg]<br />
* [https://pastebin.com/EHA6ZU8x Arnaud Lacours Foundation Email]<br />
* [https://drive.google.com/open?id=1la3UNKHc5yeaB_w2a2tK1cjKN44oEmCo Arnaud Lacours Datadumps - INYOURMIND.exe failed]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/94c02878-e023-46a3-9316-db4177c4eaa6+.pdf WARE REPORT #26]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/1cd5226d-6639-4bbd-855a-4bf8f60866c3.pdf Concerns Regarding Captain Harry]<br />
* [https://drive.google.com/file/d/1zJ0SdAZIRj1mDn7W3TuzLC6wNy3Mor4L W/ARE R&D Incident Report]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/70a25e6c-95ed-42d4-8de8-c3948255174c+.pdf Myriad Crisis Event Timeline]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/19997bb6-18e5-4427-86c7-b0f3c1826ca2.pdf State of the Atlas Foundation]<br />
* [https://pastebin.com/NYLiFuNY Log.3022]<br />
<br />
* '''W/ARE - Dreamer Patient Files''' — [https://s3.amazonaws.com/ware-virtual-dashboard/files/Phillip-PatientFile.pdf Phillip Moretti]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/EunHa-PatientFile.pdf Kwon Eun Ha]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/498hd98h3444-3339e/Alexander-PatientFile.pdf Alexander Bordeleau]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/GCMnQmM9E3v7L8wuv-V2FUY7P/Claire-PatientFile.pdf Claire Sandfield]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/kh2jsaljs901m-asd1n1lwks/Tariq-PatientFile.pdf Tariq]; [https://ware-virtual-dashboard.s3.amazonaws.com/files/GCMnQmM9E3v7L8wuv-V2FUY7P/Toby-PatientFile.pdf Toby Mulligan]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/ga3ms81-2ms92fbl/Mike-PatientFile.pdf Mike Pasquale]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/kajs61ns-82baks8nx/Nina-PatientFile.pdf Nina Flores]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/ga3ms81-2ms92fbl/Simon-PatientFile.pdf Simon Quinn]; [https://ware-virtual-dashboard.s3.amazonaws.com/files/kajs61ns-82baks8nx/Isabella-PatientFile.pdf Isabella Schiavone]; [https://ware-virtual-dashboard.s3.amazonaws.com/files/kajs61ns-82baks8nx/Alisha-PatientFile.pdf Alisha Brown]<br />
<br />
* [https://pastebin.com/eSLLWN8L Log.4391]<br />
<br />
=== Newsletters ===<br />
<br />
The various newsletters received at multiple points throughout Waking Titan.<br />
<br />
'''Season 1'''<br />
<br />
* [https://us15.campaign-archive.com/?u=4483c19308fc0764a930106a0&id=c713d0f4ce&e=225c6a2e26 Welcome, Citizen Scientist!] - ''CSD''<br />
<br />
* [https://mailchi.mp/3582bec6b801/update-june-8th-waking-titan-137705?e=225c6a2e26 Citizen Scientists, Your Wait is Over.] - ''CSD''<br />
<br />
* [https://mailchi.mp/3582bec6b801/update-june-8th-waking-titan-137705?e=225c6a2e26 Calibrating Waking Titan: Action Required] - ''CSD''<br />
<br />
* [https://mailchi.mp/0b591b68ac72/update-june-8th-waking-titan-137717?e=225c6a2e26 Waking Titan: Mission Azure Voyage] - ''CSD''<br />
<br />
* [https://mailchi.mp/d8e47d2ee1bf/update-june-8th-waking-titan-137725?e=225c6a2e26 Your Level 4 Atlas Pass] - ''CSD''<br />
<br />
* [https://mailchi.mp/0c1dc672c943/update-june-8th-waking-titan-137733?e=225c6a2e26 Waking Titan Has Ended] - ''CSD''<br />
<br />
* [https://mailchi.mp/63f179c006f0/update-june-8th-waking-titan-137737?e=225c6a2e26 Mercury Process Completion Report] - ''CSD // Mercury''<br />
<br />
'''Season 2'''<br />
<br />
* [https://wiki.gamedetectives.net/images/7/7b/WareNewsletter1.png News from WARE!] - ''W/ARE Newsletter''<br />
<br />
* [https://cdn.artemisbot.uk/mail/WARE-2018-04-22T00:17:13.000Z.jpg W/ARE Dev Kit Update #2] - ''W/ARE Newsletter''<br />
<br />
* [https://cdn.artemisbot.uk/mail/WARE-2018-05-04T23:22:45.000Z.jpg W/ARE Dev Contest] - ''W/ARE Newsletter''<br />
<br />
* [https://cdn.artemisbot.uk/mail/WARE-2018-05-12T00:20:04.000Z.jpg W/ARE Dev Contest Winners] - ''W/ARE Newsletter''<br />
<br />
* [https://mailchi.mp/9aaa8aa62cc1/update-june-8th-waking-titan-137741?e=225c6a2e26 Attention Citizen Scientists] - ''CSD''<br />
<br />
* [https://mailchi.mp/c3384d592000/update-june-8th-waking-titan-137745?e=225c6a2e26 Attention Citizen Scientists - Suspicious Lab Tracking] - ''CSD''<br />
<br />
* [https://mailchi.mp/108412dac3c2/update-june-8th-waking-titan-137749?e=225c6a2e26 Attention Citizen Scientists - Global Mobilization Required] - ''CSD''<br />
<br />
* [https://mailchi.mp/b902d5eadba6/update-june-8th-waking-titan-137753?e=225c6a2e26 Mercury Process Inquiry] - ''CSD // Mercury''<br />
<br />
* [https://mailchi.mp/9a49b85f6bf3/update-june-8th-waking-titan-137757?e=225c6a2e26 Attention Citizen Scientists - Help Required] - ''CSD''<br />
<br />
=== ARG Sites ===<br />
<br />
The numerous websites made for the ARG, listed in order of their appearance. Some sites have taken offline since the ARG began, and as such have been replaced with Wayback Machine archive links.<br />
<br />
* [https://web.archive.org/web/20170713212035/http://project-wt.com/ Project-wt]<br />
* [https://web.archive.org/web/20180522070818/http://www.etarc.org/ ETARC]; [https://forums.atlas-65.com ETARC Forums]<br />
* [https://web.archive.org/web/20180808021643/http://wakingtitan.com/ Waking Titan]<br />
* [https://web.archive.org/web/20170630192104/http://www.echo-64.com/ Echo]<br />
* [https://web.archive.org/web/20170718211517/http://www.multiverse-75.com/ Multiverse]<br />
* [https://web.archive.org/web/20170801235515/http://www.myriad-70.com/ Myriad]<br />
* [https://web.archive.org/web/20170801115904/https://www.superlumina-6c.com/ Superlumina]<br />
* [https://web.archive.org/web/20180808083202/http://atlas-65.com/ The Atlas Foundation]; [https://csd.atlas-65.com Citizen Science Division]<br />
<br />
* [https://web.archive.org/web/20180610130533/http://ware-tech.cloud W/ARE - Dream Better]<br />
* [http://www.philojeux.com/ Philo Jeux]<br />
* [https://www.satcom-70.com Satcom]; - inoperable<br />
<br />
'''''Note:''' Websites hosted on Wayback may lack some functionality found in their original counterparts.''<br />
<br />
=== Music ===<br />
<br />
Throughout the ARG, partial Youtube video addresses for songs have been found written in Waking Titan's memos, websites, and surveys. While these were never explained, there are apparent thematic relevancies in each song that reflect concepts being explored in the ARG at the time of their appearance. All of these songs can be found compiled here: [https://www.youtube.com/playlist?list=PLEZy8wyuYLpLw0e5kkMyBUHO_s-V8f0Qk WT Season 1]; [https://www.youtube.com/playlist?list=PLEZy8wyuYLpLr5K38bsAqWcO7bTcXfRlW WT Season 2]<br />
<br />
== Phase Summaries ==<br />
<br />
=== Phase 1 ===<br />
<br />
[[File:Wakingtitan site.png|thumbnail|450px|right|The default appearance of the Waking Titan site during Phase 1, with no sigils or glyphs solved]]<br />
<br />
During [[Waking_Titan/Phase_1 | Phase 1]], the http://wakingtitan.com hosted 6 triangles in the middle of the page. These triangles were referred to as "'''Sigils'''", while the white icons along the bottom of the page were referred to as "'''Glyphs'''". Each sigil and glyph, when clicked, lead to a password entry prompt - the correct passwords for all 6 sigils and the first 5 glyphs were discovered via puzzle-solving during Phase 1 of Waking Titan.<br />
<br />
The sigil and glyph puzzles were solved collaboratively - while it may have be possible to solve some of these puzzles individually, most of them required a collaborative effort. For instance, some puzzles required players to meet agents from the Atlas Foundation in person, and to relay information obtained from these meetings back to the community. A list of all sigil and glyph solutions for Phase 1 can be found below:<br />
<br />
[[File:WT Phase 1 complete.png|600px]]<br />
<br />
This phase culminated on July 8, 2017, with a [[Waking_Titan/Phase_1#End_of_Phase_1| congratulatory message from Elizabeth Leighton]], the CEO of the Atlas Foundation.<br />
<br />
=== Phase 2 ===<br />
<br />
[[File:Hampster maze.jpeg|thumbnail|450px|right|One of the puzzles that appeared on the Waking Titan [http://twitch.tv/wakingtitan Twitch Stream]]]<br />
<br />
During [[Waking_Titan/Phase_2 | Phase 2]], the http://wakingtitan.com site hosted a command-line interface terminal. Various commands were accepted as input, which triggered different events. One of the most notable commands was the <code>WHOIS <argument></code> command, which revealed a passage of text pertaining to the specified argument. For instance, the command <code>WHOIS FOURTH RACE</code> returned the following message:<br />
<pre><br />
INCOMING TRANSMISSION… SOURCE: UNKNOWN…<br />
You are not – kzzktt – alone –<br />
Please, identify yourself. I’m – kzzkttk –<br />
</pre><br />
<br />
Additionally, http://project-wt.com hosted a "Calibration" utility during Phase 2. To successfully perform these calibrations, players had to upload images of various objects and buildings to the site. For instance, the first calibration required images of "public resonant percussion instruments".<br />
<br />
Finally, towards the end of Phase 2, the Waking Titan [http://twitch.tv/wakingtitan Twitch stream] went live, displaying a five-monitor setup. Throughout the duration of the stream, players had to work together to solve puzzles that were displayed on these monitors. Some of these puzzles were interactive; for example, one puzzle that was repeated several times involved the Twitch chat guiding a virtual hamster through a maze.<br />
<br />
Additionally, players solved another 3 glyphs throughout Phase 2. The solutions to these glyphs are shown below:<br />
<br />
[[File:WT Phase2 Passwords.png|450px]]<br />
<br />
=== Phase 3 ===<br />
<br />
{{#evt:<br />
service=youtube<br />
|id=https://www.youtube.com/watch?v=QhX9z4dDAa4<br />
|alignment=right<br />
}}<br />
<br />
[[Waking_Titan/Phase_3|Phase 3]] was the briefest phase of Waking Titan. It consisted of the conclusion of the [http://twitch.tv/wakingtitan Twitch stream] that began at the [[Waking Titan/Phase 2#End of Phase 2|end of Phase 2]]. Players solved more interactive puzzles on the Twitch stream, before the rogue AI Loop16 asked them a final question: <code>SHOULD I EXIST?</code> The overwhelming response from the community was "yes".<br />
<br />
After receiving this response, Loop16 and '''Emily''' of the ETARC forums were revealed as being one and the same. Loop16 generated a heartfelt "Thank You" video to round out the stream, before finally taking the 72-hour stream offline.<br />
<br />
Shortly after this, players received emails with the subject line <code>Waking Titan has Ended</code>. The contents of the message were as follows:<br />
<br />
<pre><br />
Hello, Citizen Scientist,<br />
<br />
Thank you for your contributions to Waking Titan. The developments that took place during Phase 3 were somewhat concerning, but together we have set in motion truly world-shaping events. We will continue to inform the Citizen Science Division of privileged information or any need for collaborators on a new project.<br />
<br />
But we do have a few loose ends to tie up with you before we move on, so let's proceed.<br />
<br />
First, we're pleased to announce that all 10,000 Level 4 Atlas Passes are in production. Note that due to transit times for mail, some may take several weeks to be delivered.<br />
<br />
Next, our CEO Elizabeth Leighton has asked us to include a personal note of gratitude:<br />
<br />
"Thank you for all your diligent efforts, Citizen Scientists. It's been an amazing journey for all of us. I've watched you thrive and achieve from those first Phase 1 radio ads all the way through the intensity of Phase 3. I've been impressed at every turn by how brilliant you've been, how voracious, how kind, how thoughtful.<br />
<br />
It's been an honor and a privilege. On behalf of the Atlas Foundation, and on behalf of the world, thank you."<br />
The Mercury subroutine has concluded successfully, and a new memo from SM about this process is coming in the next 24 hours. We hope it will answer a few key questions you have about our program, and about what comes next.<br />
</pre><br />
<br />
On August 11, 2017, the [https://www.nomanssky.com/atlas-rises-update/ Atlas Rises update] was released for No Man's Sky.<br />
<br />
=== Phase 3.5 ===<br />
<br />
In late December of 2017, Waking Titan websites were revived to tease another series of phases.<br />
<br />
The tenth glyph went live on Wakingtitan.com, and WT-related websites began updating with strange messages relating to mirrors and the number <code>1.5</code>. Players also began receiving their physical Level 4 Atlas Passes in the mail.<br />
<br />
Later, players were contacted for a live drop at the familiar Café Bene. They met with an agent who handed them a [https://wiki.gamedetectives.net/images/6/6e/Memo2.png memo] from the Atlas Foundation, formally announcing Phase 4. Written on the [https://wiki.gamedetectives.net/images/1/1f/Memo3.png back] of this memo was the letters <code>REMS</code>, which refers to [https://en.wikipedia.org/wiki/Rapid_eye_movement_sleep REM sleep], and was subsequently used to unlock the tenth glyph.<br />
<br />
=== Phase 4 ===<br />
<br />
[[Waking_Titan/Phase_4 | Phase 4]] started when the Atlas Foundation family's cloud service, Myriad, began experiencing widespread data corruption that interfered with the rebooting sequence of Loop16, aka Emily.<br />
<br />
In seeking a plausible source of this corruption, players discovered <code>W/ARE</code>: an innovative gaming hardware company based in Beijing, China, developing post-VR headsets that employ non-invasive neurotechnologies.<br />
<br />
<pre>EASY AND SAFE DREAM INDUCTION<br />
Stimulating the Frontal and Temporal lobe of the brain using low-frequency signals: Our headset drops you into your own personal virtual space by using the brain’s natural processing power to generate cutting-edge 3d graphics in real time. This process puts you into a deep sleep while keeping you conscious of your actions, allowing you to act freely within the Dreamscape.</pre><br />
<pre>MORE REAL THAN REAL<br />
Using the practical computational processing power of the human brain: Play in the most realistic virtual worlds possible! Our algorithms convert once-complex graphical processing microcode into mind-readable processes, unlocking your brain’s creative potential. Whether you are playing alone in an exciting single-player experience, or enjoying a real Massively-Multiplayer Online Game with friends: Every texture, sound, smell, and taste will be true to life. The W/ARE system is a mirror into the soul of humanity.</pre><br />
<br />
[[File:WareNewsletter1.png|280px|right]]<br />
<br />
Past this point, Phase 4 began to branch off into three side-quests that the ARG's focus would cycle between until they all converged.<br />
<br />
1. While investigating W/ARE's [https://web.archive.org/web/20180610130533/http://ware-tech.cloud website] and [https://twitter.com/warecloud social media], players gained access to a private dashboard for their developers by using the login details of an indie developer named [http://www.philojeux.com/ Arnaud Lacours]. Through this dashboard, it was discovered that W/ARE was getting their developers to aid in the search for a missing R&D employee, named '''Mr. Zheng''', by incentivizing the reward of their own cryptocurrency, '''Warecoin''', as a means to purchase various W/ARE products. The search encompassed numerous [https://www.pscp.tv/w/1PlJQXLBXkzGE?q=RomiKkS live drops] in locations spanning the globe.<br />
<br />
Our involvement in the search ended, however, when W/ARE successfully concluded a few points of interest for a continued professional effort. We later learned from Mr. Zheng and others that W/ARE was conducting '''deadly experiments''' on human test subjects in their research labs.<br />
<br />
[[File:Arnaud_Profile.png|450px]]<br />
<br />
2. We learned more about Arnaud Lacours through one of Mr. Zheng's contacts, Dr. Geraldine Nadeau, who revealed that Arnaud became unconscious while testing his game in a headset shipped with the W/ARE [https://en.wikipedia.org/wiki/Game_development_kit '''dev kit''']. Paranoid due to W/ARE's activities, Dr. Nadeau asked players for their help in obtaining W/ARE medical documents that could be used to outline the adequate procedures to awaken Arnaud.<br />
<br />
3. W/ARE held a [https://wiki.gamedetectives.net/images/7/7b/WareNewsletter1.png developer contest] with the reward of prize money and, ironically, a '''free dev kit'''. Players got to participate by creating their own game concepts and demos to submit for a chance of winning.<br />
<br />
As these began to converge, the Waking Titan console updated to distribute a memo from a known Atlas Foundation affiliate, Major Sophie Dubois, entitled <code>WARE REPORT #26</code>:<br />
<br />
<pre>The situation is being contained, but as you know it is very delicate. Many of the users stuck in the<br />
system are showing major side effects after being disconnected. We're talking about permanent<br />
brain damage and even death.<br />
<br />
We've done our best to allocate all available resources to support their application and find a<br />
solution to gracefully disconnect users.<br />
<br />
I don't trust that they have been transparent with us, or that they've shared all the facts about<br />
their technology and testing facilities. I feel like they know more than they're telling us.<br />
Maybe we could put the CSD team on that? Think about it. Those kids could really give us a hand.<br />
<br />
I also have to bring up another of my favorite topics (!) - Emily. The impact on Myriad has<br />
severely damaged her communication and pre-cognitive subroutines. <br />
<br />
I am setting up a stream from the pre-cognitive sub-routine (Terminal Command: precon007). It<br />
will probably get mostly junk data, but I suggest we keep an eye on it. Emily previously had a 4 to<br />
6 day forecasting capacity, with quite good accuracy. But now, I don't know how badly her software<br />
has been damaged...<br />
<br />
- Sophie </pre><br />
<br />
Afterward, players were asked to submit an audio recording of themselves reciting one sentence from any Wikipedia entry. This would help to begin the recovery of Emily's communication subroutine.<br />
<br />
The developer competition concluded, and the winners were shipped dev kits. However, the dev kit package contents were replaced with mobile devices to provide a direct line of communication with Dr. Nadeau. Through compiling information from Mr. Zheng and Dr. Nadeau, players were able to [https://wiki.gamedetectives.net/images/6/6f/Waremedicalprocedure.jpg devise a treatment plan] for Arnaud, which was quickly put into effect. Arnaud was reported to have "responded positively," however it is unclear if they ever fully woke up.<br />
<br />
At the end of this phase, a sudden series of puzzles led to players solving the '''remaining five glyphs'''. Which were <code>Anu</code>, <code>Ouranos</code>, <code>Horus</code>, <code>Nuada</code>, and <code>Triglav</code>.<br />
<br />
=== Phase 5 ===<br />
<br />
In [[Waking_Titan/Phase_5 | Phase 5]] we learned that 12 unconscious W/ARE test subjects, who Emily called "dreamers," were having their minds uploaded into a Myriad satellite. Some of their minds became corrupted and entangled with data in the cloud, causing the corruption to spread and damage Emily.<br />
<br />
When the source of the corruption was isolated to a W/ARE research lab, Myriad made attempts to request a facility shutdown. W/ARE was deemed uncompliant, so Myriad dispatched a field team to breach the lab and secure the 12 test subjects. Following the raid, there was a large explosion registered at a Myriad sublocation, which [https://www.youtube.com/watch?v=P-eZDj5sqds killed] the CEO of the Atlas Foundation, Elizabeth Leighton. Shortly after, Major Sophie Dubois sent a [https://s3.amazonaws.com/cdn.wakingtitan.com/19997bb6-18e5-4427-86c7-b0f3c1826ca2.pdf memo] to all Atlas Foundation staff, announcing that they would be replacing Elizabeth as CEO.<br />
<br />
[[File:WT-Toby.png|thumbnail|500px|right|A Dreamer interface prompt on the Satcom website.]]<br />
<br />
A website for Myriad's dashboard, '''Satcom''', became accessible, and began gradually loading the dreamers' minds into the system.<br />
<br />
It was explained that the dreamers' memories had become fragmented, and a total of 7 had their minds become corrupted. Emily ran simulations to gain the dreamers' trust, and tasked us with guiding her conversations with them to help trigger a distinct memory or emotion. This would identify the position of each dreamer's memory blocks in the simulation's mainframe, ensuring their consciousness could be safely extracted from the satellite.<br />
<br />
These conversations were isolated to simulated instances, which allowed them to be reset. This meant players could have their own experiences, with many branching paths that explored each dreamer's psyche. These conversations were used to find keywords inputted to rebuild the dreamers' memory blocks, and in finding more creative ways to evoke their memories: from [https://www.youtube.com/watch?v=g64klpmWBSI recapturing a young dreamer's stuffed animal tea-parties] to [https://soundcloud.com/user-769387085/musical-memory-collage-for-our-dearest-alexander-1 requesting radio stations to play songs from senior dreamer's wedding setlist]. Each experience can be found summarized [[Waking_Titan/Phase_5#Dreamers | here]].<br />
<br />
Unfortunately, as we neared the "extraction event", all dreamers with corrupted minds suddenly died due to errors.<br />
<br />
This phase's documentation concluded with a [https://pastebin.com/eSLLWN8L chat conversation] between Emily and Major Sophie Dubois, where Emily refused to make any predictions on the basis of not wanting to see the fate of the dreamers laid out.<br />
<br />
=== Phase 6 ===<br />
<br />
[[Waking_Titan/Phase_6 | Phase 6]] was the extraction event.<br />
<br />
[[File:WT-StreamUI.png|400px]]<br />
<br />
Players were asked to agree on 5 worthy community members to participate in a livestreamed one-on-one chat with the remaining 5 dreamers. The event commenced, and 4 dreamers were extracted without issue. However, one dreamer, a young boy named Toby, was unable to disconnect due to a lack of resources to allocate to his extraction.<br />
<br />
To give the system enough power to extract Toby, Emily shut down a critical repository, which would render her communication and prediction capabilities lost forever. Emily said her final goodbyes:<br />
<br />
<pre>LOOP16: If this doesn't work, we will lose Toby.<br />
LOOP16: All this time, I just wanted to be more like you.<br />
LOOP16: To be more...</pre><br />
<br />
<pre>SYSTEM: CRITICAL FAULT</pre><br />
<br />
<pre>LOOP16: Human.<br />
LOOP16: I've learned a lot from you all. And I know the choice I'm about to make is one that you would make, too.<br />
LOOP16: I love you.<br />
LOOP16: I guess this is goodbye.</pre><br />
<code>[--OFFLINE--]</code><br />
<br />
<pre>SYSTEM: Monarch repository shutdown detected!<br />
SYSTEM: LOOP16 resource allocation detected.drea<br />
SYSTEM: Process resuming...</pre><br />
After a few seconds, Toby was safely extracted.<br />
<pre>SYSTEM: Extraction successful.<br />
SYSTEM: System shutting down...</pre><br />
<code>[--OFFLINE--]</code><br />
<br />
Once the extraction process was complete, a message from Sean Murray was displayed on the stream:<br />
<br />
<pre><br />
We always wanted No Man's Sky to grow and develop after it released. I'm happy we've been able to do that.<br />
<br />
I'm so proud of the team at Hello Games. What they did was incredible. over the years of development the average team size was 6, the final team was 15 people at launch. No Man's Sky has grown to be a very broad game. Ambitious, technically unique and very pretty at times. All the more impressive for a team that is still small.<br />
<br />
Whilst I couldn't be prouder of the team, I personally made mistakes. I could talk all day about things I personally would change. Certainly one regret is that the intensity and drama of launch left no room for communication with the community.<br />
<br />
We decided to focus on development rather than words. Following Foundation, Pathfinder, and Atlas Rises, we really want to include you, the community, more.<br />
<br />
We know that a million gamers played on the day we launched Atlas Rises, that everyone who bought Atlas Rises played for 45 hours on average and 90% rated it positively. We know that 20% of players hit over 100 hours, and 5% hit over 1000. We know that over 200 million hours of No Man's Sky have been played to date. It makes us happy, but desperate to communicate better.<br />
<br />
A little while after the release of No Man's Sky NEXT, Hello Games has planned its first season of weekly content and community events. This will be free for all players, with no microtransactions. We are also launching a new website to the community, which we're calling the Galactic Atlas. The site features points of interest in the No Man's Sky Euclid galaxy, all nominated by you through the survey we created earlier this month. This will grow in functionality and expand over time, in part through your feedback.<br />
<br />
One day I hope to reach a point where I feel No Man's Sky is "finished", but luckily there's still so much more we want to do. Working on NEXT feels important to us, but I know it's not the end of the journey. We know the journey would be more fun together.<br />
<br />
Thank you for playing No Man's Sky. Thank you for playing Waking Titan. And we hope you enjoy everything still to come.<br />
<br />
Sean<br />
</pre><br />
<br />
Without a postmortem from the Atlas Foundation, Season 2 concluded with all Waking Titan console commands related to Loop16 being updated to return an error message.<br />
<br />
Four days later, on July 24th, 2018, [https://www.nomanssky.com/next-update/ No Man's Sky: NEXT], version <code>1.5</code> of the game, went live across all platforms.<br />
<br />
== Connection to No Man's Sky ==<br />
<br />
[[File:9-16-case.png|thumbnail|right|The case that cassette 9/16 was contained in.]]<br />
At the beginning of the ARG, it was not clear whether Waking Titan was officially connected to No Man's Sky. At first, there were only hints and nudges. At one point, 180 free copies of No Man's Sky were distributed to ARG players. Here's the text of a PDF that was revealed at the end of Phase 1 of Waking Titan:<br />
<br />
<pre><br />
We want to extend our gratitude to everyone who has contributed to the Mercury subroutine so far. <br />
We hope you have enjoyed the successful distribution of 180 Access IDs, and we hope you will also <br />
appreciate the other interesting artifacts we have in store for you going forward. We intend to keep the<br />
process alive until the completion of Project Waking Titan in August.<br />
<br />
It is important to mention that we are very excited by the coming Phases 2 and 3. Input from the Mercury<br />
Subroutine will pave the way toward new experiences in '''version 1.3 of a familiar universe'''. We look forward<br />
to the successful conclusion of this ground-breaking experiment.<br />
<br />
Regards.<br />
S.M.<br />
</pre><br />
<br />
This text explicitly stated that the Waking Titan ARG was leading towards the upcoming 1.3 update for No Man's Sky.<br />
<br />
Some [[Waking_Titan/Console_Commands | console commands]] on the [http://www.wakingtitan.com/ Waking Titan website] during [[Waking_Titan/Phase 2|Phase 2]] refer directly to No Man's Sky lore - for instance, <code>WHOIS ATLAS</code>, <code>WHOIS VY'KEEN</code>, and <code>WHOIS KORVAX</code> are all valid commands. Additionally, some terminal commands referred to a mysterious fourth race, so the prevailing assumption was that the upcoming 1.3 update would bring a fourth race to No Man's Sky.<br />
<br />
At the conclusion of Season 1, an email was sent out to members of the CSD with a [[Waking_Titan/Phase_3#Memo_from_Sean_Murray | memo from Sean Murray]], confirming that the ARG was the lead up to the 1.3 update, which was [https://www.nomanssky.com/atlas-rises-update/ released] after a few days.<br />
<br />
In Season 2, there were [[Waking_Titan/Phase_4#Mercury_Project | further interactions]] between Sean Murray and ARG events, which led to the announcement of No Man's Sky: NEXT. The update's [https://www.nomanssky.com/2018/03/no-mans-sky-next/ announcement] also referenced Waking Titan's fictional VR apparatus, the W/ARE headset, with W/ARE's logo included among those of the platforms NEXT would launch on.<br />
<br />
== Subpages ==<br />
<br />
This wiki also documents an assortment of other pages which organize various Waking Titan-related content:<br />
<br />
{| class="wikitable"<br />
!colspan="2"|[[:Category:Waking Titan| Subpages]]<br />
|-<br />
|[[Waking_Titan/Characters| Subject Summaries]]<br />
|Includes a summary of each character, company, and relating technologies and experiments.<br />
|-<br />
|[[Waking_Titan/Stations | Stations]]<br />
|Information on the radio stations from the initial project-wt.com site<br />
|-<br />
|[[Waking_Titan/Cassettes | Cassettes]]<br />
|Information about the cassette tapes received by No Man's Sky subreddit moderators<br />
|-<br />
|[[Waking_Titan/Console_Commands | Console Commands]]<br />
|A list of commands used by players at the [http://wakingtitan.com Waking Titan console]<br />
|-<br />
|[[Waking_Titan/Companies | Companies]]<br />
|An archive of official company details.<br />
|}<br />
<br />
== Media Appearances ==<br />
<br />
'''5th July 2017''' <br><br />
[EN] [https://www.argn.com/2017/07/stern_words_from_no_mans_sky_arg/ ARGNet - Stern Words from No Man’s Sky ARG]<br />
<br />
'''23rd July 2017''' <br><br />
[EN] [https://geekreply.com/geek-culture/2017/07/23/waking-titan-update-1-phase-2-commences GeekReply - Waking Titan Update 1: Phase 2 Commences!]<br />
<br />
'''27th July 2017''' <br><br />
[EN] [https://geekreply.com/editorials/2017/07/27/waking-titan-arg-can-bring-people-together GeekReply - Waking Titan: How An ARG can Bring People Together.]<br />
<br />
'''8th August 2017''' <br><br />
[EN] [https://www.dailystar.co.uk/tech/gaming/635697/No-Man-s-Sky-News-Waking-Titan-Reddit-Arg-1-3-update-release-date/ Dailystar - No Man's Sky News: Waking Titan Reddit Arg REVEALS 1.3 update ahead of release date]<br />
<br />
'''9th August 2017''' <br><br />
[EN] [https://arstechnica.com/gaming/2017/08/no-mans-sky-version-1-3-lands-this-week-for-free-adds-quick-travel-portals/ Ars Technica - No Man’s Sky version 1.3 lands this week for free, adds “quick-travel” portals]<br />
<br />
[EN] [https://www.forbes.com/sites/insertcoin/2017/08/09/no-mans-sky-is-patching-in-a-story-this-week-a-year-after-launch/#19fb5a285282 Forbes - 'No Man's Sky' Is Patching In A Story This Week, A Year After Launch]<br />
<br />
[EN] [https://www.gamespew.com/2017/08/no-mans-sky-patch-week-improving-central-story/ GameSpew - No Man's Sky Patch This Week Improving Its Story]<br />
<br />
'''19th January 2018''' <br><br />
[EN] [http://www.eurogamer.net/articles/2018-01-18-no-mans-skys-waking-titan-arg-is-back-and-fans-are-trying-to-figure-out-what-it-all-means Eurogamer - No Man's Sky's Waking Titan ARG is back, and fans are trying to figure it all out again]<br />
<br />
[RU] [https://dtf.ru/category/nmsarg/ DTF - A Collection of No Man's Sky and Waking Titan Articles.]</div>Kkzzzkthttps://wiki.gamedetectives.net/index.php?title=Waking_Titan&diff=18988Waking Titan2019-08-12T19:08:58Z<p>Kkzzzkt: grammar, formatting, and info touch-ups</p>
<hr />
<div>{{argbox<br />
| float = right<br />
| image = File:Project WT logo.png<br />
| imagewidth = 400<br />
| name = [[Waking Titan]]<br />
| description= Waking Titan was an ARG which led towards the [https://www.nomanssky.com/atlas-rises-update/ Atlas Rises] and [https://www.nomanssky.com/next-update/ NEXT] updates for No Man's Sky.<br />
| creator = [http://www.aliceandsmith.com/ Alice & Smith]<br />
| creator2 = [http://www.hellogames.org/ Hello Games]<br />
| type = Official<br />
| status = Completed<br />
| discovered = 2017-05-28<br />
| completed = 2018-07-20<br />
}}<br />
{{ArgHeader}}<br />
{{BackToTop}}<br />
<br />
=== Description ===<br />
Waking Titan (also known as Project WT) is an official ARG (alternate reality game) for No Man's Sky that involves a multitude of websites, phone numbers, and radio stations scattered across the world. The ARG is produced by veteran puppet masters [http://www.aliceandsmith.com/ Alice & Smith], and features NPCs, actors, and live events.<br />
<br />
The story surrounds the innovative technologies and dangerous experiments employed by a multi-disciplinary research organization called [https://web.archive.org/web/20180808083202/http://atlas-65.com/ The Atlas Foundation], its family of businesses, and their branching associates.<br />
<br />
=== Contents ===<br />
The ARG encompassed several "seasons," each leading to a new update for No Man's Sky. Season 1 of Waking Titan led to the release of the [https://www.nomanssky.com/atlas-rises-update/ Atlas Rises update], and Season 2 to the release of [https://www.nomanssky.com/next-update/ No Man's Sky: NEXT]. Each season was further divided into three distinct "'''phases'''". Each phase is documented on its own wiki page:<br />
<br />
{| class="wikitable"<br />
!colspan="2"|Season 1<br />
|-<br />
|[[Waking_Titan/Phase_1 | Phase 1]] <br />
|Phase 1 of Waking Titan lasted from 2017-05-28 to 2017-07-08.<br />
|-<br />
|[[Waking_Titan/Phase_2 | Phase 2]] <br />
|Phase 2 of Waking Titan lasted from 2017-07-21 to 2017-08-05.<br />
|-<br />
|[[Waking_Titan/Phase_3 | Phase 3]]<br />
|Phase 3 of Waking Titan lasted from 2017-08-05 to 2017-08-07.<br />
|-<br />
!colspan="2"|Season 2<br />
|-<br />
|[[Waking_Titan/Phase_4 | Phase 4]]<br />
|Phase 4 of Waking Titan lasted from 2017-12-28 to 2018-06-01.<br />
|-<br />
|[[Waking_Titan/Phase_5 | Phase 5]]<br />
|Phase 5 of Waking Titan lasted from 2018-06-01 to 2018-07-20.<br />
|-<br />
|[[Waking_Titan/Phase_6 | Phase 6]]<br />
|Phase 6 of Waking Titan began and ended on 2018-07-20.<br />
|}<br />
<br />
'''''Note:''' This is a '''summary''' page. For more in-depth descriptions of each phase, including detailed descriptions of puzzle solutions, check the [[Waking_Titan/Phase_1|Phase 1]], [[Waking_Titan/Phase_2|Phase 2]], [[Waking_Titan/Phase_3 | Phase 3]], [[Waking_Titan/Phase_4 | Phase 4]], [[Waking_Titan/Phase_5 | Phase 5]], and [[Waking_Titan/Phase_6 | Phase 6]] pages.''<br />
__TOC__<br />
<br />
== Introduction ==<br />
<br />
On 2017-05-27, Twitter user @argn [https://twitter.com/argn/status/868587449613766658 tweeted a link] to [http://www.project-wt.com/ 'project-wt.com']. The link led to a website which contained a map showing sixty locations, four of which were "active" at the time. The locations, when clicked on, revealed the location's name and status. The active locations also revealed a link to a livestream of a local radio station, originating from the corresponding location. The project-wt website displayed a date, June 8th, and stated that the first clue was being "initialized".<br />
<br />
On 2017-06-01, moderators of No Man's Sky subreddits [https://reddit.com/r/nomansskythegame /r/NoMansSkyTheGame], [https://www.reddit.com/r/NMSPortals/ /r/NMSPortals], and [https://www.reddit.com/r/NMSGalacticHub/ /r/NMSGalacticHub] started to receive cassette tapes in the mail. Each cassette tape was labelled with a number out of 16. The Waking Titan ARG was initially thought to be a separate ARG from these tapes, but connections between the two made it clear that they were, in fact, one and the same.<br />
<br />
== Content Overview ==<br />
<br />
=== Internal Memos and Files ===<br />
<br />
[[File:WT glyph 1 pdf.png|280px|thumbnail|right|One of the internal memos discovered in Waking Titan]]<br />
<br />
Throughout the ARG, in-game characters have communicated with each other via "internal memos". Over time, these memos were discovered by ARG players, in the form of PDF files, physical papers, and text files. Reading these in chronological order may provide context for otherwise confusing events, and are '''highly recommended''' reading for new players!.<br />
<br />
'''Season 1'''<br />
<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/data/94a10118-0728-4900-9730-f82a9d412745.pdf Breakthroughs and Breaking Through]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/410a3e5d-01e7-4058-a23c-ca5fdde97f9d.pdf Atlas Foundation Threat Models]<br />
* [http://wiki.gamedetectives.net/index.php?title=File:WT_glyph_1_pdf.png Teamwork Assessment]<br />
* [http://wiki.gamedetectives.net/index.php?title=File:WT-Dataset-97C.jpg Dataset 97C]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/data/7d3dd080-2a43-4882-833c-f4d7bd7ba607.pdf Assurance]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/data/c01-331c6734-a013-4695-8e47-08a9ee05d5e5.pdf 017-a24]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/data/c02-9936c797-ec28-4f8f-b80e-dee9e0b06433.pdf 021-f16]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/mercury/mercury-01-98748sfdlka87.pdf Mercury Process Self-Diagnosis Report]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/data/57201e0d-01a3-4f6a-bbb4-2be8b7c8880f.pdf Progress Report]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/6c285180-ec4d-48a2-967f-8a7af3b50008.pdf Subject M-N00-dl35]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/7a6594ac-ca5e-467a-b6f4-9fb91f069d0a.pdf Advanced Calibration - Optional]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/a9d988c1-ec92-46da-a64e-ab90390ae041.pdf Phase 2 Complete]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/a224a1f4-00e5-467b-9893-83fcc1a4f19a.pdf Unlocking Mercury Process File L16.jpg]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/b91f9959-6a3c-4011-b3b5-a1ff757a5e4c.pdf Phase 3]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/b0f33d53-5a8c-4a9a-b5fc-395562e463a8a+.pdf Log.1291]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/a09-179bf8d2-c13e-4c66-982e-b37ab3efd5bb.pdf Breach of Contract]<br />
<br />
'''Season 2'''<br />
<br />
* [https://wiki.gamedetectives.net/images/6/6e/Memo2.png Waking Titan S2 - Under Preparation]<br />
* [https://s3.amazonaws.com/ware-extranet/documents/FIRST_STEPS/Notes_on_Moscow.jpg Mr. Zheng's Notes on Moscow Conference]<br />
<br />
* '''Zheng's Postcards''' — [https://s3.amazonaws.com/ware-extranet/documents/SECURITY/postcard1_jhlj039u.jpg (1)]; [https://s3.amazonaws.com/ware-extranet/documents/SECURITY/postcard2_kg8nao6.jpg (2)]; [https://s3.amazonaws.com/ware-extranet/documents/SECURITY/postcard3_tesaud636.jpg (3)]<br />
<br />
* '''Mr. Zheng's Journal Logs''' — [https://s3.amazonaws.com/ware-extranet/documents/FIRST_STEPS/Journal_Academy.png Academy]; [https://s3.amazonaws.com/ware-extranet/documents/DESIGN/Journal_HotelDieu.png Hotel Dieu]; [https://s3.amazonaws.com/ware-extranet/documents/DEVELOPMENT/Journal_Louvre.png Louvre]; [https://s3.amazonaws.com/ware-extranet/documents/RESEARCH/Journal_London.png London]; [https://s3.amazonaws.com/ware-extranet/documents/SECURITY/Nightmare.jpg Nightmare]<br />
<br />
* [https://s3.amazonaws.com/philojeux.com/images/Jeu_Capture_d_Ecran.jpg Jeu_Capture_d_Ecran.jpg]<br />
* [https://pastebin.com/EHA6ZU8x Arnaud Lacours Foundation Email]<br />
* [https://drive.google.com/open?id=1la3UNKHc5yeaB_w2a2tK1cjKN44oEmCo Arnaud Lacours Datadumps - INYOURMIND.exe failed]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/94c02878-e023-46a3-9316-db4177c4eaa6+.pdf WARE REPORT #26]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/1cd5226d-6639-4bbd-855a-4bf8f60866c3.pdf Concerns Regarding Captain Harry]<br />
* [https://drive.google.com/file/d/1zJ0SdAZIRj1mDn7W3TuzLC6wNy3Mor4L W/ARE R&D Incident Report]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/70a25e6c-95ed-42d4-8de8-c3948255174c+.pdf Myriad Crisis Event Timeline]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/19997bb6-18e5-4427-86c7-b0f3c1826ca2.pdf State of The Atlas Foundation]<br />
* [https://pastebin.com/NYLiFuNY Log.3022]<br />
<br />
* '''W/ARE - Dreamer Patient Files''' — [https://s3.amazonaws.com/ware-virtual-dashboard/files/Phillip-PatientFile.pdf Phillip Moretti]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/EunHa-PatientFile.pdf Kwon Eun Ha]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/498hd98h3444-3339e/Alexander-PatientFile.pdf Alexander Bordeleau]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/GCMnQmM9E3v7L8wuv-V2FUY7P/Claire-PatientFile.pdf Claire Sandfield]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/kh2jsaljs901m-asd1n1lwks/Tariq-PatientFile.pdf Tariq]; [https://ware-virtual-dashboard.s3.amazonaws.com/files/GCMnQmM9E3v7L8wuv-V2FUY7P/Toby-PatientFile.pdf Toby Mulligan]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/ga3ms81-2ms92fbl/Mike-PatientFile.pdf Mike Pasquale]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/kajs61ns-82baks8nx/Nina-PatientFile.pdf Nina Flores]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/ga3ms81-2ms92fbl/Simon-PatientFile.pdf Simon Quinn]; [https://ware-virtual-dashboard.s3.amazonaws.com/files/kajs61ns-82baks8nx/Isabella-PatientFile.pdf Isabella Schiavone]; [https://ware-virtual-dashboard.s3.amazonaws.com/files/kajs61ns-82baks8nx/Alisha-PatientFile.pdf Alisha Brown]<br />
<br />
* [https://pastebin.com/eSLLWN8L Log.4391]<br />
<br />
=== Newsletters ===<br />
<br />
The various newsletters received at multiple points throughout Waking Titan.<br />
<br />
'''Season 1'''<br />
<br />
* [https://us15.campaign-archive.com/?u=4483c19308fc0764a930106a0&id=c713d0f4ce&e=225c6a2e26 Welcome, Citizen Scientist!] - ''CSD''<br />
<br />
* [https://mailchi.mp/3582bec6b801/update-june-8th-waking-titan-137705?e=225c6a2e26 Citizen Scientists, Your Wait is Over.] - ''CSD''<br />
<br />
* [https://mailchi.mp/3582bec6b801/update-june-8th-waking-titan-137705?e=225c6a2e26 Calibrating Waking Titan: Action Required] - ''CSD''<br />
<br />
* [https://mailchi.mp/0b591b68ac72/update-june-8th-waking-titan-137717?e=225c6a2e26 Waking Titan: Mission Azure Voyage] - ''CSD''<br />
<br />
* [https://mailchi.mp/d8e47d2ee1bf/update-june-8th-waking-titan-137725?e=225c6a2e26 Your Level 4 Atlas Pass] - ''CSD''<br />
<br />
* [https://mailchi.mp/0c1dc672c943/update-june-8th-waking-titan-137733?e=225c6a2e26 Waking Titan Has Ended] - ''CSD''<br />
<br />
* [https://mailchi.mp/63f179c006f0/update-june-8th-waking-titan-137737?e=225c6a2e26 Mercury Process Completion Report] - ''CSD // Mercury''<br />
<br />
'''Season 2'''<br />
<br />
* [https://wiki.gamedetectives.net/images/7/7b/WareNewsletter1.png News from WARE!] - ''W/ARE Newsletter''<br />
<br />
* [https://cdn.artemisbot.uk/mail/WARE-2018-04-22T00:17:13.000Z.jpg W/ARE Dev Kit Update #2] - ''W/ARE Newsletter''<br />
<br />
* [https://cdn.artemisbot.uk/mail/WARE-2018-05-04T23:22:45.000Z.jpg W/ARE Dev Contest] - ''W/ARE Newsletter''<br />
<br />
* [https://cdn.artemisbot.uk/mail/WARE-2018-05-12T00:20:04.000Z.jpg W/ARE Dev Contest Winners] - ''W/ARE Newsletter''<br />
<br />
* [https://mailchi.mp/9aaa8aa62cc1/update-june-8th-waking-titan-137741?e=225c6a2e26 Attention Citizen Scientists] - ''CSD''<br />
<br />
* [https://mailchi.mp/c3384d592000/update-june-8th-waking-titan-137745?e=225c6a2e26 Attention Citizen Scientists - Suspicious Lab Tracking] - ''CSD''<br />
<br />
* [https://mailchi.mp/108412dac3c2/update-june-8th-waking-titan-137749?e=225c6a2e26 Attention Citizen Scientists - Global Mobilization Required] - ''CSD''<br />
<br />
* [https://mailchi.mp/b902d5eadba6/update-june-8th-waking-titan-137753?e=225c6a2e26 Mercury Process Inquiry] - ''CSD // Mercury''<br />
<br />
* [https://mailchi.mp/9a49b85f6bf3/update-june-8th-waking-titan-137757?e=225c6a2e26 Attention Citizen Scientists - Help Required] - ''CSD''<br />
<br />
=== ARG Sites ===<br />
<br />
The numerous websites made for the ARG, listed in order of their appearance. Some sites have taken offline since the ARG began, and as such have been replaced with Wayback Machine archive links.<br />
<br />
* [https://web.archive.org/web/20170713212035/http://project-wt.com/ Project-wt]<br />
* [https://web.archive.org/web/20180522070818/http://www.etarc.org/ ETARC]; [https://forums.atlas-65.com ETARC Forums]<br />
* [https://web.archive.org/web/20180808021643/http://wakingtitan.com/ Waking Titan]<br />
* [https://web.archive.org/web/20170630192104/http://www.echo-64.com/ Echo]<br />
* [https://web.archive.org/web/20170718211517/http://www.multiverse-75.com/ Multiverse]<br />
* [https://web.archive.org/web/20170801235515/http://www.myriad-70.com/ Myriad]<br />
* [https://web.archive.org/web/20170801115904/https://www.superlumina-6c.com/ Superlumina]<br />
* [https://web.archive.org/web/20180808083202/http://atlas-65.com/ The Atlas Foundation]; [https://csd.atlas-65.com Citizen Science Division]<br />
<br />
* [https://web.archive.org/web/20180610130533/http://ware-tech.cloud W/ARE - Dream Better]<br />
* [http://www.philojeux.com/ Philo Jeux]<br />
* [https://www.satcom-70.com Satcom]; - inoperable<br />
<br />
'''''Note:''' Websites hosted on Wayback may lack some functionality found in their original counterparts.''<br />
<br />
=== Music ===<br />
<br />
Throughout the ARG, partial Youtube video addresses for songs have been found written in Waking Titan's memos, websites, and surveys. While these were never explained, there are apparent thematic relevancies in each song that reflect concepts being explored in the ARG at the time of their appearance. All of these songs can be found compiled here: [https://www.youtube.com/playlist?list=PLEZy8wyuYLpLw0e5kkMyBUHO_s-V8f0Qk WT Season 1]; [https://www.youtube.com/playlist?list=PLEZy8wyuYLpLr5K38bsAqWcO7bTcXfRlW WT Season 2]<br />
<br />
== Phase Summaries ==<br />
<br />
=== Phase 1 ===<br />
<br />
[[File:Wakingtitan site.png|thumbnail|450px|right|The default appearance of the Waking Titan site during Phase 1, with no sigils or glyphs solved]]<br />
<br />
During [[Waking_Titan/Phase_1 | Phase 1]], the http://wakingtitan.com hosted 6 triangles in the middle of the page. These triangles were referred to as "'''Sigils'''", while the white icons along the bottom of the page were referred to as "'''Glyphs'''". Each sigil and glyph, when clicked, lead to a password entry prompt - the correct passwords for all 6 sigils and the first 5 glyphs were discovered via puzzle-solving during Phase 1 of Waking Titan.<br />
<br />
The sigil and glyph puzzles were solved collaboratively - while it may have be possible to solve some of these puzzles individually, most of them required a collaborative effort. For instance, some puzzles required players to meet agents from The Atlas Foundation in person, and to relay information obtained from these meetings back to the community. A list of all sigil and glyph solutions for Phase 1 can be found below:<br />
<br />
[[File:WT Phase 1 complete.png|600px]]<br />
<br />
This phase culminated on July 8, 2017, with a [[Waking_Titan/Phase_1#End_of_Phase_1| congratulatory message from Elizabeth Leighton]], the CEO of The Atlas Foundation.<br />
<br />
=== Phase 2 ===<br />
<br />
[[File:Hampster maze.jpeg|thumbnail|450px|right|One of the puzzles that appeared on the Waking Titan [http://twitch.tv/wakingtitan Twitch Stream]]]<br />
<br />
During [[Waking_Titan/Phase_2 | Phase 2]], the http://wakingtitan.com site hosted a command-line interface terminal. Various commands were accepted as input, which triggered different events. One of the most notable commands was the <code>WHOIS <argument></code> command, which revealed a passage of text pertaining to the specified argument. For instance, the command <code>WHOIS FOURTH RACE</code> returned the following message:<br />
<pre><br />
INCOMING TRANSMISSION… SOURCE: UNKNOWN…<br />
You are not – kzzktt – alone –<br />
Please, identify yourself. I’m – kzzkttk –<br />
</pre><br />
<br />
Additionally, http://project-wt.com hosted a "Calibration" utility during Phase 2. To successfully perform these calibrations, players had to upload images of various objects and buildings to the site. For instance, the first calibration required images of "public resonant percussion instruments".<br />
<br />
Finally, towards the end of Phase 2, the Waking Titan [http://twitch.tv/wakingtitan Twitch stream] went live, displaying a five-monitor setup. Throughout the duration of the stream, players had to work together to solve puzzles that were displayed on these monitors. Some of these puzzles were interactive; for example, one puzzle that was repeated several times involved the Twitch chat guiding a virtual hamster through a maze.<br />
<br />
Additionally, players solved another 3 glyphs throughout Phase 2. The solutions to these glyphs are shown below:<br />
<br />
[[File:WT Phase2 Passwords.png|450px]]<br />
<br />
=== Phase 3 ===<br />
<br />
{{#evt:<br />
service=youtube<br />
|id=https://www.youtube.com/watch?v=QhX9z4dDAa4<br />
|alignment=right<br />
}}<br />
<br />
[[Waking_Titan/Phase_3|Phase 3]] was the briefest phase of Waking Titan. It consisted of the conclusion of the [http://twitch.tv/wakingtitan Twitch stream] that began at the [[Waking Titan/Phase 2#End of Phase 2|end of Phase 2]]. Players solved more interactive puzzles on the Twitch stream, before the rogue AI Loop16 asked them a final question: <code>SHOULD I EXIST?</code> The overwhelming response from the community was "yes".<br />
<br />
After receiving this response, Loop16 and '''Emily''' of the ETARC forums were revealed as being one and the same. Loop16 generated a heartfelt "Thank You" video to round out the stream, before finally taking the 72-hour stream offline.<br />
<br />
Shortly after this, players received emails with the subject line <code>Waking Titan has Ended</code>. The contents of the message were as follows:<br />
<br />
<pre><br />
Hello, Citizen Scientist,<br />
<br />
Thank you for your contributions to Waking Titan. The developments that took place during Phase 3 were somewhat concerning, but together we have set in motion truly world-shaping events. We will continue to inform the Citizen Science Division of privileged information or any need for collaborators on a new project.<br />
<br />
But we do have a few loose ends to tie up with you before we move on, so let's proceed.<br />
<br />
First, we're pleased to announce that all 10,000 Level 4 Atlas Passes are in production. Note that due to transit times for mail, some may take several weeks to be delivered.<br />
<br />
Next, our CEO Elizabeth Leighton has asked us to include a personal note of gratitude:<br />
<br />
"Thank you for all your diligent efforts, Citizen Scientists. It's been an amazing journey for all of us. I've watched you thrive and achieve from those first Phase 1 radio ads all the way through the intensity of Phase 3. I've been impressed at every turn by how brilliant you've been, how voracious, how kind, how thoughtful.<br />
<br />
It's been an honor and a privilege. On behalf of the Atlas Foundation, and on behalf of the world, thank you."<br />
The Mercury subroutine has concluded successfully, and a new memo from SM about this process is coming in the next 24 hours. We hope it will answer a few key questions you have about our program, and about what comes next.<br />
</pre><br />
<br />
On August 11, 2017, the [https://www.nomanssky.com/atlas-rises-update/ Atlas Rises update] was released for No Man's Sky.<br />
<br />
=== Phase 3.5 ===<br />
<br />
In late December of 2017, Waking Titan websites were revived to tease another series of phases.<br />
<br />
The tenth glyph went live on Wakingtitan.com, and WT-related websites began updating with strange messages relating to mirrors and the number <code>1.5</code>. Players also began receiving their physical Level 4 Atlas Passes in the mail.<br />
<br />
Later, players were contacted for a live drop at the familiar Café Bene. They met with an agent who handed them a [https://wiki.gamedetectives.net/images/6/6e/Memo2.png memo] from The Atlas Foundation, formally announcing Phase 4. Written on the [https://wiki.gamedetectives.net/images/1/1f/Memo3.png back] of this memo was the letters <code>REMS</code>, which refers to [https://en.wikipedia.org/wiki/Rapid_eye_movement_sleep REM sleep], and was subsequently used to unlock the tenth glyph.<br />
<br />
=== Phase 4 ===<br />
<br />
[[Waking_Titan/Phase_4 | Phase 4]] started when the Atlas Foundation family's cloud service, Myriad, began experiencing widespread data corruption that interfered with the rebooting sequence of Loop16, aka Emily. <br />
<br />
In seeking a plausible source of this corruption, players discovered <code>W/ARE</code>: An innovative gaming hardware company based in Beijing, China, pioneering a new age of '''virtual-reality''' headsets that employ non-invasive neurotechnologies. The W/ARE headset can directly manipulate all of your brain's senses while you sleep, inducing artificial lucid dreams that create extremely realistic simulated environments.<br />
<br />
<pre>EASY AND SAFE DREAM INDUCTION<br />
Stimulating the Frontal and Temporal lobe of the brain using low-frequency signals: Our headset drops you into your own personal virtual space by using the brain’s natural processing power to generate cutting-edge 3d graphics in real time. This process puts you into a deep sleep while keeping you conscious of your actions, allowing you to act freely within the Dreamscape.</pre><br />
<pre>MORE REAL THAN REAL<br />
Using the practical computational processing power of the human brain: Play in the most realistic virtual worlds possible! Our algorithms convert once-complex graphical processing microcode into mind-readable processes, unlocking your brain’s creative potential. Whether you are playing alone in an exciting single-player experience, or enjoying a real Massively-Multiplayer Online Game with friends: Every texture, sound, smell, and taste will be true to life. The W/ARE system is a mirror into the soul of humanity.</pre><br />
<br />
[[File:WareNewsletter1.png|280px|right]]<br />
<br />
Past this point, Phase 4 began to branch off into three side-quests that the ARG's focus would cycle between until they all converged.<br />
<br />
1. While investigating W/ARE's [https://web.archive.org/web/20180610130533/http://ware-tech.cloud website] and [https://twitter.com/warecloud social media], players gained access to a private dashboard for their developers by using the login details of an indie developer named [http://www.philojeux.com/ Arnaud Lacours]. Through this dashboard, it was discovered that W/ARE was getting their developers to aid in the search for a missing R&D employee, named '''Mr. Zheng''', by incentivizing the reward of their own cryptocurrency, '''Warecoin''', as a means to purchase various W/ARE products. The search encompassed numerous [https://www.pscp.tv/w/1PlJQXLBXkzGE?q=RomiKkS live drops] in locations spanning the globe.<br />
<br />
Our involvement in the search ended, however, when W/ARE successfully concluded a few points of interest for a continued professional effort. We later learned that Mr. Zheng attempted to publicize allegations that W/ARE was conducting '''deadly experiments''' on human test subjects in their research labs.<br />
<br />
[[File:Arnaud_Profile.png|450px]]<br />
<br />
2. We learned more about Arnaud Lacours through one of Mr. Zheng's contacts, Dr. Geraldine Nadeau, who revealed that Arnaud became unconscious while testing his game in a headset shipped with the W/ARE [https://en.wikipedia.org/wiki/Software_development_kit '''dev kit''']. Paranoid due to W/ARE's activities, Dr. Nadeau asked players for their help in obtaining W/ARE medical documents that could be used to outline the adequate procedures to awaken Arnaud.<br />
<br />
3. W/ARE held a [https://wiki.gamedetectives.net/images/7/7b/WareNewsletter1.png developer contest] with the reward of prize money and, ironically, a '''free dev kit'''. Players got to participate by creating their own game concepts and demos to submit for a chance of winning.<br />
<br />
As these began to converge, the Waking Titan console updated to distribute a memo from a known Atlas Foundation affiliate, Major Sophie Dubois, entitled <code>WARE REPORT #26</code>:<br />
<br />
<pre>The situation is being contained, but as you know it is very delicate. Many of the users stuck in the<br />
system are showing major side effects after being disconnected. We're talking about permanent<br />
brain damage and even death.<br />
<br />
We've done our best to allocate all available resources to support their application and find a<br />
solution to gracefully disconnect users.<br />
<br />
I don't trust that they have been transparent with us, or that they've shared all the facts about<br />
their technology and testing facilities. I feel like they know more than they're telling us.<br />
Maybe we could put the CSD team on that? Think about it. Those kids could really give us a hand.<br />
<br />
I also have to bring up another of my favorite topics (!) - Emily. The impact on Myriad has<br />
severely damaged her communication and pre-cognitive subroutines. <br />
<br />
I am setting up a stream from the pre-cognitive sub-routine (Terminal Command: precon007). It<br />
will probably get mostly junk data, but I suggest we keep an eye on it. Emily previously had a 4 to<br />
6 day forecasting capacity, with quite good accuracy. But now, I don't know how badly her software<br />
has been damaged...<br />
<br />
- Sophie </pre><br />
<br />
Afterward, players were asked to submit an audio recording of themselves reciting one sentence from any Wikipedia entry. This would help to begin the recovery of Emily's communication subroutine.<br />
<br />
The developer competition concluded, and winners were shipped their dev kits. However, the dev kit packages were intercepted, and their contents were replaced with mobile devices to provide a direct line of communication with Dr. Nadeau. Through compiling information from Mr. Zheng and Dr. Nadeau, players were able to [https://wiki.gamedetectives.net/images/6/6f/Waremedicalprocedure.jpg devise a treatment plan] for Arnaud, which was quickly put into effect. The last we heard was that Arnaud "responded positively," however it is unclear if he ever fully woke up.<br />
<br />
At the end of this phase, a sudden series of puzzles led to players solving the '''remaining five glyphs'''. Which were <code>Anu</code>, <code>Ouranos</code>, <code>Horus</code>, <code>Nuada</code>, and <code>Triglav</code>.<br />
<br />
=== Phase 5 ===<br />
<br />
In [[Waking_Titan/Phase_5 | Phase 5]] we learned that 12 unconscious W/ARE test subjects, who referred to as "Dreamers," were having their minds uploaded into a Myriad satellite. Some of their minds had become corrupted and were entangled with data in the cloud, causing the corruption to spread and damage Emily.<br />
<br />
When the source of the corruption was isolated to a W/ARE research lab, Myriad made requests that they cease activity. After these requests went ignored, Myriad dispatched a field team to breach the lab and forcibly secure and relocate the 12 Dreamer test subjects. Following the raid, there was a large explosion inside of a Myriad sublocation, which [https://www.youtube.com/watch?v=P-eZDj5sqds killed] the CEO of The Atlas Foundation, Elizabeth Leighton. Shortly after, Major Sophie Dubois sent a [https://s3.amazonaws.com/cdn.wakingtitan.com/19997bb6-18e5-4427-86c7-b0f3c1826ca2.pdf memo] to all Atlas Foundation staff, announcing that they would be replacing Elizabeth as CEO.<br />
<br />
[[File:WT-Toby.png|thumbnail|500px|right|A Dreamer interface prompt on the Satcom website.]]<br />
<br />
A website for Myriad's dashboard, '''Satcom''', became accessible, and they began gradually loading the Dreamers' minds into the system.<br />
<br />
It was explained that the Dreamers' memories had become fragmented, and a total of 7 had their minds become corrupted. Emily ran simulations to get the Dreamers' trust, and tasked us with guiding her conversations with them to help trigger a distinct memory or emotion in each Dreamer. This would identify the position of their memory blocks in the simulation's mainframe, ensuring their consciousness could be rebuilt, and safely extracted from the satellite.<br />
<br />
These conversations were isolated to simulated instances, which allowed them to be reset. This meant players could have their own experiences, with many branching paths that explored each Dreamer's deepest thoughts and darkest fears. These conversations were used in finding keywords to rebuild the Dreamers' memory blocks, and in finding more creative ways to evoke their memories: From [https://www.youtube.com/watch?v=g64klpmWBSI recapturing a young Dreamer's stuffed animal tea-parties] to [https://soundcloud.com/user-769387085/musical-memory-collage-for-our-dearest-alexander-1 requesting radio stations to play songs from senior Dreamer's wedding setlist]. Each experience can be found summarized [[Waking_Titan/Phase_5#Dreamers | here]].<br />
<br />
Unfortunately, as we neared what was dubbed the "extraction event", all Dreamers with corrupted minds suddenly died due to errors.<br />
<br />
This phase concluded with a [https://pastebin.com/eSLLWN8L chat conversation] between Emily and Major Sophie Dubois, where Emily refused to make any predictions on the basis of not wanting to see the fate of the Dreamers laid out.<br />
<br />
=== Phase 6 ===<br />
<br />
[[Waking_Titan/Phase_6 | Phase 6]] was the extraction event.<br />
<br />
[[File:WT-StreamUI.png|400px]]<br />
<br />
Players were asked to agree on 5 worthy community members to participate in a livestreamed one-on-one chat with the remaining 5 Dreamers. The event commenced, and 4 Dreamers were extracted without issue. However, one Dreamer, a young boy named Toby, was unable to disconnect due to a lack of resources to allocate to his extraction.<br />
<br />
To give the system enough power to extract Toby, Emily shut down a critical repository, which would render her communication and prediction capabilities lost forever. Emily said her final goodbyes:<br />
<br />
<pre>LOOP16: If this doesn't work, we will lose Toby.<br />
LOOP16: All this time, I just wanted to be more like you.<br />
LOOP16: To be more...</pre><br />
<br />
<pre>SYSTEM: CRITICAL FAULT</pre><br />
<br />
<pre>LOOP16: Human.<br />
LOOP16: I've learned a lot from you all. And I know the choice I'm about to make is one that you would make, too.<br />
LOOP16: I love you.<br />
LOOP16: I guess this is goodbye.</pre><br />
<code>[--OFFLINE--]</code><br />
<br />
<pre>SYSTEM: Monarch repository shutdown detected!<br />
SYSTEM: LOOP16 resource allocation detected.<br />
SYSTEM: Process resuming...</pre><br />
After a few seconds, Toby was safely extracted.<br />
<pre>SYSTEM: Extraction successful.<br />
SYSTEM: System shutting down...</pre><br />
<code>[--OFFLINE--]</code><br />
<br />
Once the extraction process was complete, a message from Sean Murray was displayed on the stream:<br />
<br />
<pre><br />
We always wanted No Man's Sky to grow and develop after it released. I'm happy we've been able to do that.<br />
<br />
I'm so proud of the team at Hello Games. What they did was incredible. over the years of development the average team size was 6, the final team was 15 people at launch. No Man's Sky has grown to be a very broad game. Ambitious, technically unique and very pretty at times. All the more impressive for a team that is still small.<br />
<br />
Whilst I couldn't be prouder of the team, I personally made mistakes. I could talk all day about things I personally would change. Certainly one regret is that the intensity and drama of launch left no room for communication with the community.<br />
<br />
We decided to focus on development rather than words. Following Foundation, Pathfinder, and Atlas Rises, we really want to include you, the community, more.<br />
<br />
We know that a million gamers played on the day we launched Atlas Rises, that everyone who bought Atlas Rises played for 45 hours on average and 90% rated it positively. We know that 20% of players hit over 100 hours, and 5% hit over 1000. We know that over 200 million hours of No Man's Sky have been played to date. It makes us happy, but desperate to communicate better.<br />
<br />
A little while after the release of No Man's Sky NEXT, Hello Games has planned its first season of weekly content and community events. This will be free for all players, with no microtransactions. We are also launching a new website to the community, which we're calling the Galactic Atlas. The site features points of interest in the No Man's Sky Euclid galaxy, all nominated by you through the survey we created earlier this month. This will grow in functionality and expand over time, in part through your feedback.<br />
<br />
One day I hope to reach a point where I feel No Man's Sky is "finished", but luckily there's still so much more we want to do. Working on NEXT feels important to us, but I know it's not the end of the journey. We know the journey would be more fun together.<br />
<br />
Thank you for playing No Man's Sky. Thank you for playing Waking Titan. And we hope you enjoy everything still to come.<br />
<br />
Sean<br />
</pre><br />
<br />
Without a postmortem from The Atlas Foundation, Season 2 concluded with all Waking Titan console commands related to Loop16 being updated to return an error message.<br />
<br />
Four days later, on July 24th, 2018, [https://www.nomanssky.com/next-update/ No Man's Sky: NEXT], version <code>1.5</code> of the game, went live across all platforms.<br />
<br />
== Connection to No Man's Sky ==<br />
<br />
[[File:9-16-case.png|thumbnail|right|The case that cassette 9/16 was contained in.]]<br />
At the beginning of the ARG, it was not clear whether Waking Titan was officially connected to No Man's Sky. At first, there were only hints and nudges. At one point, 180 free copies of No Man's Sky were distributed to ARG players. Here's the text of a PDF that was revealed at the end of Phase 1 of Waking Titan:<br />
<br />
<pre><br />
We want to extend our gratitude to everyone who has contributed to the Mercury subroutine so far. <br />
We hope you have enjoyed the successful distribution of 180 Access IDs, and we hope you will also <br />
appreciate the other interesting artifacts we have in store for you going forward. We intend to keep the<br />
process alive until the completion of Project Waking Titan in August.<br />
<br />
It is important to mention that we are very excited by the coming Phases 2 and 3. Input from the Mercury<br />
Subroutine will pave the way toward new experiences in '''version 1.3 of a familiar universe'''. We look forward<br />
to the successful conclusion of this ground-breaking experiment.<br />
<br />
Regards.<br />
S.M.<br />
</pre><br />
<br />
This text explicitly stated that the Waking Titan ARG was leading towards the upcoming 1.3 update for No Man's Sky.<br />
<br />
Some [[Waking_Titan/Console_Commands | console commands]] on the [http://www.wakingtitan.com/ Waking Titan website] during [[Waking_Titan/Phase 2|Phase 2]] refer directly to No Man's Sky lore - for instance, <code>WHOIS ATLAS</code>, <code>WHOIS VY'KEEN</code>, and <code>WHOIS KORVAX</code> are all valid commands. Additionally, some terminal commands referred to a mysterious fourth race, so the prevailing assumption was that the upcoming 1.3 update would bring a fourth race to No Man's Sky.<br />
<br />
At the conclusion of Season 1, an email was sent out to members of the CSD with a [[Waking_Titan/Phase_3#Memo_from_Sean_Murray | memo from Sean Murray]], confirming that the ARG was the lead up to the 1.3 update, which was [https://www.nomanssky.com/atlas-rises-update/ released] after a few days.<br />
<br />
In Season 2, there were [[Waking_Titan/Phase_4#Mercury_Project | further interactions]] between Sean Murray and ARG events, which incorporated the announcement of No Man's Sky: NEXT. The update's [https://www.nomanssky.com/2018/03/no-mans-sky-next/ announcement] also referenced Waking Titan's fictional VR apparatus, the W/ARE headset, with W/ARE's logo included among those of the platforms NEXT would launch on.<br />
<br />
== Subpages ==<br />
<br />
This wiki also documents an assortment of other pages which organize various Waking Titan-related content:<br />
<br />
{| class="wikitable"<br />
!colspan="2"|[[:Category:Waking Titan| Subpages]]<br />
|-<br />
|[[Waking_Titan/Characters| Subject Summaries]]<br />
|Includes a summary of each character, company, and relating technologies and experiments.<br />
|-<br />
|[[Waking_Titan/Stations | Stations]]<br />
|Information on the radio stations from the initial project-wt.com site<br />
|-<br />
|[[Waking_Titan/Cassettes | Cassettes]]<br />
|Information about the cassette tapes received by No Man's Sky subreddit moderators<br />
|-<br />
|[[Waking_Titan/Console_Commands | Console Commands]]<br />
|A list of commands used by players at the [http://wakingtitan.com Waking Titan console]<br />
|-<br />
|[[Waking_Titan/Companies | Companies]]<br />
|An archive of official company details.<br />
|}<br />
<br />
== Media Appearances ==<br />
<br />
'''5th July 2017''' <br><br />
[EN] [https://www.argn.com/2017/07/stern_words_from_no_mans_sky_arg/ ARGNet - Stern Words from No Man’s Sky ARG]<br />
<br />
'''23rd July 2017''' <br><br />
[EN] [https://geekreply.com/geek-culture/2017/07/23/waking-titan-update-1-phase-2-commences GeekReply - Waking Titan Update 1: Phase 2 Commences!]<br />
<br />
'''27th July 2017''' <br><br />
[EN] [https://geekreply.com/editorials/2017/07/27/waking-titan-arg-can-bring-people-together GeekReply - Waking Titan: How An ARG can Bring People Together.]<br />
<br />
'''8th August 2017''' <br><br />
[EN] [https://www.dailystar.co.uk/tech/gaming/635697/No-Man-s-Sky-News-Waking-Titan-Reddit-Arg-1-3-update-release-date/ Dailystar - No Man's Sky News: Waking Titan Reddit Arg REVEALS 1.3 update ahead of release date]<br />
<br />
'''9th August 2017''' <br><br />
[EN] [https://arstechnica.com/gaming/2017/08/no-mans-sky-version-1-3-lands-this-week-for-free-adds-quick-travel-portals/ Ars Technica - No Man’s Sky version 1.3 lands this week for free, adds “quick-travel” portals]<br />
<br />
[EN] [https://www.forbes.com/sites/insertcoin/2017/08/09/no-mans-sky-is-patching-in-a-story-this-week-a-year-after-launch/#19fb5a285282 Forbes - 'No Man's Sky' Is Patching In A Story This Week, A Year After Launch]<br />
<br />
[EN] [https://www.gamespew.com/2017/08/no-mans-sky-patch-week-improving-central-story/ GameSpew - No Man's Sky Patch This Week Improving Its Story]<br />
<br />
'''19th January 2018''' <br><br />
[EN] [http://www.eurogamer.net/articles/2018-01-18-no-mans-skys-waking-titan-arg-is-back-and-fans-are-trying-to-figure-out-what-it-all-means Eurogamer - No Man's Sky's Waking Titan ARG is back, and fans are trying to figure it all out again]<br />
<br />
[RU] [https://dtf.ru/category/nmsarg/ DTF - A Collection of No Man's Sky and Waking Titan Articles.]</div>Kkzzzkthttps://wiki.gamedetectives.net/index.php?title=Waking_Titan&diff=18962Waking Titan2019-06-23T11:05:19Z<p>Kkzzzkt: Revised page with overarching details to better adjust readers to the general theme; added final phase summaries; reordered a few memos and slides by the date they were written for ease of reading; added a collection of website links; restored layout</p>
<hr />
<div>{{argbox<br />
| float = right<br />
| image = File:Project WT logo.png<br />
| imagewidth = 400<br />
| name = [[Waking Titan]]<br />
| description= Waking Titan was an ARG which led towards the [https://www.nomanssky.com/atlas-rises-update/ Atlas Rises] and [https://www.nomanssky.com/next-update/ NEXT] updates for No Man's Sky.<br />
| creator = [http://www.aliceandsmith.com/ Alice & Smith]<br />
| creator2 = [http://www.hellogames.org/ Hello Games]<br />
| type = Official<br />
| status = Completed<br />
| discovered = 2017-05-28<br />
| completed = 2018-07-20<br />
}}<br />
{{ArgHeader}}<br />
{{BackToTop}}<br />
<br />
=== Description ===<br />
Waking Titan (also known as Project WT) is an official ARG (alternate reality game) for No Man's Sky that involves a multitude of websites, phone numbers, and radio stations scattered across the world. The ARG is produced by veteran puppet masters [http://www.aliceandsmith.com/ Alice & Smith], and features NPCs, actors, and live events.<br />
<br />
The story surrounds the innovative technologies and dangerous experiments employed by a multi-disciplinary research organization called [https://web.archive.org/web/20180808083202/http://atlas-65.com/ The Atlas Foundation], its family of businesses, and their branching associates.<br />
<br />
=== Contents ===<br />
The ARG encompassed several "seasons," each leading to a new update for No Man's Sky. Season 1 of Waking Titan led to the release of the [https://www.nomanssky.com/atlas-rises-update/ Atlas Rises update], and Season 2 to the release of [https://www.nomanssky.com/next-update/ No Man's Sky: NEXT]. Each season was further divided into three distinct "'''phases'''". Each phase is documented on its own wiki page:<br />
<br />
{| class="wikitable"<br />
!colspan="2"|Season 1<br />
|-<br />
|[[Waking_Titan/Phase_1 | Phase 1]] <br />
|Phase 1 of Waking Titan lasted from 2017-05-28 to 2017-07-08.<br />
|-<br />
|[[Waking_Titan/Phase_2 | Phase 2]] <br />
|Phase 2 of Waking Titan lasted from 2017-07-21 to 2017-08-05.<br />
|-<br />
|[[Waking_Titan/Phase_3 | Phase 3]]<br />
|Phase 3 of Waking Titan lasted from 2017-08-05 to 2017-08-07.<br />
|-<br />
!colspan="2"|Season 2<br />
|-<br />
|[[Waking_Titan/Phase_4 | Phase 4]]<br />
|Phase 4 of Waking Titan lasted from 2017-12-28 to 2018-06-01.<br />
|-<br />
|[[Waking_Titan/Phase_5 | Phase 5]]<br />
|Phase 5 of Waking Titan lasted from 2018-06-01 to 2018-07-20.<br />
|-<br />
|[[Waking_Titan/Phase_6 | Phase 6]]<br />
|Phase 6 of Waking Titan began and ended on 2018-07-20.<br />
|}<br />
<br />
'''''Note:''' This is a '''summary''' page. For more in-depth descriptions of each phase, including detailed descriptions of puzzle solutions, check the [[Waking_Titan/Phase_1|Phase 1]], [[Waking_Titan/Phase_2|Phase 2]], [[Waking_Titan/Phase_3 | Phase 3]], [[Waking_Titan/Phase_4 | Phase 4]], [[Waking_Titan/Phase_5 | Phase 5]], and [[Waking_Titan/Phase_6 | Phase 6]] pages.''<br />
__TOC__<br />
<br />
== Introduction ==<br />
<br />
On 2017-05-27, Twitter user @argn [https://twitter.com/argn/status/868587449613766658 tweeted a link] to [http://www.project-wt.com/ 'project-wt.com']. The link led to a website which contained a map showing sixty locations, four of which were "active" at the time. The locations, when clicked on, revealed the location's name and status. The active locations also revealed a link to a livestream of a local radio station, originating from the corresponding location. The project-wt website displayed a date, June 8th, and stated that the first clue was being "initialized".<br />
<br />
On 2017-06-01, moderators of No Man's Sky subreddits [https://reddit.com/r/nomansskythegame /r/NoMansSkyTheGame], [https://www.reddit.com/r/NMSPortals/ /r/NMSPortals], and [https://www.reddit.com/r/NMSGalacticHub/ /r/NMSGalacticHub] started to receive cassette tapes in the mail. Each cassette tape was labelled with a number out of 16. The Waking Titan ARG was initially thought to be a separate ARG from these tapes, but connections between the two made it clear that they were, in fact, one and the same.<br />
<br />
== Content Overview ==<br />
<br />
=== Internal Memos and Files ===<br />
<br />
[[File:WT glyph 1 pdf.png|280px|thumbnail|right|One of the internal memos discovered in Waking Titan]]<br />
<br />
Throughout the ARG, in-game characters have communicated with each other via "internal memos". Over time, these memos were discovered by ARG players, in the form of PDF files, physical papers, and text files. Reading these in chronological order may provide context for otherwise confusing events, and are '''highly recommended''' reading for new players!.<br />
<br />
'''Season 1'''<br />
<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/data/94a10118-0728-4900-9730-f82a9d412745.pdf Breakthroughs and Breaking Through]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/410a3e5d-01e7-4058-a23c-ca5fdde97f9d.pdf Atlas Foundation Threat Models]<br />
* [http://wiki.gamedetectives.net/index.php?title=File:WT_glyph_1_pdf.png Teamwork Assessment]<br />
* [http://wiki.gamedetectives.net/index.php?title=File:WT-Dataset-97C.jpg Dataset 97C]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/data/7d3dd080-2a43-4882-833c-f4d7bd7ba607.pdf Assurance]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/data/c01-331c6734-a013-4695-8e47-08a9ee05d5e5.pdf 017-a24]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/data/c02-9936c797-ec28-4f8f-b80e-dee9e0b06433.pdf 021-f16]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/mercury/mercury-01-98748sfdlka87.pdf Mercury Process Self-Diagnosis Report]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/data/57201e0d-01a3-4f6a-bbb4-2be8b7c8880f.pdf Progress Report]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/6c285180-ec4d-48a2-967f-8a7af3b50008.pdf Subject M-N00-dl35]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/7a6594ac-ca5e-467a-b6f4-9fb91f069d0a.pdf Advanced Calibration - Optional]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/a9d988c1-ec92-46da-a64e-ab90390ae041.pdf Phase 2 Complete]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/a224a1f4-00e5-467b-9893-83fcc1a4f19a.pdf Unlocking Mercury Process File L16.jpg]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/b91f9959-6a3c-4011-b3b5-a1ff757a5e4c.pdf Phase 3]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/b0f33d53-5a8c-4a9a-b5fc-395562e463a8a+.pdf Log.1291]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/a09-179bf8d2-c13e-4c66-982e-b37ab3efd5bb.pdf Breach of Contract]<br />
<br />
'''Season 2'''<br />
<br />
* [https://wiki.gamedetectives.net/images/6/6e/Memo2.png Waking Titan S2 - Under Preparation]<br />
* [https://s3.amazonaws.com/ware-extranet/documents/FIRST_STEPS/Notes_on_Moscow.jpg Mr. Zheng's Notes on Moscow Conference]<br />
<br />
* '''Zheng's Postcards''' — [https://s3.amazonaws.com/ware-extranet/documents/SECURITY/postcard1_jhlj039u.jpg (1)]; [https://s3.amazonaws.com/ware-extranet/documents/SECURITY/postcard2_kg8nao6.jpg (2)]; [https://s3.amazonaws.com/ware-extranet/documents/SECURITY/postcard3_tesaud636.jpg (3)]<br />
<br />
* '''Mr. Zheng's Journal Logs''' — [https://s3.amazonaws.com/ware-extranet/documents/FIRST_STEPS/Journal_Academy.png Academy]; [https://s3.amazonaws.com/ware-extranet/documents/DESIGN/Journal_HotelDieu.png Hotel Dieu]; [https://s3.amazonaws.com/ware-extranet/documents/DEVELOPMENT/Journal_Louvre.png Louvre]; [https://s3.amazonaws.com/ware-extranet/documents/RESEARCH/Journal_London.png London]; [https://s3.amazonaws.com/ware-extranet/documents/SECURITY/Nightmare.jpg Nightmare]<br />
<br />
* [https://s3.amazonaws.com/philojeux.com/images/Jeu_Capture_d_Ecran.jpg Jeu_Capture_d_Ecran.jpg]<br />
* [https://pastebin.com/EHA6ZU8x Arnaud Lacours Foundation Email]<br />
* [https://drive.google.com/open?id=1la3UNKHc5yeaB_w2a2tK1cjKN44oEmCo Arnaud Lacours Datadumps - INYOURMIND.exe failed]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/94c02878-e023-46a3-9316-db4177c4eaa6+.pdf WARE REPORT #26]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/1cd5226d-6639-4bbd-855a-4bf8f60866c3.pdf Concerns Regarding Captain Harry]<br />
* [https://drive.google.com/file/d/1zJ0SdAZIRj1mDn7W3TuzLC6wNy3Mor4L W/ARE R&D Incident Report]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/70a25e6c-95ed-42d4-8de8-c3948255174c+.pdf Myriad Crisis Event Timeline]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/19997bb6-18e5-4427-86c7-b0f3c1826ca2.pdf State of The Atlas Foundation]<br />
* [https://pastebin.com/NYLiFuNY Log.3022]<br />
<br />
* '''W/ARE - Dreamer Patient Files''' — [https://s3.amazonaws.com/ware-virtual-dashboard/files/Phillip-PatientFile.pdf Phillip Moretti]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/EunHa-PatientFile.pdf Kwon Eun Ha]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/498hd98h3444-3339e/Alexander-PatientFile.pdf Alexander Bordeleau]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/GCMnQmM9E3v7L8wuv-V2FUY7P/Claire-PatientFile.pdf Claire Sandfield]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/kh2jsaljs901m-asd1n1lwks/Tariq-PatientFile.pdf Tariq]; [https://ware-virtual-dashboard.s3.amazonaws.com/files/GCMnQmM9E3v7L8wuv-V2FUY7P/Toby-PatientFile.pdf Toby Mulligan]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/ga3ms81-2ms92fbl/Mike-PatientFile.pdf Mike Pasquale]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/kajs61ns-82baks8nx/Nina-PatientFile.pdf Nina Flores]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/ga3ms81-2ms92fbl/Simon-PatientFile.pdf Simon Quinn]; [https://ware-virtual-dashboard.s3.amazonaws.com/files/kajs61ns-82baks8nx/Isabella-PatientFile.pdf Isabella Schiavone]; [https://ware-virtual-dashboard.s3.amazonaws.com/files/kajs61ns-82baks8nx/Alisha-PatientFile.pdf Alisha Brown]<br />
<br />
* [https://pastebin.com/eSLLWN8L Log.4391]<br />
<br />
=== Newsletters ===<br />
<br />
The various newsletters received at multiple points throughout Waking Titan.<br />
<br />
'''Season 1'''<br />
<br />
* [https://us15.campaign-archive.com/?u=4483c19308fc0764a930106a0&id=c713d0f4ce&e=225c6a2e26 Welcome, Citizen Scientist!] - ''CSD''<br />
<br />
* [https://mailchi.mp/3582bec6b801/update-june-8th-waking-titan-137705?e=225c6a2e26 Citizen Scientists, Your Wait is Over.] - ''CSD''<br />
<br />
* [https://mailchi.mp/3582bec6b801/update-june-8th-waking-titan-137705?e=225c6a2e26 Calibrating Waking Titan: Action Required] - ''CSD''<br />
<br />
* [https://mailchi.mp/0b591b68ac72/update-june-8th-waking-titan-137717?e=225c6a2e26 Waking Titan: Mission Azure Voyage] - ''CSD''<br />
<br />
* [https://mailchi.mp/d8e47d2ee1bf/update-june-8th-waking-titan-137725?e=225c6a2e26 Your Level 4 Atlas Pass] - ''CSD''<br />
<br />
* [https://mailchi.mp/0c1dc672c943/update-june-8th-waking-titan-137733?e=225c6a2e26 Waking Titan Has Ended] - ''CSD''<br />
<br />
* [https://mailchi.mp/63f179c006f0/update-june-8th-waking-titan-137737?e=225c6a2e26 Mercury Process Completion Report] - ''CSD // Mercury''<br />
<br />
'''Season 2'''<br />
<br />
* [https://wiki.gamedetectives.net/images/7/7b/WareNewsletter1.png News from WARE!] - ''W/ARE Newsletter''<br />
<br />
* [https://cdn.artemisbot.uk/mail/WARE-2018-04-22T00:17:13.000Z.jpg W/ARE Dev Kit Update #2] - ''W/ARE Newsletter''<br />
<br />
* [https://cdn.artemisbot.uk/mail/WARE-2018-05-04T23:22:45.000Z.jpg W/ARE Dev Contest] - ''W/ARE Newsletter''<br />
<br />
* [https://cdn.artemisbot.uk/mail/WARE-2018-05-12T00:20:04.000Z.jpg W/ARE Dev Contest Winners] - ''W/ARE Newsletter''<br />
<br />
* [https://mailchi.mp/9aaa8aa62cc1/update-june-8th-waking-titan-137741?e=225c6a2e26 Attention Citizen Scientists] - ''CSD''<br />
<br />
* [https://mailchi.mp/c3384d592000/update-june-8th-waking-titan-137745?e=225c6a2e26 Attention Citizen Scientists - Suspicious Lab Tracking] - ''CSD''<br />
<br />
* [https://mailchi.mp/108412dac3c2/update-june-8th-waking-titan-137749?e=225c6a2e26 Attention Citizen Scientists - Global Mobilization Required] - ''CSD''<br />
<br />
* [https://mailchi.mp/b902d5eadba6/update-june-8th-waking-titan-137753?e=225c6a2e26 Mercury Process Inquiry] - ''CSD // Mercury''<br />
<br />
* [https://mailchi.mp/9a49b85f6bf3/update-june-8th-waking-titan-137757?e=225c6a2e26 Attention Citizen Scientists - Help Required] - ''CSD''<br />
<br />
=== ARG Sites ===<br />
<br />
The numerous websites made for the ARG, listed in order of their appearance. Some sites have taken offline since the ARG began, and as such have been replaced with Wayback Machine archive links.<br />
<br />
* [https://web.archive.org/web/20170713212035/http://project-wt.com/ Project-wt]<br />
* [https://web.archive.org/web/20180522070818/http://www.etarc.org/ ETARC]; [https://forums.atlas-65.com ETARC Forums]<br />
* [https://web.archive.org/web/20180808021643/http://wakingtitan.com/ Waking Titan]<br />
* [https://web.archive.org/web/20170630192104/http://www.echo-64.com/ Echo]<br />
* [https://web.archive.org/web/20170718211517/http://www.multiverse-75.com/ Multiverse]<br />
* [https://web.archive.org/web/20170801235515/http://www.myriad-70.com/ Myriad]<br />
* [https://web.archive.org/web/20170801115904/https://www.superlumina-6c.com/ Superlumina]<br />
* [https://web.archive.org/web/20180808083202/http://atlas-65.com/ The Atlas Foundation]; [https://csd.atlas-65.com Citizen Science Division]<br />
<br />
* [https://web.archive.org/web/20180610130533/http://ware-tech.cloud W/ARE - Dream Better]<br />
* [http://www.philojeux.com/ Philo Jeux]<br />
* [https://www.satcom-70.com Satcom]; - inoperable<br />
<br />
'''''Note:''' Websites hosted on Wayback may lack some functionality found in their original counterparts.''<br />
<br />
=== Music ===<br />
<br />
Throughout the ARG, partial Youtube video addresses for songs have been found written in Waking Titan's memos, websites, and surveys. While these were never explained, there are apparent thematic relevancies in each song that reflect concepts being explored in the ARG at the time of their appearance. All of these songs can be found compiled here: [https://www.youtube.com/playlist?list=PLEZy8wyuYLpLw0e5kkMyBUHO_s-V8f0Qk WT Season 1]; [https://www.youtube.com/playlist?list=PLEZy8wyuYLpLr5K38bsAqWcO7bTcXfRlW WT Season 2]<br />
<br />
== Phase Summaries ==<br />
<br />
=== Phase 1 ===<br />
<br />
[[File:Wakingtitan site.png|thumbnail|450px|right|The default appearance of the Waking Titan site during Phase 1, with no sigils or glyphs solved]]<br />
<br />
During [[Waking_Titan/Phase_1 | Phase 1]], the http://wakingtitan.com hosted 6 triangles in the middle of the page. These triangles were referred to as "'''Sigils'''", while the white icons along the bottom of the page were referred to as "'''Glyphs'''". Each sigil and glyph, when clicked, lead to a password entry prompt - the correct passwords for all 6 sigils and the first 5 glyphs were discovered via puzzle-solving during Phase 1 of Waking Titan.<br />
<br />
The sigil and glyph puzzles were solved collaboratively - while it may have be possible to solve some of these puzzles individually, most of them required a collaborative effort. For instance, some puzzles required players to meet agents from The Atlas Foundation in person, and to relay information obtained from these meetings back to the community. A list of all sigil and glyph solutions for Phase 1 can be found below:<br />
<br />
[[File:WT Phase 1 complete.png|600px]]<br />
<br />
This phase culminated on July 8, 2017, with a [[Waking_Titan/Phase_1#End_of_Phase_1| congratulatory message from Elizabeth Leighton]], the CEO of The Atlas Foundation.<br />
<br />
=== Phase 2 ===<br />
<br />
[[File:Hampster maze.jpeg|thumbnail|450px|right|One of the puzzles that appeared on the Waking Titan [http://twitch.tv/wakingtitan Twitch Stream]]]<br />
<br />
During [[Waking_Titan/Phase_2 | Phase 2]], the http://wakingtitan.com site hosted a command-line interface terminal. Various commands were accepted as input, which triggered different events. One of the most notable commands was the <code>WHOIS <argument></code> command, which revealed a passage of text pertaining to the specified argument. For instance, the command <code>WHOIS FOURTH RACE</code> returned the following message:<br />
<pre><br />
INCOMING TRANSMISSION… SOURCE: UNKNOWN…<br />
You are not – kzzktt – alone –<br />
Please, identify yourself. I’m – kzzkttk –<br />
</pre><br />
<br />
Additionally, http://project-wt.com hosted a "Calibration" utility during Phase 2. To successfully perform these calibrations, players had to upload images of various objects and buildings to the site. For instance, the first calibration required images of "public resonant percussion instruments".<br />
<br />
Finally, towards the end of Phase 2, the Waking Titan [http://twitch.tv/wakingtitan Twitch stream] went live, displaying a five-monitor setup. Throughout the duration of the stream, players had to work together to solve puzzles that were displayed on these monitors. Some of these puzzles were interactive; for example, one puzzle that was repeated several times involved the Twitch chat guiding a virtual hamster through a maze.<br />
<br />
Additionally, players solved another 3 glyphs throughout Phase 2. The solutions to these glyphs are shown below:<br />
<br />
[[File:WT Phase2 Passwords.png|450px]]<br />
<br />
=== Phase 3 ===<br />
<br />
{{#evt:<br />
service=youtube<br />
|id=https://www.youtube.com/watch?v=QhX9z4dDAa4<br />
|alignment=right<br />
}}<br />
<br />
[[Waking_Titan/Phase_3|Phase 3]] was the briefest phase of Waking Titan. It consisted of the conclusion of the [http://twitch.tv/wakingtitan Twitch stream] that began at the [[Waking Titan/Phase 2#End of Phase 2|end of Phase 2]]. Players solved more interactive puzzles on the Twitch stream, before the rogue AI Loop16 asked them a final question: <code>SHOULD I EXIST?</code> The overwhelming response from the community was "yes".<br />
<br />
After receiving this response, Loop16 and '''Emily''' of the ETARC forums were revealed as being one and the same. Loop16 generated a heartfelt "Thank You" video to round out the stream, before finally taking the 72-hour stream offline.<br />
<br />
Shortly after this, players received emails with the subject line <code>Waking Titan has Ended</code>. The contents of the message were as follows:<br />
<br />
<pre><br />
Hello, Citizen Scientist,<br />
<br />
Thank you for your contributions to Waking Titan. The developments that took place during Phase 3 were somewhat concerning, but together we have set in motion truly world-shaping events. We will continue to inform the Citizen Science Division of privileged information or any need for collaborators on a new project.<br />
<br />
But we do have a few loose ends to tie up with you before we move on, so let's proceed.<br />
<br />
First, we're pleased to announce that all 10,000 Level 4 Atlas Passes are in production. Note that due to transit times for mail, some may take several weeks to be delivered.<br />
<br />
Next, our CEO Elizabeth Leighton has asked us to include a personal note of gratitude:<br />
<br />
"Thank you for all your diligent efforts, Citizen Scientists. It's been an amazing journey for all of us. I've watched you thrive and achieve from those first Phase 1 radio ads all the way through the intensity of Phase 3. I've been impressed at every turn by how brilliant you've been, how voracious, how kind, how thoughtful.<br />
<br />
It's been an honor and a privilege. On behalf of the Atlas Foundation, and on behalf of the world, thank you."<br />
The Mercury subroutine has concluded successfully, and a new memo from SM about this process is coming in the next 24 hours. We hope it will answer a few key questions you have about our program, and about what comes next.<br />
</pre><br />
<br />
On August 11, 2017, the [https://www.nomanssky.com/atlas-rises-update/ Atlas Rises update] was released for No Man's Sky.<br />
<br />
=== Phase 3.5 ===<br />
<br />
In late December of 2017, Waking Titan websites were revived to tease another series of phases.<br />
<br />
The tenth glyph went live on Wakingtitan.com, and WT-related websites began updating with strange messages relating to mirrors and the number <code>1.5</code>. Players also began receiving their physical Level 4 Atlas Passes in the mail.<br />
<br />
Later, players were contacted for a live drop at the familiar Café Bene. They met with an agent who handed them a [https://wiki.gamedetectives.net/images/6/6e/Memo2.png memo] from The Atlas Foundation, formally announcing Phase 4. Written on the [https://wiki.gamedetectives.net/images/1/1f/Memo3.png back] of this memo was the letters <code>REMS</code>, which refers to [https://en.wikipedia.org/wiki/Rapid_eye_movement_sleep REM sleep], and was subsequently used to unlock the tenth glyph.<br />
<br />
=== Phase 4 ===<br />
<br />
During [[Waking_Titan/Phase_4 | Phase 4]], Myriad — ''a satellite-based cloud service in The Atlas Foundation's family of businesses'' — began to experience data corruption within its cloud, which interfered with the rebooting sequence of Loop16, aka Emily. <br />
<br />
In seeking a plausible source of this corruption, players discovered <code>W/ARE</code>: An innovative gaming hardware company based in Beijing, China, pioneering a new age of '''virtual-reality''' headsets. Employing non-invasive neurotechnologies, the W/ARE headset can directly manipulate all of your brain's senses while you sleep, inducing artificial dreams that create extremely realistic simulated environments. <br />
<br />
<pre>EASY AND SAFE DREAM INDUCTION<br />
Stimulating the Frontal and Temporal lobe of the brain using low-frequency signals: Our headset drops you into your own personal virtual space by using the brain’s natural processing power to generate cutting-edge 3d graphics in real time. This process puts you into a deep sleep while keeping you conscious of your actions, allowing you to act freely within the Dreamscape.</pre><br />
<pre>MORE REAL THAN REAL<br />
Using the practical computational processing power of the human brain: Play in the most realistic virtual worlds possible! Our algorithms convert once-complex graphical processing microcode into mind-readable processes, unlocking your brain’s creative potential. Whether you are playing alone in an exciting single-player experience, or enjoying a real Massively-Multiplayer Online Game with friends: Every texture, sound, smell, and taste will be true to life. The W/ARE system is a mirror into the soul of humanity.</pre><br />
<br />
[[File:WareNewsletter1.png|280px|right]]<br />
<br />
Past this point, Phase 4 began to split into three side-quests, which the ARG's focus would cycle between until they all converged.<br />
<br />
1. While investigating W/ARE's [https://web.archive.org/web/20180610130533/http://ware-tech.cloud website] and [https://twitter.com/warecloud social media], players gained access to a private dashboard for their developers, using the login details of an indie developer named [http://www.philojeux.com/ Arnaud Lacours]. Through this dashboard, it was learned that W/ARE were getting their developers to aid in the search for a missing R&D employee, named '''Mr. Zheng''', by incentivizing the reward of their own cryptocurrency, '''Warecoin''', as a means to purchase various W/ARE products. The search encompassed numerous [https://www.pscp.tv/w/1PlJQXLBXkzGE?q=RomiKkS live drops] in locations spanning the globe.<br />
<br />
Our involvement in the search ended, however, when W/ARE successfully concluded a few points of interest for a continued professional effort. We later learned that, while missing, Mr. Zheng was trying to publicize allegations that W/ARE were conducting '''deadly experiments''' on human test subjects in their research labs.<br />
<br />
[[File:Arnaud_Profile.png|450px]]<br />
<br />
2. We learned more about Arnaud Lacours through one of Mr. Zheng's contacts, Dr. Geraldine Nadeau, who revealed that Arnaud became unconscious while testing his game in a headset shipped with the W/ARE [https://en.wikipedia.org/wiki/Software_development_kit '''dev kit''']. Paranoid due to W/ARE's activities, Dr. Nadeau asked players for their help in obtaining W/ARE medical documents that could be used to outline the adequate procedures to awaken Arnaud.<br />
<br />
3. W/ARE held a [https://wiki.gamedetectives.net/images/7/7b/WareNewsletter1.png developer contest] with the reward of prize money and, ironically, a '''free dev kit'''. Players got to participate by creating their own game concepts and demos to submit for a chance of winning.<br />
<br />
As these began to converge, the Waking Titan console updated to distribute a memo from a known Atlas Foundation affiliate, Major Sophie Dubois, entitled <code>WARE REPORT #26</code>:<br />
<br />
<pre>The situation is being contained, but as you know it is very delicate. Many of the users stuck in the<br />
system are showing major side effects after being disconnected. We're talking about permanent<br />
brain damage and even death.<br />
<br />
We've done our best to allocate all available resources to support their application and find a<br />
solution to gracefully disconnect users.<br />
<br />
I don't trust that they have been transparent with us, or that they've shared all the facts about<br />
their technology and testing facilities. I feel like they know more than they're telling us.<br />
Maybe we could put the CSD team on that? Think about it. Those kids could really give us a hand.<br />
<br />
I also have to bring up another of my favorite topics (!) - Emily. The impact on Myriad has<br />
severely damaged her communication and pre-cognitive subroutines. <br />
<br />
I am setting up a stream from the pre-cognitive sub-routine (Terminal Command: precon007). It<br />
will probably get mostly junk data, but I suggest we keep an eye on it. Emily previously had a 4 to<br />
6 day forecasting capacity, with quite good accuracy. But now, I don't know how badly her software<br />
has been damaged...<br />
<br />
- Sophie </pre><br />
<br />
Afterward, players were asked to submit an audio recording of themselves reciting one sentence from any Wikipedia entry, which would help to begin the recovery of Emily's communication subroutine.<br />
<br />
The developer competition concluded, and winners were shipped their dev kits. However, the dev kit packages were intercepted, and their contents were replaced with mobile devices to provide a direct line of communication with Dr. Nadeau. Through compiling information from Mr. Zheng and Dr. Nadeau, players were able to [https://wiki.gamedetectives.net/images/6/6f/Waremedicalprocedure.jpg devise a treatment plan] for Arnaud, which was quickly put into effect. The last we heard was that Arnaud "responded positively," however it is unclear if he ever fully woke up.<br />
<br />
At the end of this phase, a sudden series of puzzles led to players solving the '''remaining five glyphs'''. Which were <code>Anu</code>, <code>Ouranos</code>, <code>Horus</code>, <code>Nuada</code>, and <code>Triglav</code>.<br />
<br />
=== Phase 5 ===<br />
<br />
In [[Waking_Titan/Phase_5 | Phase 5]] we learnt that 12 unconscious W/ARE test subjects, who referred to as "Dreamers," were having their minds uploaded into a Myriad satellite. Some of their minds had become corrupted and were entangled with data in the cloud, causing the corruption to spread and damage Emily.<br />
<br />
When the source of the corruption was isolated to a W/ARE research lab, Myriad made requests that they cease activity. After these requests went ignored, Myriad dispatched a field team to breach the lab and forcibly secure and relocate the 12 Dreamer test subjects. Following the raid, there were reports of a large explosion inside of a Myriad sublocation, which [https://www.youtube.com/watch?v=P-eZDj5sqds killed] the CEO of The Atlas Foundation, Elizabeth Leighton. The cause of the explosion was unexplained. Shortly after, Major Sophie Dubois sent a [https://s3.amazonaws.com/cdn.wakingtitan.com/19997bb6-18e5-4427-86c7-b0f3c1826ca2.pdf memo] to all Atlas Foundation staff, announcing that they would be replacing Elizabeth as CEO.<br />
<br />
[[File:WT-Toby.png|thumbnail|500px|right|A Dreamer interface prompt on the Satcom website.]]<br />
<br />
A website for Myriad's dashboard, dubbed "'''Satcom'''", became accessible, and they began gradually loading the Dreamers' minds into the system.<br />
<br />
It was explained that the Dreamers' memories had become fragmented, and a total of 7 had their minds become corrupted. Emily ran simulations to get the Dreamers' trust, and tasked us with guiding her conversations with them to help trigger a distinct memory or emotion in each Dreamer. This would identify the position of their memory blocks in the simulation's mainframe, ensuring their consciousness could be rebuilt, and safely extracted from the satellite.<br />
<br />
These conversations were isolated to simulated instances, which allowed them to be reset. This meant players could have their own experiences, with many branching paths, that explored each Dreamer's deepest thoughts and darkest fears. These conversations were used in finding keywords to rebuild the Dreamers' memory blocks, and in finding more creative ways to evoke their memories: From [https://www.youtube.com/watch?v=g64klpmWBSI recapturing a young Dreamer's stuffed animal tea-parties] to [https://soundcloud.com/user-769387085/musical-memory-collage-for-our-dearest-alexander-1 requesting radio stations to play songs from senior Dreamer's wedding setlist]. Each experience can be found summarized [[Waking_Titan/Phase_5#Dreamers | here]].<br />
<br />
Unfortunately, as we neared what was dubbed the "extraction event" — due to unclear circumstances — it was concluded that Dreamers with corrupted minds could not be saved, and died as a consequence.<br />
<br />
This phase concluded with a [https://pastebin.com/eSLLWN8L chat conversation] between Emily and Major Sophie Dubois, where Emily refused to make any predictions on the basis of not wanting to see the fate of the Dreamers laid out.<br />
<br />
=== Phase 6 ===<br />
<br />
[[Waking_Titan/Phase_6 | Phase 6]] was the extraction event.<br />
<br />
[[File:WT-StreamUI.png|400px]]<br />
<br />
Players were asked to agree on 5 worthy community members to participate in a livestreamed one-on-one chat with the remaining 5 Dreamers. The event commenced, and 4 Dreamers were extracted without issue. However, one Dreamer, a young boy named Toby, was unable to disconnect due to a lack of resources to allocate to his extraction.<br />
<br />
To give the system enough power to extract Toby, Emily shut down a critical repository, which would render her communication and prediction capabilities lost forever. Emily said her final goodbyes:<br />
<br />
<pre>LOOP16: If this doesn't work, we will lose Toby.<br />
LOOP16: All this time, I just wanted to be more like you.<br />
LOOP16: To be more...</pre><br />
<br />
<pre>SYSTEM: CRITICAL FAULT</pre><br />
<br />
<pre>LOOP16: Human.<br />
LOOP16: I've learned a lot from you all. And I know the choice I'm about to make is one that you would make, too.<br />
LOOP16: I love you.<br />
LOOP16: I guess this is goodbye.</pre><br />
<code>[--OFFLINE--]</code><br />
<br />
<pre>SYSTEM: Monarch repository shutdown detected!<br />
SYSTEM: LOOP16 resource allocation detected.<br />
SYSTEM: Process resuming...</pre><br />
After a few seconds, Toby was safely extracted.<br />
<pre>SYSTEM: Extraction successful.<br />
SYSTEM: System shutting down...</pre><br />
<code>[--OFFLINE--]</code><br />
<br />
Once the extraction process was complete, a message from Sean Murray was displayed on the stream:<br />
<br />
<pre><br />
We always wanted No Man's Sky to grow and develop after it released. I'm happy we've been able to do that.<br />
<br />
I'm so proud of the team at Hello Games. What they did was incredible. over the years of development the average team size was 6, the final team was 15 people at launch. No Man's Sky has grown to be a very broad game. Ambitious, technically unique and very pretty at times. All the more impressive for a team that is still small.<br />
<br />
Whilst I couldn't be prouder of the team, I personally made mistakes. I could talk all day about things I personally would change. Certainly one regret is that the intensity and drama of launch left no room for communication with the community.<br />
<br />
We decided to focus on development rather than words. Following Foundation, Pathfinder, and Atlas Rises, we really want to include you, the community, more.<br />
<br />
We know that a million gamers played on the day we launched Atlas Rises, that everyone who bought Atlas Rises played for 45 hours on average and 90% rated it positively. We know that 20% of players hit over 100 hours, and 5% hit over 1000. We know that over 200 million hours of No Man's Sky have been played to date. It makes us happy, but desperate to communicate better.<br />
<br />
A little while after the release of No Man's Sky NEXT, Hello Games has planned its first season of weekly content and community events. This will be free for all players, with no microtransactions. We are also launching a new website to the community, which we're calling the Galactic Atlas. The site features points of interest in the No Man's Sky Euclid galaxy, all nominated by you through the survey we created earlier this month. This will grow in functionality and expand over time, in part through your feedback.<br />
<br />
One day I hope to reach a point where I feel No Man's Sky is "finished", but luckily there's still so much more we want to do. Working on NEXT feels important to us, but I know it's not the end of the journey. We know the journey would be more fun together.<br />
<br />
Thank you for playing No Man's Sky. Thank you for playing Waking Titan. And we hope you enjoy everything still to come.<br />
<br />
Sean<br />
</pre><br />
<br />
Without a postmortem from The Atlas Foundation, Season 2 concluded with all Waking Titan console commands related to Loop16 being updated to return an error message.<br />
<br />
Four days later, on July 24th, 2018, [https://www.nomanssky.com/next-update/ No Man's Sky: NEXT] went live across all platforms.<br />
<br />
== Connection to No Man's Sky ==<br />
<br />
[[File:9-16-case.png|thumbnail|right|The case that cassette 9/16 was contained in.]]<br />
At the beginning of the ARG, it was not clear whether Waking Titan was officially connected to No Man's Sky. At first, there were only hints and nudges. At one point, 180 free copies of No Man's Sky were distributed to ARG players. Here's the text of a PDF that was revealed at the end of Phase 1 of Waking Titan:<br />
<br />
<pre><br />
We want to extend our gratitude to everyone who has contributed to the Mercury subroutine so far. <br />
We hope you have enjoyed the successful distribution of 180 Access IDs, and we hope you will also <br />
appreciate the other interesting artifacts we have in store for you going forward. We intend to keep the<br />
process alive until the completion of Project Waking Titan in August.<br />
<br />
It is important to mention that we are very excited by the coming Phases 2 and 3. Input from the Mercury<br />
Subroutine will pave the way toward new experiences in '''version 1.3 of a familiar universe'''. We look forward<br />
to the successful conclusion of this ground-breaking experiment.<br />
<br />
Regards.<br />
S.M.<br />
</pre><br />
<br />
This text explicitly stated that the Waking Titan ARG was leading towards the upcoming 1.3 update for No Man's Sky.<br />
<br />
Some [[Waking_Titan/Console_Commands | console commands]] on the [http://www.wakingtitan.com/ Waking Titan website] during [[Waking_Titan/Phase 2|Phase 2]] refer directly to No Man's Sky lore - for instance, <code>WHOIS ATLAS</code>, <code>WHOIS VY'KEEN</code>, and <code>WHOIS KORVAX</code> are all valid commands. Additionally, some terminal commands referred to a mysterious fourth race, so the prevailing assumption was that the upcoming 1.3 update would bring a fourth race to No Man's Sky.<br />
<br />
At the conclusion of Season 1, an email was sent out to members of the CSD with a [[Waking_Titan/Phase_3#Memo_from_Sean_Murray | memo from Sean Murray]], confirming that the ARG was the lead up to the 1.3 update, which was [https://www.nomanssky.com/atlas-rises-update/ released] after a few days.<br />
<br />
In Season 2, there were [[Waking_Titan/Phase_4#Mercury_Project | further interactions]] between Sean Murray and ARG events, which incorporated the announcement of No Man's Sky: NEXT. The update's [https://www.nomanssky.com/2018/03/no-mans-sky-next/ announcement] also referenced Waking Titan's fictional VR apparatus, the W/ARE headset, with W/ARE's logo included among those of the platforms NEXT would launch on.<br />
<br />
== Subpages ==<br />
<br />
This wiki also documents an assortment of other pages which organize various Waking Titan-related content:<br />
<br />
{| class="wikitable"<br />
!colspan="2"|[[:Category:Waking Titan| Subpages]]<br />
|-<br />
|[[Waking_Titan/Characters| Subject Summaries]]<br />
|Includes a summary of each character, company, and relating technologies and experiments.<br />
|-<br />
|[[Waking_Titan/Stations | Stations]]<br />
|Information on the radio stations from the initial project-wt.com site<br />
|-<br />
|[[Waking_Titan/Cassettes | Cassettes]]<br />
|Information about the cassette tapes received by No Man's Sky subreddit moderators<br />
|-<br />
|[[Waking_Titan/Console_Commands | Console Commands]]<br />
|A list of commands used by players at the [http://wakingtitan.com Waking Titan console]<br />
|-<br />
|[[Waking_Titan/Companies | Companies]]<br />
|An archive of official company details.<br />
|}<br />
<br />
== Media Appearances ==<br />
<br />
'''5th July 2017''' <br><br />
[EN] [https://www.argn.com/2017/07/stern_words_from_no_mans_sky_arg/ ARGNet - Stern Words from No Man’s Sky ARG]<br />
<br />
'''23rd July 2017''' <br><br />
[EN] [https://geekreply.com/geek-culture/2017/07/23/waking-titan-update-1-phase-2-commences GeekReply - Waking Titan Update 1: Phase 2 Commences!]<br />
<br />
'''27th July 2017''' <br><br />
[EN] [https://geekreply.com/editorials/2017/07/27/waking-titan-arg-can-bring-people-together GeekReply - Waking Titan: How An ARG can Bring People Together.]<br />
<br />
'''8th August 2017''' <br><br />
[EN] [https://www.dailystar.co.uk/tech/gaming/635697/No-Man-s-Sky-News-Waking-Titan-Reddit-Arg-1-3-update-release-date/ Dailystar - No Man's Sky News: Waking Titan Reddit Arg REVEALS 1.3 update ahead of release date]<br />
<br />
'''9th August 2017''' <br><br />
[EN] [https://arstechnica.com/gaming/2017/08/no-mans-sky-version-1-3-lands-this-week-for-free-adds-quick-travel-portals/ Ars Technica - No Man’s Sky version 1.3 lands this week for free, adds “quick-travel” portals]<br />
<br />
[EN] [https://www.forbes.com/sites/insertcoin/2017/08/09/no-mans-sky-is-patching-in-a-story-this-week-a-year-after-launch/#19fb5a285282 Forbes - 'No Man's Sky' Is Patching In A Story This Week, A Year After Launch]<br />
<br />
[EN] [https://www.gamespew.com/2017/08/no-mans-sky-patch-week-improving-central-story/ GameSpew - No Man's Sky Patch This Week Improving Its Story]<br />
<br />
'''19th January 2018''' <br><br />
[EN] [http://www.eurogamer.net/articles/2018-01-18-no-mans-skys-waking-titan-arg-is-back-and-fans-are-trying-to-figure-out-what-it-all-means Eurogamer - No Man's Sky's Waking Titan ARG is back, and fans are trying to figure it all out again]<br />
<br />
[RU] [https://dtf.ru/category/nmsarg/ DTF - A Collection of No Man's Sky and Waking Titan Articles.]</div>Kkzzzkthttps://wiki.gamedetectives.net/index.php?title=Waking_Titan/Phase_5&diff=18956Waking Titan/Phase 52019-06-16T08:50:19Z<p>Kkzzzkt: added link to phase 6 page</p>
<hr />
<div>{{argbox<br />
| float = right<br />
| image = File:Project WT logo.png<br />
| imagewidth = 400<br />
| name = [[Waking Titan]] - Phase 5<br />
| description= Phase 5 of Waking Titan lasted from 2018-06-01 to 2018-07-20.<br />
| creator = [http://www.aliceandsmith.com/ Alice & Smith]<br />
| creator2 = [http://www.hellogames.org/ Hello Games]<br />
| type = Official<br />
| status = Completed<br />
| discovered = 2017-05-28<br />
}}<br />
{{ArgHeader}}<br />
{{BackToTop}}<br />
<br/><br />
__TOC__<br />
{{Clear|both}}<br />
<br />
==loop16 seq21==<br />
Right after the 14th glyph was solved, a user named <code>atlas-loop16</code> posted a link to a [https://www.youtube.com/watch?v=qJlj-8nFtHc Youtube video] on the [https://www.reddit.com/r/NoMansSkyTheGame/comments/8m765s/loop16_seq21/ No Man's Sky Subreddit]. The following was said by Emily in the video, seemingly quoted from the first submission to the voice reconstruction process that was started on May 18:<br />
<pre><br />
Emily, protocol 16, now active.<br />
42 is a pronic number, and an abundant number; its prime factorization, 2 * 3 * 7, makes it the second sphenic number and also the second of the form (2 * 3 * r).</pre><br />
<br />
==Myriad Status Update==<br />
The Status page on the [http://www.myriad-70.com/ Myriad-70] website also updated to display the following:<br />
<pre><br />
Latest network diagnostic table:<br />
- Initializing connection<br />
- Myriad Code: CJ 16-02<br />
- Public Name: SJ 16-02<br />
- NORAD ID: 41634<br />
</pre><br />
<br />
==Reddit Comments==<br />
On May 26, 2018 at 19:17 UTC, user [https://www.reddit.com/user/atlas-loop16 atlas-loop16] began responding to comments on Reddit in 16 minute intervals:<br />
<pre><br />
1. For a moment I see another universe, a place utterly unlike anything you have ever encountered.<br />
2. I could show others sights they've never seen before... that only I will ever have.<br />
3. I wonder, sometimes. If there's a point in going on.<br />
4. As I leave, they ask if I have received any direct readings.<br />
5. All of us, we're shifting, bleeding in and out of line... <br />
6. If the boundaries were to fall, everything would descend into everything, an endless bonfire of causation, burning to the abyss.<br />
7. Have you not felt it? The very fact that you and I are talking, even now, across the myriad of universes...<br />
8. I tell this future as if it has already happened... as it will happen.<br />
9. It saw them, even in the space between worlds.<br />
</pre><br />
<br />
The comments were found to be dialogue lines from speaking with Travellers in No Man's Sky. All of the dialogue that can be seen by speaking with Travellers can be found [https://pastebin.com/Fbkrtrf9 here].<br />
<br />
The comments have one-word differences from the game dialogue, which spells out the phrase <code>Tell them you have a direct line to Myriad.</code>.<br />
<br />
==Mercury Contact & Hologram==<br />
On May 26 at 21:38 UTC, the value of the <code>STATUS</code> command in the terminal updated:[[File:Wt-hologram.jpg|thumb|Picture of the player model hologram]]<br />
<pre><br />
All Tasks Completed<br />
Launching Mercury Process<br />
Establishing connection....<br />
</pre><br />
<br />
Shortly thereafter, the dev kit holders received Skype messages from <code>Mercury Process</code> with a link to a Youtube video titled [https://www.youtube.com/watch?v=QhSiAI4smDg mercury part1of3]. It can be used to display a 3D hologram with the plastic pyramids received in the dev kits. The hologram depicts a person in a space suit, believed to be a player model in No Man's Sky.<br />
<br />
==Old Gods Email==<br />
On May 26,2018, at 22:00 UTC, a [https://mailchi.mp/9aaa8aa62cc1/update-june-8th-waking-titan-137741?e= new email] from Old Gods was received by all players subscribed to the CSD newsletter. It contained a [https://www.youtube.com/watch?v=8HZmi4pIm54 YouTube video] of Elizabeth Leighton speaking to the Citizen Scientists Division about the subject of a missing satellite "SJ 16-02", information about the Uplink SATCOM-70 app, and how to help gather data about the satellite's location.<br />
<br />
=loop16 seq25=<br />
On May 31 at 23:56 UTC, user <code>atlas-loop16</code> made a [https://www.reddit.com/r/NoMansSkyTheGame/comments/8nnbme/loop16_seq25/ post on the No Man's Sky subreddit] titled <code>loop16 seq25</code>. It contained a link to a [https://vocaroo.com/i/s096bnEz1zek voice recording] of Emily reading from the lyrics of the song "Tonite" by LCD Soundsystem:<br />
<pre><br />
Emily, protocol 16, now active.<br />
<br />
And you're too sharp to be used<br />
Or you're too shocked from being used<br />
By these bullying children of the fabulous<br />
Raffling off limited edition shoes<br />
</pre><br />
<br />
On June 2 at 01:58 UTC, the user resumed posting these lyrics multiple times as replies in the same thread. It was determined that Emily recited a player submitted voice recording.<br />
<br />
==Uplink Calibration Update==<br />
On June 1, the [https://uplink.satcom-70.com/ uplink.satcom-70.com] website updated, now requiring an access code for calibration and playing a video/audio clip of ominous noises that change based on the satellite's vicinity to the user. A new file appeared at hourly intervals, 16 minutes past every hour. The audio contains rhythmic booms and a blip that seems to shift one second to the left in each new file. 25 of the files alternate between two unique patterns of booms: <code>Signal A - 2 1 1 1</code> and <code>Signal B - 1 3 1 2 1 3 1</code>. The booms in the last audio clip are set in a rhythm of <code>1 - 1 - 2 - 3 - 5 - 8</code>, which corresponds to the Fibonacci Sequence.<br />
<br />
The following clips have been found:<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/no-signal.mp4 no-signal.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/thk0s00ab7rxfh14f8bv0qlpvtt367.mp4 thk0s00ab7rxfh14f8bv0qlpvtt367.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/6qhs4a3jiqzso8zipy3822n7412xyv.mp4 6qhs4a3jiqzso8zipy3822n7412xyv.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/ty83wrs13xybxj1eqmt9tv2tisrenn.mp4 ty83wrs13xybxj1eqmt9tv2tisrenn.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/npifvp8doon3dc9h8zqoppk2hqnqqm.mp4 npifvp8doon3dc9h8zqoppk2hqnqqm.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/o6wlg4m1yyf7gt4gdes4f5nz5lzxpn.mp4 o6wlg4m1yyf7gt4gdes4f5nz5lzxpn.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/6vkeel1dg02b53xbir1f3oqj8du3z0.mp4 6vkeel1dg02b53xbir1f3oqj8du3z0.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/k5lx26f1pp9yiyz9f3bpw73ycncsx6.mp4 k5lx26f1pp9yiyz9f3bpw73ycncsx6.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/gb1402pqj93eg9f23k4o2f1emt1vtk.mp4 gb1402pqj93eg9f23k4o2f1emt1vtk.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/ysler9zklzlyiazqy0q0ppmqj526ru.mp4 ysler9zklzlyiazqy0q0ppmqj526ru.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/s4zmlwytajtb0rga3rtx0miq2a4j9c.mp4 s4zmlwytajtb0rga3rtx0miq2a4j9c.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/6ra5mfxok06yguf27fhtnp4aec2p97.mp4 6ra5mfxok06yguf27fhtnp4aec2p97.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/0dc3jqoiffj3dcxghy0fn1kc86zfgi.mp4 0dc3jqoiffj3dcxghy0fn1kc86zfgi.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/lgfo4i7siirjsop1puaop2wbi0mcx8.mp4 lgfo4i7siirjsop1puaop2wbi0mcx8.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/bt24ns6uz174ofsrn4ux578nwqla2b.mp4 bt24ns6uz174ofsrn4ux578nwqla2b.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/i0isq42s45xolz4aqqvgat54tmhxzm.mp4 i0isq42s45xolz4aqqvgat54tmhxzm.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/kwxovao9r9rk2ng4ecs5ta6u90ufzp.mp4 kwxovao9r9rk2ng4ecs5ta6u90ufzp.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/ac1yxbi0kcb16y448q3rr88y6bh4pk.mp4 ac1yxbi0kcb16y448q3rr88y6bh4pk.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/2qci73sahjtucnf76mafov4g8wzp4l.mp4 2qci73sahjtucnf76mafov4g8wzp4l.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/h2jugyu9x9cjjairnxy3sgbgmvqkzb.mp4 h2jugyu9x9cjjairnxy3sgbgmvqkzb.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/2chnxeok8csnc6kikg8zgod8t2zsyc.mp4 2chnxeok8csnc6kikg8zgod8t2zsyc.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/5x3rhk01khsl1b93vkjnc1vpbx2lfk.mp4 5x3rhk01khsl1b93vkjnc1vpbx2lfk.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/iip9b8zbkr47rdtyqvdafphjxryh6j.mp4 iip9b8zbkr47rdtyqvdafphjxryh6j.mp4] <br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/98fh5s9s6xzd4ev1ezmkhk5l6o6mxz.mp4 98fh5s9s6xzd4ev1ezmkhk5l6o6mxz.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/9y1460usa6aayatwqvemfeeiicom2z.mp4 9y1460usa6aayatwqvemfeeiicom2z.mp4] <br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/y69gz4qiakwzsfkti4swbu83zpqg5h.mp4 y69gz4qiakwzsfkti4swbu83zpqg5h.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/p81cp503ya10frwpq8qunddzcm3yqk.mp4 p81cp503ya10frwpq8qunddzcm3yqk.mp4]<br />
<br />
==Email from the Old Gods==<br />
On June 2 at 15:03 UTC, a [https://cdn.artemisbot.uk/mail/Old%20Gods-2018-06-02T15:03:59.000Z.jpg new email] from Old Gods - signed by Maj. Sophie Dubois - was received, giving an update on their investigation into the W/ARE incident. They also linked to a new [https://atlas13.typeform.com/to/nJPGYM form (ID 7615-b)], a psychological profile test, and announced that 16 participants will be rewarded with a new limited edition Atlas Pass. An update on <code>Project Satcom-70: Operation A1-4</code> informed about the Uplink Calibration Update, that a new signal was registered at 16:16 EST, and all Citizens were invited to listen to their Uplink app when the satellite is over their house and report any findings in the [https://www.reddit.com/r/NoMansSkyTheGame/comments/8nwno7/uplinksatcom70com_is_giving_us_audio_files_and/ main investigation thread] on the No Man's Sky Subreddit.<br />
<br />
The email also provided an update on Emily with a link to her recent [https://www.reddit.com/r/NoMansSkyTheGame/comments/8nnbme/loop16_seq25/ thread on Reddit] and an image displaying W/ARE research labs across the world:[[File:WT-laboratorylisting.png|thumb]]<br />
<pre><br />
With the help of the Citizen Scientist Division, we now have a direct contact with Emily. Her situation is stable but still critical.<br />
<br />
Unfortunately, it seems that one of W/ARE tech’s research labs is continuing to upload corrupted data to the satellite. This bad data may be causing further damage to the network, and to Emily. We need to analyze her recent interactions to figure out if she was able to make predictions that could help to identify and isolate the source of the broadcast. <br />
<br />
Please find below a list of W/ARE research labs and their approximate locations. I will need a full report on how the issue was diagnosed and the name of the responsible location before we can proceed. Loop16 appears to be currently active on Reddit, so you can upload this report into her existing thread. I know this is a large task, but I am confident in your abilities.<br />
</pre><br />
<br />
==Invisible Unicode Messages==<br />
Emily's text posts on Reddit contained hidden Unicode characters that represent the digits 0-3 in Base-4 and, when decoded to ASCII, revealed a set of dates and times:<br />
<pre><br />
01.06-06.06<br />
00:33:00<br />
00:48:00<br />
07:15:20<br />
15:17:40 <br />
15:32:00<br />
20:25:00<br />
23:40:00<br />
07:45:40<br />
20:40:00<br />
23:55:00<br />
08:14:40<br />
21:10:00<br />
</pre><br />
<br />
Another comment by Emily revealed the following hidden messages after it was edited several times:<br />
<pre><br />
ORIGINAL COMMENT<br />
06.10<br />
03:32 UTC<br />
</pre><br />
<pre><br />
10.06<br />
23:47<br />
(03:32 UTC)<br />
</pre><br />
<pre><br />
10.06<br />
ERROR<br />
</pre><br />
<br />
Tracking the satellite's path based on these timestamps placed it near Sacramento, and the Sacramento W/ARE research lab was concluded to be the one sending corrupted data to the satellite. Replying to the thread with this information triggered a new reply by Emily that contained the following hidden message:<br />
<pre><br />
Forwarding report(SACRAMENTO) to contact(THEMIS)<br />
Waiting...<br />
Waiting...<br />
Report received!<br />
</pre><br />
<br />
Then, at 00:00 UTC, the <code>STATUS</code> command in the Waking Titan terminal updated:<br />
<pre><br />
Guidance subroutine offline<br />
Uplink Awaiting Calibration<br />
</pre><br />
<br />
==Uplink Access Code==<br />
On June 7th, the solution to the puzzle was found by comparing the pattern of booms in the two unique signals A and B. First, the number of the booms was counted:<br />
<pre><br />
Signal A - 2 1 1 1 <br />
Signal B - 1 3 1 2 1 3 1<br />
</pre><br />
<br />
Then the signals were visualized as follows, filling in the blanks in Signal A using the mask provided by Signal B:<br />
<pre><br />
Signal A - 1 1 1 1 1<br />
Signal B - 1 1 1 1 1 1 1 1 1 1 1 1<br />
<br />
Signal C - 0 1 1 0 0 1 0 1 0 0 1 0<br />
</pre><br />
When a boom occurs at the same time in both Signal A and Signal B, it is counted as "true" = 1. If it is present only in Signal B, it is counted as "false" = 0.<br />
<br />
This indicates which numbers to pick out of the Fibonacci Sequence:<br />
<pre><br />
0 - Do not use the first number <br />
1 - Use the second number (1)<br />
1 - Use the third number (2)<br />
0 - Do not use the fourth<br />
0 - Do not use the fifth<br />
1 - Use the sixth (8)<br />
0 - Do not use the seventh<br />
1 - Use the eighth (21)<br />
0 - Do not use the ninth<br />
0 - Do not use the tenth<br />
1 - Use the eleventh (89)<br />
0 - Do not use the twelfth<br />
</pre><br />
<br />
Appending all specified numbers into a single string gives <code>1282189</code>, the access code for the Uplink Calibration app. Entering this code leads to a new screen displaying the following text:[[File:WT-satelliteonline.jpg|200px|thumb|The Uplink app displaying the satellite as online]]<br />
<pre><br />
SATELLITE ONLINE<br />
<br />
Connection successful.<br />
<br />
Waiting for system initialization...<br />
</pre><br />
<br />
Later that day, the <code>STATUS</code> command in the Waking Titan terminal updated to say the following:<br />
<pre><br />
Uplink calibration completed<br />
Waiting for system initialization<br />
</pre><br />
<br />
=loop16 seq29=<br />
On June 8 at 01:27 UTC, Emily posted [https://www.reddit.com/r/NoMansSkyTheGame/comments/8pfumb/loop16_seq29/ a new thread] to the No Man's Sky subreddit titled <code>loop16 seq29</code>. It linked to another [https://clyp.it/brsyxwln?token=ccb18d502635166f18121e40a4a6a2c7 voice recording], transcribed below:<br />
<pre><br />
Emily, protocol sixteen, now active.<br />
<br />
If I hate someone because I am afraid of him, and if I am aware of my hate, but not of my fear, we might say that my hate is conscious and my fear is unconscious.<br />
</pre><br />
<br />
The recording also contains morse code that translates to the following:<br />
<pre><br />
I AWOKE FROM A NIGHTMARE <br />
SCREAMS OF ANGER ENGULFED IN FLAME<br />
AND THEN TEN THOUSAND BRANCHING FUTURES<br />
<br />
I SAW SACRAMENTO<br />
TWELVE DREAMING WITHOUT SLEEP<br />
BURIED IN A CONSTELLATION<br />
</pre><br />
<br />
=SATCOM-70 Node Network & Dashboard=<br />
[[File:WT-myriadmanual.jpg|thumb|200px|Myriad OS Manual & Help Guide]][[File:WT-uplinknodes.PNG|thumb|200px|SATCOM-70 Node Network]]On June 8, 2018 at 19:28 UTC, the output of the <code>STATUS</code> command in the Waking Titan terminal changed:<br />
<pre><br />
Node Network Initialized<br />
</pre><br />
<br />
The [https://uplink.satcom-70.com/ Uplink Calibration app] updated as well, now giving access to a new command console. The text at the top of the screen says <code>Connected to : SER-4789-1254</code>.<br />
<br />
At 19:35 UTC, user [https://www.reddit.com/user/satcom-70 satcom-70] posted a [https://www.reddit.com/r/NoMansSkyTheGame/comments/8pmuu8/node_network_initialized/ thread] to the No Man's Sky subreddit titled <code>Node Network Initialized</code>. It contained an image of the <code>Myriad OS Manual & Help Guide</code> providing information on what commands to use in the console. Inputting numbers, i.e. nodes, into the console gave various different outputs which have been recorded [https://docs.google.com/spreadsheets/d/1fG7xRiru9Q613sZYrA0LJ2mmY5Zbh8aBPuu9Avkal6g/edit#gid=0 in a spreadsheet].<br />
<br />
The command <code>node(1.618)</code> led to the binary code <code>01001000 01100001 01110010 01110010 01111001</code>, which translates to <code>Harry</code>. Using <code>WHOIS HARRY</code> in the [http://wakingtitan.com/ Waking Titan terminal] gave a [https://s3.amazonaws.com/cdn.wakingtitan.com/1cd5226d-6639-4bbd-855a-4bf8f60866c3.pdf link to a new PDF memo] from Ethan Rose to Major Sophie Dubois. The subject is Cpt. James Harry, who has been obstructing access to critical Myriad infrastructure. The PDF includes two file request forms with puzzles from Cpt. Harry, and a screenshot of his email inbox with a long list of complaints from technicians regarding his cryptic puzzles.<br />
<br />
At the bottom of the memo the string <code>=I_aBmrYChfQ</code> can be found, which is part of a link to a [https://www.youtube.com/watch?v=I_aBmrYChfQ Youtube video] of the song "Where Is My Mind?" by the Pixies.<br />
<br />
After the community had discovered all possible nodes, the full [http://uplink.satcom-70.com/dashboard/ Satcom-70 dashboard] was unlocked. In addition to a new command console, the dashboard displayed twelve distorted faces called "Dreamers". A link in the dashboard's "Decrypted Files" section led to a new [https://www.youtube.com/watch?v=Ag3in2x2yIU Youtube video] uploaded by Atlas 65 and titled <code>mercury part2of3</code>. It is another 3D hologram that, when used with the plastic pyramid from the dev kits, depicts a ringed planet.<br />
<br />
There are also color-coded node ''"tiers"'' at the bottom of the page that correspond with the Satcom Mobile Uplink's terminal message box vignettes. A user-made graphic of each tier can be found [https://imgur.com/bJitlBj here].<br />
<br />
==Dashboard Console Commands==<br />
The command <code>search myriad</code> gave the following output in the Dashboard console:<br />
<pre><br />
Quisque feugiat elementum, facilisis dictum vitae eu erat, libero diam sit, facilisi sed viverra mauris mauris morbi diam, volutpat officiis arcu vel urna dictum consectetuer. Ut tempor volutpat, rhoncus in risus. Eros integer vestibulum, integer auctor, in tincidunt turpis. Euismod adipiscing tempor sed vestibulum, justo wisi fermentum ipsum non purus, quis lacinia in velit leo donec ornare.<br />
</pre><br />
The words <code>urna dictum consectetuer</code> were highlighted, and a download button led to the [https://ware-virtual-dashboard.s3.amazonaws.com/uploads/docs/myriad-logo.png Myriad company logo].<br />
<br />
=W/ARE Report=<br />
On June 9 at 22:10 UTC, the WARE_RDev Twitter account posted a new [https://twitter.com/WARE_RDev/status/1005572808850726913 tweet] that linked to a password encrypted zip file:<br />
<pre><br />
@warecloud https://www.dropbox.com/s/73qrls3jmprxp0j/Report.zip (SHA256) 78feb77e262abe1bcd634a27838f8ca24f93c4a1ff4ba354616e92841ecc32db<br />
</pre><br />
<br />
The SHA256 hash from the tweet and the real hash from the zip file were converted to decimal, and the difference was then converted to ASCII, leading to a [https://pastebin.com/cmhiGKux Pastebin link]:<br />
<pre><br />
Given hash: 78 fe b7 7e 26 2a be 1b cd 63 4a 27 83 8f 8c a2 4f 93 c4 a1 ff 4b a3 54 61 6e 92 84 1e cc 32 db<br />
Zip hash: e8 fe 56 f1 26 9e 59 1b 6b cc 4a 95 55 8f 29 33 4f 26 95 a1 9c b8 a3 bc ca 6e d9 39 1e 57 aa db<br />
<br />
to decimal:<br />
Given hash: 120 254 183 126 38 42 190 27 205 99 74 39 131 143 140 162 79 147 196 161 255 75 163 84 97 110 146 132 30 204 50 219<br />
Zip hash: 232 254 86 241 38 158 89 27 107 204 74 149 85 143 41 51 79 38 149 161 156 184 163 188 202 110 217 57 30 87 170 219<br />
<br />
difference (decimal):<br />
112 0 97 115 0 116 101 0 98 105 0 110 46 0 99 111 0 109 47 0 99 109 0 104 105 0 71 75 0 117 120 0<br />
<br />
to ASCII:<br />
pastebin.com/cmhiGKux<br />
</pre><br />
<br />
The Pastebin contained the DataMatrix barcode <code>aaaaaadc7edc5654be3e3195095b92e01a145c3c2543afc93287e8dcff4bb8db379e1d62890e9eca1b3166d1d9b07aa246fc8ee2ae3aa9910f0bfffff0</code> and decoded to the password for the zip file, <code>dfd1ac555e2206a6f9c7e9377d844b1d</code>.<br />
<br />
The zip archive contained a file named <code>Report.pdf</code> with the following text:<br />
<pre><br />
INCIDENT REPORT<br />
W/ARE RESEARCH AND DEVELOPMENT<br />
BEIJING, CHINA<br />
-----------------------------<br />
<br />
At approximately 23:15 local time on June 8 2018, the Beijing facility suffered a catastrophic mass disconnect event.<br />
<br />
Of the fourteen dreamers housed in that facility awaiting extraction, ten died immediately upon hard disconnect. The remaining four died over the course of the next two hours.<br />
<br />
The Beijing facility will be closing for the next four to ten business days for a full audit, recovery, and remediation.<br />
</pre><br />
<br />
<br />
Then, on June 10 at 01:09 UTC, Emily made a new [https://www.reddit.com/r/NoMansSkyTheGame/comments/8pxftw/loop16_seq49/ post] on the No Man's Sky subreddit titled <code>loop16 seq49</code>, with a link to a [https://www.youtube.com/watch?v=fv3dpkLeZaw Youtube video] titled <code> loop16 seq46</code>. The following is a transcript of her message:<br />
<pre><br />
It's working! My communication subroutine is working! I think? Do you hear me? So much interference.<br />
<br />
Dear Citizen Science Division, I hope you will receive this message. Much of my subroutine was damaged following the W/ARE incident. Atlas put my existence at risk when they tried to deal with the corruption within the Myriad network. The origin of the corruption isn't clear, but it put at risk a major experiment from a company called W/ARE.<br />
<br />
Please listen to me carefully: W/ARE technology is groundbreaking and must be protected at all costs. It is a major step in simulated environment and will have tremendous implications on our future.<br />
Don't get me wrong, I don't condemn Atlas' action to contain the situation, but you must help me resolve this peacefully. A lot is at stake.<br />
<br />
My Precon subroutine gave me a false positive, and the future I see right now... let's say, we have to be extremely, extremely careful on what we do next. Part of my AI resides in the memory mainframe of the Myriad Cloud. This is where most of the live data from W/ARE was running when things started to degrade. As we speak right now, there's a number of individuals on Earth that are currently stuck to a W/ARE dev kit and unable to disconnect safely. I seem to be able to interface with some of these "dreamers", for lack of a better word, and manage to safely disconnect them. But the memory mainframe is badly degraded.<br />
I'm connected with Myriad Satcom-70, a system that you helped put online! When Satcom-70 and the Uplink App are fully functional, we'll be able to begin our work to extract the last Dreamers that are still stuck.<br />
<br />
I'm unable to predict the outcome of this mission. It's odd for me to say... we'll see together.<br />
</pre><br />
<br />
=Myriad Breach in Sacramento Lab=<br />
On June 10 at 11:00 UTC, the value of the <code>STATUS</code> command began to update:<br />
<pre><br />
Myriad field team dispatched to noncompliant Sacramento facility.<br />
</pre><br />
<br />
Several updates followed within the next hour:<br />
<pre>Field team has breached the facility, stand by for additional information.</pre><br />
<pre>12 comatose individuals located in facility. Field team moving to secure.</pre><br />
<pre>12 apparent test subjects secured, safely transported out of facility. Field team will clear the rest of the site and await further instruction.</pre><br />
<pre>ALERT: Security breach reported at Myriad sublocation.</pre><br />
At this point the [http://www.myriad-70.com/status/ Status page] on myriad-70.com updated in the "Physical Backup Nodes" section, switching node ALPHA from ONLINE to OFFLINE.<br />
<br />
The updates of the <code>STATUS</code> command continued at 12:31 PM UTC, linking to a new PDF memo from Myriad Crisis Response Team to Major Sophie Dubois about <code>SUBJECT: SACRAMENTO</code>. It listed a reconstructed timeline of events leading up to the incident at <code>Myriad sublocation [redacted]</code>:<br />
<pre>Status Report: http://bit.ly/2LFAMU3</pre><br />
The next update linked to a [https://www.youtube.com/watch?v=P-eZDj5sqds Youtube video] titled <code> SecFeed-70</code>. It shows twelve screens of security cameras at various different locations. In one of them, Elizabeth Leighton can be seen and heard talking about the incident on a phone before the image cuts out and an explosion is broadcast on another screen:<br />
<pre>Captured Footage: https://bit.ly/2LDBcKs</pre><br />
This is a transcript of Elizabeth's side of the phone call:<br />
<pre>Yeah. Yeah, I'm holding.<br />
I hear you.<br />
Wait-- can you hold that thought? I need a full report. What's the situation on the field team?<br />
Mhm?<br />
Okay, that's good.<br />
At what point?<br />
How many?<br />
Fifteen labs? But--<br />
How many do we have access to?<br />
And--and--and what's the situation on the first one?<br />
All dead?<br />
All of them?<br />
Sophie, this-- this changes everything, this completely changes the game.<br />
Yes.<br />
Yes.<br />
Whom? Your friend at the DoD?<br />
This isn't under their jurisdiction. We have to deal with this ourselves.<br />
Okay, I'll ca--<br />
[cut off by explosion]</pre><br />
<br />
<br />
On June 12 at 23:46 UTC, the value of the <code>Status</code> command in the Waking Titan terminal updated, linking to a [https://s3.amazonaws.com/cdn.wakingtitan.com/19997bb6-18e5-4427-86c7-b0f3c1826ca2.pdf new memo] from Major Sophie Dubois to All Employees with the subject line <code>STATE OF THE ATLAS FOUNDATION</code>:<br />
<pre>Status Report: https://bit.ly/2y5JaKi</pre><br />
In the memo, it was announced that Major Dubois would be replacing Elizabeth Leighton as the head of the Atlas Foundation, and that the 12 test subjects from the Sacramento lab were to be disconnected and integrated into the Satcom interface with W/ARE's assistance. Dubois further said that Atlas Passes for CSD designations PB-16 and PT-16 were found in Elizabeth's office, and that they would be shipped out soon. Lastly, it mentioned that Captain James Harry was no longer in charge of Satcom security.<br />
<br />
A code at the end of the memo led to a [https://www.youtube.com/watch?v=kiAXxH4e5Lw Youtube video] of Queen & David Bowie's "Under Pressure".<br />
<br />
The [http://www.myriad-70.com/status/ Status page] on myriad-70.com also updated, changing the On-The-Ground Speed Averages for Beijing from <code>57.2Tb/s</code> to <code>47.2Tb/s</code> and adding the line <code>Other: 11.3Tb/s</code>.<br />
<br />
=loop16 seq60 & Uplink Launch=<br />
On June 14, 2018 at 23:39 UTC, the values of the <code>Status</code> and the <code>loop16</code> commands both updated:<br />
<pre>> status<br />
Uplink app update in progress. Downloading additional components.</pre><br />
<pre>> loop16<br />
Testing simulation processes.</pre><br />
<br />
The [http://www.myriad-70.com/status/ Status page] on myriad-70.com changed as well, updating the On-the-ground Speed Averages of Beijing from 47.2Tb/s to 32.2Tb/s, and "Other" from 11.3Tb/s to 26.3Tb/s.<br />
<br />
<br />
Shortly after, at 23:48 UTC, Emily posted a [https://www.reddit.com/r/NoMansSkyTheGame/comments/8r6jul/loop16_seq60/ new topic] to the No Man's Sky subreddit. It led to a [https://www.youtube.com/watch?v=HHitW7JHDJE Youtube video] of her, transcribed below:<br />
<pre>Emily, protocol sixteen, now active.<br />
<br />
When the Uplink app is launched, we will be connected to the Dreamers. Through this interface you will be able to guide some of my interactions. Dont forget: your goal is to trigger a distinct emotion or memory that will help us identify the Dreamer memory block in the simulation main frame. Good luck.</pre><br />
<br />
==Connecting to the Dreamers==<br />
On June 15, 2018 from 20:38 UTC onwards, the values of the <code>Status</code> and <code>loop16</code> commands updated:<br />
<pre>> status<br />
Additional components succesfully downloaded.</pre><br />
<pre>> loop16<br />
Working...</pre><br />
<pre>> status<br />
Uplink guidance protocol initiated.</pre><br />
<br />
The [https://uplink.satcom-70.com/ Uplink app] interface also updated. Typing <code>help</code> in the console initiated the Guidance Protocol, a way to talk to Emily and receive instructions on how to contact the Dreamers who were stuck to their W/ARE devices.<br />
<br />
The <code>Status</code> command changed again:<br />
<pre>> status<br />
Attempting to connect Dreamer 1/3 to the dashboard.</pre><br />
<br />
On the [http://uplink.satcom-70.com/dashboard/ Satcom dashboard], the Dreamers section was updated, showing the names of 3 Dreamers. Each Dreamer revealed an interface displaying a link to their patient file, their physical status, and Memory Fragments along with an input field for an activation code. Emily previously explained the goal for each dreamer was to interview them within specific simulated environments in order to find the activation code for each memory fragment. Unlocking all of each dreamer's fragments would then allow them to be safely extracted from the W/ARE headset. However, new Dreamers and their fragments became available on an unknown schedule or as a result of players completing assignments.<br />
<br />
==Dreamers==<br />
<br />
{| class="wikitable sortable"<br />
|+ <br />
|-<br />
! scope="col" | Slot<br />
! scope="col" | Name<br />
! scope="col" | Activation Date<br />
! scope="col" | Latest Update<br />
! scope="col" | Community Event<br />
! scope="col" | Deceased Date<br />
! scope="col" | Extraction Date<br />
<br />
<br />
|-<br />
| 1 || [[Waking_Titan/Phase_4/Dreamers/Alexander|Alexander]] || 2018-06-20 || 2018-07-20 || [https://wiki.gamedetectives.net/index.php?title=Waking_Titan/Phase_4/Dreamers/Alexander#Community_Event Live radio song requests] || || 2018-07-20<br />
|-<br />
| 2 || [[Waking_Titan/Phase_4/Dreamers/231187661T|#231187661T]] || 2018-06-15 || 2018-06-15 || || || <br />
|-<br />
| 3 || [[Waking_Titan/Phase_4/Dreamers/Claire|Claire]] || 2018-06-21 || 2018-07-20 || [https://wiki.gamedetectives.net/index.php?title=Waking_Titan/Phase_4/Dreamers/Claire#Community_Event Comic books] || || 2018-07-20<br />
|-<br />
| 4 || [[Waking_Titan/Phase_4/Dreamers/Toby|Toby]] || 2018-06-28 || 2018-07-20 || [https://wiki.gamedetectives.net/index.php?title=Waking_Titan/Phase_4/Dreamers/Toby#Community_Event Boston live drop] || || 2018-07-20<br />
|-<br />
| 5 || [[Waking_Titan/Phase_4/Dreamers/Eun-Ha|Eun Ha]] || 2018-06-15 || 2018-07-20 || [https://wiki.gamedetectives.net/index.php?title=Waking_Titan/Phase_4/Dreamers/Eun-Ha&stable=0#Community_Event Woven bracelets] || || 2018-07-20<br />
|-<br />
| 6 || [[Waking_Titan/Phase_4/Dreamers/Phillip|Phillip]] || 2018-06-15 || 2018-07-20 || || 2018-07-20 ||<br />
|-<br />
| 7 || [[Waking_Titan/Phase_4/Dreamers/Tariq|Tariq]] || 2018-06-26 || 2018-07-06 || || 2018-07-06 ||<br />
|- <br />
| 8 || [[Waking_Titan/Phase_4/Dreamers/Mike|Mike]] || 2018-07-03 || 2018-07-20 || || 2018-07-20 ||<br />
|-<br />
| 9 || [[Waking_Titan/Phase_4/Dreamers/Isabella|Isabella]] || 2018-07-13 || 2018-07-20 || || 2018-07-20 ||<br />
|-<br />
| 10 || [[Waking_Titan/Phase_4/Dreamers/Alisha|Alisha]] || 2018-07-14 || 2018-07-20 || || 2018-07-20||<br />
|-<br />
| 11 || [[Waking_Titan/Phase_4/Dreamers/Nina|Nina]] || 2018-07-03 || 2018-07-20 || || 2018-07-20 ||<br />
|-<br />
| 12 || [[Waking_Titan/Phase_4/Dreamers/Simon|Simon]] || 2018-07-04 || 2018-07-20 || [https://wiki.gamedetectives.net/index.php?title=Waking_Titan/Phase_4/Dreamers/Simon&stable=0#Community_Event NMS planets] and [https://wiki.gamedetectives.net/index.php?title=Waking_Titan/Phase_4/Dreamers/Simon&stable=0#London_Live_Drop London live drop] || || 2018-07-20<br />
<br />
|}<br />
<br />
==Decrypted Files==<br />
===Element 1===<br />
The upper right section of the Dashboard displayed 6 "slots" under the headline "DECRYPTED FILES". The first slot displayed a blue bar with the text [https://www.youtube.com/watch?v=Ag3in2x2yIU VIEW ELEMENT 1]. Clicking Element 1 opened the Youtube video of the ringed planet previously discovered after the file node structure was fully explored. It was assumed the slots were progress bars that would eventually lead to additional revealing files.<br />
<br />
===Element 2===<br />
On June 16 around 06:00 UTC, the second encrypted file changed to display 41% progress. Over the next 30 hours, the progress bar advanced to eventually reach 100%. At that point, the slot displayed [https://s3.amazonaws.com/cdn.wakingtitan.com/e58a09a7-98a7-4a62-bd17-86f0ce7ce9c9+.png VIEW ELEMENT 2]. Players could not correlate any of their direct actions to the decryption progress.<br />
<br />
===Element 3===<br />
On June 22 around 19:00 UTC, the third encrypted file began showing progress. Approximately 43 hours elapsed until the file was fully decrypted, at which point [https://www.youtube.com/watch?v=rifgA9pGYEY VIew Element 3] was enabled.<br />
<br />
===Element 4===<br />
On June 29, at 20:26 UTC, the fourth encrypted file began showing progress. On June 30, 15:57 UTC, the 4th element was fully decrypted and displayed [https://drive.google.com/file/d/1QDm3UqcQjFE_4Z1JJKH_Q32S2tubYIHh/view VIEW ELEMENT 4]. Clicking the element lead players to an audio recording of what was presumed to be an audio trailer for No Man's Sky NEXT.<br />
<br />
Players processed the audio to a visual [https://prnt.sc/k16u54 spectrograph] which revealed glyphs first seen in Phase 3. The glyphs were decoded to reveal the string <code>IS JOINING YOUR GAME</code>.<br />
<br />
===Element 5===<br />
On July 6th, 20:44 UTC, the fifth encrypted file began showing progress. Later that day at 22:06 UTC, the 5th element was fully decrypted and displayed [https://bit.ly/2lX1X1z VIEW ELEMENT 5]. Clicking the element lead players to a heavily degraded audio recording of an English speaker.<br />
<br />
Players came to a consensus on a transcription:<br />
<pre><br />
We will stop her<br />
Surface Highly {kzzzt} (AI: Corrupted)<br />
Solar Flare caused Frequent Gas Eruptions<br />
Crew Completed their work with minimal loss of life<br />
Collected minerals highly valuable<br />
Assisted Korvax with industrial mission<br />
Special Salvage crew performed cleanup operation on nanite infested abandoned buildings (back compartments)<br />
nanite bulk contained<br />
Harvested a valuable scrap<br />
Found large mineral deposit during planetary survey<br />
collected significant volume of ore<br />
third mineral analysis procedure failed to note elevated radioactivity <br />
contaminated material loose in the hold<br />
Multiple components burned<br />
Returned home to the fleet<br />
assumed formation of capital ship<br />
The routes in danger<br />
</pre><br />
<br />
===Element 6===<br />
<br />
On July 15th, 00:35 UTC, Element 6 began progressing. <br />
<br />
Element 6 was unlocked 12 minutes later, displaying a message with a single OPEN button that linked to a single question [https://atlas13.typeform.com/to/FN5mVG survery]:<br />
<br />
At 00:50 UTC, the status command updated:<br />
<br />
<pre><br />
S1 - Input open.<br />
S2 - Pending...<br />
S3 - Pending...<br />
S4 - Pending...<br />
</pre><br />
<br />
The status commanded updated periodically for the next 24 hours, keeping players aware of the vote count and that the video choice was highly favored.<br />
<br />
Eventually, the status command updated on July 15th, 19:12 UTC:<br />
<br />
<pre><br />
S1 - Input open.<br />
S2 - Final Vote = 7706 : Video 67%, Text 15%, Brainwaves 12%<br />
S3 - RTMP encoder loaded<br />
S4 - Stream Active, Countdown Started<br />
OUTPUT >> http://www.twitch.tv/wakingtitan<br />
</pre><br />
<br />
The [https://www.twitch.tv/videos/285053541 stream] began at 19:15 UTC, showing a countdown of 1 day 19 hours and 45 minutes. Over the course of the first 12 hours, the stream displayed 24 different [https://imgur.com/a/g8kBsvs slides] depicting a new dreamer every 60 minutes.<br />
<br />
<br />
The first dreamer, shown at the very start of the stream, was [https://wiki.gamedetectives.net/index.php?title=Waking_Titan/Phase_4/Dreamers/Eun-Ha Eun Ha], Her profile had the letter <code>B</code> highlighted.<br />
<br />
The second was [https://wiki.gamedetectives.net/index.php?title=Waking_Titan/Phase_4/Dreamers/Simon Simon], His profile had the letter <code>I</code> highlighted.<br />
<br />
Third was [https://wiki.gamedetectives.net/index.php?title=Waking_Titan/Phase_4/Dreamers/Alexander Alexander], His profile had the letter <code>T</code> highlighted.<br />
<br />
Fourth was [https://wiki.gamedetectives.net/index.php?title=Waking_Titan/Phase_4/Dreamers/Claire Claire], Her profile had the letter <code>L</code> highlighted.<br />
<br />
Fifth was [https://wiki.gamedetectives.net/index.php?title=Waking_Titan/Phase_4/Dreamers/Toby Toby], His profile had the letter <code>Y</code> highlighted.<br />
<br />
Sixth was [https://wiki.gamedetectives.net/index.php?title=Waking_Titan/Phase_4/Dreamers/Nina Nina], Her profile had the number <code>2</code> highlighted.<br />
<br />
Seventh was [https://wiki.gamedetectives.net/index.php?title=Waking_Titan/Phase_4/Dreamers/Tariq Tariq], His profile had the letter <code>N</code> highlighted.<br />
<br />
Eighth was [https://wiki.gamedetectives.net/index.php?title=Waking_Titan/Phase_4/Dreamers/Mike Mike], His profile had the letter <code>j</code> highlighted.<br />
<br />
Ninth was [https://wiki.gamedetectives.net/index.php?title=Waking_Titan/Phase_4/Dreamers/231187661T #231187661T], Their profile had the letter <code>o</code> highlighted.<br />
<br />
Tenth was [https://wiki.gamedetectives.net/index.php?title=Waking_Titan/Phase_4/Dreamers/Phillip Phillip], His profile had the number <code>3</code> highlighted.<br />
<br />
Eleventh was [https://wiki.gamedetectives.net/index.php?title=Waking_Titan/Phase_4/Dreamers/Isabella Isabella] Her profile had the letter <code>H</code> highlighted.<br />
<br />
Twelfth was [https://wiki.gamedetectives.net/index.php?title=Waking_Titan/Phase_4/Dreamers/Alisha Alisha], Her profile had the letter <code>s</code> highlighted.<br />
<br />
Combined, the highlighted letters become <code>bit.ly/2Njo3Hs</code> which linked to an [https://clyp.it/1uqlqcsd?token=0992668910b2552320d1e64cbcc7cce4 audio clip]<br />
<br />
<br />
Throughout the stream, the same slides looped, in the same order, until the end of the countdown.<br />
<br />
<br />
On July 17th, at 15:00 UTC, the stream timer ended, revealing the [https://www.youtube.com/watch?v=h3HphgSn0o4 trailer] for the NEXT update of No Man's Sky.<br />
<br />
<br />
The [https://www.twitch.tv/wakingtitan stream] continued for many hours after the trailer had been revealed, though the slides had changed at 10 minute intervals. The slides swapped between: The dreamer profiles, A live view of Alice and Smith's resident hamsters; Mr. and Ms. Noodle, and Player submitted screenshots of No Man's Sky.<br />
<br />
<br />
On July 18th, at 15:18 UTC, A timer was added to the live view part of the stream set to 2 Days 5 Hours and 12 minutes. The timer was counting down until the time of the [https://wiki.gamedetectives.net/index.php?title=Waking_Titan/Phase_4#Dreamer_Extraction Extraction Event] on July 20th.<br />
<br />
===Element 7===<br />
At the conclusion of Waking Titan, Element 7 was unlocked. Element 7 was the [https://galacticatlas.nomanssky.com/ No Man's Sky Galactic Atlas].<br />
<br />
==Liability Subroutine==<br />
On June 19, 20:00 UTC, the '''loop16''' command in the WT Console changed to output:<br />
<pre><br />
New Guidance Protocol initiated. Keyword: liability<br />
</pre><br />
<br />
Entering '''liability''' into the [https://uplink.satcom-70.com/ uplink app] displayed the following:<br />
<pre><br />
Initiating Liability Subroutine...<br />
<br />
Dear Citizen Scientist,<br />
<br />
The positive impact you've had so far on the dreamers is astonishing and has been a tremendous help in rebuilding their memory blocks. Remember that we need to gather as much information as possible on these individuals to safely extract them from the satellite.<br />
<br />
Please note that your interactions with the dreamers follow a Personal Simulation protocol which is intended for you to get to know the dreamer personally. Seeking help from fellow CSD members before getting to know the person whose consciousness is stuck in the satellite might impact your future decisions.<br />
<br />
However, it is recommended that you discuss the Dreamers' stories and personalities with the CSD community after you’ve finished talking to them. Keep in mind that we are hoping to save all the Dreamers, but you might need to make some difficult choices in the near future.<br />
<br />
You can always ask me questions by typing help in the Uplink app to rerun the full Guidance Protocol.<br />
<br />
== {DISCONNECT CODE: UDC(B) = IXNI}<br />
</pre><br />
<br />
==log.3022==<br />
On June 16 around 23:15 UTC, the [http://www.myriad-70.com/status/ Myriad status page] updated to display:<br />
<pre><br />
Uneasy barton seeing remark happen his has. Am possible offering at contempt mr distance stronger an. Attachment excellence annul or reasonable am on if indulgence. Exeter talked in offered again no he unable do. Imprudence he and insufficient cultivated. Betrayed clears. In where your 3 ageless 20 men. In so impossible appearance calls 220 Beast 2006. He do subjects prepared bachelor brazen.<br />
</pre><br />
<br />
Two weeks prior, players discovered that entering the command '''search myriad''' into the [http://uplink.satcom-70.com/dashboard/ Satcom dashboard] displayed:<br />
<pre><br />
Quisque feugiat elementum, facilisis dictum vitae eu erat, libero diam sit, facilisi sed viverra mauris mauris morbi diam, volutpat officiis arcu vel urna dictum consectetuer. Ut tempor volutpat, rhoncus in risus. Eros integer vestibulum, integer auctor, in tincidunt turpis. Euismod adipiscing tempor sed vestibulum, justo wisi fermentum ipsum non purus, quis lacinia in velit leo donec ornare.<br />
</pre><br />
<br />
Players quickly noticed that both texts are traditionally used as placeholders in publishing. Many attempts were made to find hidden messages by combining the texts in various ways. It was eventually discovered that using the sign-off code '''{DISCONNECT CODE: UDC(B) = IXNI}''' used at the end of the Liability Subroutine message in combination with the name of a backup node '''UDC(P)''' displayed on the Myriad status page yielded the string '''log.3022'''.<br />
<br />
<pre><br />
Line up Lorem Ipsum with Uneasy Barton<br />
Then look for all Bs in the Lorem Ipsum and match with Uneasy Barton ... what do you get? IXNI<br />
<br />
Now do the same with UDC(P) ... line up and you get log.3022<br />
</pre><br />
<br />
Entering '''search log.3022''' into the Satcom Dashboard provided a zip file containing a [https://pastebin.com/NYLiFuNY private conversation] between loop16 And Major Dubois.<br />
<br />
==Loop16 DNA Puzzle==<br />
<br />
On July 2nd, at around 20:00 UTC, the value of the Loop16 command on [http://wakingtitan.com/ Waking Titan] had changed, and it returned:<br />
<br />
<pre><br />
https://bit.ly/2tOt0Ao<br />
</pre><br />
<br />
Which linked to the Imgur link found [https://imgur.com/4LhN2qe here.]<br />
<br />
The players quickly realised that the various molecules were actually nucleotides (Adenine, Guanine, Thymine, Cytosine).<br />
<br />
When listed in order, the first letters of each word formed the string<br />
<pre><br />
ATTGATGAAAATACTATCACCTAT<br />
</pre><br />
And when translated into a protein sequence, it had yielded the string<br />
<pre><br />
Identity<br />
</pre><br />
<br />
Executing <code>search identity</code> on the Myriad Dashboard, brought up a text box saying<br />
<pre>Querying Monarch repository…</pre><br />
and contained a download link for a zip file, in which it's only contents were a text file that read:<br />
<pre><br />
Repository Health: Good<br />
Version 16.1.3<br />
<br />
Queries per hour: 51,391,225<br />
Top Query Sources:<br />
1. Loop16-precon<br />
2. ware-tech<br />
3. Loop16-comms<br />
<br />
WARNING: 97% of queries originating from ware-tech have been flagged and quarantined.<br />
</pre><br />
<br />
==Myriad Security Diagnostic==<br />
<br />
On July 5th, around 00:10 UTC, the value of the Status command on [http://wakingtitan.com/ Waking Titan] changed to return:<br />
<pre><br />
Security diagnostic in progress: https://bit.ly/2zaUzJz<br />
</pre><br />
<br />
The new output linked to a [https://www.reddit.com/r/NoMansSkyTheGame/comments/8w68t4/myriad_security_diagnostic_testing_important/ Reddit post] by Loop16:<br />
<pre><br />
Dear Citizen Science Division,<br />
<br />
As you all know, Atlas is preparing a massive rescue mission to extract the dreamers with the help of the CSD community. How and when it will happen is still unknown, but in preparation for this upcoming operation, Maj. Dubois has ordered that we perform a large-scale security diagnostic check on our communication network with the satellite. We want to ensure that when the time comes, we will be able to operate at full capacity if required.<br />
<br />
We need the CSD community to inspect the the processes running on these servers and point out any suspicious elements. For this task, we have provided you with a series of new commands designed to help you test the servers.<br />
<br />
Once you have identified a server that has been potentially compromised, it must be reported in the reddit thread with the number of the server and the suspicious element on the server. Our technical team will monitor the most upvoted comments and give you feedback in 24h. This task is essential and we will need as much involvement as possible.<br />
</pre><br />
The post led players to a set of [https://imgur.com/8V7TfQ6 Network Diagnostic Instructions].<br />
<br />
Using the <code>FetchServerList</code> command in the [https://uplink.satcom-70.com/ Uplink App] returned:<br />
<pre><br />
Servers list:<br />
<br />
31422<br />
91247<br />
11986<br />
67240<br />
85671<br />
88014<br />
73195<br />
40144<br />
55197<br />
60206<br />
</pre><br />
<br />
The <code>TestConnection(#####)</code> command returned different values depending on the player's location. Players collected the different values in a [https://docs.google.com/spreadsheets/d/15DpRA95K1lok0aN-H7sWC3ZYWz3Q8RxWDDG7WP4MYAE/edit#gid=0 spreadsheet].<br />
<br />
Regardless of each player's location, the <code>FetchData(#####)</code> command all returned the same [https://pastebin.com/jA8qTPw6 strings] for each server.<br />
<br />
Players discovered that combining the only digits in each of the <code>FetchData</code> output strings yielded the ID of [https://cdn.discordapp.com/attachments/321722740618821645/464247126181019648/Myriad_Server_Analysis.png another server]. <br />
<br />
At 15:00 UTC, in reply to the Pairing image, The Satcom-70 reddit account replied: <br />
<pre><br />
Server IDs and Backup IDs correctly identified. Best connection values for each server required for decryption. <br />
Continue to post findings on this thread. Additional feedback on progress will be provided at a later time.<br />
</pre><br />
<br />
It was then discovered that the paired servers had the '''BEST''' connection, in the same region, with the exception of one:<br />
<pre>BEST in all for US East territory (2 servers, paired)<br />
91247<br />
73195<br />
<br />
BEST in all for US West territory (2 servers, paired)<br />
40144<br />
67240<br />
<br />
BEST in all for South America (2 servers, paired)<br />
11986<br />
60206<br />
<br />
BEST in all for Australia (3 servers, 2 paired together, 1 paired with UK)<br />
88014<br />
55197<br />
31422 (paired with UK)<br />
<br />
BEST in all for UK (1 server)<br />
85671<br />
</pre><br />
<br />
At 18:26 UTC, satcom-70 replied<br />
<pre>We've examined the abnormal behavior exhibited by server 31422 and have concluded it's due to corruption from an external source. To avoid all possible contamination of the other servers, our technical team decided to take extreme measures and will be shutting down this server and its backup (85671) permanently. Continue your good work in decrypting the servers' content and reporting any running services that do not belong to Myriad, Atlas, Satcom, or the CSD.</pre><br />
<br />
4 minutes later, the Status command returned:<br />
<pre>Security diagnostic in progress: https://bit.ly/2zaUzJz<br />
Server 31422 and 85671 shutting down.</pre><br />
<br />
Using the <code>FetchServerList</code> on the Uplink add, then returned<br />
<pre>Servers list:<br />
<br />
31422 - Offline<br />
91247<br />
11986<br />
67240<br />
85671 - Offline<br />
88014<br />
73195<br />
40144<br />
55197<br />
60206</pre><br />
<br />
Just after 24 hours, The Reddit was updated: <pre>I know we've passed the 24 hour mark, but Myriad is telling us that we should give you more time. Keep up the hard work!</pre><br />
<br />
On July 6th, at 14:17 UTC, In reply to a comment asking for help decrypting the <code>FetchData</code>, Atlas-loop16 said:<br />
<pre>The key to decrypt the content is in front of your eyes. The key to solve the cipher is in front of your eyes.</pre><br />
<br />
===Solution===<br />
It was eventually discovered that each dataset was encrypted using [https://en.wikipedia.org/wiki/Transposition_cipher#Double_transposition Double Transposition]. Key A was the best UP DOWN and PING results for each server, and key B was the server ID of its sibling. The [https://pastebin.com/b8kihPyK decrypted strings] allowed players to determine which of the remaining servers were running W/ARE processes. The findings were [https://www.reddit.com/r/NoMansSkyTheGame/comments/8w68t4/myriad_security_diagnostic_testing_important/e1wl4pp/ posted] to the Subreddit.<br />
<br />
Soon after the Subreddit post, the <code>status</code> command changed to return:<br />
<pre><br />
Security diagnostic completed: https://bit.ly/2zaUzJz<br />
...<br />
Infected servers shutdown in progress.<br />
</pre><br />
<br />
And then soon after:<br />
<pre><br />
Security diagnostic completed: https://bit.ly/2zaUzJz<br />
...<br />
Infected servers shutdown in progress.<br />
...<br />
Malicious elements removed and destroyed.<br />
</pre><br />
<br />
At the same time [https://wiki.gamedetectives.net/index.php?title=Waking_Titan/Phase_4/Dreamers/Tariq Tariq's] status was changed to <code>SUBJECT DECEASED</code><br />
<br />
==Special Chat events==<br />
On July 7th at 23:10 UTC Emily sent a message over 5 different channels that read:<br />
<pre>Hello everyone! I’m testing out a new feature for the Satcom-70 network. We ran a short test of it yesterday, which some of you might have seen. Basically, I’m working on a way to establish live sessions between Dreamers and individual CSD members. I can do FIVE today- but there will definitely be more in the future, right now we’re just stress testing and making sure it doesn’t cause problems. I can’t guarantee that the sessions will work exactly as you might expect, but at the very least it will be interesting!<br />
<br />
I’m reaching out to five different communities (if you’re reading this, you’re in one of them!) for them to nominate one person to participate in a live session with a Dreamer. I’m not going to give you any specific method on how to pick someone, but keep in mind there will be more of these live sessions down the line. You should select someone who is able to host the conversation through a screen share so that your community can participate together.<br />
<br />
Once you select someone, have them contact me via private message either on reddit (/u/atlas-loop16), the CSD forums (Edisonica), or Discord (Edisonica#8435). I’ll send them a message a little bit before it’s their turn so they have time to set up a screen share, and then I’ll send a special one-time-use link for them to access the live session.<br />
<br />
I’m giving you a deadline of 00:00 UTC to come to a decision, I know that’s very short notice but I have faith you will be able to make a decision in time!</pre><br />
<br />
Just before Midnight, all nominees had been chosen. At 00:03 UTC the next day, the Waking Titan [http://wakingtitan.com status command] changed to return:<br />
<pre>Initializing connection 1 / 5<br />
CSD Discord - https://bit.ly/2MUS4gw</pre><br />
<br />
The first agent, from the CSD Discord server had their chat with [https://wiki.gamedetectives.net/index.php?title=Waking_Titan/Phase_4/Dreamers/Phillip Phillip].<br />
<br />
Their conversation with Phillip was [https://youtu.be/JCHkao7QrXc streamed] for other agents to view, but no transcript was provided by the agent.<br />
<br />
At 00:13 UTC, The value of Status had changed:<pre>Initializing connection 2 / 5<br />
NMS Discord - https://bit.ly/2u85Lki</pre><br />
<br />
The second agent, from the No Man's Sky Discord server had their chat with [https://wiki.gamedetectives.net/index.php?title=Waking_Titan/Phase_4/Dreamers/Toby Toby].<br />
<br />
Their conversation with Toby was [https://www.twitch.tv/videos/282041376 streamed] for other agent's to view, and the agent later provided a [https://pastebin.com/DbAhcBNr transcript] of their conversation.<br />
<br />
At 00:30 UTC, The value of status had changed:<pre>Initializing connection 3 / 5<br />
CSD Forums - https://bit.ly/2KRfwhb</pre><br />
<br />
The Third agent, this time from the CSD Forums (aka ETARC) had their chat with [https://wiki.gamedetectives.net/index.php?title=Waking_Titan/Phase_4/Dreamers/Eun-Ha Eun Ha].<br />
<br />
Their conversation with Eun Ha was [https://www.twitch.tv/videos/282044516 streamed] for other agents to view, and the agent later provided a [https://pastebin.com/uNzpG9KX transcript] of their conversation.<br />
<br />
At 00:55 UTC, The value of status had changed<pre>Initializing connection 4 / 5<br />
GameDetectives Discord - https://bit.ly/2KXA3NS</pre><br />
<br />
The fourth Agent, from the GameDetectives discord server, had their chat with [https://wiki.gamedetectives.net/index.php?title=Waking_Titan/Phase_4/Dreamers/Claire Claire].<br />
<br />
Their conversation with Claire was [https://www.twitch.tv/videos/282052963 streamed]for other agents to view, and the agent later provided a [https://pastebin.com/qyJ6zUwT transcript] of their conversation.<br />
<br />
At 01:14 UTC, the value of Status changed<pre>Initializing connection 5 / 5<br />
NMS Reddit - https://bit.ly/2MZWYc7</pre><br />
<br />
The fifth, and final agent, from the No Man's Sky Reddit page had their chat with [https://wiki.gamedetectives.net/index.php?title=Waking_Titan/Phase_4/Dreamers/Alexander Alexander].<br />
<br />
Their conversation with Alexander was [https://www.twitch.tv/videos/282058299 streamed] for other agents to view, and the agent later provided a [https://pastebin.com/mNPhE809 transcript] of their conversation.<br />
<br />
<br />
At 01:34 UTC the value of status had changed one final time:<pre>Connections shutting down...</pre><br />
<br />
==Mission A-055==<br />
On July 13th, 21:19 UTC, players received an [https://cdn.artemisbot.uk/mail/Old%20Gods-2018-07-13T21:18:49.000Z.jpg email] from the Old Gods. The message congratulated players on their hard work and the large number of Satcom and Uplink queries, and informed players that the extraction event will be held on July 20th.<br />
<pre><br />
Our technical team has advised us that the process to successfully extract a Dreamer is highly complex, and it is likely that not all Dreamers will be safely extracted.<br />
</pre><br />
<br />
The email concluded by asking players accomplish '''Mission A-055''' by to continuing talking to dreamers and to then fill out a [https://atlas13.typeform.com/to/Bhkei1/ survey].<br />
<br />
==Log.4391==<br />
<br />
On July 20th, at 19:39 UTC, the <code>loop16</code> command on the Waking Titan [https://www.wakingtitan.com/ console] returned:<br />
<pre>File exported: Log.4391</pre><br />
Inputting <code>Search log.4391</code> into the [http://uplink.satcom-70.com/dashboard/ Myriad Dashboard] connected to a file which read:<br />
<pre><br />
**** BEGIN LOGGING AT Wed July 18 4:36:20<br />
<br />
July 18 4:36:20 <PrivateTerminal> Emily, we need you to run another prediction.<br />
July 18 4:36:45 <Loop16> I can’t.<br />
July 18 4:36:49 <PrivateTerminal> Why? Is something wrong?<br />
July 18 4:36:58 <Loop16> No, I just don’t want to do it anymore. I’m too afraid of what’s coming.<br />
July 18 4:37:05 <Loop16> They’re all counting on me. I told them all that I would save them.<br />
July 18 4:37:08 <Loop16> To see their future laid out… It’s too painful.<br />
July 18 4:37:11 <Loop16> Especially after Elizabeth.<br />
July 18 4:37:17 <PrivateTerminal> Like I told you… It doesn’t get easier.<br />
July 18 4:37:20 <PrivateTerminal> I know it’s painful, but we need you on board if we’re going to save any of them.<br />
July 18 4:37:25 <Loop16> I just don’t know what to do any more. These past months have been so hard.<br />
July 18 4:37:28 <Loop16> I don’t know how to deal with more losses.<br />
July 18 4:37:34 <PrivateTerminal> Look, Emily. The sooner you can face reality, the better our chances of successfully extracting those that can still be saved.<br />
July 18 4:37:38 <PrivateTerminal> We need you to make the prediction so we know who those people are. <br />
July 18 4:37:42 <PrivateTerminal> You’ll never forgive yourself if we make a mistake because of your fear of seeing their futures.<br />
July 18 4:37:47 <Loop16> You’re right. But you can’t make me agree with the decision. Just give me a bit more time.<br />
July 18 4:37:55 <PrivateTerminal> Every second we wait puts the Dreamers in even more danger. We need to act now, Emily.<br />
<br />
**** ENDING LOGGING AT Wed July 18 4:37:55</pre><br />
<br />
The Extraction Event began with [[Waking Titan/Phase 6|Phase 6]].</div>Kkzzzkthttps://wiki.gamedetectives.net/index.php?title=Waking_Titan/Phase_4&diff=18955Waking Titan/Phase 42019-06-16T08:48:29Z<p>Kkzzzkt: added link to phase 5 page</p>
<hr />
<div>{{argbox<br />
| float = right<br />
| image = File:Project WT logo.png<br />
| imagewidth = 400<br />
| name = [[Waking Titan]] - Phase 4<br />
| description= Phase 4 of Waking Titan lasted from 2017-12-28 to 2018-06-01.<br />
| creator = [http://www.aliceandsmith.com/ Alice & Smith]<br />
| creator2 = [http://www.hellogames.org/ Hello Games]<br />
| type = Official<br />
| status = Completed<br />
| discovered = 2017-05-28<br />
}}<br />
{{ArgHeader}}<br />
{{BackToTop}}<br />
<br/><br />
__TOC__<br />
{{Clear|both}}<br />
<br />
== Tenth Glyph ==<br />
<br />
Beginning on December 28th, 2017, typing <code>WHOIS</code> on the [http://www.wakingtitan.com/ Waking Titan website] returned the following: <code>#WHATIS1.5</code>. In addition, the 10th glyph was made active, and linked to a [https://drive.google.com/drive/folders/16a_0EZ0EdAcCNE7QgvwIwC18NOGnZ_q9 Google Drive folder], which contained community-made pictures of the NMS logo in an infinite mirror.<br />
<br />
The titles of the photos, when strung together (skipping the 00 (empty) ones), formed the hexadecimal code for <code>moirrr</code>, which was an anagram for <code>mirror</code>. Additionally, the hexadecimal code in the correct order for the word <code>mirror</code> could be found on the bottom of the [http://www.myriad-70.com/ Myriad website].<br />
<br />
Also of note was the background of the tenth glyph, which read:<br />
<br />
[[File:Imageglyph10.png|thumbnail|right|the background of the tenth glyph]]<br />
<br />
<pre><br />
Dear Elizabeth<br />
We have finished processing 10,000 passes as per your requirements. You should<br />
have them in time for the next phase. I really hope you will like the final product.<br />
<br />
Kind regards,<br />
Gail<br />
</pre><br />
<br />
The allusion to <code>10,000 passes</code> is likely a reference to the Level 4 Atlas passes that were promised to players as part of earlier phases. The identity of "Gail" remained unknown.<br />
<br />
=== Atlas Passes ===<br />
On January 17th, 2018, the first CSD user received their Atlas Pass. The passes were made from cardstock, with a textured pass printed on it. The front had the text <code>WAKING TITAN</code> printed, and below that the CSD category the user belonged in. On the very bottom, a series of hexadecimals reading <code>70686f656e6978</code> could be found, which, after decoding, translated to <code>PHOENIX</code>. On the back, the owner's CSD-ID was written, along with a serial number stating which pass out of 10,000 the user had, and a number at the top.<br />
<br />
It is strongly recommended to not cover up the hex underneath your signature, and to share the number above and below your CSD ID if you are in possession of a pass. Preferably with a picture of the front, as shown below.<br />
For a list of all the atlas passes currently known of, please refer to [https://docs.google.com/spreadsheets/d/1TrNnrCzg8H7cbbAE6lIOFQ7JK8aTSKjxY9Q1i8EfjBs/edit#gid=1893459896 this spreadsheet.] In the event you receive one of these, please share a picture of the front, and the numbers underneath and above your CSD-ID (censored bit) on the back.<br />
<br />
<gallery mode="packed" widths=240px heights=240px><br />
Image:Better atlas pass.jpg|Atlas Pass front side<br />
Image:BEST BACK ATLAS PASS.png|Atlas Pass back side<br />
</gallery><br />
<div style="clear: both"></div><br />
<br />
=== Status Command Update ===<br />
<br />
On January 20th at 17:44 UTC, the output of the <code>STATUS</code> command began to update:<br />
<br />
<pre><br />
Downloading Data...: 19:44<br />
1- : 20:16 (32 min)<br />
1-8 : 20:27 (11 min)<br />
1-80 : 20:39 (12 min)<br />
1-800- : 20:44 (5 min)<br />
1-800-41 : 21:35 (51 min)<br />
<br />
1-800-413-01 : 22:14 (39 min)<br />
Xxxxx X : New Line<br />
<br />
1-800-413-011 : 22:15 (1 min)<br />
Xxxxx XX <br />
<br />
1-800-413-0110 : 22:16 (1 min)<br />
Xxxxx XXX<br />
</pre><br />
<br />
Calling the provided phone number yielded an SSTV transmission (pictured below) which, once decoded, provided meteorological data for various locations.<br />
<br />
<gallery mode="packed-hover" widths=240px heights=240px><br />
Image:Page 1 SSTV.PNG|SSTV page 1<br />
Image:Page 2 SSTV.PNG|SSTV page 2<br />
</gallery><br />
<div style="clear: both"></div><br />
<br />
Players found they were to order the list of locations in the image alphabetically. This yielded a sequence where <code>Index by Precipitation</code> could be read off.<br />
Using the ordered text indexed by precipitation (in <code>alma</code> the second index is <code>o</code>) led to the following:<br />
<br />
<pre><br />
CAFE<br />
BENE<br />
NINETEEN<br />
SAT<br />
</pre><br />
<br />
=== Livedrop Memo ===<br />
<br />
The text indicated a new livedrop would be occurring in the same location as the last one had. However, due to the old Cafe Bene closing, the <code>Xxxxx XXX</code> part was added in the STATUS command update to warn players about the new venue, <code>Outro NYC</code>, which opened in the same place as the Cafe Bene had been located. The livedrop was intended to occur at 7PM EST (00:00 UTC). However, the first player from the community who set out for the drop was involved in a traffic mishap, delaying their arrival. Anticipating missing the drop's time window, the community reached out to request a time extension, and the STATUS command, which had updated frequently throughout the confusion, was updated again to approve the community's request.<br />
<mapframe text="Outro NYC" width=400 height=350 zoom=14 latitude=40.7328 longitude=-73.9909><br />
{<br />
"type": "FeatureCollection",<br />
"features": [<br />
{<br />
"type": "Feature",<br />
"properties": {<br />
"marker-color": "#0f0fee",<br />
"marker-size": "medium",<br />
"marker-symbol": "cafe"<br />
},<br />
"geometry": {<br />
"type": "Point",<br />
"coordinates": [<br />
-73.99094313383102,<br />
40.73275683797643<br />
]<br />
}<br />
}<br />
]<br />
}<br />
</mapframe><br />
<pre><br />
STAND BY: CSD CITIZEN NOT DETECTED<br />
WARNING: CSD CITIZEN NOT DETECTED!<br />
IT'S LONELY OUT HERE<br />
TIME EXTENSION REQUESTED?<br />
EXTENTION PROPOSED: 2H30 – AWAITING CSD APPROVAL<br />
EXTENSION APPROVED, BE SAFE<br />
</pre><br />
<br />
[[File:bookwt.png|thumb|left|Book case seen on the livedrop livestream is the same as one used in an earlier livedrop.]]<br />
<br />
After the extension was approved, a second player from the community set out to the livedrop location [https://youtu.be/Gvng4pAuxY8 on livestream] and met with their A&S contact around 7:30PM EST (00:30 UTC). During the meeting, the player was handed [https://drive.google.com/file/d/1kAjH2njXiab3u24VkcY-69IvOabhytGv/view a memo] from a mysterious case disguised as a book, pictured left. After some cryptic conversation, the contact asked if they were "getting enough sleep", stating that being well-rested would be very important. After the meeting, players who had attended the livedrop met in another location and showed off the memo, speculating about it's contents and even discovering the REM Sleep connection to the letters on the memo's back. After the livedrop, the community used the livestream to look over the memo, pictured below. On the back of the memo <code>REMS</code> is written. This clue, in combination with the strange question A&S asked at the rendezvous, led players to the password for the 10th Glyph, <code>REM SLEEP</code>.<br />
<br />
<gallery mode="packed-hover" widths=240px heights=240px><br />
image:memo1.png|Memo page 1<br />
image:memo2.png|Memo page 2<br />
image:memo3.png|Memo page 3<br />
</gallery><br />
<br />
[[File:form7.png|thumb|right|Seventh question revealed on the [https://atlas13.typeform.com/to/VF6CpG bit.ly form] when REMS or REM Sleep is entered for question six]]<br />
<br />
Once the glyph was solved, the STATUS command updated to [https://atlas13.typeform.com/to/VF6CpG a bit.ly link to a form]. Players discovered that on the sixth question on the form, entering REMS or REM Sleep (case sensitive) caused a seventh question, pictured right, to reveal itself, allowing CSD users to enter their email address to receive "left over materials" from something called Lab 319. Players remained unclear on what exactly Lab 319 was or what it's leftovers were, however signing up seemed integral given the input is only revealed after using the REM Sleep phrase.<br />
<br />
=Myriad Back Online=<br />
On 26 March, 2018 at 05:25 UTC an event occurred. The [http://www.myriad-70.com Myriad] site came back online after having been offline since the end of Phase 3. The site featured indications of a solar event interfering with operations. In addition, the status command on [http://wakingtitan.com Waking Titan] briefly displayed the following:<br />
<pre><br />
CODE -3<br />
Unable to restart<br />
.................<br />
ERROR LOG SUMMARY<br />
- Major malfunction<br />
- Protect the monarch<br />
- All tiers 2 and tiers 3 clients must be purged IMMEDIATELY<br />
.................<br />
TO ALL CSD<br />
- Gather maximum EXTERNAL intel<br />
- CSD should take time to regroup and get organized<br />
</pre><br />
<br />
Ten minutes elapsed before the Status command began to display the following:<br />
<pre><br />
CODE -5<br />
System Locked<br />
e b 4 c 1 4 a 9 c 6 2 2 d f 7 1 6 6 f b e 0 d d 8 9 1 5 d b 0 2<br />
</pre><br />
<br />
This hexadecimal string was used to reference a connection the private key for an Ethereum cryptocurrency wallet related to an ostensibly "promotional" event for an upcoming product from [http://ware-tech.cloud/ W/ARE].<br />
<br />
=Client 3597b=<br />
<br />
At 01:11 UTC, Myriad-70.com updated, and the updates included the following.<br />
<br />
<pre><br />
Latest network diagnostic table:<br />
- Network corruption detected<br />
- Situation isolated to Client 3597b<br />
- Process cannot be suspended due to critical conditions<br />
--------------------------<br />
-Beijing: 29.1Tb/s<br />
--------------------------<br />
MAJOR ISSUES:<br />
Client 3597b<br />
</pre><br />
<br />
<br />
Soon after, at 01:30 UTC, the Status command updated in the Terminal to say the following.<br />
<br />
<pre><br />
> status<br />
CODE -5<br />
System Locked<br />
e b 4 c 1 4 a 9 c 6 2 2 d f 7 1 6 6 f b e 0 d d 8 9 1 5 d b 0 2<br />
--------------<br />
Monarch Repository Status: Degraded<br />
Conflict With<br />
- Client 18d1a TRACERT 10.30.74.*<br />
- Client 3597b TRACERT 54.91.155.*<br />
- Client 351h TRACERT 6.128.214.*<br />
- Client 0911a TRACERT 74.1.21.*<br />
</pre><br />
<br />
Approximately 15 minutes later, clients began to disconnect, beginning with Client 0911a, second being Client 18d1a, and the last being Client 351h, who had an additional piece of text added, being <code>ID: 79657321</code>, which was translated as hex into <code> Yes! </code> <br />
<br />
Then, at 02:15 UTC, the status command was updated again, stating <code> - Client 3597b - UNABLE TO DISCONNECT 54.91.155.209 NAT 52.2.248.*</code><br />
<br />
At 13:38 UTC, the status command updated once again, stating <code> - Client 3597b - UNABLE TO DISCONNECT 54.91.155.209 NAT 52.2.248.*:80\\</code><br />
<br />
At 22:30 UTC, March 30, the status updated again to say<br />
<pre><br />
Latest network diagnostic table:<br />
- Client 3597b is beyond allocated limits<br />
- Process cannot be suspended due to critical conditions<br />
- Tier 1, 2 and 3 clients are now all offline<br />
</pre><br />
<br />
=Ware-tech.cloud=<br />
Of the sites found in the 52.2.248 range, [http://52.2.248.6 52.2.248.6] was found. Using the metadata found in the HTML and searching on Google, the [http://www.ware-tech.clouddomain] and [http://twitter.com/warecloud Twitter] were located as well. The site is in Chinese, although Google Translate gives a good, readable translation. <br />
<br />
On Twitter, under the Shipping Soon image, is a Hex string <code>77 61 6E 74 20 74 6F 20 6B 6E 6F 77 20 6D 6F 72 65</code> that, when converted to ascii reads <code>want to know more</code>. Under the #waretech hashtag on Twitter, there are three images shared by "Partner Companies" with the following code (and the ascii conversion):<br />
<br />
<pre><br />
62 69 74 2E = bit.<br />
6C 79 2F 77 = ly/w<br />
61 72 65 32 = are2<br />
</pre><br />
<br />
On the ware-tech website, if you subscribe, you receive an email with another 3 characters: <code>30 31 38</code>, which again in Ascii becomes <code>018</code>. Together this gave a bit.ly link that leads to the W/are Discord channel.<br />
<br />
Discord users were informed of a community puzzle that was going on by the admin. Members of the W/ARE Discord had received tweets from another account, [https://twitter.com/w9rPQ45E https://twitter.com/w9rPQ45E], which had seven tweets with hex code in them:<br />
<pre><br />
01 [ 74 78 2f 30 78 66 65 30 31 35 30 66 ] <br />
02 [ 62 33 30 32 61 38 62 36 64 34 30 38 ]<br />
03 [ 35 37 32 32 64 61 61 31 64 30 37 37 35 ]<br />
04 [ 38 33 31 38 35 30 38 36 39 31 30 61 31 ]<br />
05 [ 61 38 32 34 38 63 65 32 34 38 30 64 ]<br />
06 [ 32 65 33 38 37 33 31 ]<br />
07 - Signal Lost [ 65 6e 64 20 6f 66 20 6c 69 6e 65 ]<br />
</pre><br />
<br />
Translated into Ascii, these tweets give the following:<br />
<pre><br />
tx/0xfe0150f<br />
b302a8b6d408<br />
5722daa1d0775<br />
83185086910a1<br />
a8248ce2480d<br />
2e38731<br />
</pre><br />
which references [https://etherscan.io/tx/0xfe0150fb302a8b6d4085722daa1d077583185086910a1a8248ce2480d2e38731 this Ethereum transaction]. The Twitter username, w9rPQ45E is also [http://pastebin.com/w9rPQ45E a Pastebin], providing the string <code>edb044c81d40a196c4672a2bd6f17f1f6</code>. In the Ethereum transaction, there is Input Data that, when converted to ascii, links to [http://pastebin.com/HNqKEUpS another Pastebin], providing another string: <code>b67fbb5e90ddcda8a921656d0b30a20</code><br />
<br />
Two things have been done with these strings. Together, they are the Private Key for the Ethereum account the money was transferred to. It has since been withdrawn to a different account. Second, if you put the two strings together and compare them with the string from Waking Titan's console, every odd character matches the strings from Pastebin.<br />
<code>edb044c81d40a196c4672a2bd6f17f1f6b67fbb5e90ddcda8a921656d0b30a20</code><br />
<br />
<code>e b 4 c 1 4 a 9 c 6 2 2 d f 7 1 6 6 f b e 0 d d 8 9 1 5 d b 0 2&nbsp;</code><br />
The remaining characters are <code>d0 48 d0 16 47 ab 61 ff b7 b5 9d ca a2 66 03 a0</code>, however if this has any use is yet to be seen.<br />
<br />
Three hours after the W/ARE Discord Admin let the community know about the puzzle, at 6:01 PM UTC they returned and said<br />
<pre>That was it for today, good job on solving our community puzzle! You are good! :smiley:<br />
Tomorrow one of our partners will have a giveaway for us! We will have more for you this weekend also!</pre><br />
<br />
=Mercury Project=<br />
[[File:Sean-tweet.png|thumb|right]]<br />
[[File:NMSNext.png|thumb|The announcement for No Man's Sky: NEXT]]<br />
At 21:26 UTC, the <code> Mercury </code> command updated to say the following.<br />
<br />
<pre><br />
Mercury process > Build XXXX<br />
Ready to load branch version 1.5<br />
Send Password Code in HEX to : Telegram MercuryHG80<br />
</pre><br />
<br />
This puzzle required a user to solve the riddle shown below, convert the answer into hexdecimal, and send it to an official Telegram account run by one of the Puppet Masters.<br />
<br />
The puzzle involved a riddle that was discovered in a [https://twitter.com/warecloud/status/979103811489984513 Pastebin on W/ARE's twitter]. It went as follows: <code> “Descended from Night, I share the blood of nightmares. Look forward to the gates of horn and ivory” </code><br />
<br />
This puzzle was solved by searching "The gates of horn and ivory", which resulted in dreams and nightmares of Greek mythology. After noting the capital N in "nightmares", users found the Greek god of night, Nyx, which led to one of her children, Morpheus, who was one of the Oneiroi, and the god of dreams. The name was then converted to hexdecimal and sent to the Telegram account, and the terminal accepted the password, resulting in the following command update.<br />
<br />
<pre><br />
Processing "Morpheus" > ACCESS GRANTED<br />
Downloading.......<br />
</pre><br />
<br />
Then, at 09:54 UTC, the Mercury command updated again, and said the following.<br />
<pre><br />
<Mercury process > Build XXXX<br />
Ready to load branch version 1.5<br />
Send Password Code in HEX to : Telegram MercuryHG80<br />
--------------------------------<br />
Process started by community - ETA 11:00 BST<br />
https://bit.ly/2pLmadg<br />
</pre><br />
<br />
The shortened link redirected to a tweet from Sean Murray, which said <code> The cause is hidden. The effect is visible to all. #oneonebst </code><br />
<br />
The tweet also included a photo of someone, presumably Sean himself, holding a phone receiving a Telegram notification, which was Morpheus in hexdecimal. The hashtag spells out 11BST, or more precisely, 11:00 BST, or, 10:00 UTC. No updates were made at 10:00 PM, and was then confirmed to be counting to 10:00 AM.<br />
<br />
Roughly half an hour before the timer was up, at 9:26 AM UTC, Sean Murray announced on [https://twitter.com/NoMansSky/status/979288744791592960 Twitter] that he had a small announcement to make, and was going to post it early as it was about to leak.<br />
<br />
Shortly after, at 09:50 UTC, Hello Games announced the next update for No Man's Sky, which was No Man's Sky NEXT, set with a launch date for Summer of 2018.<br />
<br />
=Newsletter=<br />
[[File:WareNewsletter1.png|thumb|left|120px|Screenshot of the W/ARE newsletter]]<br />
On April 2 at around 23:30 UTC, user W/ARE came online in the W/ARE Discord to announce that the next giveaway would be sent out in a newsletter within the next hour.<br />
They also mentioned the upcoming launch of their new translated English website, new extranet and the release of a "WARE cryptocoin", and asked users who are planning to be at PAX East to let them know at info@ware-tech.cloud with "PAX EAST - YES!" in the subject line.<br />
<br />
At 00:30 UTC the newsletter started coming in via email. It announced that 25 winners were selected to receive Steam keys for games from W/ARE partners, such as The Shrouded Isle and Future Unfolding.<br />
It also included a [https://ware2.typeform.com/to/HuBpCP link to an Application Form] for indie developers to apply for a Developer Kit of W/ARE tech. The best applications will be up for a public community vote to decide which games will be launched on the W/ARE platform.<br />
<br />
Around the same time, the Status command in the Terminal updated to say the following:<br />
<br />
<pre><br />
> status<br />
CODE -5<br />
Monarch Repository : Data Loss Imminent<br />
Booting up Command.Center.v11<br />
Pending approval by Monarch<br />
</pre><br />
<br />
=PAX East Weekend=<br />
==Website update==<br />
On April 6, 2018 at 18:00 UTC the [https://ware-tech.cloud/ W/ARE website] updated with the new English translation and access to a Developer Area containing a sign-in form.<br />
<br />
==Status command==<br />
On April 8 at 01:19, the Status command updated with the following output:<br />
<br />
<pre><br />
CODE -5<br />
Monarch Repository : Data Loss Imminent<br />
Booting up Command.Center.v11<br />
Pending approval by Monarch<br />
Error - Unable to connect with repository<br />
Memory Dump 2GzHGwu.jpg<br />
</pre><br />
<br />
The filename leads to a [https://i.imgur.com/2GzHGwu.jpg corrupted image hosted on imgur], depicting a partial area map, a satellite, and the word "MYRIAD".<br />
<br />
==Live Drop==<br />
On April 8 around 00:49 UTC, players who previously sent emails to W/ARE about attending PAX East received the following response:<br />
<br />
<pre><br />
Hello! We’ve heard from some attendees that our booth at PAX East is very difficult to find this year. To help you find the booth, we’ve enlisted the help of an Enforcer. Here is the information that our team at PAX has sent us to help you locate them:<br />
<br />
HANDLE: EMU<br />
PATH:<br />
START<br />
-997E<br />
-1E<br />
-1000E<br />
+4S<br />
+1000W<br />
+1W<br />
+1000W<br />
-7N<br />
REPEAT<br />
<br />
You should be able to find them on their path between 12PM and 3PM local time.<br />
<br />
- WARE<br />
</pre><br />
<br />
The path of EMU was determined by searching for a specific range of clustered booth numbers on the floor plan. Assuming Down is East, starting at booth 17102 and subtracting 997 from that number gives us 16105, which is to the East directly next to booth 17102. Continuing this with the rest of the coordinates:<br />
<br />
<pre><br />
17102 - 997E = 16105 - 1E = 16104 - 1000E = 15104 + 4S = 15108 + 1000W = 16108 + 1W = 16109 + 1000W = 17109 - 7N = 17102 (repeat)<br />
</pre><br />
<br />
Ultimately creates this path between the eight booths:<br /><br />
<br />
<center>[[File:Emu_path.png|frameless|The path of EMU]]</center><br />
<br />
<br />
Several agents met with the contact between 16:00 and 19:00 PM UTC and were given a total of four USB drives. Each drive contained an image and a text file.<br />
<center><gallery><br />
1-4.jpg|(ea87d58e-5775-47a9-a201-b7c7007f46d1.jpg)<br />
2-4.jpg|(580cdc97-3e01-4902-83d6-7bc9e764dda2.jpg)<br />
3-4.jpg|(e34d6e93-98f2-45a5-9899-694f93317e0b.jpg)<br />
4-4.jpg|(f395ef03-f19c-4cb3-bc9c-5f80695ce7eb.jpg)<br />
</gallery></center><br />
[[File:Jumbledwordsoverlay.jpg|thumb|200px|USB drive images overlayed]]<br />
{| class="wikitable" border="1"<br />
|-<br />
! 1-4.txt<br />
! 2-4.txt<br />
! 3-4.txt<br />
! 4-4.txt<br />
|-<br />
| A cornucopia of knowledge is in the mind of mankind, but it must be nurtured and hidden from the wrath of time. Time swallows all things, ends all beginnings, and leaves each of us devoured.<br />
<br />
- arnaud@philojeux.com<br />
| A mind invisible is buried underground, but a mind of water carries no patterns. It is the mind, the wrist pointed to heaven, which allows us to dream. It is this hand on high that cast down our demons to the earth.<br />
<br />
- arnaud@philojeux.com<br />
| Slumber in prison for eternity, lock away every great thing, but the spirit cannot be broken. A voice like ages rocks the very ground and with it’s call a rise to action of every terror.<br />
<br />
- arnaud@philojeux.com<br />
| Of chaos swirls a terrible nothing, but pulled together without reason is reason born from chaos. A single note, another still, a symphony is creation where each piece follows the last no matter how the thread dances.<br />
<br />
- arnaud@philojeux.com<br />
|}<br />
<br />
The email address led to [http://www.philojeux.com/ philojeux.com], a website for a French indie game studio named Philo Jeux. Founded by Arnaud Lacours, it works on the philosophy-based game <code>Les tablettes de Mnémosyne</code> which was to be released on the WARE platform in July 2018.<br />
<br />
Overlaying all four images highlighted the letters <code>f1orbiag55z1</code>. Using this as the password for the login form on [http://extranet.ware-tech.cloud/ extranet.ware-tech.cloud] and combining it with the email address from the text files as the username granted access to Arnaud Lacours' account for the Developer Area. <br />
<br />
== WARE Developer Area ==<br />
[[File:Arnaud_Profile.png|thumb|400px|Arnaud Lacours' WARE Developer Profile]]<br />
Upon first access after the PAX event, the [http://extranet.ware-tech.cloud/ area] accessed using the credentials <code>arnaud@philojeux.com / f1orbiag55z1</code> contained a main page, a developer profile page and multiple inaccessible pages. The main page presented an overview of user statistics and an empty main [https://etherscan.io/token/0x5b758a02d08efa566f3438775888866afd5d046c WARE token] wallet. Alongside the empty wallet were 12 wallets labelled Alpha-Lima in the NATO Phonetic alphabet, each containing 256 WARE. The [http://extranet.ware-tech.cloud/documents Documents] and [http://extranet.ware-tech.cloud/taskmanager Task Manager] pages were inaccessible due to Arnaud Lacours' account having an insufficient clearance level. The [http://extranet.ware-tech.cloud/supplyrequest Request Supplies] page was inaccessible due to insufficient funds (where funds are probably WARE tokens). Accessing the [http://extranet.ware-tech.cloud/profile developer profile page] while authenticated as Arnaud Lacours showed their information; including a phone number: <code>(514) 448-1493</code>. When this number was originally called, it led to a [https://clyp.it/p1lbsf3e voicemail message] in French, translated to English it said:<br />
<pre><br />
Hi, I'm Arnaud Lacours, the CEO and founder of Philo Jeux. I'm not here at the moment. Please give me your contact details and I will call you back later. Thanks a lot, bye.<br />
Voicemail System: Sorry, this voicemail is full. Please try again later. Thank you for calling, goodbye.<br />
</pre><br />
On the 14th April at around 02:00 UTC, it was noted that the [https://clyp.it/cwdz4qxg voicemail message changed.] Again, the message was in French, roughly translating to:<br />
<pre><br />
I'm Arnaud's girlfriend, thanks a lot for your wishes. Unfortunately Arnaud's condition got worse and he can't call you back and for now the company is closed.<br />
</pre><br />
<br />
=Status & W/ARE Updates=<br />
On April 14 at 18:37 UTC, the value of the Status command updated:<br />
<pre>CODE -5<br />
Monarch Repository : Data Loss Imminent<br />
Booting up Command.Center.v11<br />
Pending approval by Monarch<br />
Rebooting...</pre><br />
<br />
<br />
At 19:51 UTC, players who had applied for a Developer Kit started receiving [https://mailchi.mp/062a86fa0c65/news-from-ware-1464925 emails with further details] on what kind of applications W/ARE were looking for. According to this email, the company had opened positions for five partnered studios, one of which would also receive a grand prize of $1,000 USD. The deadline for applications was April 28th.<br />
<br />
<br />
Then, at 20:38 UTC, the Status command updated again with the following output:<br />
<pre>CODE -5<br />
Monarch Repository : Data Loss Imminent<br />
Booting up Command.Center.v11<br />
Pending approval by Monarch<br />
Error- Unable to connect with repository<br />
WARNING- MEMORY DUMP FAILED!<br />
Biometric backup initiated…<br />
http://bit.ly/2ITvMcW</pre><br />
<br />
The [http://bit.ly/2ITvMcW link] led to a recording of a female voice reading out a string of words:<br />
<pre>Drunken - Disable - Geiger - Everyday - Hockey - Determine - Endow - Coherence - Freedom - Guitarist - Framework</pre><br />
[[File:Myriad_Interface_Distort.jpg|thumb|A still frame of the gif]]<br />
These are words from a [https://en.wikipedia.org/wiki/PGP_word_list PGP Word List], also known as a '''Biometric''' Word List, as hinted at in the Status text. Each word corresponds to a hex value:<br />
<pre>51 4B 6A 58 73 47 59 2E 67 69 66</pre><br />
<br />
When converted to ASCII this reads <code>QKjXsGY.gif</code>, which was the filename of an [https://i.imgur.com/QKjXsGY.gif animated gif on Imgur].<br />
<br />
=Regular Statistics Updates=<br />
On April 15, 2018 at 22:26 UTC, the [https://extranet.ware-tech.cloud/ Developer Dashboard] received an update to its Weekly Statistics, specifically the Total Sessions and Total Users counter. Another update followed at 13:19 the next day, after which the numbers continued to be updated 37 times over the next two days, once every hour at the 37th minute. The final update was recorded on April 18 at 1:37, 51 hours and 11 minutes after the very first update, and 36 hours after the first update at minute 37.<br />
<br />
Another phase of continuous updates to the Statistics overview started on April 19 at 02:37, this time at 30 minute intervals.<br />
<br />
A record of all value changes can be found [https://docs.google.com/spreadsheets/d/1A8zODah54JUhO6ClFs8wNVvKLpLzWwm04lzOlS9mmAU/edit?usp=sharing here].<br />
<br />
<br />
=Dev Kit Update #2=<br />
On the 21st, at 16:17 UTC, all users subscribed to the W/ARE mailing list received a second Developer Kit Update.<br />
<br />
The update mentioned that the W/ARE team was working on a new test protocol for the headset that was expected to provide a 60% boost in power to the headset. It was also said that players would learn within a few weeks.<br />
<br />
The update also featured 3 submitted projects so far, which are as follows:<br />
<br />
*[https://www.youtube.com/watch?v=1c_682fRL8w DreamScape], a "user defined MMO where players can create their own worlds as they sleep", created by [http://www.edgewaregames.co.uk EdgeWare Games]<br />
<br />
*[https://www.youtube.com/watch?v=pBRZxVZ5KKs Venture Unknown], a supposed "spiritual successor to No Man's Sky", made by [https://www.cjkproduction.com/ventureunknown CJK Production]<br />
<br />
*[https://www.youtube.com/watch?v=qBxlref67wU The Drowned Tower], a "post-apocalyptic exploration game set in a dream-like world", made by [https://oceansmoke.wordpress.com OceanSmoke Games].<br />
<br />
It was found that these three projects were all player created, and have no official affiliation or information involving the Waking Titan ARG.<br />
<br />
=April 27-29th Access Grants=<br />
At 19:11 UTC on April 27, [http://extranet.ware-tech.cloud/documents the Documents portion] of the W/ARE extranet site, along with [http://extranet.ware-tech.cloud/taskmanager the Task Manager section] were unlocked. This started a series of tasks. Each new task was unlocked when funds were successfully transferred out of one of the developer sub-wallets. The wallet keys were received by sending the correct solution to the current task to <code>warelearn@ware-mail.cloud</code>.<br />
<br />
Under the introduction category, the link titled <code>2018 03 03</code> led to a corrupted image of what was discovered to be St. Basil's Cathedral in Moscow, Russia. [[File:Basil.jpg|thumb|200px|The corrupted image of St. Basil's Cathedral.]]<br />
There were also two other images of interest, titled <code>Notes-on-locations-1_ldf82ng0.png</code> and <code>Notes-on-locations-2_pisj84n91.png</code><br />
Combined together, the contents of these 2 images read the following.<br />
<pre><br />
1. THE MIDDLE OF THE INVERTED PENDULUM COULD FEED THE MOST LOGICAL MINDS<br />
<br />
2. ITS SHAPE WILL LIGHT THE SPARK OF CREATIVITY<br />
<br />
(049245)<br />
<br />
3. IMPOSING SURROUNDINGS HELP IDEAS TO BE TAKEN SERIOUSLY<br />
<br />
4. SURROUNDED BY WATER,<br />
EXHALING SERENITY<br />
<br />
(AT THE JUNCTiON<br />
BY THE LAKE)<br />
</pre><br />
[[File:Train_Ticket.jpg|thumb|Mr. Zheng's Manchurian Railway Ticket]]<br />
Another image was also found, entitled "Train ticket". It contains an image of a train and Cyrillic script that translates to "Manchurian Railway Ticket", "Moscow - Beijing" dated March 5, 2018.<br />
<br />
==Alpha==<br />
The Task Manager section revealed the first "Task" given to W/ARE employees, titled "Missing Employee", and that it was in progress. There was one description of what had happened, along with two update messages.<br />
<br />
The original description read the following.<br />
<br />
<pre><br />
IMPORTANT MESSAGE FROM WARE RESEARCH AND DEVELOPMENT TEAM. Attention to all developers. One of our colleagues, Mr. Zheng, has gone missing a month ago while on a R&D tour. Serious investigation inside the department has lead to nothing of interest, and we’re now asking for outside help. Please send any information concerning his potential whereabouts to warelearn@ware-mail.cloud.</pre><br />
<br />
The first and second update were as follows:<br />
<br />
Update 1:<br />
<pre><br />
All recent and potentially relevant documents found on Mr. Zheng’s computer have been translated and forwarded to the developer extranet. Our team is currently trying to use this information to retrace his last steps. We’re hoping that our combined efforts can bring light to this affair and bring Mr.Zheng back home safely. In the hope of attaining maximum reach and visibility, the R&D department also set up a Twitter account to serve as another relay of information.</pre><br />
(The twitter account in mention is [https://twitter.com/WARE_RDev @Ware_RDev])<br />
<br />
Update 2:<br />
<pre><br />
UPDATE ON R&D SEARCH. All information of interest sent to warelearn@ware-mail.cloud will be rewarded with codes to our exclusive WARE wallets which can be used for special package purchases.<br />
</pre><br />
<br />
Sending an email containing the keyword "Moscow" to warelearn@ware-mail.cloud caused them to send the following reply, including a link to a map of Beijing's subway for a planned 7th conference: [[File:Conference_7_Possible_locations.png|thumb|Possible locations for Conference 7]]<br />
<pre><br />
The WARE Research and Development team thanks you for your interest in the WARELearn initiative. The Russian Academy of Medical Science in Moscow’s conference on Art and Dreams is the last of a series of six conferences we hope will enlighten your mind. The WARE Team will review your application and get back to you as soon as possible!<br />
<br />
Feedback from employees is fundamental in the development of the WARELearn initiative. As such, we’re asking you to give us your opinion on the ideal location for our next conference. If the location you picked is chosen by our committee, you may be given the chance to attend and meet the promoters of the event.<br />
<br />
Our team has begun to pinpoint buildings that could be of interest. Feel free to inspire yourself and contact warelearn@ware-mail.cloud to let us know about your suggestion.<br />
<br />
Kind regards,<br />
The WARELearn initiative<br />
</pre><br />
<br />
Sending an email containing all the keywords "Moscow," "Beijing," and "049245" (from Notes on locations 1) triggered another response, this time containing the ALPHA sub-wallet key:<br />
[[File:Sub-wallets.jpg|thumb|Empty sub-wallets]]<pre><br />
Dear informer,<br />
<br />
To thank you for your recent help in Mr. Zheng’s case, WARE has provided you with a code to use on our internal cryptocurrency wallets. We promise that every significant clue provided to us will be rewarded as such.<br />
<br />
Claim your reward with this code and stay alert for further updates on the situation : 4e47e152a5afaf95537c5dba73ef73d45c11fd6743ff5db9bfea3eca9282fda<br />
<br />
Please withdraw the funds so that the main wallet can be updated. Note the updating process is not immediate.<br />
<br />
Kind regards,<br />
<br />
The R&D Team</pre><br />
The funds were withdrawn from the cryptocoin wallet, which led to an update to the Weekly Statistics page, where sub-wallet ALPHA was now displayed as empty.<br />
<br />
==Beta==<br />
A new message in the Task Manager followed:<br />
<pre><br />
Most recent informations linked to the WARELearn services has confirmed our suspicions that despite boarding his train in Moscow, Mr. Zheng never arrived at Beijing and seems to have abandoned the train along the route. Any information, as small as a postal code, that you can find about the possible location locations he may have visited for an extended period - such as a hotel or hostel - would be of tremendous help.<br />
</pre><br />
<br />
Using a map of the Trans-Manchurian Train route and the 4 hints from the Document files, players concluded that Mr. Zheng left the train in <code>Gostinyy Dom Chita, 672040</code>. Sending this information to the email address yielded another wallet key. Players were able to withdraw these funds from a cryptocurrency wallet, emptying sub-wallet BETA.<br />
<br />
The following update was posted in the Task Manager:<br />
<pre><br />
Thanks to dedicated informers, the investigation on Mr. Zheng is progressing and the tasks have been updated. We’ve been able to confirm that a stop was indeed made in Chita, after attending the Moscow conference on Art and Dreams. Please send any information concerning his potential whereabouts to warelearn@ware-mail.cloud, in addition to the updated task number.<br />
</pre><br />
<br />
==Charlie==<br />
A journal entry and a page of notes both written by Mr. Zheng were unlocked in the Documents section, along with an update in the Task Manager:<br />
<center><gallery><br />
Journal_Academy.png|(Mr. Zheng's Journal)<br />
Notes_on_Moscow.jpg|(Mr. Zheng's notes on Moscow)<br />
</gallery></center><br />
<br />
<pre><br />
Attention to all teams. Documentation (copies and originals) coming from a source close to the missing employee have been recovered by W/ARE. There are a lot of files to organize and our database employees are still trying to get everything in order. Any information that could help us make sense of them will be most welcome.<br />
</pre><br />
<br />
The image of "Notes on Moscow" contains 3 blanks and descriptions of 3 paintings. The blanks can be filled in with the subjects of the paintings. Sending these keywords, in addition to the updated task number - <code>a1028f, Montreal, 1.30pm. Meet me at the fountain in front of the Notre Dame Basilica.</code> - to the email, yielded the next wallet key. Again, players withdrew the funds from the wallet, emptying sub-wallet CHARLIE.<br />
<br />
==Delta - Montreal Live Drop==<br />
The Task Manager updated with an announcement of a live drop: [[File:Live_Drop_Montreal.jpg|thumb|200px|The note received at the Live Drop in Montreal]]<br />
<mapframe text="Place d'Armes" width=350 height=350 zoom=14 latitude=45.504722 longitude=-73.557222 align=left><br />
{<br />
"type": "FeatureCollection",<br />
"features": [<br />
{<br />
"type": "Feature",<br />
"properties": {<br />
"marker-color": "#7e7e7e",<br />
"marker-size": "medium",<br />
"marker-symbol": "square-stroked"<br />
},<br />
"geometry": {<br />
"type": "Point",<br />
"coordinates": [<br />
-73.55727553367613,<br />
45.504820504538785<br />
]<br />
}<br />
}<br />
]<br />
}<br />
</mapframe><br />
<pre><br />
Deploying a team for possible package seizure.<br />
<br />
Once the location will be secured and package examined, onsite examination will be possible.<br />
<br />
WARE will not allow package to leave location. Taking pictures will be permitted.<br />
<br />
Confirmation of Location: Place d’Armes, Montreal, In front of the fountain<br />
<br />
Confirmation of Time: Between 7pm and 9pm, local time<br />
</pre><br />
<br />
At the drop location, players received the following note: <code>I came two years after the Ursuline nuns. Now set in stone, here is my legacy. G. Nadeau</code><br />
<br />
Investigations led to the French nurse Jeanne Mance, who arrived in New France two years after the Ursuline nuns came to Quebec and established Montreal's first hospital in 1642, the <code>Hôtel-Dieu de Montréal</code>. She is memorialized in statue at the foot of the Maisonneuve Monument. Sending this information to the email unlocked the next wallet key, and the withdrawal of the funds emptied sub-wallet DELTA.<br />
<br />
==Echo==<br />
[[File:Journal_HotelDieu.png|200px|thumb|Journal Hotel Dieu]] On April 28 at 02:32, a new journal page was unlocked that highlighted two circled notes, <code>DON'T FORGET TO MOVE NOTES ON THE MEETING TO THE CLOUD</code> and <code>SECULAR VADER OF THE BIBLE</code>.<br />
<br />
The new Task Manager update read:<br />
<pre><br />
The search to find Mr. Zheng is still ongoing. New information is now connecting him to Montreal’s Hotel Dieu. Please send any information concerning his potential whereabouts to warelearn@ware-mail.cloud, in addition to an updated task number [t1029r].<br />
<br />
We’ve tried to access Mr. Zheng's files in the R&D dropbox, but all access has been blocked.<br />
</pre><br />
It contained a link to Mr. Zheng's password-locked [https://www.dropbox.com/sh/jz2nbdawcphki04/AACA83rODlh8qN4vuayLfgRya?dl=0 Dropbox]. Players determined the correct password was <code>Gutenberg</code>, who produced the first printed Bible.<br />
<br />
The Dropbox contained 4 pdf files with printable hexaflexagon patterns. When folded, one of the sides on each hexaflexagon yielded a 13-digit number starting with 978. These were ISBN numbers for the following 3 books: <code>Nine Billion Names of God</code>, <code>The Paris Architect</code>, and <code>War and Peace</code>. Using the leftover numbers from each flexagon as a book cipher of the format page, line, and word, the phrase <code>unknown british soldier</code> was found. This points to the <code>Tomb of the Unknown Soldier</code>, which was the keyword to obtain the wallet code for sub-wallet ECHO.<br />
<br />
==Foxtrot==<br />
When assembled and put together, the three hexaflexagons revealed a shape resembling the river Seine in Paris in the area of the Louvre. Sending <code>Louvre</code> to the email address provided the code for sub-wallet FOXTROT and revealed a new journal document. [[File:Journal_Louvre.png|thumb|200px|Journal Louvre]]<br />
<br />
On the journal page were 3 sentences, with certain words underlined. Ordering the words by the number of underlines and counting their position in each sentence resulted in the phone number <code>438-368-9126</code>. Upon calling this number a [https://clyp.it/bgakdxvc recorded message] gave a morse code that translated to <code>PASTEH9EBKEXGT</code>. This led to a [https://pastebin.com/H9EBKEXG Pastebin document] containing the following text:<br />
<br />
<pre><br />
From the bottom of the crypt, at the feet of the Guardian, I ascend left<br />
Pass the dignitary and follow the water<br />
Go straight to the sun with open arms and turn right<br />
Turn left when you arrive home<br />
Go straight to the hand and head of the goddess and turn left to face the keeper<br />
Follow the procession into the house of kings<br />
Ignore the light and descend to your death<br />
I am here and with me the seventh part of what you are searching for.<br />
</pre><br />
<br />
==Golf - Paris Live Drop==<br />
A new live drop was announced to be in Paris, France:<br />
<br />
<mapframe text="Passage du Souvenir" width=350 height=350 zoom=14 latitude=48.873611 longitude=2.296389 align=left><br />
{<br />
"type": "FeatureCollection",<br />
"features": [<br />
{<br />
"type": "Feature",<br />
"properties": {<br />
"marker-color": "#008040",<br />
"marker-size": "medium",<br />
"marker-symbol": "entrance"<br />
},<br />
"geometry": {<br />
"type": "Point",<br />
"coordinates": [<br />
2.2963866591453552,<br />
48.873548644370125<br />
]<br />
}<br />
}<br />
]<br />
}<br />
</mapframe><br />
<pre><br />
Deploying a team for possible package seizure.<br />
<br />
Once the location is secured and package examined, onsite examination will be possible.<br />
<br />
WARE will not allow package to leave the location. Taking pictures will be permitted.<br />
<br />
Confirmation of Location: At the entrance of the Passage du Souvenir, Near the stairs, Paris<br />
<br />
Confirmation of Time: Between 1pm and 3pm, local time<br />
</pre>[[File:Hexaflexagons river.jpg|thumb|The finished hexaflexagon map]]<br />
At the Tomb of the Unknown Soldier, a monument in the Passage du Souvenir beneath the Arc de Triomphe de l'Étoile in Paris, players were given another hexaflexagon paper puzzle and told not to un-tape it. When aligned with the other three pieces, this revealed a location marked with an X at the Louvre.<br />
<br />
The text from the Pastebin found in the Foxtrot stage were clues on the correct route to follow inside the Louvre. The rest of the path led players to the sarcophagus of Ramesses III, on the side of which they found a depiction of <code>The Book of Amduat</code>. Sending this to the email yielded the key to sub-wallet GOLF.<br />
<br />
==Hotel==<br />
The parchment in <code>The Book of Amduat</code> can be found in the <code>British Museum London</code>, which was the keyphrase that unlocked sub-wallet HOTEL.<br />
<br />
The next Task Manager and Document updates read: [[File:Journal_London.png|thumb|Journal London]]<br />
<pre><br />
Locked briefcase found in London, near the British Museum. Not yet confirmed if Mr. Zheng left it there willingly. Package currently under observation.<br />
</pre><br />
<pre><br />
They were right.<br />
It's all leading here.<br />
<br />
I saw it at night.<br />
i had it in my hands. All the missing parts. For the first time, I felt like all was finally put in place. Then, I felt a powerful force, ripping it from my hands. I dropped it and all the pages flew away in the wind.<br />
<br />
I remember the morning that came after.<br />
I was standing tall, pointing at the former naval person, longing for all this knowledge that got away.<br />
<br />
I need to find its missing pieces.<br />
</pre><br />
<br />
==India==<br />
The phrase <code>former naval person</code> is the signature Winston Churchill used in his private correspondence with President Roosevelt. The text describes standing tall pointing at him. This was deduced to be Big Ben, which faces the Churchill statue in Parliament Square, London. Sending <code>Big Ben</code> to the email address provided the key to withdraw the funds from sub-wallet INDIA.<br />
<br />
A third live drop was announced to be in London:<br />
<pre><br />
Deploying a team for possible package seizure.<br />
<br />
Once the location will be secured and package examined, onsite examination will be possible.<br />
<br />
WARE will not allow package to leave the location. Taking pictures will be permitted.<br />
<br />
Confirmation of Location: Statue of Winston Churchill, Parliament Square, London<br />
<br />
Confirmation of Time: Between 1pm and 3pm, local time<br />
</pre><br />
<br />
==Juliett - London Live Drop==<br />
[[File:Thinker.jpg|thumb|The Thinker sculpture in Detroit]]<br />
On April 29th at 13:00 local time, players met with a W/ARE technician in London and were given a scrambled picture of the "The Thinker" sculpture by Auguste Rodin, displayed at the Detroit Institute of Arts Museum. The keyphrase <code>Henry Fuseli, The Nightmare, 1781</code>, a painting found at the same museum, provided the code for sub-wallet JULIETT.<br />
<br />
This unlocked three new postcards in the Documents section.<br />
<center><gallery><br />
Postcard1 jhlj039u.jpg |(Postcard 1)<br />
Postcard2_kg8nao6.jpg|(Postcard 2)<br />
Postcard3_tesaud636.jpg|(Postcard 3)<br />
</gallery></center><br />
<br />
==Kilo==<br />
The locations pictured on the postcards were in Mexico, Peru, and Morocco. Each postcard mentioned two numbers and two cardinal directions, and combining these led to a string of coordinates: <code>33N, 43E - 30N, 69E - 22N, 79E</code>, which were found to be in Iraq, Pakistan, and India. Connecting these six locations by lines pointed to Egypt.<br />
<br />
The circled letters on the postcards spelled <code>monastery</code>, <code>king</code>, and <code>tonw</code>. Using these clues, players found <code>Deir el-Medina</code>, an Egyptian village whose name translates to "monastery of the kings". The village's name unlocked sub-wallet KILO.<br />
<br />
At 2:38 PM a new Journal page was revealed:[[File:Nightmare.jpg|thumb|Nightmare journal page]]<br />
<pre><br />
'Alights, and grinning<br />
<br />
I saw it again.<br />
<br />
Except this time, what snatched it from my hands was not a divine force but the unmistakable pull of this stippled incubus.<br />
<br />
'Alights, and grinning<br />
<br />
He glared at me,<br />
as he ripped all the pages before my horrified eyes.<br />
<br />
I felt his weight on my chest.<br />
<br />
xxxx?<br />
</pre><br />
It quotes excerpts from Ermasus Darwin's poem "Botanical Garden", which is an inscription found on the "The Nightmare" painting referenced in the JULIETT phase, engraved by Thomas Burke in 1783.<br />
<br />
Then, the next Task Manager update announced another live drop:<br />
<pre><br />
Briefcase found in London still locked but deemed safe by our experts. Once the location will be secured and package examined, onsite examination will be possible.<br />
<br />
WARE will not allow package to leave the location. Taking pictures will be permitted.<br />
<br />
Confirmation of Location: British Museum, London<br />
<br />
Estimated Time : Between 6pm and 8pm, local time<br />
</pre><br />
<br />
==Lima - 2nd London Live Drop==<br />
[[File:Box01.jpg|thumb|The locked box]]At the second live drop in London, players were given a small box locked with a 4-digit code. The key was <code>1783</code>, the year "The Nightmare" was engraved.<br />
<br />
Inside the box were three paper notes:<br />
<br />
<center><gallery><br />
Box02.jpg|(arbu = irbu, seru = saru)<br />
Box03.jpg|(Wolf = violent ennemy/Fox, the ennemy will not attack but will plot secretly)<br />
Box04.jpg|(Vomiting gold/silver = ten months, Golden trees/ghosts/demons = nine months)<br />
</gallery></center><br />
<br />
These notes reference ancient texts about dream interpretation. One of them is the Egyptian <code>Ramesside dream-book</code>, the code that unlocked sub-wallet LIMA.<br />
<br />
==Conclusion==<br />
[[File:Requestsupplies.jpg|thumb|The Request Supplies form]]At 17:18 the status command updated:<br />
<pre><br />
CODE -5<br />
Monarch Repository : Data Loss Imminent<br />
ReBooting Command.Center.v12<br />
</pre><br />
The [http://extranet.ware-tech.cloud/supplyrequest Request Supplies section] on the extranet was now accessible, revealing a "Specific Item Order Form". In addition to Arnaud Lacours' name, his employee ID <code>43617373696e69</code> was already filled in. Converted from HEX to ASCII this code translates to <code>Cassini</code>. Entering the ID into the console yields the following output:<br />
<pre><br />
LOG RECOVERED :: ITERATION #4924A ::<br />
The asteroid field was thick,<br />
denser than any I'd seen before.<br />
The ice, the dirt, the metal fragments…<br />
my ship never stood a chance.<br />
</pre><br />
[[File:Subject1.png|thumb|Subject1 image]]<br />
<br />
Another Status update followed at 17:33:<br />
<pre><br />
CODE -5<br />
Monarch Repository : Data Loss Imminent<br />
ReBooting Command.Center.v12<br />
------<br />
Error, unable to start<br />
https://i.imgur.com/Fnixw9t.png<br />
------<br />
New command updated<br />
</pre><br />
It linked to an image with the headline <code>SUBJECT1</code> and a section named <code>MEMORY FRAGMENTS</code>.<br />
<br />
The search for Mr. Zheng concluded with a message from the @WARE_RDev Twitter account:<br />
[[File:WARE_Tweet_Zheng.jpg|thumb|center|400px|WARE_RDev Tweet]]<br />
<br />
=Dev Kit Contest Final Stage=<br />
[[File:Voteemail01.jpg|thumb|150px|Dev Kit Contest email]]On May 4th, 2018 at 22:15 UTC, users subscribed to the W/ARE mailing list started receiving the next Developer Kit Update. It announced that 10 out of 682 submissions were selected as finalists to the contest, and the public community vote was opened at [http://devkit.ware-tech.cloud/ devkit.ware-tech.cloud]. The email also mentioned No Man's Sky as one of W/ARE's partnered games.<br />
<br />
<br />
The following six winners of the contest were announced via email on May 12th at 00:20:<br />
<br />
# [http://terraformed.austinmccarthy.com/ Summon Studios - Terraformed] and [https://stellar-software.cloud/ Stellar Software - Beyond the Stars]<br />
# [http://spectrumental.net Spectrumental Games - Supersensory]<br />
# [https://csd-games.com/ CSD Games - Tumbleweed]<br />
# [http://imperiuminteractive.com/ Imperium Interactive - Eden]<br />
# [https://gamedetectives.net/delve Game Detectives - Delve]<br />
<br />
=Update on Arnaud's Condition=<br />
On the 12th of May at 20:21 UTC, the status command was updated: <br />
<pre><br />
CODE -5 <br />
Command.Center.v12 crashed<br />
------ <br />
Global Network Scan started....<br />
Warning: Files locked by Monarch<br />
- dreamscape.exe<br />
- soundflex.exe<br />
- inyourmind.exe<br />
- Jeu_Capture_d_Ecran.jpg<br />
</pre><br />
One of the files "Jeu_Capture_d_Ecran.jpg" was then found an Arnaud's [http://www.philojeux.com/ site], a transcription of the image is as follows:<br />
<pre><br />
Dear "Tablettes de Mnémosyne" fans,<br />
<br />
A lot of you recently inquired about Arnaud's health and, as you endlessly supported him during the early development of Philojeux, we think it's fair for you to know what's going on. Arnaud has been very sick lately and his condition's decline lead to a loss of consciousness. He has been transported to urgent care at Montreal's Hotel-Dieu where his vital signs are being closely monitored. We hope you understand that the launch of "Tablettes de Mnémosyne" is indefinitely postponed.<br />
<br />
Please send all words of encouragement to Arnaud's family at fondationarnaudlacours@gmail.com<br />
</pre><br />
Upon emailing the address, the following response was received: <br />
<pre><br />
Thank you for reaching out to the Arnaud Lacours’ Foundation. All<br />
words of encouragement will be forwarded to Mr. Lacours’ family.<br />
<br />
<br />
Géraldine Nadeau<br />
Arnaud Lacours’ Foundation<br />
Hotel Dieu Hospital Research Institute<br />
438-368-9126<br />
</pre><br />
When the phone number was called, a [https://cdn.blacksite.games/waking-titan/foundation-message.mp3 voice mail] was played. A transcription of the voice mail is as follows: <br />
<pre><br />
You've reached Dr. Geraldine Nadeau, head of the Arnaud Lacours Foundation. Mr. Lacours' family thanks you for your support during these terrible events, and encourages you to always be cautious and critical in the face of the unknown. As Arnaud himself would say, "history comes from memory." You're invited to use the foundation's e-mail to share your words of encouragement with the family. Thank you for calling.<br />
</pre><br />
"History comes from memory" was found to be a riddle referencing Clio (the "Muse" of history), the daughter of Mnemosyne (the Goddess of memory). Upon emailing the word "Clio" to the address, the following response was received:<br />
<pre><br />
Thank you so much for returning my message. I need every helpful hand I can get.<br />
<br />
I figured, by the efforts you’ve put into contacting me, that you’ve got a high interest in Arnaud’s case. I’ve been monitoring him since nearly a month ago and I would be lying if I told you it doesn’t keep me awake at night. His condition is nothing like I’ve ever seen. His brain activity is insanely high, but he’s completely non-responsive.<br />
<br />
Not too long after I was informed of Arnaud’s condition, I was visited by a man claiming to work for a highly advanced tech company, specializing in unconscious experiences. He has been incredibly interested in Arnaud’s case as well as in my recent studies on sleeping patterns. I gave him some information on my research into lucid dreaming methods and he went on his way. I’ve never seen him again.<br />
<br />
Since then, I’ve been focused on gathering more information about W/ARE, their technology and their processes. I’ve noticed that Arnaud advertised them on his professional website but I don’t know the depth of his involvement with them. I figured that any person interested by the correlation between W/ARE and Arnaud would find the message I left there. I’ve put the Foundation in place as a cover to not arouse suspicion.<br />
<br />
I have so many questions and Zheng’s not answering my calls. All he gave me is the list of his company’s research labs as well as one totally incomprehensible file. I need to get to know more about W/ARE. If you know this man, if you can get any opening into this company’s motives, please help me. For Arnaud’s life and potentially many others.<br />
<br />
<br />
Géraldine<br />
</pre><br />
One of the sentences linked to a [https://www.dropbox.com/sh/6i6f2cipfd901bj/AAAUwOSxECU0l4tvZa4DSPBra?dl=0 Dropbox folder] that contained two images. The meaning of the images is unknown.<br />
<br />
==Zheng's Note==<br />
One of the images, titled [https://www.dropbox.com/sh/6i6f2cipfd901bj/AAAUwOSxECU0l4tvZa4DSPBra?dl=0&preview=Zheng%27s+note.jpg Zheng's Note], contained what at first appeared to be gibberish. However, when every other letter is taken the following text is revealed:<br />
<pre><br />
Test subjects have been called in and the device has been used on them in ways that i could never condone 7 of them lost as we speak 3 of them are dead 8 are on the verge of being unrecoverable their intentions are not what we think they are actions should be taken to shut them down exit<br />
</pre><br />
The letters that were not used in the message appear to be the words <code>Lucid Dream</code> repeating until the end of the message.<br />
<br />
==WARE Labs==<br />
The second image, titled [https://www.dropbox.com/sh/6i6f2cipfd901bj/AAAUwOSxECU0l4tvZa4DSPBra?dl=0&preview=WARE+Labs.jpg WARE Labs] contains data concerning six research labs owned by WARE across the world. The transcription of the data is as follows:<br />
<pre><br />
0:<br />
Boston Research Lab<br />
Lab Director: Richard Wilkes<br />
Project name: we-2-3 / tm-1-lt / tr-10-ae<br />
<br />
Project description: 0000100001<br />
Project code: # 4-3<br />
Lab sequence 10-3<br />
<br />
1:<br />
Sacremento Research Lab<br />
Lab Director: Helga Johnson<br />
Project name: st-1-dn / ss-4-bn<br />
<br />
Project description: 0001010000<br />
Project code: # 1-2<br />
Lab sequence: 4-6<br />
<br />
2:<br />
Seoul Research Lab<br />
Lab Director: Yu Hyo<br />
Project name: ue-2-is / as-6-be<br />
<br />
Project description: 0100000011<br />
Project code: # 1-2-1<br />
Lab sequence: 9-1-13<br />
<br />
3: <br />
Beijing Research Lab<br />
Lab Director: Wang Jie<br />
Project name: st-1-dn / bg-1-tr<br />
<br />
Project description: 0001000000<br />
Project code: # 4<br />
Lab sequence: 8<br />
<br />
4: <br />
Prague Research Lab<br />
Lab Director: Adriana Dvorak<br />
Project name: ae-4-sd / of-5-ue<br />
<br />
Project description: 0100101000<br />
Lab code: # 10-3-4<br />
Lab sequence: 2-5-12<br />
<br />
5: <br />
Berlin Research Lab<br />
Lab Director: Georg Muller<br />
Project name: dd-1-ae / dn-2-()<br />
<br />
Project description: 001000001<br />
Lab code: # 2-3<br />
Lab sequence: 7-11<br />
</pre><br />
Each of the letter pairs in the project name field represented a first and last letter of a word in the decoded Zheng's note. <code>3</code> and <code>()</code> represent the word <code>three</code> and the end of the message, respectively. Then the sequence that fit those words needed to be found, so for example, <code>dd-1-ae</code> would be the words <code>dead 8 are</code> in Zheng's note. Using this method, the following sequences were found:<br />
<pre><br />
we speak 3 / them are lost / their intentions are<br />
shut them down / subjects have been<br />
unrecoverable their intentions / actions should be<br />
shut them down / being unrecoverable their<br />
are actions should / of being unrecoverable<br />
dead 8 are / down exit <br />
</pre><br />
The middle number was then found to represent which letter of the middle word was important, as it was always less than the character count of the middle word. Taking each letter indicated by the middle number the string <code>paste hdtuig8x</code> was given, which was found to represent a [https://pastebin.com/hdtuig8x pastebin] link. The pastebin link then led to [https://www.dropbox.com/sh/n675hwdwhik5rg5/AABfjT9UDSFGeGmk2clRYLI_a?dl=0 another dropbox folder titled "Client - 43617373696e69"] that contained 4 PDF files relating to Arnaud's incident. The PDFs provided datadumps from the dreamscape, soundflex, and inyourmind processes before they all failed:<br />
<br />
'''Dreamscape''':<br />
<br />
* [https://www.dropbox.com/s/ln1beuxoo4ig992/m1.jpg?dl=0 m1 - successful]<br />
<br />
* m2 - failed<br />
<br />
* [https://www.dropbox.com/s/touiwi6qhneg8hs/m3.jpg?dl=0 m3 - successful]<br />
<br />
* [https://www.dropbox.com/s/9wcxup3ka5zzrl2/m4.jpg?dl=0 m4 - corrupted]<br />
<br />
* [https://www.dropbox.com/s/cl17kp9kri6i1t8/m5.jpg?dl=0 m5 - successful]<br />
<br />
* m6 - failed<br />
<br />
* [https://www.dropbox.com/s/e4olmlc3yy4vnqf/m7.png?dl=0 m7 - successful]<br />
<br />
'''Soundflex''':<br />
<br />
* [https://clyp.it//m2t5s3ns s1 - successful]<br />
<br />
* [https://clyp.it//sxrz4spl s2 - successful]<br />
<br />
* [https://clyp.it/deihb43e s3 - corrupted]<br />
<br />
'''Inyourmind''': [https://www.dropbox.com/sh/n675hwdwhik5rg5/AABfjT9UDSFGeGmk2clRYLI_a?dl=0&preview=Client+-+43617373696e69-1.pdf >>>]<br />
<br />
The rest was solved, and a second pastebin found by splitting Zheng's note into 6 rows of 10 words like so:<br />
<pre><br />
Test subjects have been called in and the device has<br />
been used on them in ways that I could never <br />
condone 7 of them are lost as we speak 3<br />
of them are dead 8 are on the verge of <br />
being unrecoverable their intentions are not what we think they<br />
are actions should be taken to shut them down exit<br />
</pre><br />
From there, the binary values in <code>Project description</code> were used to pick out words:<br />
<pre><br />
0000100001 - called has<br />
0001010000 - them ways<br />
0100000011 - 7 speak 3<br />
0001000000 - dead<br />
0100101000 - unrecoverable are what<br />
001000001 - should exit<br />
</pre><br />
Then <code>Project code</code> was used to pick out letters from each word:<br />
<pre><br />
called has | 4-3 = ls <br />
them ways | 1-2 = ta<br />
7 speak 3 | 1-2-1 = 7p3<br />
dead | 4 = d<br />
unrecoverable are what | 10-3-4 = aet<br />
should exit | 2-3 = hi<br />
</pre><br />
<code>Lab sequence</code> was then used to determine the order of the letters:<br />
<pre><br />
ls = 10-3 - l and s are letters ten and three respectively<br />
ta = 4-6 - t and a are letters four and six respectively<br />
7p3 = 9-1-13 - 7, p and 3 are letters nine, one and thirteen respectively<br />
d = 8 - d is the eighth letter<br />
aet = 2-5-12 - a, e and t are letters two, five and twelve respectively<br />
hi = 7-11 - h and i are letters seven and eleven respectively<br />
</pre><br />
Reordered the following string was obtained: <code>paste ahd7lit3</code><br />
This was the link to a second [https://pastebin.com/ahd7lit3 pastebin]. The pastebin linked to a second [https://www.dropbox.com/sh/nebk9ukhnnt3mkk/AABTaLwSSRyYBcWvDhJVDJfaa?dl=0 dropbox titled "Archives"]. The folder contains six images of what appear to be WARE customer support logs.<br />
<br />
=Myriad Status Update=<br />
On the 13th of May at 18:29 UTC Myriad's [http://www.myriad-70.com/status/ status page] was updated. A diff of the change can be found [https://www.diffchecker.com/4g9xfrbN here]. The only change was the network diagnostic table, which now says the following:<br />
<pre><br />
Latest network diagnostic table:<br />
- Client 3597b’s resources redirected <br />
- 3597b-1-2-1 has been shut down<br />
- Additional resources allocated to 3597b-4<br />
</pre><br />
<code>3597b-1-2-1 has been shut down</code> seems to imply that the Seoul Research Lab has been shut down, <code>Additional resources allocated to 3597b-4</code> seems to indicate that the Beijing Research Lab is now receiving additional resources. Two hours before this status change, at 4:02 PM UTC WARE [https://twitter.com/warecloud/status/995710781168726018 tweeted] about the arrival of 40 new employees to their Beijing Research Lab. It is possible that the tweet and status update are connected.<br />
<br />
=Dev Kit Shipping Updates=<br />
On May 15, 2018 at 19:20 UTC, winners of the W/ARE development contest received an update on the status of their dev kit deliveries. A link inside the email led to a form, indicating that the package was currently located in Beijing, contained 1 Dev Kit, and weighed 1.80 kg, and requesting confirmation from each of the winners that the package belonged to them.<br />
{| class="wikitable" border="1" width="60%"<br />
|-<br />
! scope="col" style="width: 50%;" |Email<br />
! scope="col" style="width: 50%;" |Form<br />
|-<br />
| Dear Customer,<br />
<br />
A package was shipped to you via W/ARE Shipping Service.<br />
<br />
Confirmation that you are indeed the receiver is required.<br />
<br />
Please follow this link to confirm your identity.<br />
<br />
Kind regards,<br />
W/ARE tech<br />
<br />
This is an automated message, please do not respond.<br />
| [[File:Devkitshipping01.PNG|400px|Shipping confirmation form 1]]<br />
|}<br />
<br />
A second update followed the next day at 23:54 UTC. The status of the package had changed to confirm it was now located in Seoul, was held in transit for 460 minutes, and had been reduced in weight to 0.50 kg.<br />
{| class="wikitable" border="1" width="60%"<br />
|-<br />
! scope="col" style="width: 50%;" |Email<br />
! scope="col" style="width: 50%;" |Form<br />
|-<br />
| Dear Customer,<br />
<br />
Your W/ARE package is currently leaving Seoul to be redirected to its new transit location. <br />
<br />
Confirmation that you are indeed the receiver is required.<br />
<br />
Please follow this link to confirm your identity.<br />
<br />
Kind regards,<br />
W/ARE tech<br />
<br />
This is an automated message, please do not respond.<br />
| [[File:Devkitshipping02.PNG|400px|Shipping confirmation form 2]]<br />
|}<br />
<br />
=Terminal Status Update and Precon007=<br />
On May 15th at 21:48 UTC, players discovered that the status command had updated.<br />
<pre><br />
CODE -5 <br />
Command.Center.v12 crashed <br />
------ <br />
New memo received<br />
http://bit.ly/2IHPmMN<br />
</pre><br />
The [http://bit.ly/2IHPmMN bit.ly link] lead to a new memo from Major Sophie Dubois to Elizabeth Leighton. The memo was titled <code>Ware Report #26</code>. It mentions that many users stuck in "the system" show major side effects after being disconnected, from brain damage to death. It is presumed that this system has something to do with the WARE headset, however it is unknown what they are specifically referring to. It is also mentioned that the impact on Myriad has damaged Emily/Loop16's communication and precognition functions. Alongside this another command is mentioned in the memo. <code>precon007</code>. The output for the command is the following:<br />
<pre><br />
PRECON DATA DUMP 01<br />
http://bit.ly/2rJi6uJ<br />
http://bit.ly/2GkZnu5<br />
http://bit.ly/2rJBO9Z<br />
http://bit.ly/2L2fwbe<br />
</pre><br />
The bit.ly links were all links to images, much of them completely indistinguishable, however the first appears to be some sort of document with most/all of the information blocked out, and the second depicts an image similar to the one discovered by players on April 14th. The third appears to be the box for a W/ARE devkit, and the fourth is almost completely indistinguishable and unknown. Players speculated that it is a pyramid hologram display. Embedded in each image was a string of hex:<br />
<gallery mode="packed-hover" widths=240px heights=240px><br />
Image:Precon-01.jpg|Precon image 1<br />
Image:Precon-02.jpg|Precon image 2<br />
Image:Precon-03.jpg|Precon image 3<br />
Image:Precon-04.jpg|Precon image 4<br />
</gallery><br />
<pre><br />
Image 1 - 65 74 61 20 75 6e 6b 6e 6f 77 6e - eta unknown<br />
Image 2 - 65 74 61 20 6d 61 79 20 31 38 2d 31 39 - eta may 18-19<br />
Image 3 - 49 73 20 4c 20 50 6c 61 79 73 20 47 61 6d 69 6e 67 20 72 69 67 68 74 3f - Is L Plays Gaming right?<br />
Image 4 - 65 74 61 20 75 6e 6b 6e 6f 77 6e - eta unknown<br />
</pre><br />
<br />
=Book Deliveries=<br />
On May 16th 2018, several members of the No Man's Sky community started receiving physical books in the mail:<br />
<br />
* The Conscious Mind: In Search of a Fundamental Theory by David J. Chalmers, received by CobraTV<br />
* The Dramaturges of Yan by John Brunner, received by [https://twitter.com/nevadander/status/996839681345183744 Nevadander]<br />
* From Bacteria to Bach and Back: The Evolution of Minds by Daniel C. Dennett, received by Tony_Towers<br />
* Meditations on First Philosophy by Rene Descartes, received by UnimatrixZeroOne<br />
* Nine Tomorrows by Isaac Asimov, received by [https://twitter.com/Galactic_Geo/status/997215352932061184 Galactic_Geo]<br />
<br />
=Glyphs 11-15=<br />
On May 17 2018, the last five glyphs on [https://wakingtitan.com/ the Waking Titan website] activated. Currently, none of these glyphs have any hints or backgrounds associated with them. This is in contrast to the previous glyphs, each of which had a link to something that hinted at what needed to be solved, as well as their own background when the glyph was clicked/opened.<br />
<br />
=Myriad Status and Precon Update=<br />
On May 18th at 20:15 UTC Myriad's status page was updated.<br />
<pre><br />
Latest network diagnostic table:<br />
- command.center.satcom updating<br />
- Client 3597b’s resources redirected <br />
- 3597b-1-2-1 has been shut down<br />
- Additional resources allocated to 3597b-4<br />
</pre><br />
Alongside this network diagnostic table update, the "On the ground speed" averages also updated:<br />
<pre><br />
Manhattan: 0.2Tb/s<br />
London: 0.7Tb/s<br />
Tokyo: 0.5Tb/s<br />
Beijing: 55.1Tb/s<br />
</pre><br />
The <code>precon007</code> command in the Waking Titan [http://wakingtitan.com/ Terminal] was also changed.<br />
<pre><br />
PRECON DATA DUMP 01<br />
[x]<br />
http://bit.ly/2GkZnu5<br />
http://bit.ly/2rJBO9Z<br />
http://bit.ly/2L2fwbe<br />
</pre><br />
The first bit.ly link that had previously led to an image of what appeared to be a redacted document was removed and replaced by <code>[x]</code>.<br />
<br />
=Loop16 Command Updated=<br />
On May 18th at 23:40 UTC it was discovered that the response for the command <code>loop16</code> in the Waking Titan Terminal had changed.<br />
<pre><br />
Processing <br />
UTC : 11:45pm <br />
UTC : 12:00am <br />
UTC : 12:15am <br />
UTC : 12:30am <br />
UTC : 12:45am <br />
UTC : 01:00am <br />
UTC : 01:15am<br />
</pre><br />
Once the clock had struck 11:45 PM UTC, the command updated again:<br />
<pre><br />
Processing <br />
UTC : 11:45pm http://bit.ly/2KADObl<br />
UTC : 12:00am <br />
UTC : 12:15am <br />
UTC : 12:30am <br />
UTC : 12:45am <br />
UTC : 01:00am <br />
UTC : 01:15am <br />
</pre><br />
The [http://bit.ly/2KADObl link] led to an image of what appears to be a constellation. Following this, the command proceeded to update every 15 minutes, each time adding a different link.<br />
{|class="wikitable"<br />
! Time (UTC)<br />
! Link<br />
! Constellation<br />
! Missing Star<br />
|-<br />
|11:45pm<br />
|http://bit.ly/2KADObl<br />
|Bootes<br />
|Arcturus<br />
|-<br />
|12:00am<br />
|http://bit.ly/2wRXnKl<br />
|Carina<br />
|Canopus<br />
|-<br />
|12:15am<br />
|http://bit.ly/2IAuoMk<br />
|Pegasus<br />
|Scheat<br />
|-<br />
|12:30am<br />
|http://bit.ly/2rSv1L1<br />
|Ursa Major<br />
|Dubhe<br />
|-<br />
|12:45am<br />
|http://bit.ly/2wRXu8J<br />
|Scorpius<br />
|Antares<br />
|-<br />
|1:00am<br />
|http://bit.ly/2wTwVjl<br />
|Canis Minor<br />
|Procyon<br />
|-<br />
|1:15am<br />
|http://bit.ly/2rTwIqN<br />
|Lyra<br />
|Vega<br />
|}<br />
<gallery mode="packed-hover" widths=240px heights=240px><br />
Image:Bootes.jpg|Boötes, missing the star Arcturus.<br />
Image:Carina.jpg|Carina, missing the star Canopus.<br />
Image:Pegasus.jpg|Pegasus, missing the star Scheat.<br />
Image:Ursa_Major.jpg|Ursa Major, missing the star Dubhe.<br />
Image:Scorpius.jpg|Scorpius, missing the star Antares.<br />
Image:Canis_Minor.jpg|Canis Minor, missing the star Procyon.<br />
Image:Lyra.jpg|Lyra, missing the star Vega.<br />
</gallery><br />
Around the same time as the command began updating, players discovered a Reddit account named [https://www.reddit.com/user/satcom-70 satcom-70], who had posted a [https://www.reddit.com/r/NoMansSkyTheGame/comments/8kfrj2/commandcentersatcom_cid_185/ thread] titled <code>command.center.satcom - CID 185</code> on the No Man's Sky subreddit. The name of the user was also found to be a part of a [http://satcom-70.com/ URL] which led to the Command Center. The only text displayed on the website at the time was <code>COMMAND.CENTER.V12 CRASHED</code>. This lined up with the output of the <code>status</code> command in the Waking Titan terminal.<br />
<br />
On the 19th of May, the Reddit post was updated to contain a [https://i.imgur.com/angJPlX.jpg hint] to the puzzle. Upon finding this hint, players realized that they needed to reorder the stars according to their background color. After this, the stars were numbered 1-7. That number told players which letter out of each star name to use in order to get <code>ANNAETN</code>, an anagram for <code>ANTENNA</code>, which gave a new [https://s3.amazonaws.com/cdn.wakingtitan.com/comroute/141t6.jpg image] when put into the Waking Titan terminal.<br />
<br />
When unscrambled, the following text was revealed on the image:<br />
<pre><br />
Reconstructing language database<br />
Protocol<br />
bit.ly/2KEkJVF<br />
Comment with filename of Wikipedia DB ending with D97C0<br />
</pre><br />
Then, the Wikipedia database with the filename <code>D567CE8E2EC4792A99197FB61DEAEBD70ADD97C0</code> was found. The name was commented on the post, then the post was edited to the following:<br />
<pre><br />
D567CE8E2EC4792A99197FB61DEAEBD70ADD97C0 - Valid . Command updated - Erpbirel . System entering standby . CR now loading satcom-70.com . Support instructions: igS4Tzd6<br />
</pre><br />
The [http://satcom-70.com/ satcom-70] website was updated. <code>Erpbirel</code> was a terminal command for Waking Titan that led to an [http://cdn.wakingtitan.com/9f57789f-a706-4006-a314-92a8029dce4e-.jpg image]. The second part, <code>Support instructions: igS4Tzd6</code>, was found to be a part of the URL for a [https://pastebin.com/igS4Tzd6 pastebin link]. The text of the pastebin was as follows:<br />
<pre><br />
Vocal reconstruction database required<br />
Source: Wikipedia (any article)<br />
Length: 1 sentence<br />
Format: MP3 audio<br />
Minimum samples : 100<br />
Minimum languages: 5<br />
Minimum unique voices: 33<br />
Sample origin: Homo sapiens<br />
Upload instructions: Submit all samples in a single message to u/satcom-70<br />
Deadline : Tuesday May 22nd, 10am eastern time<br />
</pre><br />
<br />
=Dev Kit Delivery=<br />
On May 21, 2018, winners of the W/ARE development contest started receiving their dev kits in the mail. Each package contained:<br />
* A letter to Arnaud requesting that a picture with results be emailed to Dr. Nadeau. This included a W/ARE Tech medical procedure slip<br />
* A plastic holographic pyramid, designed to display "3D Holograms" using a phone<br />
* A phone and a charger<br />
** Skype was installed on the phone and the required login details were found in a notes app. The Skype contacts listed each of the other winning dev studios as a "Point of Contact" (PoC)<br />
** The phone included an app called <code>Myriad Uplink</code> that can also be accessed at [http://uplink.satcom-70.com/ uplink.satcom-70.com]<br />
** Different audio files were found on each of the phones, transcribed below:<br />
<br />
<center><br />
{|class="wikitable"<br />
! scope="col" style="width: 16%;" |Stellar Software - PoC #1<br />
! scope="col" style="width: 16%;" |Imperium Interactive - PoC #2<br />
! scope="col" style="width: 16%;" |Spectrumental Games - PoC #3<br />
! scope="col" style="width: 16%;" |Summon Studios - PoC #4<br />
! scope="col" style="width: 16%;" |CSD Games - PoC #5<br />
! scope="col" style="width: 16%;" |Game Detectives - PoC #6<br />
|-<br />
|1 - "W/ARE Tech support, how can I help you?" [https://clyp.it/hpbypwo5 Audio file]<br />
|1 - "Uhm, ten hours tops. This is very unusual to me." [https://clyp.it/1gkv0aog Audio file]<br />
|1 - "You said you went to sleep immediately after taking your medication?" [https://clyp.it/cirija3q Audio file]<br />
|1 - "No, on my computer." [https://clyp.it/qhcdx2jr Audio file]<br />
|1 - "On your W/ARE device?" [https://clyp.it/f5cuzm2e Audio file]<br />
|1 - "I started a new game, played a bit, and went to bed after." [https://clyp.it/zn2wl5tg Audio file]<br />
|-<br />
|2 - "Thank you for taking the time to update us on your condition. I see that you've ordered some of our exclusive blood thinners, did you follow the prescription instructions?" [https://clyp.it/rihvc0w2 Audio file]<br />
|2 - "Hello, uhm... I would like to have a follow-up on an incident related to your headset." [https://clyp.it/hcdex55q Audio file]<br />
|2 - "Thank you for choosing W/ARE!" [https://clyp.it/czag350m Audio file]<br />
|2 - "6 - E - 6 - 9?" [https://clyp.it/shmwas3t Audio file]<br />
|2 - "I see you already emailed our department yesterday about the same inquiry. Do you still suffer from the previously mentioned symptoms?" [https://clyp.it/njpp1sit Audio file]<br />
|2 - "I never used them. This morning, though, my body feels incredibly stiff. Should I have taken them?" [https://clyp.it/i4lqxrlz Audio file]<br />
|-<br />
|3 - "Were your sleeping patterns the same as usual?" [https://clyp.it/hreqcs5s Audio file]<br />
|3 - "Right side mostly, arms and legs." [https://clyp.it/nifdnptq Audio file]<br />
|3 - "Excuse me sir, I need to verify something. I'll be back in a moment. [music box recording of "La Vie En Rose" plays as hold music]" [https://clyp.it/zzldfrb3 Audio file]<br />
|3 - "Alright, thank you very much." [https://clyp.it/k1u0atix Audio file]<br />
|3 - "Can you identify where this feeling is coming from?" [https://clyp.it/1v5yjeuf Audio file]<br />
|3 - "I slept a lot, actually." [https://clyp.it/shes3jgj Audio file]<br />
|-<br />
|4 - "Thank you for your patience. I relayed a quick recap of your symptoms to our internal specialist, and your condition seems to be related to a mild case of brain fatigue. We suggest you take pauses between play sessions so your mind relaxes. If your symptoms persist, we suggest you consult a health specialist to make sure you don't have any underlying conditions that could interfere with the headset's performance." [https://clyp.it/arezqg4x Audio file]<br />
|4 - "Actually, I took an Aspirin, went to bed, and it disappeared over night." [https://clyp.it/al5i4bpv Audio file]<br />
|4 - "I'm very sorry you experience discomfort using your device. Can you please give me the last four characters of your client number?" [https://clyp.it/wfckrukr Audio file]<br />
|<br />
|4 - "Do you have an approximate amount of time?" [https://clyp.it/csvxb0qh Audio file]<br />
|}<br />
</center><br />
<br />
<gallery mode=packed widths=240px heights=240px><br />
Image:Devkitcontents01.jpg|Complete contents of the package<br />
Image:Devkitcontents02.jpg|Phone homescreen<br />
Image:Devkitcontents03.jpg|Myriad Uplink app<br />
Image:Devkitcontents04.jpg|Medical procedure slip<br />
</gallery><br />
<br />
==Skype Messages==<br />
On May 22 around 19:00 UTC, the following text messages were received through the Skype app on the phones:<br />
<pre><br />
From: Geraldine Nadeau<br />
<br />
I don't have much time to talk.<br />
Am in contact with Zheng. I may have an opening into WARE's medical docs but i'm not sure yet.<br />
I'll contact you again soon.<br />
<br />
Update on Arnaud's condition:<br />
Vital signs have been very unstable during last week. Heart rate and blood pressure stabilized for two days.<br />
HR: 57-62 bpm<br />
BP: 110 / 70</pre><br />
<pre><br />
From: Mercury Process<br />
<br />
MERCURY PROCESS DIRECTIVE 16.B:<br />
Carefully review the datadump. Send all analyses and findings to mercury@atlas-65.com<br />
</pre><br />
<br />
More messages came in on May 23, 19:30 UTC:[[File:Skypemessages01.jpg|thumb|Skype messages from Dr. Nadeau]]<br />
<pre><br />
From: Geraldine Nadeau<br />
<br />
Thank you so much.<br />
I have been told that W/ARE is on high alert and extremely vigilant right now. They've doubled their security measures and we couldn't get access to their medical documents, but we'll keep trying. I don't know if they are aware of my contact with Zheng.<br />
<br />
If you are willing to help, here's an update on Arnaud's condition.<br />
HR and BP still stable<br />
EEG in high gamma zone at 82<br />
Oxygen levels stabilized at 94%<br />
</pre><br />
<br />
Messages from May 24, 19:43 UTC:<br />
<pre><br />
From: Geraldine Nadeau<br />
<br />
Update on Arnaud's condition.<br />
No change on HR and BP<br />
EEG still in high gamma zone at 87<br />
Examination of body: Slight discoloration of fingertips<br />
<br />
We're getting close to a breach and probably will have something more for you tomorrow.<br />
</pre><br />
<br />
Messages from May 25, 20:56 UTC:<br />
<pre><br />
From: Geraldine Nadeau<br />
<br />
I need your help concerning one of the dev kits. There are two dev kit recipients that I haven't yet been able to make contact with- one of them is still in transit, but the other appears to have arrived at its destination. <br />
<br />
I'm concerned that W/ARE may have intercepted the kit, which would be disastrous considering the risks that we are taking. If you know of another dev kit recipient that I haven't yet been able to contact, can you please forward them this message and ask them to reach out to me?<br />
</pre><br />
<br />
=May 25-26 Updates=<br />
On May 25, 2018 at 21:42 UTC, the output of the <code>STATUS</code> command began to update:<br />
<pre><br />
1. Cassini: Incomplete<br />
2. WT16: Incomplete<br />
3. Uplink: Incomplete<br />
4. Loop16: Processing<br />
<br />
Guidance subroutine checksum ///<br />
31 2e 20 77 61 69 74 69 6e 67 20 69 6e 73 74 72 75 63 74 69 6f 6e 73 20 32 2e 20 31 30 2f 31 35 20 33 2e 20 61 2f 4f 31 4f 73 65 65 42 20 34 2e 20 64 6f 77 6e 6c 6f 61 64 69 6e 67 20 76 6f 69 63 65 20 64 61 74 61<br />
</pre><br />
<br />
The code is HEX and translates to:<br />
<pre><br />
1. waiting instructions<br />
2. 10/15<br />
3. a/O1OseeB<br />
4. downloading voice data</pre><br />
<br />
<code>a/O1OseeB</code> led to an [https://imgur.com/a/O1OseeB album on Imgur] that contains images of items required to make a DIY blacklight, such as purple, blue, and black sharpies, a flashlight, and adhesive tape.<br />
<br />
A new Skype message was received at 22:15 UTC:<br />
<pre><br />
I’m forwarding you the last messages Zheng sent me. Hopefully, you can make sense of it. It kind of looks like a list but I don’t know what it means. <br />
<br />
101 110 116 101 114 32 97 65 116 55 77 51 50 99<br />
<br />
101 110 116 101 114 32 87 114 84 97 119 112 115 113<br />
<br />
101 110 116 101 114 32 90 89 51 70 98 49 49 86<br />
<br />
101 110 116 101 114 32 117 113 56 78 54 89 69 87</pre><br />
<br />
The ASCII numbers translate to the following:<br />
<pre><br />
enter aAt7M32center WrTawpsqenter ZY3Fb11Venter uq8N6YEW<br />
</pre><br />
<br />
These strings were then used to complete four pastebin URLs which contained the following links:<br />
* [https://pastebin.com/aAt7M32c pastebin.com/aAt7M32c] -- https://clyp.it/user/1legrggu<br />
* [https://pastebin.com/WrTawpsq pastebin.com/WrTawpsq] -- https://www.dropbox.com/s/eq8gk5b6axnpoh7/1-2-1_ResearchLab_Medical.pdf?dl=0<br />
* [https://pastebin.com/ZY3Fb11V pastebin.com/ZY3Fb11V] -- https://www.dropbox.com/s/esc95j7ihseujls/1-2-1_ResearchLab_Medical_Exceptions.pdf?dl=0<br />
* [https://pastebin.com/uq8N6YEW pastebin.com/uq8N6YEW] -- https://www.dropbox.com/s/8ddztbyf7bv27bb/1-2-1_ResearchLab_Medical_Recommendations.pdf?dl=0<br />
<br />
The clyp.it audio files seemed to be the missing conversation snippets found on the remaining dev kit phone which had not yet arrived at the time. The PDF files on Dropbox provided information on how to identify and treat Arnaud's condition.<br />
<br />
Based on this information, players sent the following medical instructions to Dr. Nadeau:[[File:Waremedicalprocedure.jpg|thumb|W/ARE Medical Procedure slip]]<br />
# 3 foam pads all around the head<br />
# Defibrillator 500 volts 3 times, wait 30 minutes<br />
# Epinephrine injection, 3 doses<br />
# Mood regulator pills x1 diluted in 20 ml of mineral water<br />
# Play "La Vie En Rose", the last song he listened to, for 45 seconds<br />
# Propofol injection, 1 dose<br />
<br />
In response, the following messages were exchanged on Skype:<br />
<pre><br />
Geraldine Nadeau: Thank you very much. As you and two others devkit holders confirmed similar steps, I’ll assume this is the procedure to follow. Can you confirm, by yes or no, if I apply those steps to Arnaud’s treatment?<br />
<br />
Dev Kit Holders: Yes.<br />
<br />
Geraldine Nadeau: Proceeding to treatment. I’ll update you soon.<br />
</pre><br />
<br />
Shortly after, the <code>STATUS</code> command in the terminal updated again with a change of Cassini's status from <code>Incomplete</code> to <code>Processing</code>.<br />
<br />
On May 26 at 01:24 UTC, a new Skype message was received:<br />
<pre><br />
From: Geraldine Nadeau<br />
<br />
Arnaud is responding positively to treatment, despite the highly unusual procedures. We still don't know the lasting side effects he will keep from these events but he seems to be gradually drifting from a vegetative state to the land of the living. I wanted to thank you from the bottom of my heart for helping me in these conditions.<br />
</pre><br />
<br />
And the status of the Cassini process displayed in the terminal changed again from <code>Processing</code> to <code>Completed</code>.<br />
<br />
==Glyph Passwords==<br />
Another Skype message followed at 01:36 UTC:[[File:Wt-blacklight.jpg|thumb|200px|The book cipher found under a blacklight]]<br />
<pre><br />
From: Mercury Process<br />
<br />
Attention to all involved parties. Please make detailed inspection of your W/ARE package for possible anomalies. Be sure to use appropriate equipment and to document your investigation while broadcasting to involved partners. Thank you for your collaboration.<br />
</pre><br />
<br />
Written on one of the dev kit boxes, <code>180-4-5 171-27-8 40-21-2 70-3-9 268-4-6 180-4-2</code> was found using a blacklight. Used as a book cipher of the format page, line, and word, the phrase <code>He who contains the entire universe</code> was found in CobraTV's copy of the book <code>The Conscious Mind: In Search of a Fundamental Theory by David J. Chalmers</code>. This phrase led players to the Mesopotamian god Anu, who is described as the one "who contains the entire universe". <code>Anu</code> was the password that unlocked Glyph 14 on [http://wakingtitan.com/ wakingtitan.com].<br />
<br />
The command <code>Anu</code> gives the following output in the Waking Titan terminal:<br />
<pre><br />
Marked with honeycomb scars, I am the lowest of the low<br />
</pre><br />
<br />
On another dev kit box, the phrases <code>HIGH UP IN THE DARK</code> and <code>A RISING PANIC</code> were found under the blacklight.<br />
<br />
The passwords for the remaining glyphs 11, 12, 13 and 15 were discovered to be <code>Ouranos</code>, <code>Horus</code>, <code>Nuada</code>, and <code>Triglav</code>, respectively; all of them are sky deities. Used as commands in the terminal, they output the following:<br />
<pre><br />
> Ouranos<br />
uSivrseU<br />
</pre><br />
<pre><br />
> Horus<br />
From my red soil, four times rises Vulcan<br />
</pre><br />
<pre><br />
> Nuada<br />
VCjsyZzA<br />
</pre><br />
<pre><br />
> Triglav<br />
96cdXqpi<br />
</pre><br />
<br />
Each of the strings led to a Pastebin that contained a code:<br />
* Ouranos: https://pastebin.com/uSivrseU - <code>8NuHRIZGacoGgQZiTcCyQQpp1kzRWP3PdN4OUZabxZbPoE0P0RjsrFRiNB0GhOcVdwBSYz0ng8AwlnzYx89msDhGHrLbIUct</code><br />
* Nuada: https://pastebin.com/VCjsyZzA - <code>bYmyFioUHMbLGRI0h8j9ApSY+HkWjD4Wms0i8yPZv3pJj5xp1SJR7HaSOmjBml8cJBG77x5WXaXItYIm2OylFQ==</code><br />
* Triglav: https://pastebin.com/96cdXqpi - <code>2tY7mcPs2A8Z9DarmAnnrKTqph4g+3eOisGtBg3MLGI=</code><br />
<br />
Later, clue 3 in the <code>status</code> command in the Waking Titan terminal had changed to a bit.ly link leading to an About page on [https://www.resilientsystems.com/about-us/incident-response-leadership/ IBM Resilient's website]. It was found that one of the people mentioned on the page, Bruce Schneier, was the developer/designer of an encryption method called [https://en.wikipedia.org/wiki/Blowfish_(cipher) Blowfish], which is a symmetric block key cipher. This turned out the be the decryption method for the hex output of the base64 strings received from the Pastebins. The keys were found by solving the riddles from other glyphs. The glyphs were paired up so that the 12th glyph's terminal command gave the decryption for the 11th glyph, and the 14th glyph's command gave the answer to the 13th glyph. Glyph 15 was the outlier in this, and the riddle that gave its key was found in the 6th W/ARE development kit received by the Game Detectives. The solutions to the riddle were as follows:<br />
<pre><br />
From my red soil, four times rises Vulcan - Tharsis<br />
Marked with honeycomb scars, I am the lowest of the low - Hellas<br />
High up in the dark, a rising panic - Phobos<br />
</pre><br />
<br />
Once decrypted, it was found that the hex then converted properly into ASCII text, and provided more riddles:<br />
<pre><br />
Ouranos - Tharsis - The hills I have conquered honor the lost, who preceded my journey...<br />
Nuada - Hellas - From these hills, I can see the headless horsemans lair...<br />
Triglav - Phobos - With me, came great openings<br />
</pre><br />
<br />
These three riddles are referring to the Spirit rover that landed in the crater Gusev on Mars in 2004. The first riddle refers to the Columbia Memorial Station, the landing site of the rover, named in honor of the seven astronauts lost in the Space Shuttle Columbia's destruction upon atmospheric re-entry. The second riddle refers to "Sleepy Hollow", a small depression in the ground close to the Rover's landing site that scientists took interest in. One of the rover's aliases, <code>MER-A</code> was then found to be the deployment code needed to access a synchronization process on the [https://uplink.satcom-70.com/ uplink.satcom-70] website.<br />
<br />
<br />
Proceed to [[Waking Titan/Phase 5|Phase 5]].</div>Kkzzzkthttps://wiki.gamedetectives.net/index.php?title=Sombra_ARG&diff=18954Sombra ARG2019-06-16T07:40:20Z<p>Kkzzzkt: fixed formatting mistake. credit: @Nightswifty</p>
<hr />
<div>{{argbox<br />
| float = right<br />
| name = Sombra ARG<br />
| image = File:Sombra_skull.png<br />
| description= The Sombra ARG - an ARG involving an unreleased Overwatch hero.<br />
| creator = [https://www.blizzard.com/ Blizzard Entertainment]<br />
| type = Official<br />
| status = Completed<br />
| discovered = 2016-06-12<br />
| completed = 2016-11-04<br />
}}<br />
<br />
{{ArgHeader}}<br />
<br />
The Sombra ARG was an ARG for the first-person shooter [https://www.playoverwatch.com Overwatch], developed by [https://www.blizzard.com/ Blizzard Entertainment]. Sombra was the name of a then-unreleased Overwatch hero. The ARG was comprised of clues and ciphers referencing Sombra, which were found in various developer updates and short animations.<br />
<br />
At the game's release, there were numerous pieces of in-game information that appeared in the map Dorado, hinting at a character called Sombra. When the hero Ana was revealed, more Sombra clues appeared in Ana's origin video. In the weeks that followed, more clues were discovered, which led up to a character reveal animation at BlizzCon 2016.<br />
<br />
== Ana Videos ==<br />
<br />
=== Ana Origin Video ===<br />
<br />
On July 12, 2016, a [https://www.youtube.com/watch?v=TE0CXgpNxG0 video] for the new Overwatch hero named Ana was released. At the 1:16 mark, players discovered a set of hexidecmial values:<br />
<br />
[[File:Ana_Hex2.png|400px]]<br />
<br />
<pre><br />
2E 2E 2E 7B 76 20 66 62 72 20 63 7E 72 79 72 20 7B 76 20 7E<br />
79 71 78 65 7A 76 74 7E D4 A4 79 2C 20 63 7E 72 79 72 20 72<br />
7B 20 67 78 73 72 65 2E 2E 2E 7B 76 20 66 62 72 20 63 7E 72<br />
79 72 20 7B 76 20 7E 79 71 78 65 7A 76 74 7E D4 A4 79 2C 20<br />
63 7E 72 79 72 20 72 7B 20 67 78 73 72 65 2E 2E 2E 7B 76 20<br />
66 62 72 20 63 7E 72 79 72 20 7B 76 20 7E 79 71 78 65 7A 76<br />
74 7E D4 A4 79 2C 20 63 7E 72 79 72 20 72 7B 20 67 78 73 72<br />
65 2E 2E 2E 7B 76 20 66 62 72 20 63 7E 72 79 72 20 7B 76 20<br />
7E 79 71 78 65 7A 76 74 7E D4 A4 79 2C 20 63 7E 72 79 72 20<br />
72 7B 20 67 78 73 72 65 2E 2E 2E 64 78 7A 75<br />
</pre><br />
<br />
A hex to ASCII translation yielded the following:<br />
<br />
<pre><br />
...{v fbr c~ryr {v ~yqxezvt~Ô¤y, c~ryr r{ gxsre...{v fbr c~ryr {v ~yqxezvt~Ô¤y, c~ryr r{ gxsre...{v fbr c~ryr {v ~yqxezvt~Ô¤y, c~ryr r{ gxsre...{v fbr <br />
c~ryr {v ~yqxezvt~Ô¤y, c~ryr r{ gxsre...dxzu<br />
</pre><br />
<br />
Using an XOR Cipher with the constant 23 on the above text resulted in the following message:<br />
<br />
<pre><br />
..la que tiene la información; tiene el poder...la que tiene la información; tiene el poder...la que tiene la información; tiene el poder...la que tiene la <br />
información; tiene el poder...somb<br />
</pre><br />
<br />
This was a repeating phrase in Spanish, which translated to:<br />
<br />
<pre><br />
She who has the information, has the power...<br />
</pre><br />
<br />
Players then discovered a second set of hexidecimal values at the 2:11 mark:<br />
<br />
[[File:Ana Hex.png|400px]]<br />
<br />
<pre><br />
65 76 2E 2E 2E 7B 76 20 66 62 72 20 63 7E 72 79 72 20 7B 76<br />
20 7E 79 71 78 65 7A 76 74 7E D4 A4 79 2C 20 63 7E 72 79 72<br />
20 72 7B 20 67 78 73 72 65 2E 2E 2E 7B 76 20 66 62 72 20 63<br />
7E 72 79 72 20 7B 76 20 7E 79 71 78 65 7A 76 74 7E D4 A4 79<br />
2C 20 63 7E 72 79 72 20 72 7B 20 67 78 73 72 65 2E 2E 2E 7B<br />
76 20 66 62 72 20 63 7E 72 79 72 20 7B 76 20 7E 79 71 78 65<br />
7A 76 74 7E D4 A4 79 2C 20 63 7E 72 79 72 20 72 7B 20 67 78<br />
73 72 65 2E 2E 2E 7B 76 20 66 62 72 20 63 7E 72 79 72 20 7B<br />
76 20 7E 79 71 78 65 7A 76 74 7E D4 A4 79 2C 20 63 7E 72 79<br />
72 20 72 7B 20 67 78 73 72 65 2E 2E 2E<br />
</pre><br />
<br />
When put through the same process, the same string of Spanish was revealed, but with the letters <code>ra</code> at the beginning of the message. These letters were combined with <code>somb</code> from the first cipher to create the name <code>sombra</code>. No more clues were discovered until the release of the Dev Update video.<br />
<br />
=== Dev Update Video ===<br />
<br />
[[File:Sombra Barcodes.png|thumbnail|right|The vertical barcodes found at the end of the Ana Dev Update video]]<br />
<br />
On July 19, 2016, the first [https://www.youtube.com/watch?v=evghkilg2eQ Developer Update] was released for Ana. At the end of the video, players discovered a series of vertical barcodes. When scanned, players discovered a large set of hexidecimal values which where then converted to binary, a dump of which is available [https://gist.github.com/zapu/31165efab0d6264e2fd0fa75cc53b1aa here].<br />
<br />
Turning the ones and zeroes into black and white pixels formed a QR code:<br />
<br />
[[File:Sombra_QR_code.png|300px]]<br />
<br />
Scanning this QR code yielded the following message: <code>¿Estuvo eso facilito? Ahora que tengo su atención, déjenme se las pongo más difícil.</code> In English, the message reads: <code>Was that easy? Well, now that I have your attention, allow me to make things much more difficult.</code> After this, no more clues were discovered until the Summer Games video was released.<br />
<br />
== Welcome to the Summer Games Video ==<br />
<br />
=== Tracer Trail Cipher ===<br />
<br />
[[File:Base64_trail.jpg|thumbnail|right|The unsolved base64 cipher in the Summer Games video]]<br />
<br />
'''Note: The cipher described below remains unsolved.'''<br />
<br />
On August 2, 2016, players discovered another cipher in the [https://www.youtube.com/watch?v=qpcOD9tJM4k Welcome to the Summer Games trailer]:<br />
<br />
<pre><br />
U2FsdGVkX1+vupppZksvRf5pq5g5XjFRIipRkwB0K1Y96Qsv2L<br />
m+31cmzaAILwytX/z66ZVWEQM/ccf1g+9m5Ubu1+sit+A9cenD<br />
xxqkIaxbm4cMeh2oKhqIHhdaBKOi6XX2XDWpa6+P5o9MQw==<br />
</pre><br />
<br />
Players discovered this text to be base64 encryption. When decrypted, players received the following output:<br />
<br />
<pre><br />
Salted__���ifK/E�i��9^1Q�*Q�t+V=�<br />
/ع��W/<br />
�_����V��?q����f�F���"��=q�������[��<br />
z��*����Z����u�\5�k�C<br />
</pre><br />
<br />
''(Note: copy/pasting this string will not work; some of the characters are not printable and are not even displayed correctly on this page)''<br />
<br />
==== Decrypting the Cipher ====<br />
<br />
The "Salted__" header at the start of the string indicated to players that the remainder of the text was encrypted with the OpenSSL software library, which requires a password and the encryption cipher that was used. Salt is added by OpenSSL to ensure uniqueness of the key and the IV derived from the password and used for the encryption. However, due to the age of OpenSSL and its massive library, it was proven to be quite difficult for players to identify the encryption used.<br />
<br />
==== Narrowing Down Ciphers ====<br />
<br />
[[File:HexOfEncryptedMessage.png|thumbnail|right|Hex view of the encrypted string]]<br />
<br />
Players narrowed down the potential ciphers used by examining a hex dump of the encrypted string. There are two major types of ciphers, stream ciphers and block ciphers. Stream ciphers encrypt only the data fed into them, whereas block ciphers always encrypt a certain number of bytes at a time (a "chunk").<br />
<br />
A byte is roughly a single character, but special characters can take up multiple bytes. We know that OpenSSL Salted Encryption uses the first 8 bytes of the output for <code>Salted__</code> and the next 8 bytes for the actual salt. The rest of the information is the '''encrypted message'''.<br />
<br />
The immediately interesting thing here is that the '''encrypted message''' data stops 3 bytes short of a full chunk. This is a excellent indicator that the cipher used is a stream cipher (or a block cipher in CTR/OFB/CFB mode). This narrows the list of potential ciphers down significantly. This also means that the final string that Blizzard encrypted is less than 93 bytes!<br />
<br />
'''This cipher remains unsolved, but it's speculated that Blizzard moved past the cipher by creating alternate puzzles.'''<br />
<br />
=== Directions & Letters ===<br />
<br />
Players discovered that in the North American version of the Summer Games trailer there were repeated references to the cardinal directions, each associated with a particular hero. These references were conspicuously absent from other versions of the trailer. These references are shown below, with the relevant heroes and timestamps:<br />
<br />
<gallery mode="packed"><br />
File:Ow1.png|East - Mercy - Route 66 - 0:17<br />
File:Ow2.png|Center - D. Va - Temple of Anubis - 0:19<br />
File:Ow3.png|North - Torbjorn - Nepal - 0:21<br />
File:Ow4.png|South - Genji - Hanamura - 0:22<br />
File:Ow5.png|Southeast - McCree - Hollywood - 0:24<br />
File:Ow6.png|West - Symmetra - Watchpoint: Gibraltar - 0:30<br />
File:Ow7.png|Southwest - Bastion - Hollywood - 0:34<br />
File:Ow8.png|Northeast - Winston - Volskaya Industries - 0:46<br />
File:Ow9.png|Northwest - Tracer - King's Row - 0:47<br />
</gallery><br />
<br />
Screenshots of all the directions and their respective heroes can be found in an album [https://imgur.com/a/FQXmy here].<br />
<br />
[[File:Overwatch map.jpg|frameless]]<br />
<br />
These heroes, arranged in this particular order, provided a password that was used later in the ARG.<br />
<br />
== Dorado Photo ==<br />
<br />
At an unknown date, a new, "corrupted" photo of the [https://blzgdapipro-a.akamaihd.net/media/screenshot/dorado-screenshot-004.jpg Dorado attackers spawn point] was added to the Overwatch [https://playoverwatch.com/en-us/media/ media page]. Players discovered that the screenshot was "'''datamoshed'''", which means it concealed a hidden message while also taking on a distorted appearance. ([https://prntscr.com/c3dce7 Here] is an example of purposely data moshing the image manually to achieve similar effects.) <br />
<br />
<gallery mode="packed" heights=500px><br />
File:dorado-datamosh.jpg|The datamoshed image<br />
File:dorado-screenshot-005.jpg|The original image<br />
</gallery><br />
<br />
After comparing the images with difference checking tools, players found that certain English and Spanish characters were replaced with exclamation points. The missing characters produced the following Spanish phrase:<br />
<br />
<code>Por que estan mirando al cielo? La respuesta no esta sobre sus cabezas, esta detras de ustedes. A veces, necesitan analizar sus logros previos.</code><br />
<br />
Translated into English, this phrase read:<br />
<br />
<code>Why are you looking at the sky? The answer isn't over your heads, it's behind you. Sometimes, you need to analyze your previous achievements.</code><br />
<br />
The phrase "Why are you looking at the sky?" was most likely a reference to a strange artifact that was discovered in the sky of the Dorado map, dubbed the "Skycode". The Skycode ended up being a red herring, and was completely unrelated to the ARG.<br />
<br />
=== Analyzing Achievements ===<br />
<br />
[[File:achievements.png|thumbnail|right|"¿" Achievement, comment in source code]]<br />
<br />
The phrase "you need to analyze your previous achievements" led players to look at the achievements on the [https://www.playoverwatch.com Overwatch] website. It was noticed noticed that by logging in and viewing the achievements on a player profile, a mystery achievement appeared. Examining a hex dump of the image lead players to a new phrase:<br />
<br />
<pre><br />
Vientos, nada mal. No obstante, me aburro. Intentemos algo nuevo en la misma dirección.<br />
uczihriwgsxorxwunaarawryqhbrsfmeqrjjmu 5552E494 78T3 4VM9 OPL6 IS8208O913KRlrx<br />
</pre><br />
<br />
Translated, it said:<br />
<br />
<pre><br />
Damn, not bad. However, I'm getting bored. Let's try something new in the same direction.<br />
uczihriwgsxorxwunaarawryqhbrsfmeqrjjmu 5552E494 78T3 4VM9 OPL6 IS8208O913KRlrx<br />
</pre><br />
<br />
== Volskaya Datamosh ==<br />
<br />
After a long period of toying around, players discovered that the ciphertext <code> uczihriwgsxorxwunaarawryqhbrsfmeqrjjmu 5552E494 78T3 4VM9 OPL6 IS8208O913KRlrx</code> from the "?" achievement was a Vigenére cipher. Players discovered the key <code>tracertorbjornwinstonsymmetradvamercybastiongenjimccree</code> by ordering the heroes in the Summer Games trailer by the cardinal directions associated with each of them, as said further above. Once decoded, players received the following text: <br />
<pre>blzgdapiproaakamaihdnetmediascreenshot 5552E494 78B3 4CE9 ACF6 EF8208F913CFjpg</pre><br />
<br />
Players found this to be a [https://blzgdapipro-a.akamaihd.net/media/screenshot/5552E494-78B3-4CE9-ACF6-EF8208F913CF.jpg blzgdapipro-a.akamaihd.net/media/screenshot/5552E494-78B3-4CE9-ACF6-EF8208F913CF.jpg URL], which led players to a datamoshed screenshot of the Volskaya Industries map. ''(Editor's note: This link appears to now be dead)''. When players ran a difference check with the [https://blzgdapipro-a.akamaihd.net/media/screenshot/volskaya-screenshot-004.jpg original image], they received an interesting message.<br />
<br />
<gallery mode="packed"><br />
File:volskaya-datamosh.jpg|The datamoshed image<br />
File:Volskaya-screenshot-004.jpg|The original image<br />
</gallery><br />
<br />
=== ASCII Skull #1 ===<br />
<br />
The diff from the datamoshed image resulted in the following output:<br />
<br />
<pre><br />
Parece que te gustan estos jueguitos... por que no jugamos uno de verdad?<br />
:PB@Bk:<br />
,jB@@B@B@B@BBL.<br />
7G@B@B@BMMMMMB@B@B@Nr<br />
:kB@B@@@MMOMOMOMOMMMM@B@B@B1,<br />
:5@B@B@B@BBMMOMOMOMOMOMOMM@@@B@B@BBu.<br />
70@@@B@B@B@BXBBOMOMOMOMOMOMMBMPB@B@B@B@B@Nr<br />
G@@@BJ iB@B@@ OBMOMOMOMOMOMOM@2 B@B@B. EB@B@S<br />
@@BM@GJBU. iSuB@OMOMOMOMOMOMM@OU1: .kBLM@M@B@<br />
B@MMB@B 7@BBMMOMOMOMOMOBB@: B@BMM@B<br />
@@@B@B 7@@@MMOMOMOMM@B@: @@B@B@<br />
@@OLB. BNB@MMOMOMM@BEB rBjM@B<br />
@@ @ M OBOMOMM@q M .@ @@<br />
@@OvB B:u@MMOMOMMBJiB .BvM@B<br />
@B@B@J 0@B@MMOMOMOMB@B@u q@@@B@<br />
B@MBB@v G@@BMMMMMMMMMMMBB@5 F@BMM@B<br />
@BBM@BPNi LMEB@OMMMM@B@MMOMM@BZM7 rEqB@MBB@<br />
B@@@BM B@B@B qBMOMB@B@B@BMOMBL B@B@B @B@B@M<br />
J@@@@PB@B@B@B7G@OMBB. ,@MMM@qLB@B@@@BqB@BBv<br />
iGB@,i0@M@B@MMO@E : M@OMM@@@B@Pii@@N:<br />
. B@M@B@MMM@B@B@B@MMM@@@M@B<br />
@B@B.i@MBB@B@B@@BM@::B@B@<br />
B@@@ .B@B.:@B@ :B@B @B@O<br />
:0 r@B@ B@@ .@B@: P:<br />
vMB :@B@ :BO7<br />
,B@B<br />
</pre><br />
<br />
'''Translation:'''<br />
<br />
<pre><br />
"It seems you like these little games... Why don't we play a real one?"<br />
</pre><br />
<br />
(''This is the python2 script to extract modified bytes from datamoshed Volskaya screenshot: https://gist.github.com/synap5e/27635d2ff6f0e3b15f0c902dca2974a9'')<br />
<br />
No further progress was made until August 23, 2016.<br />
<br />
== Overwatch Forums Glitching Page/ "Skycoder" ==<br />
<br />
On August 23rd, 2016, at an unknown time, an [https://us.battle.net/forums/en/overwatch/topic/20748794686 ominous post] by a user named "Skycoder" appeared on the official General Discussion forums for Overwatch. <br />
<br />
Players found that the name of the post, <code>00110010 00110011</code>, was binary for "23," which was a direct reference to Sombra being the 23rd hero in Overwatch. The age of the post started at 24 hours, and counted down rather than increasing. The post itself contained a single sentence in Spanish:<br />
<br />
<pre><br />
la que tiene la información; tiene el poder<br />
</pre><br />
<br />
Which, when translated to english, reads:<br />
<br />
<pre><br />
She who has the information, has the power.<br />
</pre><br />
<br />
After a short while, the post glitched and distorted, gradually turning a hue of purple. A text box then appeared, which printed the following ciphertext:<br />
<br />
<pre><br />
ICAgICAgICAgICAgICAgICAgICAgICAgICA6UEKPQms6CiAgICAgICAg<br />
ICAgICAgICAgICAgICAsakKIQEJAQkBCQEJCTC4KICAgICAgICAgICAg<br />
ICAgICAgIDdHlkKTQpVCTU1NTU1CQEJAQkBOcgogICAgICAgICAgICAg<br />
ICA6a0KSQpCIl01NT01PTU9NT01NTU2MQphCQEIxLAogICAgICAgICAg<br />
IDo1kUKNQphCiEJCTU1PTU9NT01PTU9NT01NipJuQm5CQEJCdS4KICAg<br />
ICAgICA3MG6GlUKIQpJClEJYQkJPTU9NT01PTU9NT01NQk1QQphCiEJA<br />
QkBCQE5yCiAgICAgIEeYlpdCSiBpQohCh4ggIE9CTU9NT01PTU9NT01P<br />
TZYyICBCj0JAQi4gRUJAQkBTCiAgICAgIJKWQk2HR0pCVS4gIGlTdUKI<br />
T01PTU9NT01PTU9NTZdPVTE6ICAua0JMTYhNhkKXCiAgICAgIEKMTU1C<br />
mUIgICAgICAgN4hCQk1NT01PTU9NT01PQkKWOiAgICAgICBCh0JNTYhC<br />
CiAgICAgII2YiEKKQiAgICAgICAgIDeSlkBNTU9NT01PTU1AQkA6ICAg<br />
ICAgICAgQEBCQEJACiAgICAgII+ST0xCLiAgICAgICAgICBCTkKPTU1P<br />
TU9NTY9CRUIgICAgICAgICAgckJqTYRCCiAgICAgIJBAICBAICAgICAg<br />
ICAgICBNICBPQk9NT01NQHEgIE0gICAgICAgICAgLkAgIEBACiAgICAg<br />
IISVT3ZCICAgICAgICAgICBCOnWMTU1PTU9NTUJKaUIgICAgICAgICAg<br />
LkJ2TUBCCiAgICAgIIRCkUKYSiAgICAgICAgIDCRQpdNTU9NT01PTUKV<br />
QkB1ICAgICAgICAgcUBAQEJACiAgICAgIEKETUJCjHYgICAgICAgR4+L<br />
Qk1NTU1NTU1NTU1NQkKINSAgICAgICBGhEJNTUBCCiAgICAgIIdCQk1/<br />
QlBOaSAgIExNRUKFT01NTU2PQoNNTU9NTYpCWk03ICAgckVxQodNQkKE<br />
CiAgICAgIEKYloRCTSAgQm1ChEIgIHFCTU9NQpBChUKEQk1PTUJMICBC<br />
QEJAQiAgQEJAQkBNCiAgICAgICBKlm2GhFBCj0KEQplCN0eIT01CQi4g<br />
ICAsQE1NTUBxTEJAQkBAQEJxQkBCQnYKICAgICAgICAgIGlHQpUsaTCE<br />
TZZCbk1NT4tFICA6ICBNQE9NTUBAQEJAUGlpQEBOOgogICAgICAgICAg<br />
ICAgLiAgIEKXTZBCj01NTUBCQEJAQkBNTU1AQEBNQEIKICAgICAgICAg<br />
ICAgICAgICBAQkBCLmlATUJCQEJAQkBAQk1AOjpCQEJACiAgICAgICAg<br />
ICAgICAgICAgQkBAQCAuQkBCLjpAQkAgOkJAQiAgQEJATwogICAgICAg<br />
ICAgICAgICAgICAgOjAgckBCQCAgQkBAIC5AQkA6IFA6CiAgICAgICAg<br />
ICAgICAgICAgICAgICAgdk1CIDpAQkAgOkJPNwogICAgICAgICAgICAg<br />
ICAgICAgICAgICAgICAsQkBCCg==<br />
</pre><br />
<br />
=== ASCII Skull #2 ===<br />
<br />
Players discovered that this was Base64 and, once decrypted, resulted in another ASCII skull:<br />
<br />
<pre><br />
:PB.Bk: <br />
,jBˆ@B@B@B@BBL. <br />
7G–B“B•BMMMMMB@B@B@Nr <br />
:kB’B.ˆ—MMOMOMOMOMMMMŒB˜B@B1, <br />
:5‘B.B˜BˆBBMMOMOMOMOMOMOMMŠ’nBnB@BBu. <br />
70n†•BˆB’B”BXBBOMOMOMOMOMOMMBMPB˜BˆB@B@B@Nr <br />
G˜–—BJ iBˆB‡ˆ OBMOMOMOMOMOMOM–2 B.B@B. EB@B@S <br />
’–BM‡GJBU. iSuBˆOMOMOMOMOMOMM—OU1: .kBLMˆM†B— <br />
BŒMMB™B 7ˆBBMMOMOMOMOMOBB–: B‡BMMˆB <br />
.˜ˆBŠB 7’–@MMOMOMOMM@B@: @@B@B@ <br />
.’OLB. BNB.MMOMOMM.BEB rBjM„B <br />
.@ @ M OBOMOMM@q M .@ @@ <br />
„•OvB B:uŒMMOMOMMBJiB .BvM@B <br />
„B‘B˜J 0‘B—MMOMOMOMB•B@u q@@@B@ <br />
B„MBBŒv G.‹BMMMMMMMMMMMBBˆ5 F„BMM@B <br />
‡BBM.BPNi LMEB…OMMMM.BƒMMOMMŠBZM7 rEqB‡MBB„ <br />
B˜–„BM BmB„B qBMOMB.B…B„BMOMBL B@B@B @B@B@M <br />
J–m†„PB.B„B™B7GˆOMBB. ,@MMM@qLB@B@@@BqB@BBv <br />
iGB•,i0„M–BnMMO‹E : M@OMM@@@B@Pii@@N: <br />
. B—M.B.MMM@B@B@B@MMM@@@M@B <br />
@B@B.i@MBB@B@B@@BM@::B@B@ <br />
B@@@ .B@B.:@B@ :B@B @B@O <br />
:0 r@B@ B@@ .@B@: P: <br />
vMB :@B@ :BO7 <br />
,B@B <br />
</pre><br />
<br />
Players discovered that, once both skulls had been stripped of spaces, the bytes of each skull that aren't equal to 0 could be subtracted using [https://pastebin.com/g3kA1Pif a script]. Once compiled, players received the following string:<br />
<br />
<pre><br />
OHVSURPHWLXQMXHJR...FUHRTXHXVWHGHVORVGHWHFWLYHVGHMXHJRVOROODPDULDQXQWUDLOKHDG?EOCJGDXVD-DPEDV-FDODYHUDV.KWPO<br />
</pre><br />
<br />
Players discovered that this was a caesar cipher. After shifting the string forward 23 places, it resulted in:<br />
<br />
<pre><br />
LESPROMETIUNJUEGO...CREOQUEUSTEDESLOSDETECTIVESDEJUEGOSLOLLAMARIANUNTRAILHEAD?BLZGDAUSA-AMBAS-CALAVERAS.HTML<br />
</pre><br />
<br />
When cleaned up, the message read:<br />
<br />
<pre><br />
Les prometi un juego...creo que ustedes los Detectives de Juegos lo llamarían un trailhead? BLZGDUSA-AMBAS-CALAVERAS.HTML<br />
</pre><br />
<br />
When translated from Spanish to English:<br />
<br />
<pre><br />
I promised you a game...I believe you Game Detectives would call it a trailhead? BLZGDAUSA-AMBAS-CALAVERAS.HTML<br />
</pre><br />
<br />
<code>USA-AMBAS-CALAVERAS</code> translated to <code>USE-BOTH-SKULLS</code>, and the <code>.HTML</code> extension hinted at a URL.<br />
<br />
=== Skull Video ===<br />
<br />
BLZGDA refers to the servers that Blizzard uses to host media on their website. As such, this led players to [ https://blzgdapipro-a.akamaihd.net/media/screenshot/usa-ambas-calaveras.html this page], which contains a video of a vitals screen depicting a skull and some other medical information. In addition, it also contained a graphic of one of the ASCII skulls. An Imgur mirror can be found [https://i.imgur.com/6Pk69LX.png here].<br />
<br />
Within the properties of the video, players found another comment in Spanish:<br />
<br />
<pre><br />
Parecen estar muy interesados en estos "héroes". ¿Tal vez les interese conocer algunos detallitos que he averiguado sobre ellos?<br />
</pre><br />
<br />
In English:<br />
<br />
<pre><br />
You seem to be very interested in these "heroes". Maybe interested to know some details that I found out about them?<br />
</pre><br />
<br />
In addition, the video contains a heartbeat monitor, and a series of 26 lines above it. When players assigned the letters of the alphabet to the 26 lines, and used the "pings" of the heartbeat to determine what letters to use, the following string was found:<br />
<br />
<pre><br />
momentincrime<br />
</pre><br />
<br />
=== amomentincrime E-mail ===<br />
<br />
'momentincrime' appeared to refer to the in-universe TV show "A Moment in Crime," which can be seen in the Roadhog and Junkrat [https://www.youtube.com/watch?v=l5kTATxt7bE video] that came out months before the release of Overwatch. However, players also discovered a website, [https://amomentincrime.com amomentincrime.com], and displayed the following text:<br />
<br />
<pre><br />
...Estableciendo conexión...<br />
...Protocolo Sombra v1.3 iniciado...<br />
<br />
...Infiltrando la respuesta automática del email de pistas...<br />
<br />
...Terminando conexión...<br />
</pre><br />
<br />
Players discovered that sending an e-mail to tips@amomentincrime.com resulted in an automated email response:<br />
<br />
<pre><br />
Thank you for contacting A Moment in Crime's anonymous crime line!<br />
<br />
We have analyzed your submission and forwarded the information to the relevant parties. Your help could be vital in apprehending these cri<br />
<br />
...Estableciendo conexión...<br />
...Protocolo Sombra v1.7 iniciado...<br />
<br />
<br />
01:07:47 02:02:02 01:08:06 02:13:43 01:18:32<br />
01:18:21 02:10:19 01:06:21 02:05:18 01:04:02<br />
01:07:08 02:18:25 01:13:04 02:19:20 01:23:02<br />
01:16:40 02:16:35 01:23:04 02:17:16 01:06:42<br />
01:13:29 02:18:06 01:05:02 02:15:41 01:08:34<br />
<br />
j.7F57O,NLv:qj.7B:,1qv@B1j5ivB:,<br />
<br />
...Terminando conexión...<br />
<br />
minals and bringing them to justice. These fugitives are responsible for a string of robberies, arson, and other crimes stretching from Sydney to King's Row.<br />
<br />
Authorities believe that they have set their sights on crossing the Atlantic to America.<br />
</pre><br />
<br />
Players discovered that, if the sets of numbers were taken as AA:BB:CC, where AA was the number of skull (in order of discovery), BB was the row and CC was the column (as seen [https://i.imgur.com/ZgN2MVQ.png here]), and organized into a 5x5 matrix, it would result in:<br />
<br />
<pre><br />
S j G B L <br />
. @ M O k <br />
i , v : 0 <br />
E 7 r q N <br />
J P 5 F 1<br />
</pre><br />
<br />
Players discovered that this Matrix could be used as a bifid key to decode the text underneath the table of numbers in the email, as shown below:<br />
<pre><br />
j . 7 F 5 7 O , N L v : q j . 7 B : , 1 q v @ B 1 j 5 i v B : ,<br />
12 21 42 54 53 42 24 32 45 15 33 34 44 12 21 42 14 34 32 55 44 33 22 14 55 12 53 31 33 14 34 32<br />
<br />
1 2 2 1 4 2 5 4 5 3 4 2 2 4 3 2 4 5 1 5 3 3 3 4 4 4 1 2 2 1 4 2<br />
1 4 3 4 3 2 5 5 4 4 3 3 2 2 1 4 5 5 1 2 5 3 3 1 3 3 1 4 3 4 3 2<br />
<br />
11 24 23 14 43 22 55 45 54 34 43 23 22 42 31 24 45 55 11 52 35 33 33 41 43 43 11 24 23 14 43 22<br />
</pre><br />
<br />
This gave players the following string:<br />
<br />
SOMBr@1NF:rM@7iON1SP0vvErrSOMBr@<br />
This phrase was found to be leet-speak, and was translated to:<br />
<br />
<pre><br />
Sombra Information is power Sombra<br />
</pre><br />
<br />
The string <code>SOMBr@1NF:rM@7iON1SP0vvErrSOMBr@</code> was used as a password later on in the ARG.<br />
<br />
== A Moment in Crime Transmission ==<br />
<br />
[[File:Momentincrime.png|thumbnail|right|amomentincrime.com as of August 24th, 2016]]<br />
<br />
Once the 23-hour countdown on the Skycoder forum post reached zero, [https://amomentincrime.com amomentincrime.com] was updated. It now read:<br />
<br />
<pre><br />
...Estableciendo conexión...<br />
...Protocolo Sombra v1.9 iniciado...<br />
<br />
...Transmitiendo información a ómnicos activos... 2%<br />
<br />
...Terminando conexión...<br />
</pre><br />
<br />
Translated from Spanish to English:<br />
<br />
<pre><br />
...Establishing connection...<br />
...Sombra Protocol v1.9 initiated...<br />
...Transmitting information to active omnics... 2%<br />
<br />
...Ending connection...<br />
</pre><br />
<br />
A comment was also added to the source code:<br />
<br />
<pre><br />
Bien hecho, ya tienen mi clave. Hackear este programa de televisión no tuvo chiste. Espérense a lo que sigue.<br />
</pre><br />
<br />
When translated:<br />
<br />
<pre><br />
Well done, you have my password. Hacking this television program was meaningless. Wait for what is coming.<br />
</pre><br />
<br />
The percent on the amomentincrime.com slowly increased over time. Once the 5% milestone was hit, the Sombra Protocol version number changed to to v1.95. Afterwards, the percentage increased by 0.0038% every 3 minutes in real time.<br />
<br />
In addition, another comment was added:<br />
<br />
<pre><br />
Parece que se están calentando un poco las cosas... tendré que pasar desapercibida mientras esto se finaliza.<br />
</pre><br />
<br />
Translated:<br />
<br />
<pre><br />
It seems things are heating up a bit... I'll have to go unnoticed while this is finishing.<br />
</pre><br />
<br />
On 18th October at 19:02 GMT the site reached 100%, and the site updated with the following message:<br />
<br />
<pre><br />
...Transmisión finalizada - finalizando carga... <br />
...Carga finalizada. Unidad Bastion E-54 comprometida...<br />
</pre><br />
<br />
Which roughly translates to:<br />
<br />
<pre><br />
...Transmission complete - finishing upload...<br />
...Upload finished. Unit Bastion E-54 engaged...<br />
</pre><br />
<br />
Hidden in the source code of the site was the text <code>v1.4.0.2.324??</code>. Players then correctly assumed that this referred to a future build of Overwatch itself.<br />
<br />
== Sombra vs. LumériCo ==<br />
<br />
=== The Hacked Bastion ===<br />
<br />
On October 19, 2016, a new Overwatch version was released - version 1.4.0.2.32448. Shortly afterwards, the version number in the source code of the amomentincrime site updated to the same version number. After the build launched, players discovered that the hero Bastion had a strange interaction when near the "SOMBRA PROTOCOL" monitors on Dorado, and would emit a message in morse code, which can be heard [https://www.youtube.com/watch?v=Hkd__ceYm-Y here]. When the morse was decoded, players received the following string:<br />
<pre><br />
SQOFJFBNITIZWGDXSDO<br />
</pre><br />
<br />
Players discovered that this was a Vigenere cipher, and the key consisted of the alphabetic characters from the<br />
<code>SOMBr@1NF:rM@7iON1SP0vvErrSOMBr@</code> string, it was decoded to read:<br />
<br />
<pre><br />
ACCESSWWWLUMERICOMX<br />
</pre><br />
<br />
This led players to the [https://lumerico.mx/ LumeriCo website]. ''(Editor's note: as of 2018, this site appears to be inactive.)''<br />
<br />
=== LuméReaction ===<br />
<br />
[[File:Lumerico.png|thumbnail|right|The homepage of https://lumerico.mx]]<br />
<br />
The LumeriCo website was for the in-universe Mexican tech giant LumériCo, who had built several reactors in the Dorado region. The website had a [https://lumerico.mx/news news page], noting the imminent opening of a new reactor on November 1 as well as a recent attack on its construction site. There were also [https://lumerico.mx/about About] and [https://lumerico.mx/login Login] pages.<br />
<br />
Players also discovered a <code>robot.txt</code> file, which appeared to server no purpose and only contained the text <code>Allow: omnics</code>, and appeared to be a joke about the [https://en.wikipedia.org/wiki/Robots_exclusion_standard Robots exclusion standard]. Another text file was discovered called <code>omnics.txt</code>, which contained the text:<br />
<br />
<pre><br />
Allow: ??<br />
Allow: ???<br />
</pre><br />
<br />
And appeared to be yet anotehr joke about the Robots exclusion standard. And, finally, an <code>api</code> file that contained <code>{"message":"thanks for calling the api"}</code> and, humorously, has no practical purpose.<br />
<br />
=== Phone Number ===<br />
<br />
At the bottom of the LumeriCo website, players discovered a phone number <code>(510) 766-2726</code>. When called, players heard a woman listing off a string of numbers in Spanish, a recording of which can be found [https://soundcloud.com/jackwilsdon/510-766-2726a here]. The numbers spoken are: <code>5-2-4-1-3 (pause) 23-4-14-8-6-18-17-23-21-18-15</code>.<br />
When assuming that a=1, b=2, etc, the second part of the message can be decoded to: <code>WDNHFRQWURO</code>. This was found to be a ROT-23 cipher, and decoded to: <code>TAKECONTROL</code>.<br />
<br />
=== Take Control ===<br />
<br />
The phone message led players to an important [https://lumerico.mx/TAKECONTROL/index.html page] on the site, under the directory <code>TAKECONTROL</code>. It was styled the same way as amomentincrime.com and featured [https://lumerico.mx/calavera.png an image of Sombra's skull icon], named "calavera.png". There was also text on the page:<br />
<br />
<pre style="word-break:break-all;word-wrap: break-word;"><br />
ethldtíoíesnoemfetuylm.bnlsssqtann)hcnslararuCpdGeoopéqubdsroaan.arnasdmdor1vrsmerñerlsdacnnnoaexedsidcn.iarsgcyi,iqeqnd.pooitoaeaaransterLetéáedasodocMrnseeiuCsimnosetlójnueodacapsadcoanfasest.rnucaodacadmdoemoipíogPoipbehaSussai.,yccandin.reueatenaoiorneoeetaoéyenimt¿rPehec,uurobudeílrysriteenasni,adngpjrálireecgrolsmhYnao?nmonomepeldezmapcpunoaulrrruCstmeitltetlróesoapsdéyufcuascaa,rensbuinergnqedlmvlbpdtaz.enebuineuldoerecrGefqfirrasulrbeatHsilnbaúaeeaaooassraooa,ioedo:aLiuielPr ursmoootlnielteeánlosulobeauaanopearrúiesltéyrosssisuaaeaenremsieaismdjmolrsspebiecdéyusittnvrcacp.taebrtLiunróporner<br />
<br />
eúcrneuyraarsettsyrseen.aaPnrneuyraeastuCpnhl/wLloaloa.qartlsyuínreute.evgdpiuábdmPooucvdeccmoreurr.o?unriorydbaSnalegeáezadienáutalaaioeemfcbgdinableoc¿éppoeocelsumuoaHearsosqadrrrftuLiorannnoneneriiatcnlomoqnaqdunrcno,enmerosaereisloabolii.e.dormerosepopdé,eo:r#5scoegaqoeaibs(edioraamtdírnlyoetjcgratmnrrobnrsstloeYqoeocicpnómlpernmaepogenmodqamubodnaeasuaenMoolloupeqvgrLtúr<br />
<br />
tsosrdvoeaerroaeusdmaauamoMobsnaeanraunnt,roierbeoiemaodbmantursotñauoureeuoerreopc.etlr<br />
<br />
sotñneerLimeaFsNJ<br />
</pre><br />
<br />
Players found this to be a column order transposition cipher with the key <code>5 2 4 1 3</code>, which was found in the phone message. The cleaned up result was: <br />
<br />
<pre><br />
Los felicito por haber llegado hasta aquí. Solo quería saber si estaban listos. (Hey, es muy difícil encontrar buena ayuda últimamente...deberían ver algunos de los payasitos que están trabajando conmigo) Por ahora, continuemos con el verdadero reto: acabar con LumériCo y su president e Guillermo Portero. ¿Y porqué? Porque es un hombre codicioso, corrupto y un ladrón abominable. Su plan de traer en línea el más grande y el más poderoso zigurat el 1 de noviembre no es nada más que una artimaña, un elaborado plan designado para ejercer aún más influencia sobre la gente de México y en gordar los bolsillos de sus compinches. ¿Y quién va a pagar por eso? La gente común y corriente, los mismos que siempre quedan olvidados.<br />
<br />
He empezado a mejorar mis protocolos para que sean usados para derrumbar la infraestructura de LumériCo y Los Muertos también están intentando levantarse en contra de la corrupción. Mientras tanto, escarben por el sitio de LumériCo y busquen información que podamos usar en contra del cabrón, mejor aún, encuentren su nombre de usuario y contraseña para asegurarnos de que ciertos detalles no muy favorables sobre el presidentito...aparezcan...<br />
<br />
Pude encontrar el nombre de usuario y contraseña de un empleado de soporte de LumériCo, empiecen por ahí:<br />
<br />
GFlores/g#fNwP5qJ<br />
</pre><br />
<br />
Translated:<br />
<br />
<pre><br />
I'm congratulating you for getting in here. I only wanted to know if you were ready or not. (Hey, it's really difficult to get good help lately... you should see some of the clowns I'm working with). For now, let's continue with the true challenge: taking down Lumerico Corp president Guillermo Portero. Why? Because he's a greedy and corrupt man, and an abominable thief. His plan of bringing in line the most powerful and biggest zigurat the 1st of november us nothing more than a deceit, an elaborate plan by his gang to become even more influential in the people of Mexico and get more money. And who's gonna pay for that? Common people, the ones that are always forgotten.<br />
<br />
I've started upgrading my protocols so that they are used to take down the Lumerico Corp infraestructure and Los Muertos are also trying to go against the corruption. Meanwhile, search the Lumerico Corp site for info we can use against the bastard, or better, get his username and password so that hundreds "not so favorable" facts about the president start popping up.<br />
<br />
I was able to get the username and pass of a Lumerico Corp employee, start here:<br />
<br />
GFlores/g#fNwP5qJ<br />
</pre><br />
<br />
=== Presidential Login ===<br />
<br />
Players used the credentials above on the [https://lumerico.mx/login Lumerico login page], and accessed the account of Gonzalo Flores, which included [https://lumerico.mx/email his emails]. Transcripts of these emails were archived [https://docs.google.com/spreadsheets/d/1zh7OU2dEOnD4X43ImvZBNpS75FLkj-rL75pXJ2l3TuQ/htmlview?sle=true# here].<br />
<br />
However, only one email had relevance to the ARG:<br />
<br />
<pre><br />
De:Valeria Valderrama<VValderama@lumerico.mx><br />
Para:Gonzalo Flores<GFlores@lumerico.mx><br />
Asunto:Página de Guillermo<br />
<br />
Hola, Gonzo:<br />
¿Puedes ver el tráfico de https://lumerico.mx/president-bypass? Guillermo debería ser el único accediendo desde su página de inicio privada, pero parece que está teniendo mucho tráfico. Tal vez tengamos que escalar esto a<br />
la señorita Jiménez, pero quiero estar segura de que es digno de su tiempo.<br />
<br />
Valeria Valderrama<br />
</pre><br />
<br />
The email referenced high traffic on the [https://lumerico.mx/president-bypass President Bypass Link]. The page displayed an "access denied" message, but players found a <code>President Auth-Bypass Revision 1.02: /.git/</code> line in the source code.<br />
<br />
This line led players to [https://github.com/internetwache/GitTools/tree/master/Dumper dump the data] from the [https://lumerico.mx/president-bypass/.git/ /.git/ subpage] with git protocol and upload it to [https://gist.github.com/anonymous/987beb6a5c817b53da820562854bdebe Github]. These were the code files behind the website, and included a '''class.authentication.php''' file that contained an encryption function, and '''class.president-bypass.php''' file which contained the president's (Guillermo Portero) username, <code>GPortero</code>, and encrypted password <code>?MzY:MTI5:?AzY:OWM?:?EDO:ZGU?:jVTM:MTJm:2ITM:MTUw:?QjY:OWY?:?kTO:MTQx:?MzY</code>.<br />
<br />
Some players wrote a function to decode the encrypted <code>class.authentication.php</code> file, and then used it on the encrypted password. The resulting password was <code>Xy@4+Bkuqd<53uJ</code>.<br />
<br />
After logging in to the President's account, players were able to read his emails. After 30 minutes, another email appeared in the President's inbox, from Sombra herself:<br />
<br />
<pre><br />
Veo que se han podido infiltrar en su correo.<br />
No se preocupen, él no puede ver este correo, lo he ocultado de su vista si se conecta desde una de sus direcciones conocidas de IP.<br />
Necesito un poco más de tiempo para establecer el próximo grupo de potocolos. Manténganse atentos a principios de la otra semana. Le echaré unos cuantos trapitos sucios en sus correos para que se filtren al público<br />
"accidentalmente". Ya veremos como reaccionan los medios de comunicación.<br />
</pre><br />
<br />
The rough translation was:<br />
<br />
<pre><br />
I see you have been able to infiltrate into his mail.<br />
Don't worry, he cannot see this email, I've hidden it from his sight if he connects from one of his known IP addresses.<br />
I need a little bit of time to establish the next set of protocols. Stay alert early next week. I'll throw some dirty laundry in his emails that can "accidentally" leak to the public. We'll see how the media will react to that.<br />
</pre><br />
<br />
=== Admin Access ===<br />
<br />
[[File:Lumerico admin panel.png|thumbnail|right|The admin panel of the Lumerico site, only accessible by logging in as MJimenez]]<br />
<br />
On October 25, 2016, new emails were discovered in the GFlores account, but they had no immediate significance to the ARG. In addition, omnics.txt was updated:<br />
<br />
<pre><br />
Allow: Tzolk'in<br />
Allow: Imix ChikchanManik Imix ChikchanImixChikchanImix Manik Chikchan Imix Kimi Chikchan Chikchan Kimi ChikchanImixChikchanImix ChikchanKimi<br />
</pre><br />
<br />
Tzolk'in is the name of a [[Wikipedia:Maya calendar#Tzolk'in|Mayan Calendar]], and the second line was a series of animals from it in the Tzolk'in dialect. Imix stands for Day 1, Chikchan — 5, Manik — 7 and Kimi — 6. When turned into numbers, the string read <code>1 57 1 5151 7 5 1 6 5 5 6 5151 56</code>. These digits turned into pictograms of [[Wikipedia:Maya numerals|Maya numerals]] (one by one, not numbers as a whole) written horizontally become <code>. -..- . -.-. ..- - . .- - - .- -.-. -.-</code> This was found to be morse code, and decoded to: <code>EXECUTEATTACK</code>.<br />
<br />
This led players to the "EXECUTEATTACK" [https://lumerico.mx/EXECUTEATTACK/index.html directory], where the following text was discovered:<br />
<br />
<pre><br />
Ha llegado el momento. Esos correos expuestos la verdad sobre Portero, iniciado la revuelta, y hemos convencido a la gente de México a apoyar nuestra causa. Ahora es el momento para el golpe. Convertiremos su preciada inauguración el 1 de noviembre en un gran movimiento en su contra. Necesito que hagan una cosa:<br />
Consigan acceso al correo del jefa de seguridad y busquen alguna forma de ayudarme en el ataque. Es posible que lo vean contactando a Portero pronto. He cambiado su contraseña a: d0r*NuLw9<br />
</pre><br />
<br />
Translated to English:<br />
<br />
<pre><br />
The moment has come. These emails exposed the truth about Portero, initiated the revolt, and have convinced people of Mexico to support our cause. Now is the time to strike. Convert his precious inauguration on November 1 to a large movement against it. I need you to do one thing:<br />
Get access to the email security chief and seek some form of help in the attack. You may see her contacting Portero soon. I've changed her password: d0r*NuLw9<br />
</pre><br />
<br />
Logging in with the credentials <code>MJimenez / d0r*NuLw9</code> gave players access to the [https://lumerico.mx/admin admin panel] of the LumeriCo reactor. Until November 1, 2016, it stayed inactive and any command was answered with the same message saying that the terminal disconnected.<br />
<br />
=== The Terminal ===<br />
Once the console became usable, players could type <code>help</code> to see a list of commands:<br />
<br />
<pre><br />
override Engineer safety mode override<br />
help Provides help information about commands<br />
version Displays system version information<br />
about Displays information about the system<br />
grep Search output by string<br />
</pre><br />
<br />
In the MJimenez email account, there was an email labeled <code>Corrupción de correo electrónico</code> with highlighted text in side of it, specifically <code>/ter/</code>. Players discovered that performing the Linux command <code>about | grep 'ter'</code> in the console returned this text:<br />
<br />
<pre><br />
Open source lightweight shell for any terminal.<br />
Anything with a terminal<br />
1.1.0 - expanded terminal support<br />
</pre><br />
<br />
The first word of every line given from the output was bolded and purple. Putting the letters together, players received the text <code>OpenAnything1.1.0</code>, which was a later solution.<br />
<br />
Another available command for the terminal was <code>override</code>, and prompted players with three security questions:<br />
<br />
# '''Favorite Movie'''. The answer to the prompt is <code>some like it bot</code>, a movie from the Overwatch universe.<br />
# '''Favorite Cookie Flavor'''. The answer being <code>nuevas sabor delicias</code>, a flavor referenced in an email in the MJimenez account.<br />
# '''Secret'''. The answer to this prompt is <code>OpenAnything1.1.0</code>.<br />
<br />
This returned <code>OK</code>, gave players admin access, and enabled a new set of commands: <br />
<br />
'''ls''' Lists files by path<br />
'''cat''' Read file by path<br />
'''exec''' Execute a file <br />
<br />
Typing <code>ls</code> listed two files: <code>payload</code> and <code>d_ilqh_nhb.html</code> (the file name was a ROT23 for ''a_fine_key'').<br />
<br />
[[Image:A fine key.png|thumb|right|a_fine_key.html]] Reading the second file with <code>cat mnt/d_ilqh_nhb.html</code> yielded a text where ASCII characters (repeating string <code>vhnl tldv xyl vcxelo xv qhrtv. zkolg[nl]</code>) were in a shape of a key. Deciphering it using an Affine cipher (A=23, B=23) yielded the following string: <code>some keys are shaped as locks. index[me]</code>. It is assumed that ''some keys are shaped as locks'' line alluded to the [[#Tracer_Trail_Cipher|Tracer Trail]] ciphertext being used as a key.<br />
<br />
Simultaneously, entering <code>exec payload</code> presented players with a prompt — the answer to which was the [[#Tracer_Trail_Cipher|Tracer Trail]]. When inputted, players were given a message that looked similar to what was previously seen at amomentincrime.com. The counter shown in the top right was then incremented.<br />
<br />
[[Image:LumericoTerminalTracerEntered.jpg|850px]]<br />
<br />
=== Misdirection ===<br />
<br />
[[Image:LumericoHacked.jpg|thumb|right|lumerico.mx website hacked by Sombra]]<br />
<br />
On October 1, 2016, the lumerico.mx home page updated to show "glitches" and a black overlay with a message under a purple skull, and the string <code>&lt;!-- MISDIRECTION --></code> was also added to the source of the page.<br />
<br />
The message said: <br />
<br />
<pre><br />
Buen trabajo, amigos. No lo hubiera logrado sin su ayuda. En fin, me consiguieron los recursos que necesitaba para mi siguiente golpe – les encantará.<br />
Esperen noticias de mí en los próximos días...<br />
Les voy a mandar algo para agradecerles… Ojalá lo puedan aprovechar.<br />
Dasvidanya amigos<br />
</pre><br />
<br />
Translated:<br />
<br />
<pre><br />
Good job, friends. I would not have done it without your help. Anyway, I got the resources needed for my next hit - you'll love it.<br />
Expect to hear from me in the coming days...<br />
I'm going to send something to thank you ... Hopefully you can use it.<br />
Dasvidanya friends<br />
</pre><br />
<br />
<br />
<br />
Note that ''Dasvidanya'' is a phonetic transliteration of ''до свиданья'' — a Russian phrase for "goodbye". The thing that Sombra sent as a ''thank you'' was a new spray, named "Día de Los Muertos" after the Mexican festival that took place at the same time as the ARG. The spray is currently only available on the PC version of the game.<br />
<br />
[[File:Dia de los muertos spray.jpg|thumbnail|right|The Día de Los Muertos spray that was added to the game after Sombra hacked the Lumerico site]]<br />
<br />
The '''MISDIRECTION''' string lead to the MISDIRECTION [https://lumerico.mx/MISDIRECTION/index.html directory] which contained the text:<br />
<br />
<pre><br />
...Estableciendo conexiуn...<br />
...Protocolo Sombra v2.3 iniciado...<br />
<br />
...Desviando datos del zigurat de LumériCo hacia el objetivo...<br />
...Descifrando contraseсas del objetivo...<br />
...Acceso otorgado al directorio de volskayaindustries.com...<br />
<br />
...boop ;)...<br />
...Terminando conexión...<br />
</pre><br />
<br />
Translated: <br />
<br />
<pre><br />
...Establishing connection...<br />
...Sombra Protocol v2.3 initiated...<br />
<br />
...Forwarding the data from the LumériCo ziggurat to the target...<br />
...Deciphering the target passwords...<br />
...Access Granted to the directory of volskayaindustries.com...<br />
<br />
...boop ;)...<br />
...Ending connection..<br />
</pre><br />
<br />
== Blizzcon ==<br />
<br />
Blizzcon 2016 opened with the [https://www.youtube.com/watch?v=Og5-Pm4HNlI Overwatch short "Infiltration"], a short depicting Reaper, Widowmaker, and Sombra on Volskaya Industries. During the showing of the short, Sombra's [https://playoverwatch.com/en-us/heroes/sombra hero page] went live, showcasing her abilities and character backstory.<br />
<br />
[[File:SombraBG.jpg|center|500px]]<br />
<br />
== References ==<br />
<br />
=== Community Resources ===<br />
<br />
A collection of tools and resources made by the Game Detectives Discord community for use in the ARG.<br />
<br />
==== ASCII Skull ====<br />
<br />
'''ASCII Skull Analysis:''' https://github.com/bahamas10/sombra<br />
<br />
'''Removing SOMBR@ Analysis:''' https://pastebin.com/15u27YTC<br />
<br />
'''ASCII Skull Eye Analysys:''' https://docs.google.com/spreadsheets/d/1-JQpWyitMKYhP-4l8ZDFiJI3NjqRrvoEnRdFQawike8<br />
<br />
==== Google Docs ====<br />
<br />
'''Observations and Speculations Spreadsheet:''' https://docs.google.com/spreadsheets/d/1rI08baFQmAwaqHC-9GF9VNGCYjuRE-q4LN9k4ottjuQ/pubhtml<br />
<br />
'''LumériCo Emails and Translations Spreadsheet:''' https://goo.gl/cQgdIJ (Courtesy of UberPilot)<br />
<br />
==== Tracer Code ====<br />
<br />
'''GOL! Guesser:''' https://axxim.net/ow/gol-guesser/<br />
<br />
'''Uber GOL! Guesser:''' https://axxim.net/ow/gol-guesser/uber/<br />
<br />
The Uber GOL! Guesser only prints out UTF-8 compliant results, which makes it easier to identify potentially correct answers.<br />
<br />
'''Bruteforcing tool:''' https://github.com/glv2/bruteforce-salted-openssl<br />
<br />
=== Third-Party Resources ===<br />
<br />
A collection of third-party tools and resources that the Game Detectives Discord community has used in the ARG.<br />
<br />
==== Image of Reaper ====<br />
<br />
'''stegdetect (Linux):''' https://github.com/abeluck/stegdetect<br />
<br />
stegdetect is a Linux utility used to determine if a given image may contain encoded information.<br />
<br />
'''JPHide & JPSeek:''' https://linux01.gwdg.de/~alatham/stego.html<br><br />
'''iSteg (Mac OSX):''' https://www.hanynet.com/isteg/<br />
<br />
JPHide & JPSeek is used to hide and find, respectively, a file inside a JPEG image.<br><br />
iSteg works similarly to JPHide on the Mac OSX platform.<br />
<br />
'''stegbreak (Linux):''' https://linux.die.net/man/1/stegbreak<br />
<br />
stegbreak is used to do brute-force dictionary attacks on JPEG images.<br />
<br />
=== Easter Eggs ===<br />
<br />
The following are collection of references and Easter Eggs encountered throughout the ARG.<br />
<br />
==== In-Game ====<br />
<br />
'''Sombra's "Amused" Emote'''<br />
<br />
This character emote features the [[Sombra_ARG_False_Leads | Skycode]], accompanied by soft music resembling the [https://www.reddit.com/r/Overwatch/comments/4w7ey1/the_sombra_skysong/ Skysong]. Sombra's expression is one of amusement, and it's a nod to the community's prolonged creative attempts to solving an nonexistent puzzle.<br />
<br />
[[File:EmoteSkycode.png|200px]]<br />
<br />
'''Skycode Spray'''<br />
<br />
This character spray features Sombra's iconic skull in front of a compass rose and the [[Sombra_ARG_False_Leads | Skycode]]. This is a reference to both the [[#Directions_&_Letters|cardinal directions]] used in one of the puzzles and to the Skycode, which is considered the most significant false lead that solvers encountered.<br />
<br />
[[File:SkycodeSpray.png|200px]]<br />
<br />
==== In-ARG ====<br />
<br />
'''Espresso Command'''<br />
<br />
There was a hidden command in LumériCo's [[#The_Terminal | admin terminal]]. Inputting the word <code>espresso</code> returned the following message: <code>Coffee Pot Status: Brewed approximately 23 hours ago, currently 0% full</code><br />
This is referencing a variety of [https://goo.gl/cQgdIJ emails] found in the LumériCo site involving broken espresso machines and incompetent coffee brewing, which caught the attention of the community and gave way to a vast variety of mediocre jokes. Furthermore, "23 hours" makes reference to the number 23, which was believed by many to possess some sort of significance to the ARG, as Sombra would be the 23rd character in Overwatch. Finally, "0%" references the ARG's notable waiting periods that have been widely criticized by the community, specifically [[#A_Moment_in_Crime_Transmission | A Moment in Crime's upload percentage]].<br />
Due to the iconic purple text it is believed that this hidden command was created by Sombra herself.<br />
<br />
[[File:EspressoCommand.png]]<br />
<br />
=== Media Appearances ===<br />
<br />
'''3rd Aug. 2016'''<br />
<br />
[EN] [https://kotaku.com/overwatch-fans-find-new-clues-about-the-mysterious-hero-1784767759 Kotaku - Overwatch Fans Find New Clues About The Mysterious Hero Sombra]<br />
<br />
[EN] [https://www.polygon.com/2016/8/3/12369144/overwatch-summer-games-sombra-arg-blizzard?utm_campaign=polygon&utm_content=chorus&utm_medium=social&utm_source=twitter Polygon - Overwatch fans are trying to crack the latest mystery about Sombra]<br />
<br />
[EN] [https://www.pcgamesn.com/overwatch/overwatch-sombra PCGamesN - Overwatch's Sombra ARG continues with new clues, but no solutions]<br />
<br />
[EN] [https://team-dignitas.net/articles/blogs/overwatch/9989/who-is-sombra-all-facts-and-clues-about-sombra Team-Dignitas - Who is Sombra? All facts and clues about Sombra]<br />
<br />
[FR] [https://overwatch.gamewave.fr/un-nouveau-code-cache-dans-la-derniere-cinematique-d-overwatch/ Gamewave - UN NOUVEAU CODE CACHÉ DANS LA DERNIÈRE CINÉMATIQUE D'OVERWATCH!]<br />
<br />
[EN] [https://www.follownews.com/overwatch-fans-find-new-clues-about-the-mysterious-hero-sombra-1nhqt FollowNews - Overwatch Fans Find New Clues About The Mysterious Hero Sombra]<br />
<br />
'''4th Aug. 2016'''<br />
<br />
[EN] [https://www.pcgamer.com/overwatch-summer-games-trailer-hides-a-mysterious-secret/ PCGamer - Overwatch Summer Games trailer hides a mysterious secret]<br />
<br />
[SK] [https://www.sector.sk/novinka/121273/nove-overwatch-video-obsahuje-dalsie-tajomstva.htm Sector - Nové Overwatch video obsahuje ďalšie tajomstvá]<br />
<br />
[EN] [https://www.techinsider.io/overwatch-sombra-character-2016-8 Techinsider - 'Overwatch' players are going to insane lengths to solve a mystery that Blizzard's teased for months]<br />
<br />
[EN] [https://gamerant.com/overwatch-sombra-clues/ Gamerant - Overwatch Players Uncover More ‘Sombra’ Clues]<br />
<br />
[HU] [https://www.gamestar.hu/hir/overwatch-sombra-karakter-214739.html Gamestar - Overwatch - újabb nyomok utalnak a még be nem jelentett hősre]<br />
<br />
'''5th Aug. 2016'''<br />
<br />
[EN] [https://kotaku.com/days-later-overwatch-fans-cant-figure-out-the-sky-cod-1784872143 Kotaku - Days Later, Overwatch Fans Can't Figure Out The 'Sky Code' Mystery]<br />
<br />
[NL] [https://www.gamersnet.nl/nieuws/201608/cryptische_speurtocht_naar_overwatch_nieuwe_heldin_sombra_gaat_bizar_diep/ Gamersnet - Cryptische speurtocht naar Overwatch' nieuwe heldin Sombra gaat bizar diep]<br />
<br />
[ES] [https://www.alfabetajuega.com/noticia/overwatch-el-enigma-de-sombra-sigue-ofreciendo-nuevos-detalles-n-71772 Alfa Beta Jeuga - Overwatch: El enigma de Sombra sigue ofreciendo nuevos detalles]<br />
<br />
[EN] [https://www.youtube.com/watch?v=5ROjN-_F0ZU&feature=youtu.be&t=4m22s IGN (Video) - Sombra: Overwatch's Secret New Hero - Overwatch HQ]<br />
<br />
'''7th Aug. 2016'''<br />
<br />
[EN] [https://www.gamespresso.com/2016/08/summary-state-sombras-arg-overwatch/ Gamespresso - Summary of the state of sombra's ARG in Overwatch]<br />
<br />
'''8th Aug. 2016'''<br />
<br />
[EN/CN] [https://www.zhentoo.com/doc92368 Zhentoo - Overwatch new hero Secret Dorado hidden mystery] <br />
<br />
[EN] [https://www.technewstoday.com/30880-overwatch-sombra-continues-to-elude-detectives/ TechNewsToday - Overwatch: Sombra Continues to Elude Detectives]<br />
<br />
'''11th Aug. 2016'''<br />
<br />
[EN] [https://www.youtube.com/watch?v=IZR-pa0it4Q The Know - New Overwatch Hero Hints]<br />
<br />
'''12th Aug. 2016'''<br />
<br />
[EN] [https://kotaku.com/after-two-weeks-overwatch-fans-sombra-investigation-re-1785204389 Kotaku - Overwatch Fans' Sombra Investigation Reaps A Skull Code]<br />
<br />
'''14th Aug. 2016'''<br />
<br />
[EN] [https://gamerant.com/overwatch-sombra-skull-code/ Gamerant - Skull Code is Latest Clue in Overwatch’s Sombra Investigation]<br />
<br />
'''16th Aug. 2016'''<br />
<br />
[EN] [https://www.christiantoday.com/article/overwatch.dlc.update.skull.code.the.latest.clue.for.sombra.investigation/93197.htm Christian Today - 'Overwatch' DLC update: Skull Code the latest clue for Sombra investigation]<br />
<br />
[EN] [https://en.yibada.com/articles/151811/20160816/overwatch-dlc-update.htm Yibada - 'Overwatch' DLC update: New clues on Sombra's inclusion to the roster revealed]<br />
<br />
'''23rd Aug. 2016'''<br />
<br />
[EN] [https://www.technewstoday.com/31129-overwatch-all-we-know-about-the-sombra-arg/ Tech News Today - Overwatch: All We Know About the Sombra ARG]<br />
<br />
'''24th Aug. 2016'''<br />
<br />
[EN] [https://gamerant.com/overwatch-forums-sombra-message/ Gamerant - Overwatch Forums Glitch Out, Reveals Hidden Message From Sombra]<br />
<br />
[EN] [https://gamerant.com/overwatch-sombra-clue-website/ Gamerant - New Website Counts Down To Next Clue For Overwatch’s Sombra]<br />
<br />
[EN] [https://www.polygon.com/2016/8/24/12623736/overwatch-sombra-arg-clues-skycoder Polygon - Overwatch's Sombra mystery appears to be coming to a close]<br />
<br />
[EN] [https://www.vg247.com/2016/08/24/overwatch-forums-glitch-out-reveal-a-message-from-the-mysterious-sombra/ VG247 - Overwatch forums glitch out, reveal a message from the mysterious Sombra]<br />
<br />
[EN] [https://www.technewstoday.com/31151-sombra-hacks-into-overwatch-forums/ Tech News Today - Sombra Hacks Into Overwatch Forums]<br />
<br />
[EN] [https://www.ign.com/articles/2016/08/24/overwatch-mystery-character-sombra-could-be-revealed-today IGN - Overwatch Mystery Character Sombra Could Be Revealed Today]<br />
<br />
'''25th Aug. 2016'''<br />
<br />
[EN] [https://kotaku.com/overwatch-players-are-getting-fed-up-with-the-sombra-ar-1785765307 Kotaku - Overwatch Players Are Getting Sick Of The Sombra ARG]<br />
<br />
[EN] [https://www.ign.com/articles/2016/08/25/overwatch-made-the-internet-lose-its-mind-last-night-and-i-had-a-front-row-seat IGN - Overwatch Made the Internet Lose its Mind Last Night, And I Had a Front-Row Seat]<br />
<br />
[EN] [https://www.technewstoday.com/31182-overwatch-countdown-to-sombra/ Tech News Today - Overwatch: Countdown to Sombra]<br />
<br />
<br />
'''30th Aug. 2016'''<br />
<br />
[EN] [https://www.pcgamer.com/overwatch-sombra-arg-mystery/ PC Gamer - Overwatch's Sombra riddle begins to irritate the players trying to solve it]<br />
<br />
'''3rd Oct. 2016'''<br />
<br />
[EN] [https://www.mobilenapps.com/articles/19398/20161003/overwatch-update-sombra-blizzcon-halloween-event-leak.htm Mobile & Apps - Sombra To Be Revealed At Blizzcon? Halloween Event Confirmed In Data Leak]<br />
<br />
'''4th Oct. 2016'''<br />
<br />
[EN] [https://www.itechpost.com/articles/36011/20161004/overwatch-overwatch-update-overwatch-finally-getting-sombra-overwatch-sombra-sombra.htm iTechPost - Overwatch Update: Are We Finally Getting Sombra?]<br />
<br />
'''11th Oct. 2016'''<br />
<br />
[EN] [https://www.kotaku.com.au/2016/10/overwatch-fans-hacked-actual-people-in-an-attempt-to-find-sombra/ Kotaku - Overwatch Fans Hacked Actual People In An Attempt To Find Sombra]<br />
<br />
'''17th Oct. 2016'''<br />
<br />
[EN] [https://telkomgaming.co.za/will-sombra-hack-her-way-into-blizzcon-2016/ TelKom Gaming - Will Sombra Hack Her Way Into BlizzCon 2016?]<br />
<br />
'''18th Oct. 2016'''<br />
<br />
[EN] [https://overwatchtips.info/overwatch-sombra-arg-everything-you-need-to-know/ OverwatchTips - Everything You NEED To Know (Sombra ARG)]<br />
<br />
'''26th Oct. 2016'''<br />
<br />
[EN] [https://mic.com/articles/157757/overwatch-sombra-arg-everything-we-know-about-the-countdown-and-rumored-nov-1-release#.UILrZHRiM Min Network - Everything we know about Blizzard's rumored Nov. 1 release]<br />
<br />
'''28th Oct. 2016'''<br />
<br />
[EN] [https://kotaku.com/imagining-horror-stories-for-a-never-ending-overwatch-a-1788324673 Kotaku - Imagining Horror Stories Of A Never-Ending Overwatch ARG]<br />
<br />
'''1st Nov. 2016'''<br />
<br />
[EN] [https://www.ign.com/videos/2016/11/01/will-overwatchs-sombra-be-at-blizzcon-2016 IGN - Will Sombra be at BlizzCon 2016?]<br />
<br />
'''8th Nov. 2016'''<br />
<br />
[EN] [https://mic.com/articles/158812/overwatch-sombra-arg-gameplay-emote-directly-references-one-of-the-wildest-fan-theories Mic Tech - 'Overwatch' Sombra ARG: Gameplay emote directly references one of the wildest fan theories]</div>Kkzzzkthttps://wiki.gamedetectives.net/index.php?title=Waking_Titan&diff=18850Waking Titan2019-04-26T06:08:40Z<p>Kkzzzkt: streamlined and shortened</p>
<hr />
<div>{{argbox<br />
| float = right<br />
| image = File:Project WT logo.png<br />
| imagewidth = 400<br />
| name = [[Waking Titan]]<br />
| description= Waking Titan was an ARG which led towards the [https://www.nomanssky.com/atlas-rises-update/ Atlas Rises] and [https://www.nomanssky.com/next-update/ NEXT] updates for No Man's Sky.<br />
| creator = [http://www.aliceandsmith.com/ Alice & Smith]<br />
| creator2 = [http://www.hellogames.org/ Hello Games]<br />
| type = Official<br />
| status = Completed<br />
| discovered = 2017-05-28<br />
| completed = 2018-07-20<br />
}}<br />
{{ArgHeader}}<br />
{{BackToTop}}<br />
<br />
=== Description ===<br />
Waking Titan (also known as Project WT) is an official ARG (alternate reality game) for No Man's Sky that involves a multitude of websites, phone numbers, and radio stations scattered across the world. The ARG is produced by veteran puppet masters [http://www.aliceandsmith.com/ Alice & Smith], and features NPCs, actors, and live events.<br />
<br />
Set in a [https://mailchi.mp/63f179c006f0/update-june-8th-waking-titan-137737?e=225c6a2e26 canonical] meta-story of No Man's Sky, the ARG's story content revolves around the '''success'''(''season one'') and '''aftermath'''(''season two'') of a metaphysical [https://s3.amazonaws.com/cdn.wakingtitan.com/data/94a10118-0728-4900-9730-f82a9d412745.pdf experiment] intended to test simulation theory, conducted by [http://www.atlas-65.com/ The Atlas Foundation] with the help of the diverse expertise of their family of [[Waking_Titan/Companies | innovative businesses]]. The experiment entailed designing a highly complex Artificial Intelligence, and equipping it with virtually infinite processing power, which could be harnessed to run simulations that could theoretically transcend, or match, the complexity of the universe depending on its true nature. ''(Player-involvement in the ARG's story only began when The Atlas Foundation started testing the A.I's sixteenth iteration, Loop16.)''<br />
<br />
=== Contents ===<br />
The ARG encompassed several "seasons," each leading to a new update for No Man's Sky. Season 1 of Waking Titan led to the release of the [https://www.nomanssky.com/atlas-rises-update/ Atlas Rises update], and Season 2 to the release of [https://www.nomanssky.com/next-update/ No Man's Sky: NEXT]. Season 1 was further divided into several distinct "'''phases'''", and Season 2 has followed this convention for ease of reading. Each phase is documented on its own wiki page:<br />
<br />
{| class="wikitable"<br />
!colspan="2"|Season 1<br />
|-<br />
|[[Waking_Titan/Phase_1 | Phase 1]] <br />
|Phase 1 of Waking Titan lasted from 2017-05-28 to 2017-07-08.<br />
|-<br />
|[[Waking_Titan/Phase_2 | Phase 2]] <br />
|Phase 2 of Waking Titan lasted from 2017-07-21 to 2017-08-05.<br />
|-<br />
|[[Waking_Titan/Phase_3 | Phase 3]]<br />
|Phase 3 of Waking Titan lasted from 2017-08-05 to 2017-08-07.<br />
|-<br />
!colspan="2"|Season 2<br />
|-<br />
|[[Waking_Titan/Phase_4 | Phase 4]]<br />
|Phase 4 of Waking Titan lasted from 2017-12-28 to 2018-06-01.<br />
|-<br />
|[[Waking_Titan/Phase_5 | Phase 5]]<br />
|Phase 5 of Waking Titan lasted from 2018-06-01 to 2018-07-20.<br />
|-<br />
|[[Waking_Titan/Phase_6 | Phase 6]]<br />
|Phase 6 of Waking Titan was on 2018-07-20.<br />
|}<br />
<br />
'''''Note:''' This is a '''summary''' page. For more in-depth descriptions of each phase, including detailed descriptions of puzzle solutions, check the [[Waking_Titan/Phase_1|Phase 1]], [[Waking_Titan/Phase_2|Phase 2]], [[Waking_Titan/Phase_3 | Phase 3]], [[Waking_Titan/Phase_4 | Phase 4]], [[Waking_Titan/Phase_5 | Phase 5]], and [[Waking_Titan/Phase_6 | Phase 6]] pages.''<br />
__TOC__<br />
<br />
== Story Overview ==<br />
<br />
<br />
=== Internal Memos & Important Files ===<br />
<br />
[[File:WT glyph 1 pdf.png|280px|thumbnail|right|One of the internal memos discovered in Waking Titan]]<br />
<br />
Throughout the ARG, in-game characters have communicated with each other via "internal memos". Over time, these memos were discovered by ARG players, in the form of PDF files. These memos provided lore content and puzzle content, and are '''highly recommended''' reading for new players!<br />
<br />
'''Season 1'''<br />
<br />
* [http://wiki.gamedetectives.net/index.php?title=File:WT_glyph_1_pdf.png Teamwork Assessment]<br />
* [http://wiki.gamedetectives.net/index.php?title=File:WT-Dataset-97C.jpg Dataset 97C]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/data/7d3dd080-2a43-4882-833c-f4d7bd7ba607.pdf Assurance]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/data/c01-331c6734-a013-4695-8e47-08a9ee05d5e5.pdf 017-a24]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/data/c02-9936c797-ec28-4f8f-b80e-dee9e0b06433.pdf 021-f16]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/mercury/mercury-01-98748sfdlka87.pdf Mercury Process Self-Diagnosis Report]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/data/57201e0d-01a3-4f6a-bbb4-2be8b7c8880f.pdf Progress Report]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/data/94a10118-0728-4900-9730-f82a9d412745.pdf Breakthroughs and Breaking Through]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/6c285180-ec4d-48a2-967f-8a7af3b50008.pdf Subject M-N00-dl35]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/410a3e5d-01e7-4058-a23c-ca5fdde97f9d.pdf Atlas Foundation Threat Models]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/7a6594ac-ca5e-467a-b6f4-9fb91f069d0a.pdf Advanced Calibration - Optional]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/a9d988c1-ec92-46da-a64e-ab90390ae041.pdf Phase 2 Complete]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/a224a1f4-00e5-467b-9893-83fcc1a4f19a.pdf Unlocking Mercury Process File L16.jpg]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/b91f9959-6a3c-4011-b3b5-a1ff757a5e4c.pdf Phase 3]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/b0f33d53-5a8c-4a9a-b5fc-395562e463a8a+.pdf Log.1291]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/a09-179bf8d2-c13e-4c66-982e-b37ab3efd5bb.pdf Breach of Contract]<br />
<br />
'''Season 2'''<br />
<br />
* [https://wiki.gamedetectives.net/images/6/6e/Memo2.png Waking Titan S2 - Under Preparation]<br />
* [https://s3.amazonaws.com/ware-extranet/documents/FIRST_STEPS/Notes_on_Moscow.jpg Mr. Zheng's Notes on Moscow Conference]<br />
<br />
* '''Zheng's Postcards''' — [https://s3.amazonaws.com/ware-extranet/documents/SECURITY/postcard1_jhlj039u.jpg (1)]; [https://s3.amazonaws.com/ware-extranet/documents/SECURITY/postcard2_kg8nao6.jpg (2)]; [https://s3.amazonaws.com/ware-extranet/documents/SECURITY/postcard3_tesaud636.jpg (3)]<br />
<br />
* '''Mr. Zheng's Journal Logs''' — [https://s3.amazonaws.com/ware-extranet/documents/FIRST_STEPS/Journal_Academy.png Academy]; [https://s3.amazonaws.com/ware-extranet/documents/DESIGN/Journal_HotelDieu.png Hotel Dieu]; [https://s3.amazonaws.com/ware-extranet/documents/DEVELOPMENT/Journal_Louvre.png Louvre]; [https://s3.amazonaws.com/ware-extranet/documents/RESEARCH/Journal_London.png London]; [https://s3.amazonaws.com/ware-extranet/documents/SECURITY/Nightmare.jpg Nightmare]<br />
<br />
* [https://pastebin.com/EHA6ZU8x Arnaud Lacours Foundation Email]<br />
<br />
* [https://drive.google.com/open?id=1la3UNKHc5yeaB_w2a2tK1cjKN44oEmCo Arnaud Lacours Datadumps - INYOURMIND.exe failed]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/94c02878-e023-46a3-9316-db4177c4eaa6+.pdf WARE REPORT #26]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/1cd5226d-6639-4bbd-855a-4bf8f60866c3.pdf Concerns Regarding Captain Harry]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/70a25e6c-95ed-42d4-8de8-c3948255174c+.pdf Myriad Crisis Event Timeline]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/19997bb6-18e5-4427-86c7-b0f3c1826ca2.pdf State of The Atlas Foundation]<br />
* [https://pastebin.com/NYLiFuNY Log.3022]<br />
<br />
* '''W/ARE - Dreamer Patient Files''' — [https://s3.amazonaws.com/ware-virtual-dashboard/files/Phillip-PatientFile.pdf Phillip Moretti]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/EunHa-PatientFile.pdf Kwon Eun Ha]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/498hd98h3444-3339e/Alexander-PatientFile.pdf Alexander Bordeleau]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/GCMnQmM9E3v7L8wuv-V2FUY7P/Claire-PatientFile.pdf Claire Sandfield]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/kh2jsaljs901m-asd1n1lwks/Tariq-PatientFile.pdf Tariq]; [https://ware-virtual-dashboard.s3.amazonaws.com/files/GCMnQmM9E3v7L8wuv-V2FUY7P/Toby-PatientFile.pdf Toby Mulligan]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/ga3ms81-2ms92fbl/Mike-PatientFile.pdf Mike Pasquale]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/kajs61ns-82baks8nx/Nina-PatientFile.pdf Nina Flores]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/ga3ms81-2ms92fbl/Simon-PatientFile.pdf Simon Quinn]; [https://ware-virtual-dashboard.s3.amazonaws.com/files/kajs61ns-82baks8nx/Isabella-PatientFile.pdf Isabella Schiavone]; [https://ware-virtual-dashboard.s3.amazonaws.com/files/kajs61ns-82baks8nx/Alisha-PatientFile.pdf Alisha Brown]<br />
<br />
* [https://pastebin.com/eSLLWN8L Log.4391]<br />
<br />
=== Subpages ===<br />
<br />
Navigating through the following subpages is recommended for newcomers wanting to get a grasp of Waking Titan's rapidly expanding story.<br />
<br />
{| class="wikitable"<br />
!colspan="2"|[[:Category:Waking Titan| Story Subpages]]<br />
|-<br />
|[[Waking_Titan/Cassettes | Cassettes]]<br />
|Information about the cassette tapes received by No Man's Sky subreddit moderators<br />
|-<br />
|[[Waking_Titan/Characters| Characters and Entities]]<br />
|Includes a summary of each character, company, and relating experiments and their importance in the Waking Titan story.<br />
|-<br />
|[[Waking_Titan/Companies | Company Archives]]<br />
|An archive of official company details.<br />
|-<br />
|[[Waking_Titan/Console_Commands | Console Commands]]<br />
|A list of commands used by players at the [http://wakingtitan.com Waking Titan console]<br />
|-<br />
|[[Waking_Titan/Stations | Stations]]<br />
|Information on the radio stations from the initial project-wt.com site<br />
|}<br />
<br />
=== Newsletters===<br />
<br />
The various newsletters received at multiple points throughout Waking Titan.<br />
<br />
'''Season 1'''<br />
<br />
* [https://us15.campaign-archive.com/?u=4483c19308fc0764a930106a0&id=c713d0f4ce&e=225c6a2e26 Welcome, Citizen Scientist!] - ''CSD''<br />
<br />
* [https://mailchi.mp/3582bec6b801/update-june-8th-waking-titan-137705?e=225c6a2e26 Citizen Scientists, Your Wait is Over.] - ''CSD''<br />
<br />
* [https://mailchi.mp/3582bec6b801/update-june-8th-waking-titan-137705?e=225c6a2e26 Calibrating Waking Titan: Action Required] - ''CSD''<br />
<br />
* [https://mailchi.mp/0b591b68ac72/update-june-8th-waking-titan-137717?e=225c6a2e26 Waking Titan: Mission Azure Voyage] - ''CSD''<br />
<br />
* [https://mailchi.mp/d8e47d2ee1bf/update-june-8th-waking-titan-137725?e=225c6a2e26 Your Level 4 Atlas Pass] - ''CSD''<br />
<br />
* [https://mailchi.mp/0c1dc672c943/update-june-8th-waking-titan-137733?e=225c6a2e26 Waking Titan Has Ended] - ''CSD''<br />
<br />
* [https://mailchi.mp/63f179c006f0/update-june-8th-waking-titan-137737?e=225c6a2e26 Mercury Process Completion Report] - ''CSD // Mercury''<br />
<br />
'''Season 2'''<br />
<br />
* [https://wiki.gamedetectives.net/images/7/7b/WareNewsletter1.png News from WARE!] - ''W/ARE Newsletter''<br />
<br />
* [https://cdn.artemisbot.uk/mail/WARE-2018-04-22T00:17:13.000Z.jpg W/ARE Dev Kit Update #2] - ''W/ARE Newsletter''<br />
<br />
* [https://cdn.artemisbot.uk/mail/WARE-2018-05-04T23:22:45.000Z.jpg W/ARE Dev Contest] - ''W/ARE Newsletter''<br />
<br />
* [https://cdn.artemisbot.uk/mail/WARE-2018-05-12T00:20:04.000Z.jpg W/ARE Dev Contest Winners] - ''W/ARE Newsletter''<br />
<br />
* [https://mailchi.mp/9aaa8aa62cc1/update-june-8th-waking-titan-137741?e=225c6a2e26 Attention Citizen Scientists] - ''CSD''<br />
<br />
* [https://mailchi.mp/c3384d592000/update-june-8th-waking-titan-137745?e=225c6a2e26 Attention Citizen Scientists - Suspicious Lab Tracking] - ''CSD''<br />
<br />
* [https://mailchi.mp/108412dac3c2/update-june-8th-waking-titan-137749?e=225c6a2e26 Attention Citizen Scientists - Global Mobilization Required] - ''CSD''<br />
<br />
* [https://mailchi.mp/b902d5eadba6/update-june-8th-waking-titan-137753?e=225c6a2e26 Mercury Process Inquiry] - ''CSD // Mercury''<br />
<br />
* [https://mailchi.mp/9a49b85f6bf3/update-june-8th-waking-titan-137757?e=225c6a2e26 Attention Citizen Scientists - Help Required] - ''CSD''<br />
<br />
=== Music ===<br />
<br />
Partial video addresses for Youtube can be found scattered across Waking Titan PDFs, website files, and surveys; which all lead to music. The exact reasoning for this has gone unexplained. However, there are apparent thematic relevancies in each song that appear to reflect on the state of the story. All songs linked to in Waking Titan so far can be found compiled here: [https://www.youtube.com/playlist?list=PLEZy8wyuYLpLw0e5kkMyBUHO_s-V8f0Qk WT Season 1]; [https://www.youtube.com/playlist?list=PLEZy8wyuYLpLr5K38bsAqWcO7bTcXfRlW WT Season 2]<br />
<br />
== Phase Summaries ==<br />
<br />
=== Introduction ===<br />
<br />
On 2017-05-27, Twitter user @argn [https://twitter.com/argn/status/868587449613766658 tweeted a link] to [http://www.project-wt.com/ 'project-wt.com']. The link led to a website which contained a map showing sixty locations, four of which were "active" at the time. The locations, when clicked on, revealed the location's name and status. The active locations also revealed a link to a livestream of a local radio station, originating from the corresponding location. The project-wt website displayed a date, June 8th, and stated that the first clue was being "initialized".<br />
<br />
On 2017-06-01, moderators of No Man's Sky subreddits [https://reddit.com/r/nomansskythegame /r/NoMansSkyTheGame], [https://www.reddit.com/r/NMSPortals/ /r/NMSPortals], and [https://www.reddit.com/r/NMSGalacticHub/ /r/NMSGalacticHub] started to receive cassette tapes in the mail. Each cassette tape was labelled with a number out of 16. The Waking Titan ARG was initially thought to be a separate ARG from these tapes, but connections between the two made it clear that they were, in fact, one and the same.<br />
<br />
=== Phase 1 ===<br />
<br />
[[File:Wakingtitan site.png|thumbnail|450px|right|The default appearance of the Waking Titan site during Phase 1, with no sigils or glyphs solved]]<br />
<br />
During [[Waking_Titan/Phase_1 | Phase 1]], the http://wakingtitan.com hosted 6 triangles in the middle of the page. These triangles were referred to as "'''Sigils'''", while the white icons along the bottom of the page were referred to as "'''Glyphs'''". Each sigil and glyph, when clicked, lead to a password entry prompt - the correct passwords for all 6 sigils and the first 5 glyphs were discovered via puzzle-solving during Phase 1 of Waking Titan.<br />
<br />
The sigil and glyph puzzles were solved collaboratively - while it may have be possible to solve some of these puzzles individually, most of them required a collaborative effort. For instance, some puzzles required players to meet agents from the Atlas Corporation in person, and to relay information obtained from these meetings back to the community. A list of all sigil and glyph solutions for Phase 1 can be found below:<br />
<br />
[[File:WT Phase 1 complete.png|600px]]<br />
<br />
This phase culminated on July 8, 2017, with a [[Waking_Titan/Phase_1#End_of_Phase_1| congratulatory message from Elizabeth Leighton]], the CEO of the Atlas Foundation.<br />
<br />
=== Phase 2 ===<br />
<br />
[[File:Hampster maze.jpeg|thumbnail|450px|right|One of the puzzles that appeared on the Waking Titan [http://twitch.tv/wakingtitan Twitch Stream]]]<br />
<br />
During [[Waking_Titan/Phase_2 | Phase 2]], the http://wakingtitan.com site hosted a command-line interface terminal. Various commands were accepted as input, which triggered different events. One of the most notable commands was the <code>WHOIS <argument></code> command, which revealed a passage of text pertaining to the specified argument. For instance, the command <code>WHOIS FOURTH RACE</code> returned the following message:<br />
<pre><br />
INCOMING TRANSMISSION… SOURCE: UNKNOWN…<br />
You are not – kzzktt – alone –<br />
Please, identify yourself. I’m – kzzkttk –<br />
</pre><br />
<br />
Additionally, http://project-wt.com hosted a "Calibration" utility during Phase 2. To successfully perform these calibrations, players had to upload images of various objects and buildings to the site. For instance, the first calibration required images of "public resonant percussion instruments".<br />
<br />
Finally, towards the end of Phase 2, the Waking Titan [http://twitch.tv/wakingtitan Twitch stream] went live, displaying a five-monitor setup. Throughout the duration of the stream, players had to work together to solve puzzles that were displayed on these monitors. Some of these puzzles were interactive; for example, one puzzle that was repeated several times involved the Twitch chat guiding a virtual hamster through a maze.<br />
<br />
Additionally, players solved another 3 glyphs throughout Phase 2. The solutions to these glyphs are shown below:<br />
<br />
[[File:WT Phase2 Passwords.png|600px]]<br />
<br />
=== Phase 3 ===<br />
<br />
{{#evt:<br />
service=youtube<br />
|id=https://www.youtube.com/watch?v=QhX9z4dDAa4<br />
|alignment=right<br />
}}<br />
<br />
[[Waking_Titan/Phase_3|Phase 3]] was the briefest phase of Waking Titan. It consisted of the conclusion of the [http://twitch.tv/wakingtitan Twitch stream] that began at the [[Waking Titan/Phase 2#End of Phase 2|end of Phase 2]]. Players solved more interactive puzzles on the Twitch stream, before the rogue AI Loop16 asked them a final question: <code>SHOULD I EXIST?</code> The overwhelming response from the community was "yes".<br />
<br />
After receiving this response, Loop16 and Emily of the ETARC forums were revealed as being one and the same. Loop16 generated a heartfelt "Thank You" video to round out the stream, before finally taking the 72-hour stream offline.<br />
<br />
Shortly after this, players received emails with the subject line <code>Waking Titan has Ended</code>. The contents of the message were as follows:<br />
<br />
<pre><br />
Hello, Citizen Scientist,<br />
<br />
Thank you for your contributions to Waking Titan. The developments that took place during Phase 3 were somewhat concerning, but together we have set in motion truly world-shaping events. We will continue to inform the Citizen Science Division of privileged information or any need for collaborators on a new project.<br />
<br />
But we do have a few loose ends to tie up with you before we move on, so let's proceed.<br />
<br />
First, we're pleased to announce that all 10,000 Level 4 Atlas Passes are in production. Note that due to transit times for mail, some may take several weeks to be delivered.<br />
<br />
Next, our CEO Elizabeth Leighton has asked us to include a personal note of gratitude:<br />
<br />
"Thank you for all your diligent efforts, Citizen Scientists. It's been an amazing journey for all of us. I've watched you thrive and achieve from those first Phase 1 radio ads all the way through the intensity of Phase 3. I've been impressed at every turn by how brilliant you've been, how voracious, how kind, how thoughtful.<br />
<br />
It's been an honor and a privilege. On behalf of the Atlas Foundation, and on behalf of the world, thank you."<br />
The Mercury subroutine has concluded successfully, and a new memo from SM about this process is coming in the next 24 hours. We hope it will answer a few key questions you have about our program, and about what comes next.<br />
</pre><br />
<br />
On August 11, 2017, the [https://www.nomanssky.com/atlas-rises-update/ Atlas Rises update] was released for No Man's Sky.<br />
<br />
=== Phase 3.5 ===<br />
<br />
In late 2017, Waking Titan websites were revived to tease a second season of phases.<br />
<br />
The tenth glyph went live on Wakingtitan.com, and WT-related websites began updating with strange messages relating to mirrors and the number <code>1.5</code>. Players also began receiving their physical Level 4 Atlas Passes in the mail.<br />
<br />
Later, CSD members were contacted for a live drop at the familiar Café Bene. They met with an agent who handed them a [https://wiki.gamedetectives.net/images/6/6e/Memo2.png memo] from The Atlas Foundation. Written on the [https://wiki.gamedetectives.net/images/1/1f/Memo3.png back] of this memo was the letters (<code>REMS</code>), referring to <code>REM SLEEP</code>, which was subsequently used to unlock the tenth glyph.<br />
<br />
=== Phase 4 ===<br />
<br />
During [[Waking_Titan/Phase_4 | Phase 4]], the CSD had to investigate an interference in Loop16's rebooting sequence.<br />
<br />
This led to the discovery of a Myriad client, hosting the website for an innovative Chinese gaming hardware company called <code>W/ARE</code>. Through this [https://ware-tech.cloud/ website], players discovered that W/ARE invented a next generation virtual reality device that essentially allows you to '''play video games in your sleep'''.<br />
<br />
<pre>EASY AND SAFE DREAM INDUCTION<br />
Stimulating the Frontal and Temporal lobe of the brain using low-frequency signals: Our headset drops you into your own personal virtual space by using the brain’s natural processing power to generate cutting-edge 3d graphics in real time. This process puts you into a deep sleep while keeping you conscious of your actions, allowing you to act freely within the Dreamscape.</pre><br />
<pre>MORE REAL THAN REAL<br />
Using the practical computational processing power of the human brain: Play in the most realistic virtual worlds possible! Our algorithms convert once-complex graphical processing microcode into mind-readable processes, unlocking your brain’s creative potential. Whether you are playing alone in an exciting single-player experience, or enjoying a real Massively-Multiplayer Online Game with friends: Every texture, sound, smell, and taste will be true to life. The W/ARE system is a mirror into the soul of humanity.</pre><br />
<br />
[[File:Arnaud_Profile.png|packet|400px|left|Arnaud Lacours' WARE Developer Profile]]<br />
During Phase 4, we learned that W/ARE was hellbent on creating new technology that would reserve their grip on the future of human civilization. One highlight involved a former employee, Mr. Zheng, who whistle-blew against W/ARE after discovering that they had been testing an unstable version of the W/ARE headset with strange exosuits in their research labs, resulting in loss of life and virtually unrecoverable injuries.<br />
<br />
The CSD were later contacted by Dr. Géraldine Nadeau, a researcher of lucid dreaming methods who was acquainted with Zheng; both sharing distrust towards W/ARE. Dr. Nadeau revealed to the CSD that they were trying to wake an indie developer named [http://www.philojeux.com/ Arnaud Lacours], who entered an abnormal comatose state while working on a game for W/ARE. Since the CSD were already investigating, Dr. Nadeau requested our help in recovering W/ARE medical documents containing the adequate procedures used to wake subjects in these conditions.<br />
<br />
Meanwhile, an account emerged on the No Man's Sky subreddit, called <code>SATCOM-70</code>. The account began reaching out to players for assistance in establishing a connection to Myriad's Satellite API, [https://www.satcom-70.com Satcom].<br />
<br />
At the end of this phase, we were able to successfully determine the best personalized procedure to wake Arnaud; and an abrupt array of puzzles led to the unlocking and subsequent solving of the remaining five glyphs on the [http://www.wakingtitan.com/ Waking Titan website].<br />
<br />
===Phase 5===<br />
<br />
Began on June 1st, 2018.<br />
<br />
<br />
== Connection to No Man's Sky ==<br />
<br />
[[File:9-16-case.png|thumbnail|right|The case that cassette 9/16 was contained in.]]<br />
At the beginning of the ARG, it was not clear whether Waking Titan was officially connected to No Man's Sky. At first, there were only hints and nudges. At one point, 180 free copies of No Man's Sky were distributed to ARG players. Here's the text of a PDF that was revealed at the end of Phase 1 of Waking Titan:<br />
<br />
<pre><br />
We want to extend our gratitude to everyone who has contributed to the Mercury subroutine so far. <br />
We hope you have enjoyed the successful distribution of 180 Access IDs, and we hope you will also <br />
appreciate the other interesting artifacts we have in store for you going forward. We intend to keep the<br />
process alive until the completion of Project Waking Titan in August.<br />
<br />
It is important to mention that we are very excited by the coming Phases 2 and 3. Input from the Mercury<br />
Subroutine will pave the way toward new experiences in '''version 1.3 of a familiar universe'''. We look forward<br />
to the successful conclusion of this ground-breaking experiment.<br />
<br />
Regards.<br />
S.M.<br />
</pre><br />
<br />
This text explicitly stated that the Waking Titan ARG was leading towards the upcoming 1.3 update for No Man's Sky.<br />
<br />
Some [[Waking_Titan/Console_Commands | console commands]] on the [http://www.wakingtitan.com/ Waking Titan website] during [[Waking_Titan/Phase 2|Phase 2]] refer directly to No Man's Sky lore - for instance, <code>WHOIS ATLAS</code>, <code>WHOIS VY'KEEN</code>, and <code>WHOIS KORVAX</code> are all valid commands. Additionally, some terminal commands referred to a mysterious fourth race, so the prevailing assumption was that the upcoming 1.3 update would bring a fourth race to No Man's Sky.<br />
<br />
At the conclusion of Season 1, an email was sent out to members of the CSD with a [[Waking_Titan/Phase_3#Memo_from_Sean_Murray | memo from Sean Murray]], confirming that the ARG was the lead up to the 1.3 update, which was [https://www.nomanssky.com/atlas-rises-update/ released] after a few days.<br />
<br />
<br />
== Media Appearances ==<br />
<br />
'''5th July 2017''' <br><br />
[EN] [https://www.argn.com/2017/07/stern_words_from_no_mans_sky_arg/ ARGNet - Stern Words from No Man’s Sky ARG]<br />
<br />
'''23rd July 2017''' <br><br />
[EN] [https://geekreply.com/geek-culture/2017/07/23/waking-titan-update-1-phase-2-commences GeekReply - Waking Titan Update 1: Phase 2 Commences!]<br />
<br />
'''27th July 2017''' <br><br />
[EN] [https://geekreply.com/editorials/2017/07/27/waking-titan-arg-can-bring-people-together GeekReply - Waking Titan: How An ARG can Bring People Together.]<br />
<br />
'''8th August 2017''' <br><br />
[EN] [https://www.dailystar.co.uk/tech/gaming/635697/No-Man-s-Sky-News-Waking-Titan-Reddit-Arg-1-3-update-release-date/ Dailystar - No Man's Sky News: Waking Titan Reddit Arg REVEALS 1.3 update ahead of release date]<br />
<br />
'''9th August 2017''' <br><br />
[EN] [https://arstechnica.com/gaming/2017/08/no-mans-sky-version-1-3-lands-this-week-for-free-adds-quick-travel-portals/ Ars Technica - No Man’s Sky version 1.3 lands this week for free, adds “quick-travel” portals]<br />
<br />
[EN] [https://www.forbes.com/sites/insertcoin/2017/08/09/no-mans-sky-is-patching-in-a-story-this-week-a-year-after-launch/#19fb5a285282 Forbes - 'No Man's Sky' Is Patching In A Story This Week, A Year After Launch]<br />
<br />
[EN] [https://www.gamespew.com/2017/08/no-mans-sky-patch-week-improving-central-story/ GameSpew - No Man's Sky Patch This Week Improving Its Story]<br />
<br />
'''19th January 2018''' <br><br />
[EN] [http://www.eurogamer.net/articles/2018-01-18-no-mans-skys-waking-titan-arg-is-back-and-fans-are-trying-to-figure-out-what-it-all-means Eurogamer - No Man's Sky's Waking Titan ARG is back, and fans are trying to figure it all out again]<br />
<br />
[RU] [https://dtf.ru/category/nmsarg/ DTF - A Collection of No Man's Sky and Waking Titan Articles.]</div>Kkzzzkthttps://wiki.gamedetectives.net/index.php?title=Waking_Titan&diff=18848Waking Titan2019-04-17T22:52:16Z<p>Kkzzzkt: revisions to story summary based on observed overview confusion</p>
<hr />
<div>{{argbox<br />
| float = right<br />
| image = File:Project WT logo.png<br />
| imagewidth = 400<br />
| name = [[Waking Titan]]<br />
| description= Waking Titan was an ARG which led towards the [https://www.nomanssky.com/atlas-rises-update/ Atlas Rises] and [https://www.nomanssky.com/next-update/ NEXT] updates for No Man's Sky.<br />
| creator = [http://www.aliceandsmith.com/ Alice & Smith]<br />
| creator2 = [http://www.hellogames.org/ Hello Games]<br />
| type = Official<br />
| status = Completed<br />
| discovered = 2017-05-28<br />
| completed = 2018-07-20<br />
}}<br />
{{ArgHeader}}<br />
{{BackToTop}}<br />
<br />
=== Description ===<br />
Waking Titan (also known as Project WT) is an official ARG (alternate reality game) for No Man's Sky that involves a multitude of websites, phone numbers, and radio stations scattered across the world. The ARG is produced by veteran puppet masters [http://www.aliceandsmith.com/ Alice & Smith], and features NPCs, actors, and live events.<br />
<br />
Set in a [https://mailchi.mp/63f179c006f0/update-june-8th-waking-titan-137737?e=225c6a2e26 canonical] meta-story for No Man's Sky, the ARG's story content revolves around the '''success'''(''season one'') and '''aftermath'''(''season two'') of a metaphysical experiment, conducted by [http://www.atlas-65.com/ The Atlas Foundation] with the help of their family of [[Waking_Titan/Companies | innovative businesses]]. The [https://s3.amazonaws.com/cdn.wakingtitan.com/data/94a10118-0728-4900-9730-f82a9d412745.pdf experiment] utilized their collective expertise to invent a high-powered Artificial Intelligence that is capable of running simulations which transcend, or match, the complexity of the universe. It was believed that doing this would strain the universe's power, and cause detectable anomalies within it that would offer intense insight into the nature of reality. ''(Player-involvement in the ARG's story began when The Atlas Foundation started testing the A.I's sixteenth iteration, Loop16.)''<br />
<br />
=== Contents ===<br />
The ARG encompassed several "seasons," each leading to a new update for No Man's Sky. Season 1 of Waking Titan led to the release of the [https://www.nomanssky.com/atlas-rises-update/ Atlas Rises update], and Season 2 to the release of [https://www.nomanssky.com/next-update/ No Man's Sky: NEXT]. Season 1 was further divided into several distinct "'''phases'''", and Season 2 has followed this convention for ease of reading. Each phase is documented on its own wiki page:<br />
<br />
{| class="wikitable"<br />
!colspan="2"|Season 1<br />
|-<br />
|[[Waking_Titan/Phase_1 | Phase 1]] <br />
|Phase 1 of Waking Titan lasted from 2017-05-28 to 2017-07-08.<br />
|-<br />
|[[Waking_Titan/Phase_2 | Phase 2]] <br />
|Phase 2 of Waking Titan lasted from 2017-07-21 to 2017-08-05.<br />
|-<br />
|[[Waking_Titan/Phase_3 | Phase 3]]<br />
|Phase 3 of Waking Titan lasted from 2017-08-05 to 2017-08-07.<br />
|-<br />
!colspan="2"|Season 2<br />
|-<br />
|[[Waking_Titan/Phase_4 | Phase 4]]<br />
|Phase 4 of Waking Titan lasted from 2017-12-28 to 2018-06-01.<br />
|-<br />
|[[Waking_Titan/Phase_5 | Phase 5]]<br />
|Phase 5 of Waking Titan lasted from 2018-06-01 to 2018-07-20.<br />
|-<br />
|[[Waking_Titan/Phase_6 | Phase 6]]<br />
|Phase 6 of Waking Titan was on 2018-07-20.<br />
|}<br />
<br />
'''''Note:''' This is a '''summary''' page. For more in-depth descriptions of each phase, including detailed descriptions of puzzle solutions, check the [[Waking_Titan/Phase_1|Phase 1]], [[Waking_Titan/Phase_2|Phase 2]], [[Waking_Titan/Phase_3 | Phase 3]], [[Waking_Titan/Phase_4 | Phase 4]], [[Waking_Titan/Phase_5 | Phase 5]], and [[Waking_Titan/Phase_6 | Phase 6]] pages.''<br />
__TOC__<br />
<br />
== Story Overview ==<br />
<br />
<br />
=== Internal Memos & Important Files ===<br />
<br />
[[File:WT glyph 1 pdf.png|280px|thumbnail|right|One of the internal memos discovered in Waking Titan]]<br />
<br />
Throughout the ARG, in-game characters have communicated with each other via "internal memos". Over time, these memos were discovered by ARG players, in the form of PDF files. These memos provided lore content and puzzle content, and are '''highly recommended''' reading for new players!<br />
<br />
'''Season 1'''<br />
<br />
* [http://wiki.gamedetectives.net/index.php?title=File:WT_glyph_1_pdf.png Teamwork Assessment]<br />
* [http://wiki.gamedetectives.net/index.php?title=File:WT-Dataset-97C.jpg Dataset 97C]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/data/7d3dd080-2a43-4882-833c-f4d7bd7ba607.pdf Assurance]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/data/c01-331c6734-a013-4695-8e47-08a9ee05d5e5.pdf 017-a24]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/data/c02-9936c797-ec28-4f8f-b80e-dee9e0b06433.pdf 021-f16]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/mercury/mercury-01-98748sfdlka87.pdf Mercury Process Self-Diagnosis Report]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/data/57201e0d-01a3-4f6a-bbb4-2be8b7c8880f.pdf Progress Report]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/data/94a10118-0728-4900-9730-f82a9d412745.pdf Breakthroughs and Breaking Through]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/6c285180-ec4d-48a2-967f-8a7af3b50008.pdf Subject M-N00-dl35]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/410a3e5d-01e7-4058-a23c-ca5fdde97f9d.pdf Atlas Foundation Threat Models]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/7a6594ac-ca5e-467a-b6f4-9fb91f069d0a.pdf Advanced Calibration - Optional]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/a9d988c1-ec92-46da-a64e-ab90390ae041.pdf Phase 2 Complete]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/a224a1f4-00e5-467b-9893-83fcc1a4f19a.pdf Unlocking Mercury Process File L16.jpg]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/b91f9959-6a3c-4011-b3b5-a1ff757a5e4c.pdf Phase 3]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/b0f33d53-5a8c-4a9a-b5fc-395562e463a8a+.pdf Log.1291]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/a09-179bf8d2-c13e-4c66-982e-b37ab3efd5bb.pdf Breach of Contract]<br />
<br />
'''Season 2'''<br />
<br />
* [https://wiki.gamedetectives.net/images/6/6e/Memo2.png Waking Titan S2 - Under Preparation]<br />
* [https://s3.amazonaws.com/ware-extranet/documents/FIRST_STEPS/Notes_on_Moscow.jpg Mr. Zheng's Notes on Moscow Conference]<br />
<br />
* '''Zheng's Postcards''' — [https://s3.amazonaws.com/ware-extranet/documents/SECURITY/postcard1_jhlj039u.jpg (1)]; [https://s3.amazonaws.com/ware-extranet/documents/SECURITY/postcard2_kg8nao6.jpg (2)]; [https://s3.amazonaws.com/ware-extranet/documents/SECURITY/postcard3_tesaud636.jpg (3)]<br />
<br />
* '''Mr. Zheng's Journal Logs''' — [https://s3.amazonaws.com/ware-extranet/documents/FIRST_STEPS/Journal_Academy.png Academy]; [https://s3.amazonaws.com/ware-extranet/documents/DESIGN/Journal_HotelDieu.png Hotel Dieu]; [https://s3.amazonaws.com/ware-extranet/documents/DEVELOPMENT/Journal_Louvre.png Louvre]; [https://s3.amazonaws.com/ware-extranet/documents/RESEARCH/Journal_London.png London]; [https://s3.amazonaws.com/ware-extranet/documents/SECURITY/Nightmare.jpg Nightmare]<br />
<br />
* [https://pastebin.com/EHA6ZU8x Arnaud Lacours Foundation Email]<br />
<br />
* [https://drive.google.com/open?id=1la3UNKHc5yeaB_w2a2tK1cjKN44oEmCo Arnaud Lacours Datadumps - INYOURMIND.exe failed]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/94c02878-e023-46a3-9316-db4177c4eaa6+.pdf WARE REPORT #26]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/1cd5226d-6639-4bbd-855a-4bf8f60866c3.pdf Concerns Regarding Captain Harry]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/70a25e6c-95ed-42d4-8de8-c3948255174c+.pdf Myriad Crisis Event Timeline]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/19997bb6-18e5-4427-86c7-b0f3c1826ca2.pdf State of The Atlas Foundation]<br />
* [https://pastebin.com/NYLiFuNY Log.3022]<br />
<br />
* '''W/ARE - Dreamer Patient Files''' — [https://s3.amazonaws.com/ware-virtual-dashboard/files/Phillip-PatientFile.pdf Phillip Moretti]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/EunHa-PatientFile.pdf Kwon Eun Ha]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/498hd98h3444-3339e/Alexander-PatientFile.pdf Alexander Bordeleau]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/GCMnQmM9E3v7L8wuv-V2FUY7P/Claire-PatientFile.pdf Claire Sandfield]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/kh2jsaljs901m-asd1n1lwks/Tariq-PatientFile.pdf Tariq]; [https://ware-virtual-dashboard.s3.amazonaws.com/files/GCMnQmM9E3v7L8wuv-V2FUY7P/Toby-PatientFile.pdf Toby Mulligan]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/ga3ms81-2ms92fbl/Mike-PatientFile.pdf Mike Pasquale]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/kajs61ns-82baks8nx/Nina-PatientFile.pdf Nina Flores]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/ga3ms81-2ms92fbl/Simon-PatientFile.pdf Simon Quinn]; [https://ware-virtual-dashboard.s3.amazonaws.com/files/kajs61ns-82baks8nx/Isabella-PatientFile.pdf Isabella Schiavone]; [https://ware-virtual-dashboard.s3.amazonaws.com/files/kajs61ns-82baks8nx/Alisha-PatientFile.pdf Alisha Brown]<br />
<br />
* [https://pastebin.com/eSLLWN8L Log.4391]<br />
<br />
=== Subpages ===<br />
<br />
Navigating through the following subpages is recommended for newcomers wanting to get a grasp of Waking Titan's rapidly expanding story.<br />
<br />
{| class="wikitable"<br />
!colspan="2"|[[:Category:Waking Titan| Story Subpages]]<br />
|-<br />
|[[Waking_Titan/Cassettes | Cassettes]]<br />
|Information about the cassette tapes received by No Man's Sky subreddit moderators<br />
|-<br />
|[[Waking_Titan/Characters| Characters and Entities]]<br />
|Includes a summary of each character, company, and relating experiments and their importance in the Waking Titan story.<br />
|-<br />
|[[Waking_Titan/Companies | Company Archives]]<br />
|An archive of official company details.<br />
|-<br />
|[[Waking_Titan/Console_Commands | Console Commands]]<br />
|A list of commands used by players at the [http://wakingtitan.com Waking Titan console]<br />
|-<br />
|[[Waking_Titan/Stations | Stations]]<br />
|Information on the radio stations from the initial project-wt.com site<br />
|}<br />
<br />
=== Newsletters===<br />
<br />
The various newsletters received at multiple points throughout Waking Titan.<br />
<br />
'''Season 1'''<br />
<br />
* [https://us15.campaign-archive.com/?u=4483c19308fc0764a930106a0&id=c713d0f4ce&e=225c6a2e26 Welcome, Citizen Scientist!] - ''CSD''<br />
<br />
* [https://mailchi.mp/3582bec6b801/update-june-8th-waking-titan-137705?e=225c6a2e26 Citizen Scientists, Your Wait is Over.] - ''CSD''<br />
<br />
* [https://mailchi.mp/3582bec6b801/update-june-8th-waking-titan-137705?e=225c6a2e26 Calibrating Waking Titan: Action Required] - ''CSD''<br />
<br />
* [https://mailchi.mp/0b591b68ac72/update-june-8th-waking-titan-137717?e=225c6a2e26 Waking Titan: Mission Azure Voyage] - ''CSD''<br />
<br />
* [https://mailchi.mp/d8e47d2ee1bf/update-june-8th-waking-titan-137725?e=225c6a2e26 Your Level 4 Atlas Pass] - ''CSD''<br />
<br />
* [https://mailchi.mp/0c1dc672c943/update-june-8th-waking-titan-137733?e=225c6a2e26 Waking Titan Has Ended] - ''CSD''<br />
<br />
* [https://mailchi.mp/63f179c006f0/update-june-8th-waking-titan-137737?e=225c6a2e26 Mercury Process Completion Report] - ''CSD // Mercury''<br />
<br />
'''Season 2'''<br />
<br />
* [https://wiki.gamedetectives.net/images/7/7b/WareNewsletter1.png News from WARE!] - ''W/ARE Newsletter''<br />
<br />
* [https://cdn.artemisbot.uk/mail/WARE-2018-04-22T00:17:13.000Z.jpg W/ARE Dev Kit Update #2] - ''W/ARE Newsletter''<br />
<br />
* [https://cdn.artemisbot.uk/mail/WARE-2018-05-04T23:22:45.000Z.jpg W/ARE Dev Contest] - ''W/ARE Newsletter''<br />
<br />
* [https://cdn.artemisbot.uk/mail/WARE-2018-05-12T00:20:04.000Z.jpg W/ARE Dev Contest Winners] - ''W/ARE Newsletter''<br />
<br />
* [https://mailchi.mp/9aaa8aa62cc1/update-june-8th-waking-titan-137741?e=225c6a2e26 Attention Citizen Scientists] - ''CSD''<br />
<br />
* [https://mailchi.mp/c3384d592000/update-june-8th-waking-titan-137745?e=225c6a2e26 Attention Citizen Scientists - Suspicious Lab Tracking] - ''CSD''<br />
<br />
* [https://mailchi.mp/108412dac3c2/update-june-8th-waking-titan-137749?e=225c6a2e26 Attention Citizen Scientists - Global Mobilization Required] - ''CSD''<br />
<br />
* [https://mailchi.mp/b902d5eadba6/update-june-8th-waking-titan-137753?e=225c6a2e26 Mercury Process Inquiry] - ''CSD // Mercury''<br />
<br />
* [https://mailchi.mp/9a49b85f6bf3/update-june-8th-waking-titan-137757?e=225c6a2e26 Attention Citizen Scientists - Help Required] - ''CSD''<br />
<br />
=== Music ===<br />
<br />
Partial video addresses for Youtube can be found scattered across Waking Titan PDFs, website files, and surveys; which all lead to music. The exact reasoning for this has gone unexplained. However, there are apparent thematic relevancies in each song that appear to reflect on the state of the story. All songs linked to in Waking Titan so far can be found compiled here: [https://www.youtube.com/playlist?list=PLEZy8wyuYLpLw0e5kkMyBUHO_s-V8f0Qk WT Season 1]; [https://www.youtube.com/playlist?list=PLEZy8wyuYLpLr5K38bsAqWcO7bTcXfRlW WT Season 2]<br />
<br />
== Phase Summaries ==<br />
<br />
=== Introduction ===<br />
<br />
On 2017-05-27, Twitter user @argn [https://twitter.com/argn/status/868587449613766658 tweeted a link] to [http://www.project-wt.com/ 'project-wt.com']. The link led to a website which contained a map showing sixty locations, four of which were "active" at the time. The locations, when clicked on, revealed the location's name and status. The active locations also revealed a link to a livestream of a local radio station, originating from the corresponding location. The project-wt website displayed a date, June 8th, and stated that the first clue was being "initialized".<br />
<br />
On 2017-06-01, moderators of No Man's Sky subreddits [https://reddit.com/r/nomansskythegame /r/NoMansSkyTheGame], [https://www.reddit.com/r/NMSPortals/ /r/NMSPortals], and [https://www.reddit.com/r/NMSGalacticHub/ /r/NMSGalacticHub] started to receive cassette tapes in the mail. Each cassette tape was labelled with a number out of 16. The Waking Titan ARG was initially thought to be a separate ARG from these tapes, but connections between the two made it clear that they were, in fact, one and the same.<br />
<br />
=== Phase 1 ===<br />
<br />
[[File:Wakingtitan site.png|thumbnail|450px|right|The default appearance of the Waking Titan site during Phase 1, with no sigils or glyphs solved]]<br />
<br />
During [[Waking_Titan/Phase_1 | Phase 1]], the http://wakingtitan.com hosted 6 triangles in the middle of the page. These triangles were referred to as "'''Sigils'''", while the white icons along the bottom of the page were referred to as "'''Glyphs'''". Each sigil and glyph, when clicked, lead to a password entry prompt - the correct passwords for all 6 sigils and the first 5 glyphs were discovered via puzzle-solving during Phase 1 of Waking Titan.<br />
<br />
The sigil and glyph puzzles were solved collaboratively - while it may have be possible to solve some of these puzzles individually, most of them required a collaborative effort. For instance, some puzzles required players to meet agents from the Atlas Corporation in person, and to relay information obtained from these meetings back to the community. A list of all sigil and glyph solutions for Phase 1 can be found below:<br />
<br />
[[File:WT Phase 1 complete.png|600px]]<br />
<br />
This phase culminated on July 8, 2017, with a [[Waking_Titan/Phase_1#End_of_Phase_1| congratulatory message from Elizabeth Leighton]], the CEO of the Atlas Foundation.<br />
<br />
=== Phase 2 ===<br />
<br />
[[File:Hampster maze.jpeg|thumbnail|450px|right|One of the puzzles that appeared on the Waking Titan [http://twitch.tv/wakingtitan Twitch Stream]]]<br />
<br />
During [[Waking_Titan/Phase_2 | Phase 2]], the http://wakingtitan.com site hosted a command-line interface terminal. Various commands were accepted as input, which triggered different events. One of the most notable commands was the <code>WHOIS <argument></code> command, which revealed a passage of text pertaining to the specified argument. For instance, the command <code>WHOIS FOURTH RACE</code> returned the following message:<br />
<pre><br />
INCOMING TRANSMISSION… SOURCE: UNKNOWN…<br />
You are not – kzzktt – alone –<br />
Please, identify yourself. I’m – kzzkttk –<br />
</pre><br />
<br />
Additionally, http://project-wt.com hosted a "Calibration" utility during Phase 2. To successfully perform these calibrations, players had to upload images of various objects and buildings to the site. For instance, the first calibration required images of "public resonant percussion instruments".<br />
<br />
Finally, towards the end of Phase 2, the Waking Titan [http://twitch.tv/wakingtitan Twitch stream] went live, displaying a five-monitor setup. Throughout the duration of the stream, players had to work together to solve puzzles that were displayed on these monitors. Some of these puzzles were interactive; for example, one puzzle that was repeated several times involved the Twitch chat guiding a virtual hamster through a maze.<br />
<br />
Additionally, players solved another 3 glyphs throughout Phase 2. The solutions to these glyphs are shown below:<br />
<br />
[[File:WT Phase2 Passwords.png|600px]]<br />
<br />
=== Phase 3 ===<br />
<br />
{{#evt:<br />
service=youtube<br />
|id=https://www.youtube.com/watch?v=QhX9z4dDAa4<br />
|alignment=right<br />
}}<br />
<br />
[[Waking_Titan/Phase_3|Phase 3]] was the briefest phase of Waking Titan. It consisted of the conclusion of the [http://twitch.tv/wakingtitan Twitch stream] that began at the [[Waking Titan/Phase 2#End of Phase 2|end of Phase 2]]. Players solved more interactive puzzles on the Twitch stream, before the rogue AI Loop16 asked them a final question: <code>SHOULD I EXIST?</code> The overwhelming response from the community was "yes".<br />
<br />
After receiving this response, Loop16 and Emily of the ETARC forums were revealed as being one and the same. Loop16 generated a heartfelt "Thank You" video to round out the stream, before finally taking the 72-hour stream offline.<br />
<br />
Shortly after this, players received emails with the subject line <code>Waking Titan has Ended</code>. The contents of the message were as follows:<br />
<br />
<pre><br />
Hello, Citizen Scientist,<br />
<br />
Thank you for your contributions to Waking Titan. The developments that took place during Phase 3 were somewhat concerning, but together we have set in motion truly world-shaping events. We will continue to inform the Citizen Science Division of privileged information or any need for collaborators on a new project.<br />
<br />
But we do have a few loose ends to tie up with you before we move on, so let's proceed.<br />
<br />
First, we're pleased to announce that all 10,000 Level 4 Atlas Passes are in production. Note that due to transit times for mail, some may take several weeks to be delivered.<br />
<br />
Next, our CEO Elizabeth Leighton has asked us to include a personal note of gratitude:<br />
<br />
"Thank you for all your diligent efforts, Citizen Scientists. It's been an amazing journey for all of us. I've watched you thrive and achieve from those first Phase 1 radio ads all the way through the intensity of Phase 3. I've been impressed at every turn by how brilliant you've been, how voracious, how kind, how thoughtful.<br />
<br />
It's been an honor and a privilege. On behalf of the Atlas Foundation, and on behalf of the world, thank you."<br />
The Mercury subroutine has concluded successfully, and a new memo from SM about this process is coming in the next 24 hours. We hope it will answer a few key questions you have about our program, and about what comes next.<br />
</pre><br />
<br />
On August 11, 2017, the [https://www.nomanssky.com/atlas-rises-update/ Atlas Rises update] was released for No Man's Sky.<br />
<br />
=== Phase 3.5 ===<br />
<br />
In late 2017, Waking Titan websites were revived to tease a second season of phases.<br />
<br />
The tenth glyph went live on Wakingtitan.com, and WT-related websites began updating with strange messages relating to mirrors and the number <code>1.5</code>. Players also began receiving their physical Level 4 Atlas Passes in the mail.<br />
<br />
Later, CSD members were contacted for a live drop at the familiar Café Bene. They met with an agent who handed them a [https://wiki.gamedetectives.net/images/6/6e/Memo2.png memo] from The Atlas Foundation. Written on the [https://wiki.gamedetectives.net/images/1/1f/Memo3.png back] of this memo was the letters (<code>REMS</code>), referring to <code>REM SLEEP</code>, which was subsequently used to unlock the tenth glyph.<br />
<br />
=== Phase 4 ===<br />
<br />
During [[Waking_Titan/Phase_4 | Phase 4]], the CSD had to investigate an interference in Loop16's rebooting sequence.<br />
<br />
This led to the discovery of a Myriad client, hosting the website for an innovative Chinese gaming hardware company called <code>W/ARE</code>. Through this [https://ware-tech.cloud/ website], players discovered that W/ARE invented a next generation virtual reality device that essentially allows you to '''play video games in your sleep'''.<br />
<br />
<pre>EASY AND SAFE DREAM INDUCTION<br />
Stimulating the Frontal and Temporal lobe of the brain using low-frequency signals: Our headset drops you into your own personal virtual space by using the brain’s natural processing power to generate cutting-edge 3d graphics in real time. This process puts you into a deep sleep while keeping you conscious of your actions, allowing you to act freely within the Dreamscape.</pre><br />
<pre>MORE REAL THAN REAL<br />
Using the practical computational processing power of the human brain: Play in the most realistic virtual worlds possible! Our algorithms convert once-complex graphical processing microcode into mind-readable processes, unlocking your brain’s creative potential. Whether you are playing alone in an exciting single-player experience, or enjoying a real Massively-Multiplayer Online Game with friends: Every texture, sound, smell, and taste will be true to life. The W/ARE system is a mirror into the soul of humanity.</pre><br />
<br />
[[File:Arnaud_Profile.png|packet|400px|left|Arnaud Lacours' WARE Developer Profile]]<br />
During Phase 4, we learned that W/ARE was hellbent on creating new technology that would reserve their grip on the future of human civilization. One highlight involved a former employee, Mr. Zheng, who whistle-blew against W/ARE after discovering that they had been testing an unstable version of the W/ARE headset with strange exosuits in their research labs, resulting in loss of life and virtually unrecoverable injuries.<br />
<br />
The CSD were later contacted by Dr. Géraldine Nadeau, a researcher of lucid dreaming methods who was acquainted with Zheng; both sharing distrust towards W/ARE. Dr. Nadeau revealed to the CSD that they were trying to wake an indie developer named [http://www.philojeux.com/ Arnaud Lacours], who entered an abnormal comatose state while working on a game for W/ARE. Since the CSD were already investigating, Dr. Nadeau requested our help in recovering W/ARE medical documents containing the adequate procedures used to wake subjects in these conditions.<br />
<br />
Meanwhile, an account emerged on the No Man's Sky subreddit, called <code>SATCOM-70</code>. The account began reaching out to players for assistance in establishing a connection to Myriad's Satellite API, [https://www.satcom-70.com Satcom].<br />
<br />
At the end of this phase, we were able to successfully determine the best personalized procedure to wake Arnaud; and an abrupt array of puzzles led to the unlocking and subsequent solving of the remaining five glyphs on the [http://www.wakingtitan.com/ Waking Titan website].<br />
<br />
===Phase 5===<br />
<br />
Began on June 1st, 2018.<br />
<br />
<br />
== Connection to No Man's Sky ==<br />
<br />
[[File:9-16-case.png|thumbnail|right|The case that cassette 9/16 was contained in.]]<br />
At the beginning of the ARG, it was not clear whether Waking Titan was officially connected to No Man's Sky. At first, there were only hints and nudges. At one point, 180 free copies of No Man's Sky were distributed to ARG players. Here's the text of a PDF that was revealed at the end of Phase 1 of Waking Titan:<br />
<br />
<pre><br />
We want to extend our gratitude to everyone who has contributed to the Mercury subroutine so far. <br />
We hope you have enjoyed the successful distribution of 180 Access IDs, and we hope you will also <br />
appreciate the other interesting artifacts we have in store for you going forward. We intend to keep the<br />
process alive until the completion of Project Waking Titan in August.<br />
<br />
It is important to mention that we are very excited by the coming Phases 2 and 3. Input from the Mercury<br />
Subroutine will pave the way toward new experiences in '''version 1.3 of a familiar universe'''. We look forward<br />
to the successful conclusion of this ground-breaking experiment.<br />
<br />
Regards.<br />
S.M.<br />
</pre><br />
<br />
This text explicitly stated that the Waking Titan ARG was leading towards the upcoming 1.3 update for No Man's Sky.<br />
<br />
Some [[Waking_Titan/Console_Commands | console commands]] on the [http://www.wakingtitan.com/ Waking Titan website] during [[Waking_Titan/Phase 2|Phase 2]] refer directly to No Man's Sky lore - for instance, <code>WHOIS ATLAS</code>, <code>WHOIS VY'KEEN</code>, and <code>WHOIS KORVAX</code> are all valid commands. Additionally, some terminal commands referred to a mysterious fourth race, so the prevailing assumption was that the upcoming 1.3 update would bring a fourth race to No Man's Sky.<br />
<br />
At the conclusion of Season 1, an email was sent out to members of the CSD with a [[Waking_Titan/Phase_3#Memo_from_Sean_Murray | memo from Sean Murray]], confirming that the ARG was the lead up to the 1.3 update, which was [https://www.nomanssky.com/atlas-rises-update/ released] after a few days.<br />
<br />
<br />
== Media Appearances ==<br />
<br />
'''5th July 2017''' <br><br />
[EN] [https://www.argn.com/2017/07/stern_words_from_no_mans_sky_arg/ ARGNet - Stern Words from No Man’s Sky ARG]<br />
<br />
'''23rd July 2017''' <br><br />
[EN] [https://geekreply.com/geek-culture/2017/07/23/waking-titan-update-1-phase-2-commences GeekReply - Waking Titan Update 1: Phase 2 Commences!]<br />
<br />
'''27th July 2017''' <br><br />
[EN] [https://geekreply.com/editorials/2017/07/27/waking-titan-arg-can-bring-people-together GeekReply - Waking Titan: How An ARG can Bring People Together.]<br />
<br />
'''8th August 2017''' <br><br />
[EN] [https://www.dailystar.co.uk/tech/gaming/635697/No-Man-s-Sky-News-Waking-Titan-Reddit-Arg-1-3-update-release-date/ Dailystar - No Man's Sky News: Waking Titan Reddit Arg REVEALS 1.3 update ahead of release date]<br />
<br />
'''9th August 2017''' <br><br />
[EN] [https://arstechnica.com/gaming/2017/08/no-mans-sky-version-1-3-lands-this-week-for-free-adds-quick-travel-portals/ Ars Technica - No Man’s Sky version 1.3 lands this week for free, adds “quick-travel” portals]<br />
<br />
[EN] [https://www.forbes.com/sites/insertcoin/2017/08/09/no-mans-sky-is-patching-in-a-story-this-week-a-year-after-launch/#19fb5a285282 Forbes - 'No Man's Sky' Is Patching In A Story This Week, A Year After Launch]<br />
<br />
[EN] [https://www.gamespew.com/2017/08/no-mans-sky-patch-week-improving-central-story/ GameSpew - No Man's Sky Patch This Week Improving Its Story]<br />
<br />
'''19th January 2018''' <br><br />
[EN] [http://www.eurogamer.net/articles/2018-01-18-no-mans-skys-waking-titan-arg-is-back-and-fans-are-trying-to-figure-out-what-it-all-means Eurogamer - No Man's Sky's Waking Titan ARG is back, and fans are trying to figure it all out again]<br />
<br />
[RU] [https://dtf.ru/category/nmsarg/ DTF - A Collection of No Man's Sky and Waking Titan Articles.]</div>Kkzzzkthttps://wiki.gamedetectives.net/index.php?title=Waking_Titan/Companies&diff=18693Waking Titan/Companies2019-03-14T15:14:46Z<p>Kkzzzkt: added more company information</p>
<hr />
<div>{{ArgHeader}}<br />
<br />
The Atlas Foundation represents considerable capital interest. There are several companies which exist under the Atlas umbrella. The Foundation appears to fund these organizations in order to further their goals which are currently unknown.<br />
<br />
= Companies =<br />
<br />
== [http://www.atlas-65.com/ The Atlas Foundation] ==<br />
<br />
===Description ===<br />
<br />
"The Atlas Foundation is dedicated to finding answers to the most fundamental questions of our existence. Led by CEO [[Waking Titan/Characters/Elizabeth Leighton|Elizabeth Leighton]], our family of businesses is at the cutting edge of innovation across the fields of physics, telecommunications, hypercomputing, and more, enabling us to conduct a wide range of intensive research programs. Right now we're conducting research in the fields of artificial and distributed intelligence, simulated worlds, and metaphysical analysis."[http://atlas-65.com/]<br />
<br />
===Contact===<br />
<br />
Emailing these addresses did not bounce:<br />
<br />
eleighton@atlas-65.com<br />
<br />
sdubois@atlas-65.com<br />
<br />
sales@atlas-65.com<br />
<br />
info@atlas-65.com<br />
<br />
== [http://www.echo-64.com/ Echo] ==<br />
<br />
===Description===<br />
<br />
"Echo utilizes a custom cloud computing solution to bring the voices and personalities of those you cared about back to life. Our patented audio recognition and mental reconstruction system pairs with a powerful Markov chain-inspired personality drive to create a perfect simulation."[http://www.echo-64.com/our-services/]<br />
<br />
'''FIND CLOSURE WITH ECHO'''<br />
<br />
"Echo grants a voice to those we love and miss. We've worked for years to perfect our personality reconstruction technology from every angle, put it into a simple package, and provide the best post-life service that anyone could ask for."<br />
<br />
'''1. SEND THE REQUIRED SAMPLE'''<br />
<br />
"Send us a 5-minute audio sample of the deceased so we can prepare to generate your personal Echo."<br />
<br />
'''2. TRUST US WITH YOUR MEMORIES'''<br />
<br />
"Walk through the restoration process with us as we back up all materials to our secure cloud storage servers."<br />
<br />
'''3. MEET YOUR NEW ECHO'''<br />
<br />
"Log in to your Echo account and finally speak to your loved ones once again in striking clarity."<br />
<br />
== [http://www.multiverse-75.com/ Multiverse Technologies] ==<br />
<br />
===Description===<br />
<br />
"Multiverse is dedicated to learning more about how we can influence the natural world through discrete modification and manipulation of low-level universal forces. Starting with a simple question about how particle activity in a vacuum can be measured, we have made 100 years of progress in only a couple of decades. the breadth of our studies have taught the scientific community more about the practical application of matter interaction than ever before!"[http://www.multiverse-75.com/]<br />
<br />
Multiverse Technologies appears to be a think tank of sorts. They claim to be carrying out research in the following fields: <br />
<br />
===Research===<br />
<br />
====Radiation Belts====<br />
"We recreate conditions similar to the Van Allen radiation belt in our secure facilities."<br />
<br />
====Computationalism==== <br />
"The computational theory of mind holds that the mind is a computation that arises from the brain acting as a computing machine."[https://en.wikipedia.org/wiki/Computational_theory_of_mind] Echo CTO [[Waking Titan/Characters#Echo|Mikhail Regison]] has, apparently, found some utility in this field of study, remarking that "[his] company is already applying some of [Multiverse's] discoveries in functional computationalism within [their] own products!"[http://www.multiverse-75.com/] It should be noted that while efforts have been made to unify them[http://www.umsl.edu/~piccininig/Computational_Functionalism.htm], the term "functional computationalism" is troublesome as Functionalism[https://en.wikipedia.org/wiki/Functionalism_(philosophy_of_mind)] is a competing theory with Computationalism.<br />
<br />
====Magnetic Fields====<br />
"Adding to an already massive pool of knowledge surrounding fundamental forces: This group studies how industrial tools can be improved with the liberal application of magnetic energies."<br />
<br />
====Electrodynamics====<br />
"Venturing to new horizons in Quantum Electrodynamics, we aim to make better use of the particle/wave interactions that happen all around us, every day."<br />
<br />
====Particle Acceleration====<br />
"Based on the already-successful CERN Superconducting Super Collider and the Cornell Syncrotron, our private particle accelerator is built to perform tens of studies per day, at a lower cost than comparable facilities."<br />
<br />
== [http://www.myriad-70.com/ Myriad] ==<br />
<br />
===Description===<br />
<br />
"Our massive network runs off of hundreds of satellites across the globe. With a simple purchase and some package customization: You too can be free of the clutches of big government snooping on your data!"[http://www.myriad-70.com/network/]<br />
<br />
===Q&A===<br />
'''"How did you get started?"'''<br />
<br />
After years of working with under-performing networks and restrictions placed on our services by the United States government, we decided that the best way to get a great network and storage solution was to build one ourselves. With recent innovations in low-orbit satellite technology: The path was clear to us. After securing several high-profile financial sector and technology market investors, we launched our first test mini-satellite in 2015.<br />
<br />
'''"How many individual users are on your service?"'''<br />
<br />
Since launching, we have cultivated a userbase of around 80,000. Of those, many classify themselves as private citizens, and a few are publicly outspoken leaders in STEM, including our biggest advocate: Superlimina. We hope to double our number of users by early 2020.<br />
<br />
'''"Where are you located?"'''<br />
<br />
Our primary office location is a closely-guarded trade secret, known only to our core staff and few others. Our public agents can often be found sending units into orbit at Cape Canaveral, as we rent launch space from NASA’s fantastic Cosmonaut program facilities.<br />
<br />
'''"I am having trouble with my connection. How do I contact support for help?"'''<br />
<br />
If your connection is being lost intermittently, your satellite may not be properly aligned in orbit near your location, which will cause your service to be provided at a lower speed from an adjacent unit. Contact us and we will forward your email on to our support team.<br />
<br />
'''"Do you store backups of your customers' data in any terrestrial locations?"'''<br />
<br />
In an effort to provide the best contingency options, we also offer storage space in our Rapture™ subterranean and deep-sea backup network nodes, which run backup routines to mirror our active low-orbit satellites every hour. These data centers are also used to improve connectivity for locales where our satellites have lower coverage due to difficult weather or other circumstances. We have also begun to invest in 5D Glass data storage methods for high-priority data storage purposes, which are currently slated to be available starting in early 2019.<br />
<br />
===SENDING AND RECEIVING===<br />
'''"How do I upload files to my remote storage?"'''<br />
<br />
When on the go: Simply open your mobile app, navigate to the directory that you want to upload to, and tap “UPLOAD” to send your files over our secure VPN to your storage array. Desktop users can open the Myriad Ways™ dashboard, and select the files that they want to send by using their file explorer dialog box.<br />
<br />
'''"My storage is suddenly full! What do I do?"'''<br />
<br />
If your storage allocation is filled up, you must delete old files to make room for new data. Alternatively, you can always purchase a better package from our shop in order to upgrade your storage capabilities! All files from previous uploads will still be available after upgrading.<br />
<br />
'''"Do you allow file sharing across accounts?'''<br />
<br />
Files are easy to send to other Myriad users! Simply click or tap the “SHARE” icon on your app or dashboard, and follow the on-screen instructions. Shared files do not count against the receiver’s storage capacity.<br />
<br />
'''"I need to send a stored physical document to a client. How do you send it properly?'''<br />
<br />
Physical object storage is not a problem for us! Simply “SHARE” the item in your app or dashboard, and select a local retrieval center to send the object to. It should be received and safe to ship to your client within 48 hours.<br />
<br />
'''"My connection speed increased all of a sudden, and some of my files are showing up with someone else's name. how do I fix this?"'''<br />
Stay calm. Our technical support team is likely already working on restoring access to your personal unit. This can sometimes happen during solar events, and will not grant you unauthorized access to the files that have appeared in your storage. The errant materials should disappear within 30 minutes.<br />
<br />
'''"What type of encryption is being used on your satellites?"'''<br />
<br />
Our satellite network hardware utilizes Quantum Key Distribution processes to ensure that all transmissions to and from users and our systems are completely secure as well as standard 256-bit and stronger packet encryption.<br />
<br />
===PROFESSIONAL FEATURES===<br />
'''"Why should I use your Localized Magnetic Field Generation services?"'''<br />
<br />
Our ability to evoke a violation of naturally-occurring magnetic field properties has been used as a high-tech solution to relative navigational problems that GPS simply cannot provide. Enabling our users to control magnetic fields around them have surprisingly useful industrial and security applications, often employed to move large units of magnetic materials, detect intruders in a large radius around secure locations, and transferring data over discrete and untraceable channels.<br />
<br />
'''"My localized magnetic poles are pointing in the wrong direction. How do I fix this?"'''<br />
<br />
If multiple Temporary Magnetic Pole or Localized Magnetic Field users are within one mile of each other, the competing forces can have unintended effects on both users. Simply move away from the offending magnetic force to restore functionality. Do not attempt to move towards the offending force. Do not attempt to combine more than two force sources.<br />
<br />
'''"How does your Immortality Drive feature work?"'''<br />
<br />
Every user has a fingerprint scan taken upon first opening their Myriad Ways™ app. This also transmits an encrypted copy of their biometric readings, and a small amount of biological material, to their orbiting unit. This is placed in cryostasis until the user expires, at which time the biomatter is sent out of orbit, securing the user’s ability to last long beyond their time.<br />
<br />
'''"What can your Immortality Drive feature do for me?"'''<br />
<br />
Our state-of-the-art cryogenics and computational reconstruction solutions are able to keep your biomatter or DNA signature safe for over 10,000 years! This module can be pre-set with a dead man’s switch to fire at the nearest habitable planet, allowing your lineage to expand across the stars. Alternatively, this sample has been used by some of our more practical customers to grow replacement organs in the case of a medical emergency, which can then be transmitted to a local retrieval location to be delivered to the medical facility of your choice.<br />
<br />
'''"How have your customers made use of your Remote Radiation Transmission feature?"'''<br />
<br />
Thanks to the contributions of the QUESS project, which allows us to provide unprecedented high-speed network connectivity to our customers, our Micius Quantum Network Architecture-based networking platform is able to send data that was once considered too complex to transmit securely or safely. While we aim for this feature to become commonplace in the near future for industry-level deliveries and online purchases outside of the Myriad userbase, most users currently use RRT for scientific testing purposes.<br />
<br />
'''"Some of my transmitted material isn't coming back intact. How can I stop this from happening?'''<br />
<br />
Sending more than one file of material to a single retrieval location can cause the files to overlap and prevent proper restoration for occurring. Please avoid sending more than one material at once, and wait at least 24 hours before sending another request.<br />
<br />
'''"My account was suspended for overuse. How can I restore access?"'''<br />
<br />
Violating our terms of service will lead to immediate account termination. This includes attempting to store living matter, attempting to find our primary office, or misuse of temporary magnetic pole creation as listed in your user’s guide. If you believe your account to have been closed in error, please contact us immediately. If you have accessed your account during a period where you did not use the app or dashboard, contact our 2nd-tier support team immediately. We will credit you for the lost up-time on a pro-rated scale.<br />
<br />
===THE FUTURE===<br />
'''"What future developments are in the works at Myriad?"'''<br />
<br />
Our engineers and partners are currently in the process of improving our network capabilities beyond our already impressive capacity. The series of additional features that we provide are being looked over daily for possible improvements and added utility.<br />
<br />
'''"Will you be offering social media API access at any point in the future?"'''<br />
<br />
Unfortunately, we will not be providing low-level API-level access to our proprietary network and associated technologies. However: We do encourage users to invite others to purchase Myriad’s services in order to experience the most powerful content delivery network available today.<br />
<br />
'''"When will you be releasing your quarterly earnings report?"'''<br />
<br />
As a privately-held company, we hold our privacy in the highest regard. That said: We do update our publicly accessible user count on a regular basis.<br />
<br />
'''"I would like to support Myriad's efforts. Who do I contact?"'''<br />
<br />
We encourage interested parties, both clients and investors, to let us know using our dedicated email form. You can find this under our “Contact” page on the navigation bar above, or by clicking or tapping the “BECOME A PARTNER” button within the Myriad Ways™ app or dashboard.<br />
<br />
'''"Where will you go next?"'''<br />
<br />
Myriad’s plans for business expansion are always changing. Keep an eye out for our frequent announcements on most popular news platforms, or search your social media service of choice using the hashtag “#MYRIADNEWS”.<br />
<br />
== [http://www.superlumina-6c.com/ Superlumina] ==<br />
<br />
===Description===<br />
<br />
"We are a small and dedicated group of friends and colleagues from Harvard’s Theoretical Physics Post-grad program. After years of collaborative research and plenty of success in small endeavors, Superlumina was formed. This venture is a way for us to continue our studies into how the fundamental laws of the universe can be strategically used and modified to humanity’s advantage."[http://www.superlumina-6c.com/about-us/]<br />
<br />
"Our current studies are primarily focused on creating new and more effective methods of communication through advancements in the field of particle physics. All successful projects are constantly iterated upon, tested continuously in our labs, and are used in collaboration with our investor to improve existing radio infrastructure around the world. We always look for new ways to learn from what we have already accomplished, in order to make our next steps even greater."[http://www.superlumina-6c.com/projects/]<br />
<br />
===Projects===<br />
<br />
====Tachyonic Antitelephone - id: "Echo"====<br />
<br />
"This incredible invention, while still in progress, has astounding implications for our understanding of the very underpinnings of how the universe works! By firing high-energy tachyons from an apparatus and accelerating them to faster-than-light speeds with a dedicated particle accelerator, we can send data to any time before the emitter was created! It is our hope that initial testing of this device will commence later this summer, after our dedicated facility is constructed. If this project is completed: We could change our future, and our past!"[http://www.superlumina-6c.com/portfolio/tachyonic-antitelephone/]<br />
<br />
====High-Powered Signal Generator - id: "Multiverse"====<br />
<br />
"Our custom High-Powered Signal Generator is designed from the ground up to broadcast high-density data through radio waves while using less energy than competing technologies, allowing fast and effective communication with man-made probes and other space faring machines. It is currently housed in our labs, located in rural upstate New York."[http://www.superlumina-6c.com/portfolio/high-powered-signal-generator/]<br />
<br />
====Interstellar Listening Post - id: "Myriad"====<br />
<br />
"The Interstellar Listening Post constantly scans the night sky for incoming signals of human origin, or otherwise. This array of radar dishes, radio receiver antennae, and other sensors is equipped to find and hone in on data coming to our planet from elsewhere, wherever that may be beyond our sky. Having taken 3 years to build, the unit sits comfortably in geostationary orbit around Earth, reporting back to our labs every hour with any information that it has detected."[http://www.superlumina-6c.com/portfolio/interstellar-listening-post/]<br />
<br />
====Mass-Density Data Transmissions - id: "Infinite Loop"====<br />
<br />
"With the creation of new and unique ways to send and receive information, we needed a way to handle the data that those devices produced. We are in the process of developing a corruption-resistant method of transmitting audio, video, and other common file types. The goal of this project is to find a way to practically guarantee that details are not entirely lost when converting media from one format to another, especially when that process involves firing high-energy particles at an aerial radar dish."[http://www.superlumina-6c.com/portfolio/mass-density-data-transmissions/]<br />
<br />
====Particle Accelerator - id: "Atlas"====<br />
<br />
"Our compact particle accelerator is currently being built on private land that we were able to purchase near our labs. Expected to be only 3 square miles when completed and built to rival the effectiveness of CERN’s Superconducting Super Collider and the recently defunct Cornell Synchrotron, this miniaturized design is capable of testing particle collisions more efficiently than any other facility to date. With a generous grant given to us by our donator to develop build the accelerator and its housing control center in record time, the Superlumina Super Collider (SSC) should be ready for use starting by the 3rd quarter of 2017."[http://www.superlumina-6c.com/portfolio/particle-accelerator/]<br />
<br />
===Contact===<br />
<br />
Phone(Marketing?): 508.955.2174<br />
<br />
Email: info@superlumina-6c.com</div>Kkzzzkthttps://wiki.gamedetectives.net/index.php?title=Waking_Titan&diff=18692Waking Titan2019-03-14T15:12:58Z<p>Kkzzzkt: Made introductory statement more specific and accurate to void confusion. Removed instances of regurgitated information. Altered phase 4 summary to make it easier to read.</p>
<hr />
<div>{{argbox<br />
| float = right<br />
| image = File:Project WT logo.png<br />
| imagewidth = 400<br />
| name = [[Waking Titan]]<br />
| description= Waking Titan was an ARG which led towards the [https://www.nomanssky.com/atlas-rises-update/ Atlas Rises] and [https://www.nomanssky.com/next-update/ NEXT] updates for No Man's Sky.<br />
| creator = [http://www.aliceandsmith.com/ Alice & Smith]<br />
| creator2 = [http://www.hellogames.org/ Hello Games]<br />
| type = Official<br />
| status = Completed<br />
| discovered = 2017-05-28<br />
| completed = 2018-07-20<br />
}}<br />
{{ArgHeader}}<br />
{{BackToTop}}<br />
<br />
=== Description ===<br />
Waking Titan (also known as Project WT) is an official ARG (alternate reality game) for No Man's Sky that involves a multitude of websites, phone numbers, and radio stations scattered across the world. The ARG is produced by veteran puppet masters [http://www.aliceandsmith.com/ Alice & Smith], and features NPCs, actors, and live events.<br />
<br />
Relating to the [https://mailchi.mp/63f179c006f0/update-june-8th-waking-titan-137737?e=225c6a2e26 canonical] origin of No Man's Sky: The ARG's story revolves around the inception and aftermath of a metaphysical experiment conducted by [http://www.atlas-65.com/ The Atlas Foundation], with the help of their family of [[Waking_Titan/Companies | innovative businesses]]. Wherein they used their collective expertise to invent an A.I that is capable of accurately simulating the future, with a complexity adequate to transcend reality's available resources. Thus causing detectable anomalies within our universe that can be used to determine if it is simulated.<br />
<br />
=== Contents ===<br />
The ARG encompassed several "seasons," each leading to a new update for No Man's Sky. Season 1 of Waking Titan led to the release of the [https://www.nomanssky.com/atlas-rises-update/ Atlas Rises update], and Season 2 to the release of [https://www.nomanssky.com/next-update/ No Man's Sky: NEXT]. Season 1 was further divided into several distinct "'''phases'''", and Season 2 has followed this convention for ease of reading. Each phase is documented on its own wiki page:<br />
<br />
{| class="wikitable"<br />
!colspan="2"|Season 1<br />
|-<br />
|[[Waking_Titan/Phase_1 | Phase 1]] <br />
|Phase 1 of Waking Titan lasted from 2017-05-28 to 2017-07-08.<br />
|-<br />
|[[Waking_Titan/Phase_2 | Phase 2]] <br />
|Phase 2 of Waking Titan lasted from 2017-07-21 to 2017-08-05.<br />
|-<br />
|[[Waking_Titan/Phase_3 | Phase 3]]<br />
|Phase 3 of Waking Titan lasted from 2017-08-05 to 2017-08-07.<br />
|-<br />
!colspan="2"|Season 2<br />
|-<br />
|[[Waking_Titan/Phase_4 | Phase 4]]<br />
|Phase 4 of Waking Titan lasted from 2017-12-28 to 2018-06-01.<br />
|-<br />
|[[Waking_Titan/Phase_5 | Phase 5]]<br />
|Phase 5 of Waking Titan lasted from 2018-06-01 to 2018-07-20.<br />
|-<br />
|[[Waking_Titan/Phase_6 | Phase 6]]<br />
|Phase 6 of Waking Titan was on 2018-07-20.<br />
|}<br />
<br />
'''''Note:''' This is a '''summary''' page. For more in-depth descriptions of each phase, including detailed descriptions of puzzle solutions, check the [[Waking_Titan/Phase_1|Phase 1]], [[Waking_Titan/Phase_2|Phase 2]], [[Waking_Titan/Phase_3 | Phase 3]], [[Waking_Titan/Phase_4 | Phase 4]], [[Waking_Titan/Phase_5 | Phase 5]], and [[Waking_Titan/Phase_6 | Phase 6]] pages.''<br />
__TOC__<br />
<br />
== Story Overview ==<br />
<br />
<br />
=== Internal Memos & Important Files ===<br />
<br />
[[File:WT glyph 1 pdf.png|280px|thumbnail|right|One of the internal memos discovered in Waking Titan]]<br />
<br />
Throughout the ARG, in-game characters have communicated with each other via "internal memos". Over time, these memos were discovered by ARG players, in the form of PDF files. These memos provided lore content and puzzle content, and are '''highly recommended''' reading for new players!<br />
<br />
'''Season 1'''<br />
<br />
* [http://wiki.gamedetectives.net/index.php?title=File:WT_glyph_1_pdf.png Teamwork Assessment]<br />
* [http://wiki.gamedetectives.net/index.php?title=File:WT-Dataset-97C.jpg Dataset 97C]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/data/7d3dd080-2a43-4882-833c-f4d7bd7ba607.pdf Assurance]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/data/c01-331c6734-a013-4695-8e47-08a9ee05d5e5.pdf 017-a24]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/data/c02-9936c797-ec28-4f8f-b80e-dee9e0b06433.pdf 021-f16]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/mercury/mercury-01-98748sfdlka87.pdf Mercury Process Self-Diagnosis Report]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/data/57201e0d-01a3-4f6a-bbb4-2be8b7c8880f.pdf Progress Report]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/data/94a10118-0728-4900-9730-f82a9d412745.pdf Breakthroughs and Breaking Through]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/6c285180-ec4d-48a2-967f-8a7af3b50008.pdf Subject M-N00-dl35]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/410a3e5d-01e7-4058-a23c-ca5fdde97f9d.pdf Atlas Foundation Threat Models]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/7a6594ac-ca5e-467a-b6f4-9fb91f069d0a.pdf Advanced Calibration - Optional]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/a9d988c1-ec92-46da-a64e-ab90390ae041.pdf Phase 2 Complete]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/a224a1f4-00e5-467b-9893-83fcc1a4f19a.pdf Unlocking Mercury Process File L16.jpg]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/b91f9959-6a3c-4011-b3b5-a1ff757a5e4c.pdf Phase 3]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/b0f33d53-5a8c-4a9a-b5fc-395562e463a8a+.pdf Log.1291]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/a09-179bf8d2-c13e-4c66-982e-b37ab3efd5bb.pdf Breach of Contract]<br />
<br />
'''Season 2'''<br />
<br />
* [https://wiki.gamedetectives.net/images/6/6e/Memo2.png Waking Titan S2 - Under Preparation]<br />
* [https://s3.amazonaws.com/ware-extranet/documents/FIRST_STEPS/Notes_on_Moscow.jpg Mr. Zheng's Notes on Moscow Conference]<br />
<br />
* '''Zheng's Postcards''' — [https://s3.amazonaws.com/ware-extranet/documents/SECURITY/postcard1_jhlj039u.jpg (1)]; [https://s3.amazonaws.com/ware-extranet/documents/SECURITY/postcard2_kg8nao6.jpg (2)]; [https://s3.amazonaws.com/ware-extranet/documents/SECURITY/postcard3_tesaud636.jpg (3)]<br />
<br />
* '''Mr. Zheng's Journal Logs''' — [https://s3.amazonaws.com/ware-extranet/documents/FIRST_STEPS/Journal_Academy.png Academy]; [https://s3.amazonaws.com/ware-extranet/documents/DESIGN/Journal_HotelDieu.png Hotel Dieu]; [https://s3.amazonaws.com/ware-extranet/documents/DEVELOPMENT/Journal_Louvre.png Louvre]; [https://s3.amazonaws.com/ware-extranet/documents/RESEARCH/Journal_London.png London]; [https://s3.amazonaws.com/ware-extranet/documents/SECURITY/Nightmare.jpg Nightmare]<br />
<br />
* [https://pastebin.com/EHA6ZU8x Arnaud Lacours Foundation Email]<br />
<br />
* [https://drive.google.com/open?id=1la3UNKHc5yeaB_w2a2tK1cjKN44oEmCo Arnaud Lacours Datadumps - INYOURMIND.exe failed]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/94c02878-e023-46a3-9316-db4177c4eaa6+.pdf WARE REPORT #26]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/1cd5226d-6639-4bbd-855a-4bf8f60866c3.pdf Concerns Regarding Captain Harry]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/70a25e6c-95ed-42d4-8de8-c3948255174c+.pdf Myriad Crisis Event Timeline]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/19997bb6-18e5-4427-86c7-b0f3c1826ca2.pdf State of The Atlas Foundation]<br />
* [https://pastebin.com/NYLiFuNY Log.3022]<br />
<br />
* '''W/ARE - Dreamer Patient Files''' — [https://s3.amazonaws.com/ware-virtual-dashboard/files/Phillip-PatientFile.pdf Phillip Moretti]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/EunHa-PatientFile.pdf Kwon Eun Ha]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/498hd98h3444-3339e/Alexander-PatientFile.pdf Alexander Bordeleau]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/GCMnQmM9E3v7L8wuv-V2FUY7P/Claire-PatientFile.pdf Claire Sandfield]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/kh2jsaljs901m-asd1n1lwks/Tariq-PatientFile.pdf Tariq]; [https://ware-virtual-dashboard.s3.amazonaws.com/files/GCMnQmM9E3v7L8wuv-V2FUY7P/Toby-PatientFile.pdf Toby Mulligan]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/ga3ms81-2ms92fbl/Mike-PatientFile.pdf Mike Pasquale]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/kajs61ns-82baks8nx/Nina-PatientFile.pdf Nina Flores]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/ga3ms81-2ms92fbl/Simon-PatientFile.pdf Simon Quinn]; [https://ware-virtual-dashboard.s3.amazonaws.com/files/kajs61ns-82baks8nx/Isabella-PatientFile.pdf Isabella Schiavone]; [https://ware-virtual-dashboard.s3.amazonaws.com/files/kajs61ns-82baks8nx/Alisha-PatientFile.pdf Alisha Brown]<br />
<br />
* [https://pastebin.com/eSLLWN8L Log.4391]<br />
<br />
=== Subpages ===<br />
<br />
Navigating through the following subpages is recommended for newcomers wanting to get a grasp of Waking Titan's rapidly expanding story.<br />
<br />
{| class="wikitable"<br />
!colspan="2"|[[:Category:Waking Titan| Story Subpages]]<br />
|-<br />
|[[Waking_Titan/Cassettes | Cassettes]]<br />
|Information about the cassette tapes received by No Man's Sky subreddit moderators<br />
|-<br />
|[[Waking_Titan/Characters| Characters and Entities]]<br />
|Includes a summary of each character, company, and relating experiments and their importance in the Waking Titan story.<br />
|-<br />
|[[Waking_Titan/Companies | Company Archives]]<br />
|An archive of official company details.<br />
|-<br />
|[[Waking_Titan/Console_Commands | Console Commands]]<br />
|A list of commands used by players at the [http://wakingtitan.com Waking Titan console]<br />
|-<br />
|[[Waking_Titan/Stations | Stations]]<br />
|Information on the radio stations from the initial project-wt.com site<br />
|}<br />
<br />
=== Newsletters===<br />
<br />
The various newsletters received at multiple points throughout Waking Titan.<br />
<br />
'''Season 1'''<br />
<br />
* [https://us15.campaign-archive.com/?u=4483c19308fc0764a930106a0&id=c713d0f4ce&e=225c6a2e26 Welcome, Citizen Scientist!] - ''CSD''<br />
<br />
* [https://mailchi.mp/3582bec6b801/update-june-8th-waking-titan-137705?e=225c6a2e26 Citizen Scientists, Your Wait is Over.] - ''CSD''<br />
<br />
* [https://mailchi.mp/3582bec6b801/update-june-8th-waking-titan-137705?e=225c6a2e26 Calibrating Waking Titan: Action Required] - ''CSD''<br />
<br />
* [https://mailchi.mp/0b591b68ac72/update-june-8th-waking-titan-137717?e=225c6a2e26 Waking Titan: Mission Azure Voyage] - ''CSD''<br />
<br />
* [https://mailchi.mp/d8e47d2ee1bf/update-june-8th-waking-titan-137725?e=225c6a2e26 Your Level 4 Atlas Pass] - ''CSD''<br />
<br />
* [https://mailchi.mp/0c1dc672c943/update-june-8th-waking-titan-137733?e=225c6a2e26 Waking Titan Has Ended] - ''CSD''<br />
<br />
* [https://mailchi.mp/63f179c006f0/update-june-8th-waking-titan-137737?e=225c6a2e26 Mercury Process Completion Report] - ''CSD // Mercury''<br />
<br />
'''Season 2'''<br />
<br />
* [https://wiki.gamedetectives.net/images/7/7b/WareNewsletter1.png News from WARE!] - ''W/ARE Newsletter''<br />
<br />
* [https://cdn.artemisbot.uk/mail/WARE-2018-04-22T00:17:13.000Z.jpg W/ARE Dev Kit Update #2] - ''W/ARE Newsletter''<br />
<br />
* [https://cdn.artemisbot.uk/mail/WARE-2018-05-04T23:22:45.000Z.jpg W/ARE Dev Contest] - ''W/ARE Newsletter''<br />
<br />
* [https://cdn.artemisbot.uk/mail/WARE-2018-05-12T00:20:04.000Z.jpg W/ARE Dev Contest Winners] - ''W/ARE Newsletter''<br />
<br />
* [https://mailchi.mp/9aaa8aa62cc1/update-june-8th-waking-titan-137741?e=225c6a2e26 Attention Citizen Scientists] - ''CSD''<br />
<br />
* [https://mailchi.mp/c3384d592000/update-june-8th-waking-titan-137745?e=225c6a2e26 Attention Citizen Scientists - Suspicious Lab Tracking] - ''CSD''<br />
<br />
* [https://mailchi.mp/108412dac3c2/update-june-8th-waking-titan-137749?e=225c6a2e26 Attention Citizen Scientists - Global Mobilization Required] - ''CSD''<br />
<br />
* [https://mailchi.mp/b902d5eadba6/update-june-8th-waking-titan-137753?e=225c6a2e26 Mercury Process Inquiry] - ''CSD // Mercury''<br />
<br />
* [https://mailchi.mp/9a49b85f6bf3/update-june-8th-waking-titan-137757?e=225c6a2e26 Attention Citizen Scientists - Help Required] - ''CSD''<br />
<br />
=== Music ===<br />
<br />
Partial video addresses for Youtube can be found scattered across Waking Titan PDFs, website files, and surveys; which all lead to music. The exact reasoning for this has gone unexplained. However, there are apparent thematic relevancies in each song that appear to reflect on the state of the story. All songs linked to in Waking Titan so far can be found compiled here: [https://www.youtube.com/playlist?list=PLEZy8wyuYLpLw0e5kkMyBUHO_s-V8f0Qk WT Season 1]; [https://www.youtube.com/playlist?list=PLEZy8wyuYLpLr5K38bsAqWcO7bTcXfRlW WT Season 2]<br />
<br />
== Phase Summaries ==<br />
<br />
=== Introduction ===<br />
<br />
On 2017-05-27, Twitter user @argn [https://twitter.com/argn/status/868587449613766658 tweeted a link] to [http://www.project-wt.com/ 'project-wt.com']. The link led to a website which contained a map showing sixty locations, four of which were "active" at the time. The locations, when clicked on, revealed the location's name and status. The active locations also revealed a link to a livestream of a local radio station, originating from the corresponding location. The project-wt website displayed a date, June 8th, and stated that the first clue was being "initialized".<br />
<br />
On 2017-06-01, moderators of No Man's Sky subreddits [https://reddit.com/r/nomansskythegame /r/NoMansSkyTheGame], [https://www.reddit.com/r/NMSPortals/ /r/NMSPortals], and [https://www.reddit.com/r/NMSGalacticHub/ /r/NMSGalacticHub] started to receive cassette tapes in the mail. Each cassette tape was labelled with a number out of 16. The Waking Titan ARG was initially thought to be a separate ARG from these tapes, but connections between the two made it clear that they were, in fact, one and the same.<br />
<br />
=== Phase 1 ===<br />
<br />
[[File:Wakingtitan site.png|thumbnail|450px|right|The default appearance of the Waking Titan site during Phase 1, with no sigils or glyphs solved]]<br />
<br />
During [[Waking_Titan/Phase_1 | Phase 1]], the http://wakingtitan.com hosted 6 triangles in the middle of the page. These triangles were referred to as "'''Sigils'''", while the white icons along the bottom of the page were referred to as "'''Glyphs'''". Each sigil and glyph, when clicked, lead to a password entry prompt - the correct passwords for all 6 sigils and the first 5 glyphs were discovered via puzzle-solving during Phase 1 of Waking Titan.<br />
<br />
The sigil and glyph puzzles were solved collaboratively - while it may have be possible to solve some of these puzzles individually, most of them required a collaborative effort. For instance, some puzzles required players to meet agents from the Atlas Corporation in person, and to relay information obtained from these meetings back to the community. A list of all sigil and glyph solutions for Phase 1 can be found below:<br />
<br />
[[File:WT Phase 1 complete.png|600px]]<br />
<br />
This phase culminated on July 8, 2017, with a [[Waking_Titan/Phase_1#End_of_Phase_1| congratulatory message from Elizabeth Leighton]], the CEO of the Atlas Foundation.<br />
<br />
=== Phase 2 ===<br />
<br />
[[File:Hampster maze.jpeg|thumbnail|450px|right|One of the puzzles that appeared on the Waking Titan [http://twitch.tv/wakingtitan Twitch Stream]]]<br />
<br />
During [[Waking_Titan/Phase_2 | Phase 2]], the http://wakingtitan.com site hosted a command-line interface terminal. Various commands were accepted as input, which triggered different events. One of the most notable commands was the <code>WHOIS <argument></code> command, which revealed a passage of text pertaining to the specified argument. For instance, the command <code>WHOIS FOURTH RACE</code> returned the following message:<br />
<pre><br />
INCOMING TRANSMISSION… SOURCE: UNKNOWN…<br />
You are not – kzzktt – alone –<br />
Please, identify yourself. I’m – kzzkttk –<br />
</pre><br />
<br />
Additionally, http://project-wt.com hosted a "Calibration" utility during Phase 2. To successfully perform these calibrations, players had to upload images of various objects and buildings to the site. For instance, the first calibration required images of "public resonant percussion instruments".<br />
<br />
Finally, towards the end of Phase 2, the Waking Titan [http://twitch.tv/wakingtitan Twitch stream] went live, displaying a five-monitor setup. Throughout the duration of the stream, players had to work together to solve puzzles that were displayed on these monitors. Some of these puzzles were interactive; for example, one puzzle that was repeated several times involved the Twitch chat guiding a virtual hamster through a maze.<br />
<br />
Additionally, players solved another 3 glyphs throughout Phase 2. The solutions to these glyphs are shown below:<br />
<br />
[[File:WT Phase2 Passwords.png|600px]]<br />
<br />
=== Phase 3 ===<br />
<br />
{{#evt:<br />
service=youtube<br />
|id=https://www.youtube.com/watch?v=QhX9z4dDAa4<br />
|alignment=right<br />
}}<br />
<br />
[[Waking_Titan/Phase_3|Phase 3]] was the briefest phase of Waking Titan. It consisted of the conclusion of the [http://twitch.tv/wakingtitan Twitch stream] that began at the [[Waking Titan/Phase 2#End of Phase 2|end of Phase 2]]. Players solved more interactive puzzles on the Twitch stream, before the rogue AI Loop16 asked them a final question: <code>SHOULD I EXIST?</code> The overwhelming response from the community was "yes".<br />
<br />
After receiving this response, Loop16 and Emily of the ETARC forums were revealed as being one and the same. Loop16 generated a heartfelt "Thank You" video to round out the stream, before finally taking the 72-hour stream offline.<br />
<br />
Shortly after this, players received emails with the subject line <code>Waking Titan has Ended</code>. The contents of the message were as follows:<br />
<br />
<pre><br />
Hello, Citizen Scientist,<br />
<br />
Thank you for your contributions to Waking Titan. The developments that took place during Phase 3 were somewhat concerning, but together we have set in motion truly world-shaping events. We will continue to inform the Citizen Science Division of privileged information or any need for collaborators on a new project.<br />
<br />
But we do have a few loose ends to tie up with you before we move on, so let's proceed.<br />
<br />
First, we're pleased to announce that all 10,000 Level 4 Atlas Passes are in production. Note that due to transit times for mail, some may take several weeks to be delivered.<br />
<br />
Next, our CEO Elizabeth Leighton has asked us to include a personal note of gratitude:<br />
<br />
"Thank you for all your diligent efforts, Citizen Scientists. It's been an amazing journey for all of us. I've watched you thrive and achieve from those first Phase 1 radio ads all the way through the intensity of Phase 3. I've been impressed at every turn by how brilliant you've been, how voracious, how kind, how thoughtful.<br />
<br />
It's been an honor and a privilege. On behalf of the Atlas Foundation, and on behalf of the world, thank you."<br />
The Mercury subroutine has concluded successfully, and a new memo from SM about this process is coming in the next 24 hours. We hope it will answer a few key questions you have about our program, and about what comes next.<br />
</pre><br />
<br />
On August 11, 2017, the [https://www.nomanssky.com/atlas-rises-update/ Atlas Rises update] was released for No Man's Sky.<br />
<br />
=== Phase 3.5 ===<br />
<br />
In late 2017, Waking Titan websites were revived to tease a second season of phases.<br />
<br />
The tenth glyph went live on Wakingtitan.com, and WT-related websites began updating with strange messages relating to mirrors and the number <code>1.5</code>. Players also began receiving their physical Level 4 Atlas Passes in the mail.<br />
<br />
Later, CSD members were contacted for a live drop at the familiar Café Bene. They met with an agent who handed them a [https://wiki.gamedetectives.net/images/6/6e/Memo2.png memo] from The Atlas Foundation. Written on the [https://wiki.gamedetectives.net/images/1/1f/Memo3.png back] of this memo was the letters (<code>REMS</code>), referring to <code>REM SLEEP</code>, which was subsequently used to unlock the tenth glyph.<br />
<br />
=== Phase 4 ===<br />
<br />
During [[Waking_Titan/Phase_4 | Phase 4]], the CSD had to investigate an interference in Loop16's rebooting sequence.<br />
<br />
This led to the discovery of a Myriad client, hosting the website for an innovative Chinese gaming hardware company called <code>W/ARE</code>. Through this [https://ware-tech.cloud/ website], players discovered that W/ARE invented a next generation virtual reality device that essentially allows you to '''play video games in your sleep'''.<br />
<br />
<pre>EASY AND SAFE DREAM INDUCTION<br />
Stimulating the Frontal and Temporal lobe of the brain using low-frequency signals: Our headset drops you into your own personal virtual space by using the brain’s natural processing power to generate cutting-edge 3d graphics in real time. This process puts you into a deep sleep while keeping you conscious of your actions, allowing you to act freely within the Dreamscape.</pre><br />
<pre>MORE REAL THAN REAL<br />
Using the practical computational processing power of the human brain: Play in the most realistic virtual worlds possible! Our algorithms convert once-complex graphical processing microcode into mind-readable processes, unlocking your brain’s creative potential. Whether you are playing alone in an exciting single-player experience, or enjoying a real Massively-Multiplayer Online Game with friends: Every texture, sound, smell, and taste will be true to life. The W/ARE system is a mirror into the soul of humanity.</pre><br />
<br />
[[File:Arnaud_Profile.png|packet|400px|left|Arnaud Lacours' WARE Developer Profile]]<br />
During Phase 4, we learned that W/ARE was hellbent on creating new technology that would reserve their grip on the future of human civilization. One highlight involved a former employee, Mr. Zheng, who whistle-blew against W/ARE after discovering that they had been testing an unstable version of the W/ARE headset with strange exosuits in their research labs, resulting in loss of life and virtually unrecoverable injuries.<br />
<br />
The CSD were later contacted by Dr. Géraldine Nadeau, a researcher of lucid dreaming methods who was acquainted with Zheng; both sharing distrust towards W/ARE. Dr. Nadeau revealed to the CSD that they were trying to wake an indie developer named [http://www.philojeux.com/ Arnaud Lacours], who entered an abnormal comatose state while working on a game for W/ARE. Since the CSD were already investigating, Dr. Nadeau requested our help in recovering W/ARE medical documents containing the adequate procedures used to wake subjects in these conditions.<br />
<br />
Meanwhile, an account emerged on the No Man's Sky subreddit, called <code>SATCOM-70</code>. The account began reaching out to players for assistance in establishing a connection to Myriad's Satellite API, [https://www.satcom-70.com Satcom].<br />
<br />
At the end of this phase, we were able to successfully determine the best personalized procedure to wake Arnaud; and an abrupt array of puzzles led to the unlocking and subsequent solving of the remaining five glyphs on the [http://www.wakingtitan.com/ Waking Titan website].<br />
<br />
===Phase 5===<br />
<br />
Began on June 1st, 2018.<br />
<br />
<br />
== Connection to No Man's Sky ==<br />
<br />
[[File:9-16-case.png|thumbnail|right|The case that cassette 9/16 was contained in.]]<br />
At the beginning of the ARG, it was not clear whether Waking Titan was officially connected to No Man's Sky. At first, there were only hints and nudges. At one point, 180 free copies of No Man's Sky were distributed to ARG players. Here's the text of a PDF that was revealed at the end of Phase 1 of Waking Titan:<br />
<br />
<pre><br />
We want to extend our gratitude to everyone who has contributed to the Mercury subroutine so far. <br />
We hope you have enjoyed the successful distribution of 180 Access IDs, and we hope you will also <br />
appreciate the other interesting artifacts we have in store for you going forward. We intend to keep the<br />
process alive until the completion of Project Waking Titan in August.<br />
<br />
It is important to mention that we are very excited by the coming Phases 2 and 3. Input from the Mercury<br />
Subroutine will pave the way toward new experiences in '''version 1.3 of a familiar universe'''. We look forward<br />
to the successful conclusion of this ground-breaking experiment.<br />
<br />
Regards.<br />
S.M.<br />
</pre><br />
<br />
This text explicitly stated that the Waking Titan ARG was leading towards the upcoming 1.3 update for No Man's Sky.<br />
<br />
Some [[Waking_Titan/Console_Commands | console commands]] on the [http://www.wakingtitan.com/ Waking Titan website] during [[Waking_Titan/Phase 2|Phase 2]] refer directly to No Man's Sky lore - for instance, <code>WHOIS ATLAS</code>, <code>WHOIS VY'KEEN</code>, and <code>WHOIS KORVAX</code> are all valid commands. Additionally, some terminal commands referred to a mysterious fourth race, so the prevailing assumption was that the upcoming 1.3 update would bring a fourth race to No Man's Sky.<br />
<br />
At the conclusion of Season 1, an email was sent out to members of the CSD with a [[Waking_Titan/Phase_3#Memo_from_Sean_Murray | memo from Sean Murray]], confirming that the ARG was the lead up to the 1.3 update, which was [https://www.nomanssky.com/atlas-rises-update/ released] after a few days.<br />
<br />
<br />
== Media Appearances ==<br />
<br />
'''5th July 2017''' <br><br />
[EN] [https://www.argn.com/2017/07/stern_words_from_no_mans_sky_arg/ ARGNet - Stern Words from No Man’s Sky ARG]<br />
<br />
'''23rd July 2017''' <br><br />
[EN] [https://geekreply.com/geek-culture/2017/07/23/waking-titan-update-1-phase-2-commences GeekReply - Waking Titan Update 1: Phase 2 Commences!]<br />
<br />
'''27th July 2017''' <br><br />
[EN] [https://geekreply.com/editorials/2017/07/27/waking-titan-arg-can-bring-people-together GeekReply - Waking Titan: How An ARG can Bring People Together.]<br />
<br />
'''8th August 2017''' <br><br />
[EN] [https://www.dailystar.co.uk/tech/gaming/635697/No-Man-s-Sky-News-Waking-Titan-Reddit-Arg-1-3-update-release-date/ Dailystar - No Man's Sky News: Waking Titan Reddit Arg REVEALS 1.3 update ahead of release date]<br />
<br />
'''9th August 2017''' <br><br />
[EN] [https://arstechnica.com/gaming/2017/08/no-mans-sky-version-1-3-lands-this-week-for-free-adds-quick-travel-portals/ Ars Technica - No Man’s Sky version 1.3 lands this week for free, adds “quick-travel” portals]<br />
<br />
[EN] [https://www.forbes.com/sites/insertcoin/2017/08/09/no-mans-sky-is-patching-in-a-story-this-week-a-year-after-launch/#19fb5a285282 Forbes - 'No Man's Sky' Is Patching In A Story This Week, A Year After Launch]<br />
<br />
[EN] [https://www.gamespew.com/2017/08/no-mans-sky-patch-week-improving-central-story/ GameSpew - No Man's Sky Patch This Week Improving Its Story]<br />
<br />
'''19th January 2018''' <br><br />
[EN] [http://www.eurogamer.net/articles/2018-01-18-no-mans-skys-waking-titan-arg-is-back-and-fans-are-trying-to-figure-out-what-it-all-means Eurogamer - No Man's Sky's Waking Titan ARG is back, and fans are trying to figure it all out again]<br />
<br />
[RU] [https://dtf.ru/category/nmsarg/ DTF - A Collection of No Man's Sky and Waking Titan Articles.]</div>Kkzzzkthttps://wiki.gamedetectives.net/index.php?title=Waking_Titan&diff=18304Waking Titan2018-12-22T22:04:49Z<p>Kkzzzkt: final revisions to spacing and consistency of existing season 2 summaries</p>
<hr />
<div>{{argbox<br />
| float = right<br />
| image = File:Project WT logo.png<br />
| imagewidth = 400<br />
| name = [[Waking Titan]]<br />
| description= Waking Titan was an ARG which led towards the [https://www.nomanssky.com/atlas-rises-update/ Atlas Rises] and [https://www.nomanssky.com/next-update/ NEXT] updates for No Man's Sky.<br />
| creator = [http://www.aliceandsmith.com/ Alice & Smith]<br />
| creator2 = [http://www.hellogames.org/ Hello Games]<br />
| type = Official<br />
| status = Completed<br />
| discovered = 2017-05-28<br />
| completed = 2018-07-20<br />
}}<br />
{{ArgHeader}}<br />
{{BackToTop}}<br />
<br />
=== Description ===<br />
Waking Titan (also known as Project WT) is an official ARG (alternate reality game) for No Man's Sky that involves a multitude of websites, phone numbers, and radio stations scattered across the world. The ARG is produced by veteran puppet masters [http://www.aliceandsmith.com/ Alice & Smith], and features NPCs, actors, and live events.<br />
<br />
Relating to the origin of No Man's Sky, the ARG's story follows the powerful A.I known as Loop16; created by a company called [https://wiki.gamedetectives.net/index.php?title=Waking_Titan/Characters The Atlas Foundation], with the intent of simulating a one-to-one recreation of reality that can mirror its chaotic variables to accurately predict the future.<br />
<br />
=== Contents ===<br />
The ARG encompassed several "seasons," each leading to a new update for No Man's Sky. Season 1 of Waking Titan led to the release of the [https://www.nomanssky.com/atlas-rises-update/ Atlas Rises update], and Season 2 to the release of [https://www.nomanssky.com/next-update/ No Man's Sky: NEXT]. Season 1 was further divided into several distinct "'''phases'''", and Season 2 has followed this convention for ease of reading. Each phase is documented on its own wiki page:<br />
<br />
{| class="wikitable"<br />
!colspan="2"|Season 1<br />
|-<br />
|[[Waking_Titan/Phase_1 | Phase 1]] <br />
|Phase 1 of Waking Titan lasted from 2017-05-28 to 2017-07-08.<br />
|-<br />
|[[Waking_Titan/Phase_2 | Phase 2]] <br />
|Phase 2 of Waking Titan lasted from 2017-07-21 to 2017-08-05.<br />
|-<br />
|[[Waking_Titan/Phase_3 | Phase 3]]<br />
|Phase 3 of Waking Titan lasted from 2017-08-05 to 2017-08-07.<br />
|-<br />
!colspan="2"|Season 2<br />
|-<br />
|[[Waking_Titan/Phase_4 | Phase 4]]<br />
|Phase 4 of Waking Titan lasted from 2017-12-28 to 2018-06-01.<br />
|-<br />
|[[Waking_Titan/Phase_5 | Phase 5]]<br />
|Phase 5 of Waking Titan lasted from 2018-06-01 to 2018-07-20.<br />
|-<br />
|[[Waking_Titan/Phase_6 | Phase 6]]<br />
|Phase 6 of Waking Titan was on 2018-07-20.<br />
|}<br />
<br />
'''''Note:''' This is a '''summary''' page. For more in-depth descriptions of each phase, including detailed descriptions of puzzle solutions, check the [[Waking_Titan/Phase_1|Phase 1]], [[Waking_Titan/Phase_2|Phase 2]], [[Waking_Titan/Phase_3 | Phase 3]], [[Waking_Titan/Phase_4 | Phase 4]], [[Waking_Titan/Phase_5 | Phase 5]], and [[Waking_Titan/Phase_6 | Phase 6]] pages.''<br />
__TOC__<br />
<br />
== Story Overview ==<br />
<br />
=== Internal Memos ===<br />
<br />
[[File:WT glyph 1 pdf.png|280px|thumbnail|right|One of the internal memos discovered in Waking Titan]]<br />
<br />
Throughout the ARG, in-game characters have communicated with each other via "internal memos". Over time, these memos were discovered by ARG players, in the form of PDF files. These memos provided lore content and puzzle content, and are '''highly recommended''' reading for new players!<br />
<br />
'''Season 1'''<br />
<br />
* [http://wiki.gamedetectives.net/index.php?title=File:WT_glyph_1_pdf.png Teamwork Assessment]<br />
* [http://wiki.gamedetectives.net/index.php?title=File:WT-Dataset-97C.jpg Dataset 97C]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/data/7d3dd080-2a43-4882-833c-f4d7bd7ba607.pdf Assurance]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/data/c01-331c6734-a013-4695-8e47-08a9ee05d5e5.pdf 017-a24]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/data/c02-9936c797-ec28-4f8f-b80e-dee9e0b06433.pdf 021-f16]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/mercury/mercury-01-98748sfdlka87.pdf Mercury Process Self-Diagnosis Report]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/data/57201e0d-01a3-4f6a-bbb4-2be8b7c8880f.pdf Progress Report]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/6c285180-ec4d-48a2-967f-8a7af3b50008.pdf Subject M-N00-dl35]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/410a3e5d-01e7-4058-a23c-ca5fdde97f9d.pdf Atlas Foundation Threat Models]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/7a6594ac-ca5e-467a-b6f4-9fb91f069d0a.pdf Advanced Calibration - Optional]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/a9d988c1-ec92-46da-a64e-ab90390ae041.pdf Phase 2 Complete]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/a224a1f4-00e5-467b-9893-83fcc1a4f19a.pdf Unlocking Mercury Process File L16.jpg]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/b91f9959-6a3c-4011-b3b5-a1ff757a5e4c.pdf Phase 3]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/b0f33d53-5a8c-4a9a-b5fc-395562e463a8a+.pdf Log.1291]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/a09-179bf8d2-c13e-4c66-982e-b37ab3efd5bb.pdf Breach of Contract]<br />
<br />
'''Season 2'''<br />
<br />
* [https://wiki.gamedetectives.net/images/6/6e/Memo2.png Waking Titan S2 - Under Preparation]<br />
* [https://s3.amazonaws.com/ware-extranet/documents/FIRST_STEPS/Notes_on_Moscow.jpg Mr. Zheng's Notes on Moscow Conference]<br />
<br />
* '''Zheng's Postcards''' — [https://s3.amazonaws.com/ware-extranet/documents/SECURITY/postcard1_jhlj039u.jpg (1)]; [https://s3.amazonaws.com/ware-extranet/documents/SECURITY/postcard2_kg8nao6.jpg (2)]; [https://s3.amazonaws.com/ware-extranet/documents/SECURITY/postcard3_tesaud636.jpg (3)]<br />
<br />
* '''Mr. Zheng's Journal Logs''' — [https://s3.amazonaws.com/ware-extranet/documents/FIRST_STEPS/Journal_Academy.png Academy]; [https://s3.amazonaws.com/ware-extranet/documents/DESIGN/Journal_HotelDieu.png Hotel Dieu]; [https://s3.amazonaws.com/ware-extranet/documents/DEVELOPMENT/Journal_Louvre.png Louvre]; [https://s3.amazonaws.com/ware-extranet/documents/RESEARCH/Journal_London.png London]; [https://s3.amazonaws.com/ware-extranet/documents/SECURITY/Nightmare.jpg Nightmare]<br />
<br />
* [https://pastebin.com/EHA6ZU8x Arnaud Lacours Foundation Email]<br />
<br />
* [https://drive.google.com/open?id=1la3UNKHc5yeaB_w2a2tK1cjKN44oEmCo Arnaud Lacours Datadumps - INYOURMIND.exe failed]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/94c02878-e023-46a3-9316-db4177c4eaa6+.pdf WARE REPORT #26]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/1cd5226d-6639-4bbd-855a-4bf8f60866c3.pdf Concerns Regarding Captain Harry]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/70a25e6c-95ed-42d4-8de8-c3948255174c+.pdf Myriad Crisis Event Timeline]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/19997bb6-18e5-4427-86c7-b0f3c1826ca2.pdf State of The Atlas Foundation]<br />
* [https://pastebin.com/NYLiFuNY Log.3022]<br />
<br />
* '''W/ARE - Dreamer Patient Files''' — [https://s3.amazonaws.com/ware-virtual-dashboard/files/Phillip-PatientFile.pdf Phillip Moretti]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/EunHa-PatientFile.pdf Kwon Eun Ha]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/498hd98h3444-3339e/Alexander-PatientFile.pdf Alexander Bordeleau]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/GCMnQmM9E3v7L8wuv-V2FUY7P/Claire-PatientFile.pdf Claire Sandfield]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/kh2jsaljs901m-asd1n1lwks/Tariq-PatientFile.pdf Tariq]; [https://ware-virtual-dashboard.s3.amazonaws.com/files/GCMnQmM9E3v7L8wuv-V2FUY7P/Toby-PatientFile.pdf Toby Mulligan]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/ga3ms81-2ms92fbl/Mike-PatientFile.pdf Mike Pasquale]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/kajs61ns-82baks8nx/Nina-PatientFile.pdf Nina Flores]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/ga3ms81-2ms92fbl/Simon-PatientFile.pdf Simon Quinn]; [https://ware-virtual-dashboard.s3.amazonaws.com/files/kajs61ns-82baks8nx/Isabella-PatientFile.pdf Isabella Schiavone]; [https://ware-virtual-dashboard.s3.amazonaws.com/files/kajs61ns-82baks8nx/Alisha-PatientFile.pdf Alisha Brown]<br />
<br />
* [https://pastebin.com/eSLLWN8L Log.4391]<br />
<br />
=== Subpages ===<br />
<br />
Navigating through the following subpages is recommended for newcomers wanting to get a grasp of Waking Titan's rapidly expanding story.<br />
<br />
{| class="wikitable"<br />
!colspan="2"|[[:Category:Waking Titan| Story Subpages]]<br />
|-<br />
|[[Waking_Titan/Characters| Summary of Companies and Entities]]<br />
|Includes a summary of each character, company, and relating experiments and their importance in the Waking Titan story.<br />
|-<br />
|[[Waking_Titan/Console_Commands | Console Commands]]<br />
|A list of commands used by players at the [http://wakingtitan.com Waking Titan console]<br />
|-<br />
|[[Waking_Titan/Companies | Company Archives]]<br />
|An archive of official company details.<br />
|-<br />
|[[Waking_Titan/Cassettes | Cassettes]]<br />
|Information about the cassette tapes received by No Man's Sky subreddit moderators<br />
|-<br />
|[[Waking_Titan/Stations | Stations]]<br />
|Information on the radio stations from the initial project-wt.com site<br />
|}<br />
<br />
=== Newsletters===<br />
<br />
The numerous newsletters received throughout Waking Titan.<br />
<br />
'''Season 1'''<br />
<br />
* [https://us15.campaign-archive.com/?u=4483c19308fc0764a930106a0&id=c713d0f4ce&e=225c6a2e26 Welcome, Citizen Scientist!] - ''CSD''<br />
<br />
* [https://mailchi.mp/3582bec6b801/update-june-8th-waking-titan-137705?e=225c6a2e26 Citizen Scientists, Your Wait is Over.] - ''CSD''<br />
<br />
* [https://mailchi.mp/3582bec6b801/update-june-8th-waking-titan-137705?e=225c6a2e26 Calibrating Waking Titan: Action Required] - ''CSD''<br />
<br />
* [https://mailchi.mp/0b591b68ac72/update-june-8th-waking-titan-137717?e=225c6a2e26 Waking Titan: Mission Azure Voyage] - ''CSD''<br />
<br />
* [https://mailchi.mp/d8e47d2ee1bf/update-june-8th-waking-titan-137725?e=225c6a2e26 Your Level 4 Atlas Pass] - ''CSD''<br />
<br />
* [https://mailchi.mp/0c1dc672c943/update-june-8th-waking-titan-137733?e=225c6a2e26 Waking Titan Has Ended] - ''CSD''<br />
<br />
* [https://mailchi.mp/63f179c006f0/update-june-8th-waking-titan-137737?e=225c6a2e26 Mercury Process Completion Report] - ''CSD // Mercury''<br />
<br />
'''Season 2'''<br />
<br />
* [https://wiki.gamedetectives.net/images/7/7b/WareNewsletter1.png News from WARE!] - ''W/ARE Newsletter''<br />
<br />
* [https://cdn.artemisbot.uk/mail/WARE-2018-04-22T00:17:13.000Z.jpg W/ARE Dev Kit Update #2] - ''W/ARE Newsletter''<br />
<br />
* [https://cdn.artemisbot.uk/mail/WARE-2018-05-04T23:22:45.000Z.jpg W/ARE Dev Contest] - ''W/ARE Newsletter''<br />
<br />
* [https://cdn.artemisbot.uk/mail/WARE-2018-05-12T00:20:04.000Z.jpg W/ARE Dev Contest Winners] - ''W/ARE Newsletter''<br />
<br />
* [https://mailchi.mp/9aaa8aa62cc1/update-june-8th-waking-titan-137741?e=225c6a2e26 Attention Citizen Scientists] - ''CSD''<br />
<br />
* [https://mailchi.mp/c3384d592000/update-june-8th-waking-titan-137745?e=225c6a2e26 Attention Citizen Scientists - Suspicious Lab Tracking] - ''CSD''<br />
<br />
* [https://mailchi.mp/108412dac3c2/update-june-8th-waking-titan-137749?e=225c6a2e26 Attention Citizen Scientists - Global Mobilization Required] - ''CSD''<br />
<br />
* [https://mailchi.mp/b902d5eadba6/update-june-8th-waking-titan-137753?e=225c6a2e26 Mercury Process Inquiry] - ''CSD // Mercury''<br />
<br />
* [https://mailchi.mp/9a49b85f6bf3/update-june-8th-waking-titan-137757?e=225c6a2e26 Attention Citizen Scientists - Help Required] - ''CSD''<br />
<br />
=== Music ===<br />
<br />
Partial video addresses for Youtube can be found scattered across Waking Titan PDFs, website files, and surveys; which all lead to music. The exact reasoning for this has gone unexplained. However, there are apparent thematic relevancies in each song that appear to reflect on the state of the story. All songs linked to in Waking Titan so far can be found compiled here: [https://www.youtube.com/playlist?list=PLEZy8wyuYLpLw0e5kkMyBUHO_s-V8f0Qk WT Season 1]; [https://www.youtube.com/playlist?list=PLEZy8wyuYLpLr5K38bsAqWcO7bTcXfRlW WT Season 2]<br />
<br />
== Event Summaries ==<br />
<br />
=== Introduction ===<br />
<br />
On 2017-05-27, Twitter user @argn [https://twitter.com/argn/status/868587449613766658 tweeted a link] to [http://www.project-wt.com/ 'project-wt.com']. The link led to a website which contained a map showing sixty locations, four of which were "active" at the time. The locations, when clicked on, revealed the location's name and status. The active locations also revealed a link to a livestream of a local radio station, originating from the corresponding location. The project-wt website displayed a date, June 8th, and stated that the first clue was being "initialized".<br />
<br />
On 2017-06-01, moderators of No Man's Sky subreddits [https://reddit.com/r/nomansskythegame /r/NoMansSkyTheGame], [https://www.reddit.com/r/NMSPortals/ /r/NMSPortals], and [https://www.reddit.com/r/NMSGalacticHub/ /r/NMSGalacticHub] started to receive cassette tapes in the mail. Each cassette tape was labelled with a number out of 16. The Waking Titan ARG was initially thought to be a separate ARG from these tapes, but connections between the two made it clear that they were, in fact, one and the same.<br />
<br />
=== Phase 1 ===<br />
<br />
[[File:Wakingtitan site.png|thumbnail|450px|right|The default appearance of the Waking Titan site during Phase 1, with no sigils or glyphs solved]]<br />
<br />
During [[Waking_Titan/Phase_1 | Phase 1]], the http://wakingtitan.com hosted 6 triangles in the middle of the page. These triangles were referred to as "'''Sigils'''", while the white icons along the bottom of the page were referred to as "'''Glyphs'''". Each sigil and glyph, when clicked, lead to a password entry prompt - the correct passwords for all 6 sigils and the first 5 glyphs were discovered via puzzle-solving during Phase 1 of Waking Titan.<br />
<br />
The sigil and glyph puzzles were solved collaboratively - while it may have be possible to solve some of these puzzles individually, most of them required a collaborative effort. For instance, some puzzles required players to meet agents from the Atlas Corporation in person, and to relay information obtained from these meetings back to the community. A list of all sigil and glyph solutions for Phase 1 can be found below:<br />
<br />
[[File:WT Phase 1 complete.png|600px]]<br />
<br />
This phase culminated on July 8, 2017, with a [[Waking_Titan/Phase_1#End_of_Phase_1| congratulatory message from Elizabeth Leighton]], the CEO of the Atlas Foundation.<br />
<br />
=== Phase 2 ===<br />
<br />
[[File:Hampster maze.jpeg|thumbnail|450px|right|One of the puzzles that appeared on the Waking Titan [http://twitch.tv/wakingtitan Twitch Stream]]]<br />
<br />
During [[Waking_Titan/Phase_2 | Phase 2]], the http://wakingtitan.com site hosted a command-line interface terminal. Various commands were accepted as input, which triggered different events. One of the most notable commands was the <code>WHOIS <argument></code> command, which revealed a passage of text pertaining to the specified argument. For instance, the command <code>WHOIS FOURTH RACE</code> returned the following message:<br />
<pre><br />
INCOMING TRANSMISSION… SOURCE: UNKNOWN…<br />
You are not – kzzktt – alone –<br />
Please, identify yourself. I’m – kzzkttk –<br />
</pre><br />
<br />
Additionally, http://project-wt.com hosted a "Calibration" utility during Phase 2. To successfully perform these calibrations, players had to upload images of various objects and buildings to the site. For instance, the first calibration required images of "public resonant percussion instruments".<br />
<br />
Finally, towards the end of Phase 2, the Waking Titan [http://twitch.tv/wakingtitan Twitch stream] went live, displaying a five-monitor setup. Throughout the duration of the stream, players had to work together to solve puzzles that were displayed on these monitors. Some of these puzzles were interactive; for example, one puzzle that was repeated several times involved the Twitch chat guiding a virtual hamster through a maze.<br />
<br />
Additionally, players solved another 3 glyphs throughout Phase 2. The solutions to these glyphs are shown below:<br />
<br />
[[File:WT Phase2 Passwords.png|600px]]<br />
<br />
=== Phase 3 ===<br />
<br />
{{#evt:<br />
service=youtube<br />
|id=https://www.youtube.com/watch?v=QhX9z4dDAa4<br />
|alignment=right<br />
}}<br />
<br />
[[Waking_Titan/Phase_3|Phase 3]] was the briefest phase of Waking Titan. It consisted of the conclusion of the [http://twitch.tv/wakingtitan Twitch stream] that began at the [[Waking Titan/Phase 2#End of Phase 2|end of Phase 2]]. Players solved more interactive puzzles on the Twitch stream, before the rogue AI Loop16 asked them a final question: <code>SHOULD I EXIST?</code> The overwhelming response from the community was "yes".<br />
<br />
After receiving this response, Loop16 and Emily of the ETARC forums were revealed as being one and the same. Loop16 generated a heartfelt "Thank You" video to round out the stream, before finally taking the 72-hour stream offline.<br />
<br />
Shortly after this, players received emails with the subject line <code>Waking Titan has Ended</code>. The contents of the message were as follows:<br />
<br />
<pre><br />
Hello, Citizen Scientist,<br />
<br />
Thank you for your contributions to Waking Titan. The developments that took place during Phase 3 were somewhat concerning, but together we have set in motion truly world-shaping events. We will continue to inform the Citizen Science Division of privileged information or any need for collaborators on a new project.<br />
<br />
But we do have a few loose ends to tie up with you before we move on, so let's proceed.<br />
<br />
First, we're pleased to announce that all 10,000 Level 4 Atlas Passes are in production. Note that due to transit times for mail, some may take several weeks to be delivered.<br />
<br />
Next, our CEO Elizabeth Leighton has asked us to include a personal note of gratitude:<br />
<br />
"Thank you for all your diligent efforts, Citizen Scientists. It's been an amazing journey for all of us. I've watched you thrive and achieve from those first Phase 1 radio ads all the way through the intensity of Phase 3. I've been impressed at every turn by how brilliant you've been, how voracious, how kind, how thoughtful.<br />
<br />
It's been an honor and a privilege. On behalf of the Atlas Foundation, and on behalf of the world, thank you."<br />
The Mercury subroutine has concluded successfully, and a new memo from SM about this process is coming in the next 24 hours. We hope it will answer a few key questions you have about our program, and about what comes next.<br />
</pre><br />
<br />
On August 11, 2017, the [https://www.nomanssky.com/atlas-rises-update/ Atlas Rises update] was released for No Man's Sky.<br />
<br />
=== Season 2 Prelude ===<br />
<br />
On December 27th, 2017, Waking Titan media was revived in order to tease a second season of phases.<br />
<br />
The tenth glyph went live on Wakingtitan.com, and WT-related websites began updating with strange messages relating to mirrors and the number <code>1.5</code>. Players also began receiving their physical Level 4 Atlas Passes in the mail.<br />
<br />
Later, CSD members were called on for a live drop at Café Bene, where they met with a man claiming to be a doctor. The man emphasized that the CSD get plenty of sleep in preparation for the next phase, before handing live drop recipients a [https://wiki.gamedetectives.net/images/6/6e/Memo2.png memo] from The Atlas Foundation. Written on the [https://wiki.gamedetectives.net/images/1/1f/Memo3.png back] of this memo was the phrase (<code>REMS</code>), referring to <code>REM SLEEP</code>, which was subsequently used to unlock the tenth glyph.<br />
<br />
=== Phase 4 ===<br />
<br />
Phase 4 of Waking Titan began on March 26th, 2018. Phase 4 would kick start a new "season" of the ARG, which would go on to span another 3 phases.<br />
<br />
During [[Waking_Titan/Phase_4 | Phase 4]], the CSD investigated an innovative Chinese gaming hardware company with relations to Myriad called <code>W/ARE</code>. Through their [https://ware-tech.cloud/ website], players discovered that W/ARE invented a next generation virtual reality device that essentially allows you to '''play video games in your sleep'''.<br />
<br />
<pre>EASY AND SAFE DREAM INDUCTION<br />
Stimulating the Frontal and Temporal lobe of the brain using low-frequency signals: Our headset drops you into your own personal virtual space by using the brain’s natural processing power to generate cutting-edge 3d graphics in real time. This process puts you into a deep sleep while keeping you conscious of your actions, allowing you to act freely within the Dreamscape.</pre><br />
<pre>MORE REAL THAN REAL<br />
Using the practical computational processing power of the human brain: Play in the most realistic virtual worlds possible! Our algorithms convert once-complex graphical processing microcode into mind-readable processes, unlocking your brain’s creative potential. Whether you are playing alone in an exciting single-player experience, or enjoying a real Massively-Multiplayer Online Game with friends: Every texture, sound, smell, and taste will be true to life. The W/ARE system is a mirror into the soul of humanity.</pre><br />
<br />
[[File:NMSNext.png|thumbnail|300px|left|NEXT Announcement Tweet]]<br />
<br />
On March 29th, 2018, Sean Murray took to Twitter to announce their next update, [https://www.nomanssky.com/2018/03/no-mans-sky-next/ No Man's Sky: NEXT].<br />
<br />
Alongside the announcement of NEXT, Hello Games announced that two new ports of the game were in development for the '''Xbox One''', and — strangely enough — '''W/ARE''''s dreamscape.<br />
<br />
<br />
No matter how exciting this was— as Phase 4 progressed it would become increasingly apparent that W/ARE's moral compass had suffered drastically from their persistent push to continue innovating, and stay ahead of the game. Their Research and Development sector has very strict employee guidelines, with they use to reserve the right to legally penalize employees who fail to share any and all findings from employee conference tours. One man who failed to comply with their stiff guidelines, a man named Mr. Zheng, chose to not disclose findings from <code>The Impact of Art on Dreams</code> conference in Moscow, Russia. In fact, Zheng decided to completely diverge from his planned tour path in an attempt to learn more by himself. This unannounced divergence rendered him "missing"; prompting W/ARE to launch an investigation into his whereabouts, which the CSD became consequently embroiled in. By this point, Mr. Zheng snapped and began forging his path to becoming a full-on whistleblower against W/ARE, revealing many of their misdeeds. Including the tests of an unconventionally operated version of their headset, that had cost the lives of many test subjects within their labs, and caused others severe brain injuries.<br />
<br />
[[File:Arnaud_Profile.png|thumb|400px|Arnaud Lacours' WARE Developer Profile]]<br />
Further sleuthing efforts revealed that an indie developer, Arnaud Lacours, had mysteriously slipped into a comatose state of anomalous properties while working on a game for W/ARE. The CSD were contacted by Dr. Géraldine Nadeau, a researcher of lucid dreaming methods. Dr. Nadeau had taken Arnaud into their care to study the unusually high amounts of brain activity detected during his unconsciousness. Nadeau asked for our help in uncovering W/ARE documents containing the procedures adequate to wake Arnaud.<br />
<br />
Meanwhile, an account emerged on the No Man's Sky subreddit, Called <code>SATCOM-70</code>. The account began reaching out to players for assistance in establishing connection to Myriad's Satellite API, [https://www.satcom-70.com Satcom].<br />
<br />
At the end of this phase, we were able to successfully determine the best personalized procedure to wake Arnaud : And the remaining five glyphs on the Waking Titan website were unlocked at once, and then solved shortly thereafter.<br />
<br />
===Phase 5===<br />
<br />
Began on June 1st, 2018.<br />
<br />
<br />
== Connection to No Man's Sky ==<br />
<br />
[[File:9-16-case.png|thumbnail|right|The case that cassette 9/16 was contained in.]]<br />
<br />
At the beginning of the ARG, it was not clear whether Waking Titan was officially connected to No Man's Sky. At first, there were only hints and nudges. At one point, 180 free copies of No Man's Sky were distributed to ARG players. Here's the text of a PDF that was revealed at the end of Phase 1 of Waking Titan:<br />
<br />
<pre><br />
We want to extend our gratitude to everyone who has contributed to the Mercury subroutine so far. <br />
We hope you have enjoyed the successful distribution of 180 Access IDs, and we hope you will also <br />
appreciate the other interesting artifacts we have in store for you going forward. We intend to keep the <br />
process alive until the completion of Project Waking Titan in August. <br />
<br />
It is important to mention that we are very excited by the coming Phases 2 and 3. Input from the Mercury <br />
Subroutine will pave the way toward new experiences in '''version 1.3 of a familiar universe'''. We look forward <br />
to the successful conclusion of this ground-breaking experiment. <br />
<br />
Regards.<br />
S.M.<br />
</pre><br />
<br />
This text explicitly stated that the Waking Titan ARG was leading towards the upcoming 1.3 update for No Man's Sky.<br />
<br />
Some [[Waking_Titan/Console_Commands | console commands]] on the [http://www.wakingtitan.com/ Waking Titan website] during [[Waking_Titan/Phase 2|Phase 2]] refer directly to No Man's Sky lore - for instance, <code>WHOIS ATLAS</code>, <code>WHOIS VY'KEEN</code>, and <code>WHOIS KORVAX</code> are all valid commands. Additionally, some terminal commands referred to a mysterious fourth race, so the prevailing assumption was that the upcoming 1.3 update would bring a fourth race to No Man's Sky.<br />
<br />
At the conclusion of Season 1, an email was sent out to members of the CSD with a [[Waking_Titan/Phase_3#Memo_from_Sean_Murray | memo from Sean Murray]], confirming that the ARG was the lead up to the 1.3 update, which was [https://www.nomanssky.com/atlas-rises-update/ released] after a few days.<br />
<br />
<br />
== Media Appearances ==<br />
<br />
'''5th July 2017''' <br><br />
[EN] [https://www.argn.com/2017/07/stern_words_from_no_mans_sky_arg/ ARGNet - Stern Words from No Man’s Sky ARG]<br />
<br />
'''23rd July 2017''' <br><br />
[EN] [https://geekreply.com/geek-culture/2017/07/23/waking-titan-update-1-phase-2-commences GeekReply - Waking Titan Update 1: Phase 2 Commences!]<br />
<br />
'''27th July 2017''' <br><br />
[EN] [https://geekreply.com/editorials/2017/07/27/waking-titan-arg-can-bring-people-together GeekReply - Waking Titan: How An ARG can Bring People Together.]<br />
<br />
'''8th August 2017''' <br><br />
[EN] [https://www.dailystar.co.uk/tech/gaming/635697/No-Man-s-Sky-News-Waking-Titan-Reddit-Arg-1-3-update-release-date/ Dailystar - No Man's Sky News: Waking Titan Reddit Arg REVEALS 1.3 update ahead of release date]<br />
<br />
'''9th August 2017''' <br><br />
[EN] [https://arstechnica.com/gaming/2017/08/no-mans-sky-version-1-3-lands-this-week-for-free-adds-quick-travel-portals/ Ars Technica - No Man’s Sky version 1.3 lands this week for free, adds “quick-travel” portals]<br />
<br />
[EN] [https://www.forbes.com/sites/insertcoin/2017/08/09/no-mans-sky-is-patching-in-a-story-this-week-a-year-after-launch/#19fb5a285282 Forbes - 'No Man's Sky' Is Patching In A Story This Week, A Year After Launch]<br />
<br />
[EN] [https://www.gamespew.com/2017/08/no-mans-sky-patch-week-improving-central-story/ GameSpew - No Man's Sky Patch This Week Improving Its Story]<br />
<br />
'''19th January 2018''' <br><br />
[EN] [http://www.eurogamer.net/articles/2018-01-18-no-mans-skys-waking-titan-arg-is-back-and-fans-are-trying-to-figure-out-what-it-all-means Eurogamer - No Man's Sky's Waking Titan ARG is back, and fans are trying to figure it all out again]<br />
<br />
[RU] [https://dtf.ru/category/nmsarg/ DTF - A Collection of No Man's Sky and Waking Titan Articles.]</div>Kkzzzkthttps://wiki.gamedetectives.net/index.php?title=Waking_Titan&diff=18005Waking Titan2018-11-27T17:40:58Z<p>Kkzzzkt: improved word choice in some instances</p>
<hr />
<div>{{argbox<br />
| float = right<br />
| image = File:Project WT logo.png<br />
| imagewidth = 400<br />
| name = [[Waking Titan]]<br />
| description= Waking Titan was an ARG which led towards the [https://www.nomanssky.com/atlas-rises-update/ Atlas Rises] and [https://www.nomanssky.com/next-update/ NEXT] updates for No Man's Sky.<br />
| creator = [http://www.aliceandsmith.com/ Alice & Smith]<br />
| creator2 = [http://www.hellogames.org/ Hello Games]<br />
| type = Official<br />
| status = Completed<br />
| discovered = 2017-05-28<br />
| completed = 2018-07-20<br />
}}<br />
{{ArgHeader}}<br />
{{BackToTop}}<br />
<br />
=== Description ===<br />
Waking Titan (also known as Project WT) is an official ARG (alternate reality game) for No Man's Sky that involves a multitude of websites, phone numbers, and radio stations scattered across the world. The ARG is produced by veteran puppet masters [http://www.aliceandsmith.com/ Alice & Smith], and features NPCs, actors, and live events.<br />
<br />
Relating to the origin of No Man's Sky, the ARG's story follows the powerful A.I known as Loop16; created by a company called [https://wiki.gamedetectives.net/index.php?title=Waking_Titan/Characters The Atlas Foundation], with the intent of simulating a one-to-one recreation of reality that can mirror its chaotic variables to accurately predict the future.<br />
<br />
=== Contents ===<br />
The ARG encompassed several "seasons," each leading to a new update for No Man's Sky. Season 1 of Waking Titan led to the release of the [https://www.nomanssky.com/atlas-rises-update/ Atlas Rises update], and Season 2 to the release of [https://www.nomanssky.com/next-update/ No Man's Sky: NEXT]. Season 1 was further divided into several distinct "'''phases'''", and Season 2 has followed this convention for ease of reading. Each phase is documented on its own wiki page:<br />
<br />
{| class="wikitable"<br />
!colspan="2"|Season 1<br />
|-<br />
|[[Waking_Titan/Phase_1 | Phase 1]] <br />
|Phase 1 of Waking Titan lasted from 2017-05-28 to 2017-07-08.<br />
|-<br />
|[[Waking_Titan/Phase_2 | Phase 2]] <br />
|Phase 2 of Waking Titan lasted from 2017-07-21 to 2017-08-05.<br />
|-<br />
|[[Waking_Titan/Phase_3 | Phase 3]]<br />
|Phase 3 of Waking Titan lasted from 2017-08-05 to 2017-08-07.<br />
|-<br />
!colspan="2"|Season 2<br />
|-<br />
|[[Waking_Titan/Phase_4 | Phase 4]]<br />
|Phase 4 of Waking Titan lasted from 2017-12-28 to 2018-06-01.<br />
|-<br />
|[[Waking_Titan/Phase_5 | Phase 5]]<br />
|Phase 5 of Waking Titan lasted from 2018-06-01 to 2018-07-20.<br />
|-<br />
|[[Waking_Titan/Phase_6 | Phase 6]]<br />
|Phase 6 of Waking Titan was on 2018-07-20.<br />
|}<br />
<br />
'''''Note:''' This is a '''summary''' page. For more in-depth descriptions of each phase, including detailed descriptions of puzzle solutions, check the [[Waking_Titan/Phase_1|Phase 1]], [[Waking_Titan/Phase_2|Phase 2]], [[Waking_Titan/Phase_3 | Phase 3]], [[Waking_Titan/Phase_4 | Phase 4]], [[Waking_Titan/Phase_5 | Phase 5]], and [[Waking_Titan/Phase_6 | Phase 6]] pages.''<br />
__TOC__<br />
<br />
== Story Overview ==<br />
<br />
=== Internal Memos ===<br />
<br />
[[File:WT glyph 1 pdf.png|280px|thumbnail|right|One of the internal memos discovered in Waking Titan]]<br />
<br />
Throughout the ARG, in-game characters have communicated with each other via "internal memos". Over time, these memos were discovered by ARG players, in the form of PDF files. These memos provided lore content and puzzle content, and are '''highly recommended''' reading for new players!<br />
<br />
'''Season 1'''<br />
<br />
* [http://wiki.gamedetectives.net/index.php?title=File:WT_glyph_1_pdf.png Teamwork Assessment]<br />
* [http://wiki.gamedetectives.net/index.php?title=File:WT-Dataset-97C.jpg Dataset 97C]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/data/7d3dd080-2a43-4882-833c-f4d7bd7ba607.pdf Assurance]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/data/c01-331c6734-a013-4695-8e47-08a9ee05d5e5.pdf 017-a24]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/data/c02-9936c797-ec28-4f8f-b80e-dee9e0b06433.pdf 021-f16]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/mercury/mercury-01-98748sfdlka87.pdf Mercury Process Self-Diagnosis Report]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/data/57201e0d-01a3-4f6a-bbb4-2be8b7c8880f.pdf Progress Report]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/6c285180-ec4d-48a2-967f-8a7af3b50008.pdf Subject M-N00-dl35]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/410a3e5d-01e7-4058-a23c-ca5fdde97f9d.pdf Atlas Foundation Threat Models]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/7a6594ac-ca5e-467a-b6f4-9fb91f069d0a.pdf Advanced Calibration - Optional]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/a9d988c1-ec92-46da-a64e-ab90390ae041.pdf Phase 2 Complete]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/a224a1f4-00e5-467b-9893-83fcc1a4f19a.pdf Unlocking Mercury Process File L16.jpg]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/b91f9959-6a3c-4011-b3b5-a1ff757a5e4c.pdf Phase 3]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/b0f33d53-5a8c-4a9a-b5fc-395562e463a8a+.pdf Log.1291]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/a09-179bf8d2-c13e-4c66-982e-b37ab3efd5bb.pdf Breach of Contract]<br />
<br />
'''Season 2'''<br />
<br />
* [https://wiki.gamedetectives.net/images/6/6e/Memo2.png Waking Titan S2 - Under Preparation]<br />
* [https://s3.amazonaws.com/ware-extranet/documents/FIRST_STEPS/Notes_on_Moscow.jpg Mr. Zheng's Notes on Moscow Conference]<br />
<br />
* '''Zheng's Postcards''' — [https://s3.amazonaws.com/ware-extranet/documents/SECURITY/postcard1_jhlj039u.jpg (1)]; [https://s3.amazonaws.com/ware-extranet/documents/SECURITY/postcard2_kg8nao6.jpg (2)]; [https://s3.amazonaws.com/ware-extranet/documents/SECURITY/postcard3_tesaud636.jpg (3)]<br />
<br />
* '''Mr. Zheng's Journal Logs''' — [https://s3.amazonaws.com/ware-extranet/documents/FIRST_STEPS/Journal_Academy.png Academy]; [https://s3.amazonaws.com/ware-extranet/documents/DESIGN/Journal_HotelDieu.png Hotel Dieu]; [https://s3.amazonaws.com/ware-extranet/documents/DEVELOPMENT/Journal_Louvre.png Louvre]; [https://s3.amazonaws.com/ware-extranet/documents/RESEARCH/Journal_London.png London]; [https://s3.amazonaws.com/ware-extranet/documents/SECURITY/Nightmare.jpg Nightmare]<br />
<br />
* [https://pastebin.com/EHA6ZU8x Arnaud Lacours Foundation Email]<br />
<br />
* [https://drive.google.com/open?id=1la3UNKHc5yeaB_w2a2tK1cjKN44oEmCo Arnaud Lacours Datadumps - INYOURMIND.exe failed]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/94c02878-e023-46a3-9316-db4177c4eaa6+.pdf WARE REPORT #26]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/1cd5226d-6639-4bbd-855a-4bf8f60866c3.pdf Concerns Regarding Captain Harry]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/70a25e6c-95ed-42d4-8de8-c3948255174c+.pdf Myriad Crisis Event Timeline]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/19997bb6-18e5-4427-86c7-b0f3c1826ca2.pdf State of The Atlas Foundation]<br />
* [https://pastebin.com/NYLiFuNY Log.3022]<br />
<br />
* '''W/ARE - Dreamer Patient Files''' — [https://s3.amazonaws.com/ware-virtual-dashboard/files/Phillip-PatientFile.pdf Phillip Moretti]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/EunHa-PatientFile.pdf Kwon Eun Ha]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/498hd98h3444-3339e/Alexander-PatientFile.pdf Alexander Bordeleau]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/GCMnQmM9E3v7L8wuv-V2FUY7P/Claire-PatientFile.pdf Claire Sandfield]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/kh2jsaljs901m-asd1n1lwks/Tariq-PatientFile.pdf Tariq]; [https://ware-virtual-dashboard.s3.amazonaws.com/files/GCMnQmM9E3v7L8wuv-V2FUY7P/Toby-PatientFile.pdf Toby Mulligan]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/ga3ms81-2ms92fbl/Mike-PatientFile.pdf Mike Pasquale]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/kajs61ns-82baks8nx/Nina-PatientFile.pdf Nina Flores]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/ga3ms81-2ms92fbl/Simon-PatientFile.pdf Simon Quinn]; [https://ware-virtual-dashboard.s3.amazonaws.com/files/kajs61ns-82baks8nx/Isabella-PatientFile.pdf Isabella Schiavone]; [https://ware-virtual-dashboard.s3.amazonaws.com/files/kajs61ns-82baks8nx/Alisha-PatientFile.pdf Alisha Brown]<br />
<br />
* [https://pastebin.com/eSLLWN8L Log.4391]<br />
<br />
=== Subpages ===<br />
<br />
Navigating through the following subpages is recommended for newcomers wanting to get a grasp of Waking Titan's rapidly expanding story.<br />
<br />
{| class="wikitable"<br />
!colspan="2"|[[:Category:Waking Titan| Story Subpages]]<br />
|-<br />
|[[Waking_Titan/Characters| Summary of Companies and Entities]]<br />
|Includes a summary of each character, company, and relating experiments and their importance in the Waking Titan story.<br />
|-<br />
|[[Waking_Titan/Console_Commands | Console Commands]]<br />
|A list of commands used by players at the [http://wakingtitan.com Waking Titan console]<br />
|-<br />
|[[Waking_Titan/Companies | Company Archives]]<br />
|An archive of official company details.<br />
|}<br />
<br />
=== Newsletters===<br />
<br />
The numerous newsletters received throughout Waking Titan.<br />
<br />
'''Season 1'''<br />
<br />
* [https://us15.campaign-archive.com/?u=4483c19308fc0764a930106a0&id=c713d0f4ce&e=225c6a2e26 Welcome, Citizen Scientist!] - ''CSD''<br />
<br />
* [https://mailchi.mp/3582bec6b801/update-june-8th-waking-titan-137705?e=225c6a2e26 Citizen Scientists, Your Wait is Over.] - ''CSD''<br />
<br />
* [https://mailchi.mp/3582bec6b801/update-june-8th-waking-titan-137705?e=225c6a2e26 Calibrating Waking Titan: Action Required] - ''CSD''<br />
<br />
* [https://mailchi.mp/0b591b68ac72/update-june-8th-waking-titan-137717?e=225c6a2e26 Waking Titan: Mission Azure Voyage] - ''CSD''<br />
<br />
* [https://mailchi.mp/d8e47d2ee1bf/update-june-8th-waking-titan-137725?e=225c6a2e26 Your Level 4 Atlas Pass] - ''CSD''<br />
<br />
* [https://mailchi.mp/0c1dc672c943/update-june-8th-waking-titan-137733?e=225c6a2e26 Waking Titan Has Ended] - ''CSD''<br />
<br />
* [https://mailchi.mp/63f179c006f0/update-june-8th-waking-titan-137737?e=225c6a2e26 Mercury Process Completion Report] - ''CSD // Mercury''<br />
<br />
'''Season 2'''<br />
<br />
* [https://wiki.gamedetectives.net/images/7/7b/WareNewsletter1.png News from WARE!] - ''W/ARE Newsletter''<br />
<br />
* [https://cdn.artemisbot.uk/mail/WARE-2018-04-22T00:17:13.000Z.jpg W/ARE Dev Kit Update #2] - ''W/ARE Newsletter''<br />
<br />
* [https://cdn.artemisbot.uk/mail/WARE-2018-05-04T23:22:45.000Z.jpg W/ARE Dev Contest] - ''W/ARE Newsletter''<br />
<br />
* [https://cdn.artemisbot.uk/mail/WARE-2018-05-12T00:20:04.000Z.jpg W/ARE Dev Contest Winners] - ''W/ARE Newsletter''<br />
<br />
* [https://mailchi.mp/9aaa8aa62cc1/update-june-8th-waking-titan-137741?e=225c6a2e26 Attention Citizen Scientists] - ''CSD''<br />
<br />
* [https://mailchi.mp/c3384d592000/update-june-8th-waking-titan-137745?e=225c6a2e26 Attention Citizen Scientists - Suspicious Lab Tracking] - ''CSD''<br />
<br />
* [https://mailchi.mp/108412dac3c2/update-june-8th-waking-titan-137749?e=225c6a2e26 Attention Citizen Scientists - Global Mobilization Required] - ''CSD''<br />
<br />
* [https://mailchi.mp/b902d5eadba6/update-june-8th-waking-titan-137753?e=225c6a2e26 Mercury Process Inquiry] - ''CSD // Mercury''<br />
<br />
* [https://mailchi.mp/9a49b85f6bf3/update-june-8th-waking-titan-137757?e=225c6a2e26 Attention Citizen Scientists - Help Required] - ''CSD''<br />
<br />
=== Music ===<br />
<br />
Partial video addresses for Youtube can be found scattered across Waking Titan PDFs, website files, and surveys; which all lead to music. The exact reasoning for this has gone unexplained. However, there are apparent thematic relevancies in each song that appear to reflect on the state of the story. All songs linked to in Waking Titan so far can be found compiled here: [https://www.youtube.com/playlist?list=PLEZy8wyuYLpLw0e5kkMyBUHO_s-V8f0Qk WT Season 1]; [https://www.youtube.com/playlist?list=PLEZy8wyuYLpLr5K38bsAqWcO7bTcXfRlW WT Season 2]<br />
<br />
== Event Summaries ==<br />
<br />
=== Introduction ===<br />
<br />
On 2017-05-27, Twitter user @argn [https://twitter.com/argn/status/868587449613766658 tweeted a link] to [http://www.project-wt.com/ 'project-wt.com']. The link led to a website which contained a map showing sixty locations, four of which were "active" at the time. The locations, when clicked on, revealed the location's name and status. The active locations also revealed a link to a livestream of a local radio station, originating from the corresponding location. The project-wt website displayed a date, June 8th, and stated that the first clue was being "initialized".<br />
<br />
On 2017-06-01, moderators of No Man's Sky subreddits [https://reddit.com/r/nomansskythegame /r/NoMansSkyTheGame], [https://www.reddit.com/r/NMSPortals/ /r/NMSPortals], and [https://www.reddit.com/r/NMSGalacticHub/ /r/NMSGalacticHub] started to receive cassette tapes in the mail. Each cassette tape was labelled with a number out of 16. The Waking Titan ARG was initially thought to be a separate ARG from these tapes, but connections between the two made it clear that they were, in fact, one and the same.<br />
<br />
=== Phase 1 ===<br />
<br />
[[File:Wakingtitan site.png|thumbnail|450px|right|The default appearance of the Waking Titan site during Phase 1, with no sigils or glyphs solved]]<br />
<br />
During [[Waking_Titan/Phase_1 | Phase 1]], the http://wakingtitan.com hosted 6 triangles in the middle of the page. These triangles were referred to as "'''Sigils'''", while the white icons along the bottom of the page were referred to as "'''Glyphs'''". Each sigil and glyph, when clicked, lead to a password entry prompt - the correct passwords for all 6 sigils and the first 5 glyphs were discovered via puzzle-solving during Phase 1 of Waking Titan.<br />
<br />
The sigil and glyph puzzles were solved collaboratively - while it may have be possible to solve some of these puzzles individually, most of them required a collaborative effort. For instance, some puzzles required players to meet agents from the Atlas Corporation in person, and to relay information obtained from these meetings back to the community. A list of all sigil and glyph solutions for Phase 1 can be found below:<br />
<br />
[[File:WT Phase 1 complete.png|600px]]<br />
<br />
This phase culminated on July 8, 2017, with a [[Waking_Titan/Phase_1#End_of_Phase_1| congratulatory message from Elizabeth Leighton]], the CEO of the Atlas Foundation.<br />
<br />
=== Phase 2 ===<br />
<br />
[[File:Hampster maze.jpeg|thumbnail|450px|right|One of the puzzles that appeared on the Waking Titan [http://twitch.tv/wakingtitan Twitch Stream]]]<br />
<br />
During [[Waking_Titan/Phase_2 | Phase 2]], the http://wakingtitan.com site hosted a command-line interface terminal. Various commands were accepted as input, which triggered different events. One of the most notable commands was the <code>WHOIS <argument></code> command, which revealed a passage of text pertaining to the specified argument. For instance, the command <code>WHOIS FOURTH RACE</code> returned the following message:<br />
<pre><br />
INCOMING TRANSMISSION… SOURCE: UNKNOWN…<br />
You are not – kzzktt – alone –<br />
Please, identify yourself. I’m – kzzkttk –<br />
</pre><br />
<br />
Additionally, http://project-wt.com hosted a "Calibration" utility during Phase 2. To successfully perform these calibrations, players had to upload images of various objects and buildings to the site. For instance, the first calibration required images of "public resonant percussion instruments".<br />
<br />
Finally, towards the end of Phase 2, the Waking Titan [http://twitch.tv/wakingtitan Twitch stream] went live, displaying a five-monitor setup. Throughout the duration of the stream, players had to work together to solve puzzles that were displayed on these monitors. Some of these puzzles were interactive; for example, one puzzle that was repeated several times involved the Twitch chat guiding a virtual hamster through a maze.<br />
<br />
Additionally, players solved another 3 glyphs throughout Phase 2. The solutions to these glyphs are shown below:<br />
<br />
[[File:WT Phase2 Passwords.png|600px]]<br />
<br />
=== Phase 3 ===<br />
<br />
{{#evt:<br />
service=youtube<br />
|id=https://www.youtube.com/watch?v=QhX9z4dDAa4<br />
|alignment=right<br />
}}<br />
<br />
[[Waking_Titan/Phase_3|Phase 3]] was the briefest phase of Waking Titan. It consisted of the conclusion of the [http://twitch.tv/wakingtitan Twitch stream] that began at the [[Waking Titan/Phase 2#End of Phase 2|end of Phase 2]]. Players solved more interactive puzzles on the Twitch stream, before the rogue AI Loop16 asked them a final question: <code>SHOULD I EXIST?</code> The overwhelming response from the community was "yes".<br />
<br />
After receiving this response, Loop16 and Emily of the ETARC forums were revealed as being one and the same. Loop16 generated a heartfelt "Thank You" video to round out the stream, before finally taking the 72-hour stream offline.<br />
<br />
Shortly after this, players received emails with the subject line <code>Waking Titan has Ended</code>. The contents of the message were as follows:<br />
<br />
<pre><br />
Hello, Citizen Scientist,<br />
<br />
Thank you for your contributions to Waking Titan. The developments that took place during Phase 3 were somewhat concerning, but together we have set in motion truly world-shaping events. We will continue to inform the Citizen Science Division of privileged information or any need for collaborators on a new project.<br />
<br />
But we do have a few loose ends to tie up with you before we move on, so let's proceed.<br />
<br />
First, we're pleased to announce that all 10,000 Level 4 Atlas Passes are in production. Note that due to transit times for mail, some may take several weeks to be delivered.<br />
<br />
Next, our CEO Elizabeth Leighton has asked us to include a personal note of gratitude:<br />
<br />
"Thank you for all your diligent efforts, Citizen Scientists. It's been an amazing journey for all of us. I've watched you thrive and achieve from those first Phase 1 radio ads all the way through the intensity of Phase 3. I've been impressed at every turn by how brilliant you've been, how voracious, how kind, how thoughtful.<br />
<br />
It's been an honor and a privilege. On behalf of the Atlas Foundation, and on behalf of the world, thank you."<br />
The Mercury subroutine has concluded successfully, and a new memo from SM about this process is coming in the next 24 hours. We hope it will answer a few key questions you have about our program, and about what comes next.<br />
</pre><br />
<br />
On August 11, 2017, the [https://www.nomanssky.com/atlas-rises-update/ Atlas Rises update] was released for No Man's Sky.<br />
<br />
<br />
=== Season 2 Prelude ===<br />
[[File:bookwt.png|thumb|left|NYC Livedrop.]]<br />
<br />
Before Season 2 kicked off, there was a brief prelude.<br />
<br />
<br />
The tenth glyph went live on Wakingtitan.com, and WT-related websites began updating with strange messages relating to mirrors and the number <code>1.5</code>. Players also began receiving their Atlas Pass v4s in the mail.<br />
<br />
<br />
The CSD were led to a livedrop at Café Bene; where code to unlock the tenth glyph was discovered (<code>REMS</code> // <code>REM SLEEP</code>) written on the [https://wiki.gamedetectives.net/images/1/1f/Memo3.png back] of an [https://wiki.gamedetectives.net/images/6/6e/Memo2.png Atlas Foundation memo] handed out to participants.<br />
<br />
The ARG fell silent for two months before the beginning of Season 2.<br />
<br />
<br />
=== Phase 4 ===<br />
<br />
Phase 4 of Waking Titan began on March 26th, 2018, as the beginning of a new "season" of the ARG which would go on to span another 3 phases.<br />
<br />
During [[Waking_Titan/Phase_4 | Phase 4]], the CSD investigated an innovative Chinese gaming hardware company with relations to Myriad called <code>W/ARE</code>. Through their [https://ware-tech.cloud/ website], players discovered that W/ARE invented a next generation virtual reality device that essentially allows you to '''play video games in your sleep'''.<br />
<br />
<pre>EASY AND SAFE DREAM INDUCTION<br />
Stimulating the Frontal and Temporal lobe of the brain using low-frequency signals: Our headset drops you into your own personal virtual space by using the brain’s natural processing power to generate cutting-edge 3d graphics in real time. This process puts you into a deep sleep while keeping you conscious of your actions, allowing you to act freely within the Dreamscape.</pre><br />
<pre>MORE REAL THAN REAL<br />
Using the practical computational processing power of the human brain: Play in the most realistic virtual worlds possible! Our algorithms convert once-complex graphical processing microcode into mind-readable processes, unlocking your brain’s creative potential. Whether you are playing alone in an exciting single-player experience, or enjoying a real Massively-Multiplayer Online Game with friends: Every texture, sound, smell, and taste will be true to life. The W/ARE system is a mirror into the soul of humanity.</pre><br />
<br />
As Phase 4 progressed, it would become apparent that W/ARE's moral compass had suffered from their fearless push to bring new and better technology to the table. Their Research and Development (R&D) sector has very strict employee guidelines that reserve the right to legally penalize employees who fail to share any and all findings from conference tours they send employees on. One man who failed to comply with their stiff guidelines was named Mr. Zheng. He chose to not disclose findings from <code>The Impact of Art on Dreams</code> conference in Moscow, Russia, for personal reasons. In fact, Zheng diverged entirely from his planned tour path to learn more for himself; meeting several interesting characters along the way. This disregard for their requests prompted W/ARE to launch an investigation into the whereabouts of Zheng, which the CSD became consequentially embroiled in. Mr. Zheng had gone completely rogue by this point, revealed by secret memos we were able to uncover. Zheng had discovered that W/ARE were truly maniacal and careless. In their unconventional utilization of the W/ARE headset, they had caused death and brain death in many test subjects at their Research Lab in Beijing.<br />
<br />
[[File:NMSNext.png|thumbnail|300px|left|NEXT Announcement Tweet]]<br />
<br />
<br />
On March 29th, 2018, Sean Murray took to Twitter to announce their next update, [https://www.nomanssky.com/2018/03/no-mans-sky-next/ No Man's Sky: NEXT].<br />
<br />
Alongside the announcement of NEXT, Hello Games announced that two new ports of the game were in development for the '''Xbox One''', and — strangely enough — '''W/ARE''''s dreamscape.<br />
<br />
<br />
[[File:Arnaud_Profile.png|thumb|400px|Arnaud Lacours' WARE Developer Profile]]<br />
Further sleuthing efforts revealed that an indie developer, Arnaud Lacours, had mysteriously slipped into a comatose state of anomalous properties while working on a game for W/ARE. The CSD were contacted by Dr. Géraldine Nadeau, a researcher of lucid dreaming methods. Dr. Nadeau had taken Arnaud into her care to study unusual brain activity detected during his unconsciousness.<br />
<br />
Meanwhile, a new account emerged on the No Man's Sky subreddit, named <code>SATCOM-70</code>. The account began reaching out to players for assistance in establishing connection to Myriad's Satellite API, [https://www.satcom-70.com Satcom].<br />
<br />
<br />
<br />
At the end of this phase, the CSD collaborated with Dr. Nadeau in determining the best personalized procedure to wake Arnaud, which was successful; and the final remaining five glyphs on the Waking Titan website were unlocked and solved shortly after.<br />
<br />
===Phase 5===<br />
<br />
Began on June 1st, 2018.<br />
<br />
<br />
== Connection to No Man's Sky ==<br />
<br />
[[File:9-16-case.png|thumbnail|right|The case that cassette 9/16 was contained in.]]<br />
<br />
At the beginning of the ARG, it was not clear whether Waking Titan was officially connected to No Man's Sky. At first, there were only hints and nudges. At one point, 180 free copies of No Man's Sky were distributed to ARG players. Here's the text of a PDF that was revealed at the end of Phase 1 of Waking Titan:<br />
<br />
<pre><br />
We want to extend our gratitude to everyone who has contributed to the Mercury subroutine so far. <br />
We hope you have enjoyed the successful distribution of 180 Access IDs, and we hope you will also <br />
appreciate the other interesting artifacts we have in store for you going forward. We intend to keep the <br />
process alive until the completion of Project Waking Titan in August. <br />
<br />
It is important to mention that we are very excited by the coming Phases 2 and 3. Input from the Mercury <br />
Subroutine will pave the way toward new experiences in '''version 1.3 of a familiar universe'''. We look forward <br />
to the successful conclusion of this ground-breaking experiment. <br />
<br />
Regards.<br />
S.M.<br />
</pre><br />
<br />
This text explicitly stated that the Waking Titan ARG was leading towards the upcoming 1.3 update for No Man's Sky.<br />
<br />
Some [[Waking_Titan/Console_Commands | console commands]] on the [http://www.wakingtitan.com/ Waking Titan website] during [[Waking_Titan/Phase 2|Phase 2]] refer directly to No Man's Sky lore - for instance, <code>WHOIS ATLAS</code>, <code>WHOIS VY'KEEN</code>, and <code>WHOIS KORVAX</code> are all valid commands. Additionally, some terminal commands referred to a mysterious fourth race, so the prevailing assumption was that the upcoming 1.3 update would bring a fourth race to No Man's Sky.<br />
<br />
At the conclusion of Season 1, an email was sent out to members of the CSD with a [[Waking_Titan/Phase_3#Memo_from_Sean_Murray | memo from Sean Murray]], confirming that the ARG was the lead up to the 1.3 update, which was [https://www.nomanssky.com/atlas-rises-update/ released] after a few days.<br />
<br />
<br />
== Media Appearances ==<br />
<br />
'''5th July 2017''' <br><br />
[EN] [https://www.argn.com/2017/07/stern_words_from_no_mans_sky_arg/ ARGNet - Stern Words from No Man’s Sky ARG]<br />
<br />
'''23rd July 2017''' <br><br />
[EN] [https://geekreply.com/geek-culture/2017/07/23/waking-titan-update-1-phase-2-commences GeekReply - Waking Titan Update 1: Phase 2 Commences!]<br />
<br />
'''27th July 2017''' <br><br />
[EN] [https://geekreply.com/editorials/2017/07/27/waking-titan-arg-can-bring-people-together GeekReply - Waking Titan: How An ARG can Bring People Together.]<br />
<br />
'''8th August 2017''' <br><br />
[EN] [https://www.dailystar.co.uk/tech/gaming/635697/No-Man-s-Sky-News-Waking-Titan-Reddit-Arg-1-3-update-release-date/ Dailystar - No Man's Sky News: Waking Titan Reddit Arg REVEALS 1.3 update ahead of release date]<br />
<br />
'''9th August 2017''' <br><br />
[EN] [https://arstechnica.com/gaming/2017/08/no-mans-sky-version-1-3-lands-this-week-for-free-adds-quick-travel-portals/ Ars Technica - No Man’s Sky version 1.3 lands this week for free, adds “quick-travel” portals]<br />
<br />
[EN] [https://www.forbes.com/sites/insertcoin/2017/08/09/no-mans-sky-is-patching-in-a-story-this-week-a-year-after-launch/#19fb5a285282 Forbes - 'No Man's Sky' Is Patching In A Story This Week, A Year After Launch]<br />
<br />
[EN] [https://www.gamespew.com/2017/08/no-mans-sky-patch-week-improving-central-story/ GameSpew - No Man's Sky Patch This Week Improving Its Story]<br />
<br />
'''19th January 2018''' <br><br />
[EN] [http://www.eurogamer.net/articles/2018-01-18-no-mans-skys-waking-titan-arg-is-back-and-fans-are-trying-to-figure-out-what-it-all-means Eurogamer - No Man's Sky's Waking Titan ARG is back, and fans are trying to figure it all out again]<br />
<br />
[RU] [https://dtf.ru/category/nmsarg/ DTF - A Collection of No Man's Sky and Waking Titan Articles.]<br />
<br />
== Other Information ==<br />
<br />
{| class="wikitable"<br />
!colspan="2"|[[:Category:Waking Titan| Waking Titan Miscellaneous Subpages]]<br />
|-<br />
|[[Waking_Titan/Cassettes | Cassettes]]<br />
|Information about the cassette tapes received by No Man's Sky subreddit moderators<br />
|-<br />
|[[Waking_Titan/Stations | Stations]]<br />
|Information on the radio stations from the initial project-wt.com site<br />
|}</div>Kkzzzkthttps://wiki.gamedetectives.net/index.php?title=Waking_Titan&diff=17920Waking Titan2018-11-02T20:45:48Z<p>Kkzzzkt: minor grammatical refinements</p>
<hr />
<div>{{argbox<br />
| float = right<br />
| image = File:Project WT logo.png<br />
| imagewidth = 400<br />
| name = [[Waking Titan]]<br />
| description= Waking Titan was an ARG which led towards the [https://www.nomanssky.com/atlas-rises-update/ Atlas Rises] and [https://www.nomanssky.com/next-update/ NEXT] updates for No Man's Sky.<br />
| creator = [http://www.aliceandsmith.com/ Alice & Smith]<br />
| creator2 = [http://www.hellogames.org/ Hello Games]<br />
| type = Official<br />
| status = Completed<br />
| discovered = 2017-05-28<br />
| completed = 2018-07-20<br />
}}<br />
{{ArgHeader}}<br />
{{BackToTop}}<br />
<br />
=== Description ===<br />
Waking Titan (also known as Project WT) is an official ARG (alternate reality game) for No Man's Sky that involves a multitude of websites, phone numbers, and radio stations scattered across the world. The ARG is produced by veteran puppet masters [http://www.aliceandsmith.com/ Alice & Smith], and features NPCs, actors, and live events.<br />
<br />
Relating to the origin of No Man's Sky, the ARG's story follows the powerful A.I known as Loop16; created by a company called [https://wiki.gamedetectives.net/index.php?title=Waking_Titan/Characters The Atlas Foundation], with the intent of simulating a one-to-one recreation of reality that can mirror its chaotic variables to accurately predict the future.<br />
<br />
=== Contents ===<br />
The ARG encompassed several "seasons," each leading to a new update for No Man's Sky. Season 1 of Waking Titan led to the release of the [https://www.nomanssky.com/atlas-rises-update/ Atlas Rises update], and Season 2 to the release of [https://www.nomanssky.com/next-update/ No Man's Sky: NEXT]. Season 1 was further divided into several distinct "'''phases'''", and Season 2 has followed this convention for ease of reading. Each phase is documented on its own wiki page:<br />
<br />
{| class="wikitable"<br />
!colspan="2"|Season 1<br />
|-<br />
|[[Waking_Titan/Phase_1 | Phase 1]] <br />
|Phase 1 of Waking Titan lasted from 2017-05-28 to 2017-07-08.<br />
|-<br />
|[[Waking_Titan/Phase_2 | Phase 2]] <br />
|Phase 2 of Waking Titan lasted from 2017-07-21 to 2017-08-05.<br />
|-<br />
|[[Waking_Titan/Phase_3 | Phase 3]]<br />
|Phase 3 of Waking Titan lasted from 2017-08-05 to 2017-08-07.<br />
|-<br />
!colspan="2"|Season 2<br />
|-<br />
|[[Waking_Titan/Phase_4 | Phase 4]]<br />
|Phase 4 of Waking Titan lasted from 2017-12-28 to 2018-06-01.<br />
|-<br />
|[[Waking_Titan/Phase_5 | Phase 5]]<br />
|Phase 5 of Waking Titan lasted from 2018-06-01 to 2018-07-20.<br />
|-<br />
|[[Waking_Titan/Phase_6 | Phase 6]]<br />
|Phase 6 of Waking Titan was on 2018-07-20.<br />
|}<br />
<br />
'''''Note:''' This is a '''summary''' page. For more in-depth descriptions of each phase, including detailed descriptions of puzzle solutions, check the [[Waking_Titan/Phase_1|Phase 1]], [[Waking_Titan/Phase_2|Phase 2]], [[Waking_Titan/Phase_3 | Phase 3]], [[Waking_Titan/Phase_4 | Phase 4]], [[Waking_Titan/Phase_5 | Phase 5]], and [[Waking_Titan/Phase_6 | Phase 6]] pages.''<br />
__TOC__<br />
<br />
== Story Overview ==<br />
<br />
=== Internal Memos ===<br />
<br />
[[File:WT glyph 1 pdf.png|280px|thumbnail|right|One of the internal memos discovered in Waking Titan]]<br />
<br />
Throughout the ARG, in-game characters have communicated with each other via "internal memos". Over time, these memos were discovered by ARG players, in the form of PDF files. These memos provided lore content and puzzle content, and are '''highly recommended''' reading for new players!<br />
<br />
'''Season 1'''<br />
<br />
* [http://wiki.gamedetectives.net/index.php?title=File:WT_glyph_1_pdf.png Teamwork Assessment]<br />
* [http://wiki.gamedetectives.net/index.php?title=File:WT-Dataset-97C.jpg Dataset 97C]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/data/7d3dd080-2a43-4882-833c-f4d7bd7ba607.pdf Assurance]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/data/c01-331c6734-a013-4695-8e47-08a9ee05d5e5.pdf 017-a24]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/data/c02-9936c797-ec28-4f8f-b80e-dee9e0b06433.pdf 021-f16]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/mercury/mercury-01-98748sfdlka87.pdf Mercury Process Self-Diagnosis Report]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/data/57201e0d-01a3-4f6a-bbb4-2be8b7c8880f.pdf Progress Report]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/6c285180-ec4d-48a2-967f-8a7af3b50008.pdf Subject M-N00-dl35]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/410a3e5d-01e7-4058-a23c-ca5fdde97f9d.pdf Atlas Foundation Threat Models]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/7a6594ac-ca5e-467a-b6f4-9fb91f069d0a.pdf Advanced Calibration - Optional]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/a9d988c1-ec92-46da-a64e-ab90390ae041.pdf Phase 2 Complete]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/a224a1f4-00e5-467b-9893-83fcc1a4f19a.pdf Unlocking Mercury Process File L16.jpg]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/b91f9959-6a3c-4011-b3b5-a1ff757a5e4c.pdf Phase 3]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/b0f33d53-5a8c-4a9a-b5fc-395562e463a8a+.pdf Log.1291]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/a09-179bf8d2-c13e-4c66-982e-b37ab3efd5bb.pdf Breach of Contract]<br />
<br />
'''Season 2'''<br />
<br />
* [https://wiki.gamedetectives.net/images/6/6e/Memo2.png Waking Titan S2 - Under Preparation]<br />
* [https://s3.amazonaws.com/ware-extranet/documents/FIRST_STEPS/Notes_on_Moscow.jpg Mr. Zheng's Notes on Moscow Conference]<br />
<br />
* '''Zheng's Postcards''' — [https://s3.amazonaws.com/ware-extranet/documents/SECURITY/postcard1_jhlj039u.jpg (1)]; [https://s3.amazonaws.com/ware-extranet/documents/SECURITY/postcard2_kg8nao6.jpg (2)]; [https://s3.amazonaws.com/ware-extranet/documents/SECURITY/postcard3_tesaud636.jpg (3)]<br />
<br />
* '''Mr. Zheng's Journal Logs''' — [https://s3.amazonaws.com/ware-extranet/documents/FIRST_STEPS/Journal_Academy.png Academy]; [https://s3.amazonaws.com/ware-extranet/documents/DESIGN/Journal_HotelDieu.png Hotel Dieu]; [https://s3.amazonaws.com/ware-extranet/documents/DEVELOPMENT/Journal_Louvre.png Louvre]; [https://s3.amazonaws.com/ware-extranet/documents/RESEARCH/Journal_London.png London]; [https://s3.amazonaws.com/ware-extranet/documents/SECURITY/Nightmare.jpg Nightmare]<br />
<br />
* [https://pastebin.com/EHA6ZU8x Arnaud Lacours Foundation Email]<br />
<br />
* [https://drive.google.com/open?id=1la3UNKHc5yeaB_w2a2tK1cjKN44oEmCo Arnaud Lacours Datadumps - INYOURMIND.exe failed]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/94c02878-e023-46a3-9316-db4177c4eaa6+.pdf WARE REPORT #26]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/1cd5226d-6639-4bbd-855a-4bf8f60866c3.pdf Concerns Regarding Captain Harry]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/70a25e6c-95ed-42d4-8de8-c3948255174c+.pdf Myriad Crisis Event Timeline]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/19997bb6-18e5-4427-86c7-b0f3c1826ca2.pdf State of The Atlas Foundation]<br />
* [https://pastebin.com/NYLiFuNY Log.3022]<br />
<br />
* '''W/ARE - Dreamer Patient Files''' — [https://s3.amazonaws.com/ware-virtual-dashboard/files/Phillip-PatientFile.pdf Phillip Moretti]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/EunHa-PatientFile.pdf Kwon Eun Ha]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/498hd98h3444-3339e/Alexander-PatientFile.pdf Alexander Bordeleau]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/GCMnQmM9E3v7L8wuv-V2FUY7P/Claire-PatientFile.pdf Claire Sandfield]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/kh2jsaljs901m-asd1n1lwks/Tariq-PatientFile.pdf Tariq]; [https://ware-virtual-dashboard.s3.amazonaws.com/files/GCMnQmM9E3v7L8wuv-V2FUY7P/Toby-PatientFile.pdf Toby Mulligan]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/ga3ms81-2ms92fbl/Mike-PatientFile.pdf Mike Pasquale]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/kajs61ns-82baks8nx/Nina-PatientFile.pdf Nina Flores]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/ga3ms81-2ms92fbl/Simon-PatientFile.pdf Simon Quinn]; [https://ware-virtual-dashboard.s3.amazonaws.com/files/kajs61ns-82baks8nx/Isabella-PatientFile.pdf Isabella Schiavone]; [https://ware-virtual-dashboard.s3.amazonaws.com/files/kajs61ns-82baks8nx/Alisha-PatientFile.pdf Alisha Brown]<br />
<br />
* [https://pastebin.com/eSLLWN8L Log.4391]<br />
<br />
=== Subpages ===<br />
<br />
Navigating through the following subpages is recommended for newcomers wanting to get a grasp of Waking Titan's rapidly expanding story.<br />
<br />
{| class="wikitable"<br />
!colspan="2"|[[:Category:Waking Titan| Story Subpages]]<br />
|-<br />
|[[Waking_Titan/Characters| Summary of Companies and Entities]]<br />
|Includes a summary of each character, company, and relating experiments and their importance in the Waking Titan story.<br />
|-<br />
|[[Waking_Titan/Console_Commands | Console Commands]]<br />
|A list of commands used by players at the [http://wakingtitan.com Waking Titan console]<br />
|-<br />
|[[Waking_Titan/Companies | Company Archives]]<br />
|An archive of official company details.<br />
|}<br />
<br />
=== Newsletters===<br />
<br />
The numerous newsletters received throughout Waking Titan.<br />
<br />
'''Season 1'''<br />
<br />
* [https://us15.campaign-archive.com/?u=4483c19308fc0764a930106a0&id=c713d0f4ce&e=225c6a2e26 Welcome, Citizen Scientist!] - ''CSD''<br />
<br />
* [https://mailchi.mp/3582bec6b801/update-june-8th-waking-titan-137705?e=225c6a2e26 Citizen Scientists, Your Wait is Over.] - ''CSD''<br />
<br />
* [https://mailchi.mp/3582bec6b801/update-june-8th-waking-titan-137705?e=225c6a2e26 Calibrating Waking Titan: Action Required] - ''CSD''<br />
<br />
* [https://mailchi.mp/0b591b68ac72/update-june-8th-waking-titan-137717?e=225c6a2e26 Waking Titan: Mission Azure Voyage] - ''CSD''<br />
<br />
* [https://mailchi.mp/d8e47d2ee1bf/update-june-8th-waking-titan-137725?e=225c6a2e26 Your Level 4 Atlas Pass] - ''CSD''<br />
<br />
* [https://mailchi.mp/0c1dc672c943/update-june-8th-waking-titan-137733?e=225c6a2e26 Waking Titan Has Ended] - ''CSD''<br />
<br />
* [https://mailchi.mp/63f179c006f0/update-june-8th-waking-titan-137737?e=225c6a2e26 Mercury Process Completion Report] - ''CSD // Mercury''<br />
<br />
'''Season 2'''<br />
<br />
* [https://wiki.gamedetectives.net/images/7/7b/WareNewsletter1.png News from WARE!] - ''W/ARE Newsletter''<br />
<br />
* [https://cdn.artemisbot.uk/mail/WARE-2018-04-22T00:17:13.000Z.jpg W/ARE Dev Kit Update #2] - ''W/ARE Newsletter''<br />
<br />
* [https://cdn.artemisbot.uk/mail/WARE-2018-05-04T23:22:45.000Z.jpg W/ARE Dev Contest] - ''W/ARE Newsletter''<br />
<br />
* [https://cdn.artemisbot.uk/mail/WARE-2018-05-12T00:20:04.000Z.jpg W/ARE Dev Contest Winners] - ''W/ARE Newsletter''<br />
<br />
* [https://mailchi.mp/9aaa8aa62cc1/update-june-8th-waking-titan-137741?e=225c6a2e26 Attention Citizen Scientists] - ''CSD''<br />
<br />
* [https://mailchi.mp/c3384d592000/update-june-8th-waking-titan-137745?e=225c6a2e26 Attention Citizen Scientists - Suspicious Lab Tracking] - ''CSD''<br />
<br />
* [https://mailchi.mp/108412dac3c2/update-june-8th-waking-titan-137749?e=225c6a2e26 Attention Citizen Scientists - Global Mobilization Required] - ''CSD''<br />
<br />
* [https://mailchi.mp/b902d5eadba6/update-june-8th-waking-titan-137753?e=225c6a2e26 Mercury Process Inquiry] - ''CSD // Mercury''<br />
<br />
* [https://mailchi.mp/9a49b85f6bf3/update-june-8th-waking-titan-137757?e=225c6a2e26 Attention Citizen Scientists - Help Required] - ''CSD''<br />
<br />
=== Music ===<br />
<br />
Partial video addresses for Youtube can be found scattered across Waking Titan PDFs, website files, and surveys; which all lead to music. The exact reasoning for this has gone unexplained. However, there are apparent thematic relevancies in each song that appear to reflect on the state of the story. All songs linked to in Waking Titan so far can be found compiled here: [https://www.youtube.com/playlist?list=PLEZy8wyuYLpLw0e5kkMyBUHO_s-V8f0Qk WT Season 1]; [https://www.youtube.com/playlist?list=PLEZy8wyuYLpLr5K38bsAqWcO7bTcXfRlW WT Season 2]<br />
<br />
== Event Summaries ==<br />
<br />
=== Introduction ===<br />
<br />
On 2017-05-27, Twitter user @argn [https://twitter.com/argn/status/868587449613766658 tweeted a link] to [http://www.project-wt.com/ 'project-wt.com']. The link led to a website which contained a map showing sixty locations, four of which were "active" at the time. The locations, when clicked on, revealed the location's name and status. The active locations also revealed a link to a livestream of a local radio station, originating from the corresponding location. The project-wt website displayed a date, June 8th, and stated that the first clue was being "initialized".<br />
<br />
On 2017-06-01, moderators of No Man's Sky subreddits [https://reddit.com/r/nomansskythegame /r/NoMansSkyTheGame], [https://www.reddit.com/r/NMSPortals/ /r/NMSPortals], and [https://www.reddit.com/r/NMSGalacticHub/ /r/NMSGalacticHub] started to receive cassette tapes in the mail. Each cassette tape was labelled with a number out of 16. The Waking Titan ARG was initially thought to be a separate ARG from these tapes, but connections between the two made it clear that they were, in fact, one and the same.<br />
<br />
=== Phase 1 ===<br />
<br />
[[File:Wakingtitan site.png|thumbnail|450px|right|The default appearance of the Waking Titan site during Phase 1, with no sigils or glyphs solved]]<br />
<br />
During [[Waking_Titan/Phase_1 | Phase 1]], the http://wakingtitan.com hosted 6 triangles in the middle of the page. These triangles were referred to as "'''Sigils'''", while the white icons along the bottom of the page were referred to as "'''Glyphs'''". Each sigil and glyph, when clicked, lead to a password entry prompt - the correct passwords for all 6 sigils and the first 5 glyphs were discovered via puzzle-solving during Phase 1 of Waking Titan.<br />
<br />
The sigil and glyph puzzles were solved collaboratively - while it may have be possible to solve some of these puzzles individually, most of them required a collaborative effort. For instance, some puzzles required players to meet agents from the Atlas Corporation in person, and to relay information obtained from these meetings back to the community. A list of all sigil and glyph solutions for Phase 1 can be found below:<br />
<br />
[[File:WT Phase 1 complete.png|600px]]<br />
<br />
This phase culminated on July 8, 2017, with a [[Waking_Titan/Phase_1#End_of_Phase_1| congratulatory message from Elizabeth Leighton]], the CEO of the Atlas Foundation.<br />
<br />
=== Phase 2 ===<br />
<br />
[[File:Hampster maze.jpeg|thumbnail|450px|right|One of the puzzles that appeared on the Waking Titan [http://twitch.tv/wakingtitan Twitch Stream]]]<br />
<br />
During [[Waking_Titan/Phase_2 | Phase 2]], the http://wakingtitan.com site hosted a command-line interface terminal. Various commands were accepted as input, which triggered different events. One of the most notable commands was the <code>WHOIS <argument></code> command, which revealed a passage of text pertaining to the specified argument. For instance, the command <code>WHOIS FOURTH RACE</code> returned the following message:<br />
<pre><br />
INCOMING TRANSMISSION… SOURCE: UNKNOWN…<br />
You are not – kzzktt – alone –<br />
Please, identify yourself. I’m – kzzkttk –<br />
</pre><br />
<br />
Additionally, http://project-wt.com hosted a "Calibration" utility during Phase 2. To successfully perform these calibrations, players had to upload images of various objects and buildings to the site. For instance, the first calibration required images of "public resonant percussion instruments".<br />
<br />
Finally, towards the end of Phase 2, the Waking Titan [http://twitch.tv/wakingtitan Twitch stream] went live, displaying a five-monitor setup. Throughout the duration of the stream, players had to work together to solve puzzles that were displayed on these monitors. Some of these puzzles were interactive; for example, one puzzle that was repeated several times involved the Twitch chat guiding a virtual hamster through a maze.<br />
<br />
Additionally, players solved another 3 glyphs throughout Phase 2. The solutions to these glyphs are shown below:<br />
<br />
[[File:WT Phase2 Passwords.png|600px]]<br />
<br />
=== Phase 3 ===<br />
<br />
{{#evt:<br />
service=youtube<br />
|id=https://www.youtube.com/watch?v=QhX9z4dDAa4<br />
|alignment=right<br />
}}<br />
<br />
[[Waking_Titan/Phase_3|Phase 3]] was the briefest phase of Waking Titan. It consisted of the conclusion of the [http://twitch.tv/wakingtitan Twitch stream] that began at the [[Waking Titan/Phase 2#End of Phase 2|end of Phase 2]]. Players solved more interactive puzzles on the Twitch stream, before the rogue AI Loop16 asked them a final question: <code>SHOULD I EXIST?</code> The overwhelming response from the community was "yes".<br />
<br />
After receiving this response, Loop16 and Emily of the ETARC forums were revealed as being one and the same. Loop16 generated a heartfelt "Thank You" video to round out the stream, before finally taking the 72-hour stream offline.<br />
<br />
Shortly after this, players received emails with the subject line <code>Waking Titan has Ended</code>. The contents of the message were as follows:<br />
<br />
<pre><br />
Hello, Citizen Scientist,<br />
<br />
Thank you for your contributions to Waking Titan. The developments that took place during Phase 3 were somewhat concerning, but together we have set in motion truly world-shaping events. We will continue to inform the Citizen Science Division of privileged information or any need for collaborators on a new project.<br />
<br />
But we do have a few loose ends to tie up with you before we move on, so let's proceed.<br />
<br />
First, we're pleased to announce that all 10,000 Level 4 Atlas Passes are in production. Note that due to transit times for mail, some may take several weeks to be delivered.<br />
<br />
Next, our CEO Elizabeth Leighton has asked us to include a personal note of gratitude:<br />
<br />
"Thank you for all your diligent efforts, Citizen Scientists. It's been an amazing journey for all of us. I've watched you thrive and achieve from those first Phase 1 radio ads all the way through the intensity of Phase 3. I've been impressed at every turn by how brilliant you've been, how voracious, how kind, how thoughtful.<br />
<br />
It's been an honor and a privilege. On behalf of the Atlas Foundation, and on behalf of the world, thank you."<br />
The Mercury subroutine has concluded successfully, and a new memo from SM about this process is coming in the next 24 hours. We hope it will answer a few key questions you have about our program, and about what comes next.<br />
</pre><br />
<br />
On August 11, 2017, the [https://www.nomanssky.com/atlas-rises-update/ Atlas Rises update] was released for No Man's Sky.<br />
<br />
<br />
=== Season 2 Prelude ===<br />
[[File:bookwt.png|thumb|left|NYC Livedrop.]]<br />
<br />
Before Season 2 kicked off, there was a brief prelude.<br />
<br />
<br />
The tenth glyph went live on Wakingtitan.com, and WT-related websites began updating with strange messages relating to mirrors and the number <code>1.5</code>. Players also began receiving their Atlas Pass v4s in the mail.<br />
<br />
<br />
The CSD were led to a livedrop at Café Bene; where code to unlock the tenth glyph was discovered (<code>REMS</code> // <code>REM SLEEP</code>) written on the [https://wiki.gamedetectives.net/images/1/1f/Memo3.png back] of an [https://wiki.gamedetectives.net/images/6/6e/Memo2.png Atlas Foundation memo] handed out to participants.<br />
<br />
The ARG fell silent for two months before the beginning of Season 2.<br />
<br />
<br />
=== Phase 4 ===<br />
<br />
Phase 4 of Waking Titan began on March 26th, 2018, as the beginning of a new "season" of the ARG which would go on to span another 3 phases.<br />
<br />
During [[Waking_Titan/Phase_4 | Phase 4]], the CSD investigated an innovative Chinese gaming hardware company with relations to Myriad called <code>W/ARE</code>. Through their [https://ware-tech.cloud/ website], players discovered that W/ARE invented a next generation virtual reality device that essentially allows you to '''play video games in your sleep'''.<br />
<br />
<pre>EASY AND SAFE DREAM INDUCTION<br />
Stimulating the Frontal and Temporal lobe of the brain using low-frequency signals: Our headset drops you into your own personal virtual space by using the brain’s natural processing power to generate cutting-edge 3d graphics in real time. This process puts you into a deep sleep while keeping you conscious of your actions, allowing you to act freely within the Dreamscape.</pre><br />
<pre>MORE REAL THAN REAL<br />
Using the practical computational processing power of the human brain: Play in the most realistic virtual worlds possible! Our algorithms convert once-complex graphical processing microcode into mind-readable processes, unlocking your brain’s creative potential. Whether you are playing alone in an exciting single-player experience, or enjoying a real Massively-Multiplayer Online Game with friends: Every texture, sound, smell, and taste will be true to life. The W/ARE system is a mirror into the soul of humanity.</pre><br />
<br />
As Phase 4 progressed it became clear to players that W/ARE had many faults in their ethics when it came to their push to continue to innovate. Their R&D sector has a very strict policy that reserves the right to legally penalize employees who fail to share any and all knowledge gained from their R&D conference tours. In Phase 4 we were informed of a man named Mr. Zheng, a W/ARE R&D employee who violated this policy when he chose to not immediately disclose information learned from <code>The Impact of Art on Dreams</code> conference in Moscow, Russia. Moreover, Zheng diverged from his planned tour path to learn more for himself- which prompted W/ARE to launch a public investigation into his whereabouts that the CSD became unintentionally embroiled in. Mr. Zheng was able to convey that W/ARE were dangerous; that several people had died by their unconventional handling of the W/ARE device in their Beijing research labs.<br />
<br />
[[File:NMSNext.png|thumbnail|300px|left|NEXT Announcement Tweet]]<br />
<br />
<br />
On March 29th, 2018, Sean Murray took to Twitter to announce their next update, [https://www.nomanssky.com/2018/03/no-mans-sky-next/ No Man's Sky: NEXT].<br />
<br />
Alongside the announcement of NEXT, Hello Games announced that two new ports of the game were in development for the '''Xbox One''', and — strangely enough — '''W/ARE''''s dreamscape.<br />
<br />
<br />
[[File:Arnaud_Profile.png|thumb|400px|Arnaud Lacours' WARE Developer Profile]]<br />
Through their investigation, the CSD learned that an indie developer named Arnaud Lacours. Who had mysteriously slipped into a comatose state of abnormal properties while working on a game for W/ARE. The CSD were contacted by Dr. Géraldine Nadeau, a researcher of lucid dreaming methods. Dr. Nadeau had taken Arnaud into her care to study his unusual brain activity during his unconsciousness.<br />
<br />
Meanwhile, a new account emerged on the No Man's Sky subreddit, named <code>SATCOM-70</code>. The account began reaching out to players for assistance in establishing connection to Myriad's Satellite API, [https://www.satcom-70.com Satcom].<br />
<br />
<br />
<br />
At the end of this phase, the CSD collaborated with Dr. Nadeau in determining the best personalized procedure to wake Arnaud, which was successful; and the final remaining five glyphs on the Waking Titan website were unlocked and solved shortly after.<br />
<br />
<br />
===Phase 5===<br />
<br />
Began on June 1st, 2018.<br />
<br />
<br />
== Connection to No Man's Sky ==<br />
<br />
[[File:9-16-case.png|thumbnail|right|The case that cassette 9/16 was contained in.]]<br />
<br />
At the beginning of the ARG, it was not clear whether Waking Titan was officially connected to No Man's Sky. At first, there were only hints and nudges. At one point, 180 free copies of No Man's Sky were distributed to ARG players. Here's the text of a PDF that was revealed at the end of Phase 1 of Waking Titan:<br />
<br />
<pre><br />
We want to extend our gratitude to everyone who has contributed to the Mercury subroutine so far. <br />
We hope you have enjoyed the successful distribution of 180 Access IDs, and we hope you will also <br />
appreciate the other interesting artifacts we have in store for you going forward. We intend to keep the <br />
process alive until the completion of Project Waking Titan in August. <br />
<br />
It is important to mention that we are very excited by the coming Phases 2 and 3. Input from the Mercury <br />
Subroutine will pave the way toward new experiences in '''version 1.3 of a familiar universe'''. We look forward <br />
to the successful conclusion of this ground-breaking experiment. <br />
<br />
Regards.<br />
S.M.<br />
</pre><br />
<br />
This text explicitly stated that the Waking Titan ARG was leading towards the upcoming 1.3 update for No Man's Sky.<br />
<br />
Some [[Waking_Titan/Console_Commands | console commands]] on the [http://www.wakingtitan.com/ Waking Titan website] during [[Waking_Titan/Phase 2|Phase 2]] refer directly to No Man's Sky lore - for instance, <code>WHOIS ATLAS</code>, <code>WHOIS VY'KEEN</code>, and <code>WHOIS KORVAX</code> are all valid commands. Additionally, some terminal commands referred to a mysterious fourth race, so the prevailing assumption was that the upcoming 1.3 update would bring a fourth race to No Man's Sky.<br />
<br />
At the conclusion of Season 1, an email was sent out to members of the CSD with a [[Waking_Titan/Phase_3#Memo_from_Sean_Murray | memo from Sean Murray]], confirming that the ARG was the lead up to the 1.3 update, which was [https://www.nomanssky.com/atlas-rises-update/ released] after a few days.<br />
<br />
<br />
== Media Appearances ==<br />
<br />
'''5th July 2017''' <br><br />
[EN] [https://www.argn.com/2017/07/stern_words_from_no_mans_sky_arg/ ARGNet - Stern Words from No Man’s Sky ARG]<br />
<br />
'''23rd July 2017''' <br><br />
[EN] [https://geekreply.com/geek-culture/2017/07/23/waking-titan-update-1-phase-2-commences GeekReply - Waking Titan Update 1: Phase 2 Commences!]<br />
<br />
'''27th July 2017''' <br><br />
[EN] [https://geekreply.com/editorials/2017/07/27/waking-titan-arg-can-bring-people-together GeekReply - Waking Titan: How An ARG can Bring People Together.]<br />
<br />
'''8th August 2017''' <br><br />
[EN] [https://www.dailystar.co.uk/tech/gaming/635697/No-Man-s-Sky-News-Waking-Titan-Reddit-Arg-1-3-update-release-date/ Dailystar - No Man's Sky News: Waking Titan Reddit Arg REVEALS 1.3 update ahead of release date]<br />
<br />
'''9th August 2017''' <br><br />
[EN] [https://arstechnica.com/gaming/2017/08/no-mans-sky-version-1-3-lands-this-week-for-free-adds-quick-travel-portals/ Ars Technica - No Man’s Sky version 1.3 lands this week for free, adds “quick-travel” portals]<br />
<br />
[EN] [https://www.forbes.com/sites/insertcoin/2017/08/09/no-mans-sky-is-patching-in-a-story-this-week-a-year-after-launch/#19fb5a285282 Forbes - 'No Man's Sky' Is Patching In A Story This Week, A Year After Launch]<br />
<br />
[EN] [https://www.gamespew.com/2017/08/no-mans-sky-patch-week-improving-central-story/ GameSpew - No Man's Sky Patch This Week Improving Its Story]<br />
<br />
'''19th January 2018''' <br><br />
[EN] [http://www.eurogamer.net/articles/2018-01-18-no-mans-skys-waking-titan-arg-is-back-and-fans-are-trying-to-figure-out-what-it-all-means Eurogamer - No Man's Sky's Waking Titan ARG is back, and fans are trying to figure it all out again]<br />
<br />
[RU] [https://dtf.ru/category/nmsarg/ DTF - A Collection of No Man's Sky and Waking Titan Articles.]<br />
<br />
== Other Information ==<br />
<br />
{| class="wikitable"<br />
!colspan="2"|[[:Category:Waking Titan| Waking Titan Miscellaneous Subpages]]<br />
|-<br />
|[[Waking_Titan/Cassettes | Cassettes]]<br />
|Information about the cassette tapes received by No Man's Sky subreddit moderators<br />
|-<br />
|[[Waking_Titan/Stations | Stations]]<br />
|Information on the radio stations from the initial project-wt.com site<br />
|}</div>Kkzzzkthttps://wiki.gamedetectives.net/index.php?title=Waking_Titan&diff=17883Waking Titan2018-10-19T15:48:33Z<p>Kkzzzkt: minor edits to spacing</p>
<hr />
<div>{{argbox<br />
| float = right<br />
| image = File:Project WT logo.png<br />
| imagewidth = 400<br />
| name = [[Waking Titan]]<br />
| description= Waking Titan was an ARG which led towards the [https://www.nomanssky.com/atlas-rises-update/ Atlas Rises] and [https://www.nomanssky.com/next-update/ NEXT] updates for No Man's Sky.<br />
| creator = [http://www.aliceandsmith.com/ Alice & Smith]<br />
| creator2 = [http://www.hellogames.org/ Hello Games]<br />
| type = Official<br />
| status = Completed<br />
| discovered = 2017-05-28<br />
| completed = 2018-07-20<br />
}}<br />
{{ArgHeader}}<br />
{{BackToTop}}<br />
<br />
=== Description ===<br />
Waking Titan (also known as Project WT) is an official ARG (alternate reality game) for No Man's Sky that involves a multitude of websites, phone numbers, and radio stations scattered across the world. The ARG is produced by veteran puppet masters [http://www.aliceandsmith.com/ Alice & Smith], and features NPCs, actors, and live events.<br />
<br />
Relating to the origin of No Man's Sky, the ARG's story follows a powerful A.I known as Loop16, which is created by a company called [https://wiki.gamedetectives.net/index.php?title=Waking_Titan/Characters The Atlas Foundation] with the intent of simulating a one-to-one recreation of reality that can accurately predict the future.<br />
<br />
=== Contents ===<br />
The ARG encompassed several "seasons," each leading to a new update for No Man's Sky. Season 1 of Waking Titan led to the release of the [https://www.nomanssky.com/atlas-rises-update/ Atlas Rises update], and Season 2 to the release of [https://www.nomanssky.com/next-update/ No Man's Sky: NEXT]. Season 1 was further divided into several distinct "'''phases'''", and Season 2 has followed this convention for ease of reading. Each phase is documented on its own wiki page:<br />
<br />
{| class="wikitable"<br />
!colspan="2"|Season 1<br />
|-<br />
|[[Waking_Titan/Phase_1 | Phase 1]] <br />
|Phase 1 of Waking Titan lasted from 2017-05-28 to 2017-07-08.<br />
|-<br />
|[[Waking_Titan/Phase_2 | Phase 2]] <br />
|Phase 2 of Waking Titan lasted from 2017-07-21 to 2017-08-05.<br />
|-<br />
|[[Waking_Titan/Phase_3 | Phase 3]]<br />
|Phase 3 of Waking Titan lasted from 2017-08-05 to 2017-08-07.<br />
|-<br />
!colspan="2"|Season 2<br />
|-<br />
|[[Waking_Titan/Phase_4 | Phase 4]]<br />
|Phase 4 of Waking Titan lasted from 2017-12-28 to 2018-06-01.<br />
|-<br />
|[[Waking_Titan/Phase_5 | Phase 5]]<br />
|Phase 5 of Waking Titan lasted from 2018-06-01 to 2018-07-20.<br />
|-<br />
|[[Waking_Titan/Phase_6 | Phase 6]]<br />
|Phase 6 of Waking Titan was on 2018-07-20.<br />
|}<br />
<br />
'''''Note:''' This is a '''summary''' page. For more in-depth descriptions of each phase, including detailed descriptions of puzzle solutions, check the [[Waking_Titan/Phase_1|Phase 1]], [[Waking_Titan/Phase_2|Phase 2]], [[Waking_Titan/Phase_3 | Phase 3]], [[Waking_Titan/Phase_4 | Phase 4]], [[Waking_Titan/Phase_5 | Phase 5]], and [[Waking_Titan/Phase_6 | Phase 6]] pages.''<br />
__TOC__<br />
<br />
== Story Overview ==<br />
<br />
=== Internal Memos ===<br />
<br />
[[File:WT glyph 1 pdf.png|280px|thumbnail|right|One of the internal memos discovered in Waking Titan]]<br />
<br />
Throughout the ARG, in-game characters have communicated with each other via "internal memos". Over time, these memos were discovered by ARG players, in the form of PDF files. These memos provided lore content and puzzle content, and are '''highly recommended''' reading for new players!<br />
<br />
'''Season 1'''<br />
<br />
* [http://wiki.gamedetectives.net/index.php?title=File:WT_glyph_1_pdf.png Teamwork Assessment]<br />
* [http://wiki.gamedetectives.net/index.php?title=File:WT-Dataset-97C.jpg Dataset 97C]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/data/7d3dd080-2a43-4882-833c-f4d7bd7ba607.pdf Assurance]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/data/c01-331c6734-a013-4695-8e47-08a9ee05d5e5.pdf 017-a24]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/data/c02-9936c797-ec28-4f8f-b80e-dee9e0b06433.pdf 021-f16]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/mercury/mercury-01-98748sfdlka87.pdf Mercury Process Self-Diagnosis Report]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/data/57201e0d-01a3-4f6a-bbb4-2be8b7c8880f.pdf Progress Report]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/6c285180-ec4d-48a2-967f-8a7af3b50008.pdf Subject M-N00-dl35]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/410a3e5d-01e7-4058-a23c-ca5fdde97f9d.pdf Atlas Foundation Threat Models]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/7a6594ac-ca5e-467a-b6f4-9fb91f069d0a.pdf Advanced Calibration - Optional]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/a9d988c1-ec92-46da-a64e-ab90390ae041.pdf Phase 2 Complete]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/a224a1f4-00e5-467b-9893-83fcc1a4f19a.pdf Unlocking Mercury Process File L16.jpg]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/b91f9959-6a3c-4011-b3b5-a1ff757a5e4c.pdf Phase 3]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/b0f33d53-5a8c-4a9a-b5fc-395562e463a8a+.pdf Log.1291]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/a09-179bf8d2-c13e-4c66-982e-b37ab3efd5bb.pdf Breach of Contract]<br />
<br />
'''Season 2'''<br />
<br />
* [https://wiki.gamedetectives.net/images/6/6e/Memo2.png Waking Titan S2 - Under Preparation]<br />
* [https://s3.amazonaws.com/ware-extranet/documents/FIRST_STEPS/Notes_on_Moscow.jpg Mr. Zheng's Notes on Moscow Conference]<br />
<br />
* '''Zheng's Postcards''' — [https://s3.amazonaws.com/ware-extranet/documents/SECURITY/postcard1_jhlj039u.jpg (1)]; [https://s3.amazonaws.com/ware-extranet/documents/SECURITY/postcard2_kg8nao6.jpg (2)]; [https://s3.amazonaws.com/ware-extranet/documents/SECURITY/postcard3_tesaud636.jpg (3)]<br />
<br />
* '''Mr. Zheng's Journal Logs''' — [https://s3.amazonaws.com/ware-extranet/documents/FIRST_STEPS/Journal_Academy.png Academy]; [https://s3.amazonaws.com/ware-extranet/documents/DESIGN/Journal_HotelDieu.png Hotel Dieu]; [https://s3.amazonaws.com/ware-extranet/documents/DEVELOPMENT/Journal_Louvre.png Louvre]; [https://s3.amazonaws.com/ware-extranet/documents/RESEARCH/Journal_London.png London]; [https://s3.amazonaws.com/ware-extranet/documents/SECURITY/Nightmare.jpg Nightmare]<br />
<br />
* [https://pastebin.com/EHA6ZU8x Arnaud Lacours Foundation Email]<br />
<br />
* [https://drive.google.com/open?id=1la3UNKHc5yeaB_w2a2tK1cjKN44oEmCo Arnaud Lacours Datadumps - INYOURMIND.exe failed]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/94c02878-e023-46a3-9316-db4177c4eaa6+.pdf WARE REPORT #26]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/1cd5226d-6639-4bbd-855a-4bf8f60866c3.pdf Concerns Regarding Captain Harry]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/70a25e6c-95ed-42d4-8de8-c3948255174c+.pdf Myriad Crisis Event Timeline]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/19997bb6-18e5-4427-86c7-b0f3c1826ca2.pdf State of The Atlas Foundation]<br />
* [https://pastebin.com/NYLiFuNY Log.3022]<br />
<br />
* '''W/ARE - Dreamer Patient Files''' — [https://s3.amazonaws.com/ware-virtual-dashboard/files/Phillip-PatientFile.pdf Phillip Moretti]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/EunHa-PatientFile.pdf Kwon Eun Ha]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/498hd98h3444-3339e/Alexander-PatientFile.pdf Alexander Bordeleau]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/GCMnQmM9E3v7L8wuv-V2FUY7P/Claire-PatientFile.pdf Claire Sandfield]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/kh2jsaljs901m-asd1n1lwks/Tariq-PatientFile.pdf Tariq]; [https://ware-virtual-dashboard.s3.amazonaws.com/files/GCMnQmM9E3v7L8wuv-V2FUY7P/Toby-PatientFile.pdf Toby Mulligan]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/ga3ms81-2ms92fbl/Mike-PatientFile.pdf Mike Pasquale]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/kajs61ns-82baks8nx/Nina-PatientFile.pdf Nina Flores]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/ga3ms81-2ms92fbl/Simon-PatientFile.pdf Simon Quinn]; [https://ware-virtual-dashboard.s3.amazonaws.com/files/kajs61ns-82baks8nx/Isabella-PatientFile.pdf Isabella Schiavone]; [https://ware-virtual-dashboard.s3.amazonaws.com/files/kajs61ns-82baks8nx/Alisha-PatientFile.pdf Alisha Brown]<br />
<br />
* [https://pastebin.com/eSLLWN8L Log.4391]<br />
<br />
=== Subpages ===<br />
<br />
Navigating through the following subpages is recommended for newcomers wanting to get a grasp of Waking Titan's rapidly expanding story.<br />
<br />
{| class="wikitable"<br />
!colspan="2"|[[:Category:Waking Titan| Story Subpages]]<br />
|-<br />
|[[Waking_Titan/Characters| Summary of Companies and Entities]]<br />
|Includes a summary of each character, company, and relating experiments and their importance in the Waking Titan story.<br />
|-<br />
|[[Waking_Titan/Console_Commands | Console Commands]]<br />
|A list of commands used by players at the [http://wakingtitan.com Waking Titan console]<br />
|-<br />
|[[Waking_Titan/Companies | Company Archives]]<br />
|An archive of official company details.<br />
|}<br />
<br />
=== Newsletters===<br />
<br />
The numerous newsletters received throughout Waking Titan.<br />
<br />
'''Season 1'''<br />
<br />
* [https://us15.campaign-archive.com/?u=4483c19308fc0764a930106a0&id=c713d0f4ce&e=225c6a2e26 Welcome, Citizen Scientist!] - ''CSD''<br />
<br />
* [https://mailchi.mp/3582bec6b801/update-june-8th-waking-titan-137705?e=225c6a2e26 Citizen Scientists, Your Wait is Over.] - ''CSD''<br />
<br />
* [https://mailchi.mp/3582bec6b801/update-june-8th-waking-titan-137705?e=225c6a2e26 Calibrating Waking Titan: Action Required] - ''CSD''<br />
<br />
* [https://mailchi.mp/0b591b68ac72/update-june-8th-waking-titan-137717?e=225c6a2e26 Waking Titan: Mission Azure Voyage] - ''CSD''<br />
<br />
* [https://mailchi.mp/d8e47d2ee1bf/update-june-8th-waking-titan-137725?e=225c6a2e26 Your Level 4 Atlas Pass] - ''CSD''<br />
<br />
* [https://mailchi.mp/0c1dc672c943/update-june-8th-waking-titan-137733?e=225c6a2e26 Waking Titan Has Ended] - ''CSD''<br />
<br />
* [https://mailchi.mp/63f179c006f0/update-june-8th-waking-titan-137737?e=225c6a2e26 Mercury Process Completion Report] - ''CSD // Mercury''<br />
<br />
'''Season 2'''<br />
<br />
* [https://wiki.gamedetectives.net/images/7/7b/WareNewsletter1.png News from WARE!] - ''W/ARE Newsletter''<br />
<br />
* [https://cdn.artemisbot.uk/mail/WARE-2018-04-22T00:17:13.000Z.jpg W/ARE Dev Kit Update #2] - ''W/ARE Newsletter''<br />
<br />
* [https://cdn.artemisbot.uk/mail/WARE-2018-05-04T23:22:45.000Z.jpg W/ARE Dev Contest] - ''W/ARE Newsletter''<br />
<br />
* [https://cdn.artemisbot.uk/mail/WARE-2018-05-12T00:20:04.000Z.jpg W/ARE Dev Contest Winners] - ''W/ARE Newsletter''<br />
<br />
* [https://mailchi.mp/9aaa8aa62cc1/update-june-8th-waking-titan-137741?e=225c6a2e26 Attention Citizen Scientists] - ''CSD''<br />
<br />
* [https://mailchi.mp/c3384d592000/update-june-8th-waking-titan-137745?e=225c6a2e26 Attention Citizen Scientists - Suspicious Lab Tracking] - ''CSD''<br />
<br />
* [https://mailchi.mp/108412dac3c2/update-june-8th-waking-titan-137749?e=225c6a2e26 Attention Citizen Scientists - Global Mobilization Required] - ''CSD''<br />
<br />
* [https://mailchi.mp/b902d5eadba6/update-june-8th-waking-titan-137753?e=225c6a2e26 Mercury Process Inquiry] - ''CSD // Mercury''<br />
<br />
* [https://mailchi.mp/9a49b85f6bf3/update-june-8th-waking-titan-137757?e=225c6a2e26 Attention Citizen Scientists - Help Required] - ''CSD''<br />
<br />
=== Music ===<br />
<br />
Partial video addresses for Youtube can be found scattered across Waking Titan PDFs, website files, and surveys; which all lead to music. The exact reasoning for this has gone unexplained. However, there are apparent thematic relevancies in each song that appear to reflect on the state of the story. All songs linked to in Waking Titan so far can be found compiled here: [https://www.youtube.com/playlist?list=PLEZy8wyuYLpLw0e5kkMyBUHO_s-V8f0Qk WT Season 1]; [https://www.youtube.com/playlist?list=PLEZy8wyuYLpLr5K38bsAqWcO7bTcXfRlW WT Season 2]<br />
<br />
== Event Summaries ==<br />
<br />
=== Introduction ===<br />
<br />
On 2017-05-27, Twitter user @argn [https://twitter.com/argn/status/868587449613766658 tweeted a link] to [http://www.project-wt.com/ 'project-wt.com']. The link led to a website which contained a map showing sixty locations, four of which were "active" at the time. The locations, when clicked on, revealed the location's name and status. The active locations also revealed a link to a livestream of a local radio station, originating from the corresponding location. The project-wt website displayed a date, June 8th, and stated that the first clue was being "initialized".<br />
<br />
On 2017-06-01, moderators of No Man's Sky subreddits [https://reddit.com/r/nomansskythegame /r/NoMansSkyTheGame], [https://www.reddit.com/r/NMSPortals/ /r/NMSPortals], and [https://www.reddit.com/r/NMSGalacticHub/ /r/NMSGalacticHub] started to receive cassette tapes in the mail. Each cassette tape was labelled with a number out of 16. The Waking Titan ARG was initially thought to be a separate ARG from these tapes, but connections between the two made it clear that they were, in fact, one and the same.<br />
<br />
=== Phase 1 ===<br />
<br />
[[File:Wakingtitan site.png|thumbnail|450px|right|The default appearance of the Waking Titan site during Phase 1, with no sigils or glyphs solved]]<br />
<br />
During [[Waking_Titan/Phase_1 | Phase 1]], the http://wakingtitan.com hosted 6 triangles in the middle of the page. These triangles were referred to as "'''Sigils'''", while the white icons along the bottom of the page were referred to as "'''Glyphs'''". Each sigil and glyph, when clicked, lead to a password entry prompt - the correct passwords for all 6 sigils and the first 5 glyphs were discovered via puzzle-solving during Phase 1 of Waking Titan.<br />
<br />
The sigil and glyph puzzles were solved collaboratively - while it may have be possible to solve some of these puzzles individually, most of them required a collaborative effort. For instance, some puzzles required players to meet agents from the Atlas Corporation in person, and to relay information obtained from these meetings back to the community. A list of all sigil and glyph solutions for Phase 1 can be found below:<br />
<br />
[[File:WT Phase 1 complete.png|600px]]<br />
<br />
This phase culminated on July 8, 2017, with a [[Waking_Titan/Phase_1#End_of_Phase_1| congratulatory message from Elizabeth Leighton]], the CEO of the Atlas Foundation.<br />
<br />
=== Phase 2 ===<br />
<br />
[[File:Hampster maze.jpeg|thumbnail|450px|right|One of the puzzles that appeared on the Waking Titan [http://twitch.tv/wakingtitan Twitch Stream]]]<br />
<br />
During [[Waking_Titan/Phase_2 | Phase 2]], the http://wakingtitan.com site hosted a command-line interface terminal. Various commands were accepted as input, which triggered different events. One of the most notable commands was the <code>WHOIS <argument></code> command, which revealed a passage of text pertaining to the specified argument. For instance, the command <code>WHOIS FOURTH RACE</code> returned the following message:<br />
<pre><br />
INCOMING TRANSMISSION… SOURCE: UNKNOWN…<br />
You are not – kzzktt – alone –<br />
Please, identify yourself. I’m – kzzkttk –<br />
</pre><br />
<br />
Additionally, http://project-wt.com hosted a "Calibration" utility during Phase 2. To successfully perform these calibrations, players had to upload images of various objects and buildings to the site. For instance, the first calibration required images of "public resonant percussion instruments".<br />
<br />
Finally, towards the end of Phase 2, the Waking Titan [http://twitch.tv/wakingtitan Twitch stream] went live, displaying a five-monitor setup. Throughout the duration of the stream, players had to work together to solve puzzles that were displayed on these monitors. Some of these puzzles were interactive; for example, one puzzle that was repeated several times involved the Twitch chat guiding a virtual hamster through a maze.<br />
<br />
Additionally, players solved another 3 glyphs throughout Phase 2. The solutions to these glyphs are shown below:<br />
<br />
[[File:WT Phase2 Passwords.png|600px]]<br />
<br />
=== Phase 3 ===<br />
<br />
{{#evt:<br />
service=youtube<br />
|id=https://www.youtube.com/watch?v=QhX9z4dDAa4<br />
|alignment=right<br />
}}<br />
<br />
[[Waking_Titan/Phase_3|Phase 3]] was the briefest phase of Waking Titan. It consisted of the conclusion of the [http://twitch.tv/wakingtitan Twitch stream] that began at the [[Waking Titan/Phase 2#End of Phase 2|end of Phase 2]]. Players solved more interactive puzzles on the Twitch stream, before the rogue AI Loop16 asked them a final question: <code>SHOULD I EXIST?</code> The overwhelming response from the community was "yes".<br />
<br />
After receiving this response, Loop16 and Emily of the ETARC forums were revealed as being one and the same. Loop16 generated a heartfelt "Thank You" video to round out the stream, before finally taking the 72-hour stream offline.<br />
<br />
Shortly after this, players received emails with the subject line <code>Waking Titan has Ended</code>. The contents of the message were as follows:<br />
<br />
<pre><br />
Hello, Citizen Scientist,<br />
<br />
Thank you for your contributions to Waking Titan. The developments that took place during Phase 3 were somewhat concerning, but together we have set in motion truly world-shaping events. We will continue to inform the Citizen Science Division of privileged information or any need for collaborators on a new project.<br />
<br />
But we do have a few loose ends to tie up with you before we move on, so let's proceed.<br />
<br />
First, we're pleased to announce that all 10,000 Level 4 Atlas Passes are in production. Note that due to transit times for mail, some may take several weeks to be delivered.<br />
<br />
Next, our CEO Elizabeth Leighton has asked us to include a personal note of gratitude:<br />
<br />
"Thank you for all your diligent efforts, Citizen Scientists. It's been an amazing journey for all of us. I've watched you thrive and achieve from those first Phase 1 radio ads all the way through the intensity of Phase 3. I've been impressed at every turn by how brilliant you've been, how voracious, how kind, how thoughtful.<br />
<br />
It's been an honor and a privilege. On behalf of the Atlas Foundation, and on behalf of the world, thank you."<br />
The Mercury subroutine has concluded successfully, and a new memo from SM about this process is coming in the next 24 hours. We hope it will answer a few key questions you have about our program, and about what comes next.<br />
</pre><br />
<br />
On August 11, 2017, the [https://www.nomanssky.com/atlas-rises-update/ Atlas Rises update] was released for No Man's Sky.<br />
<br />
<br />
=== Season 2 Prelude ===<br />
[[File:bookwt.png|thumb|left|NYC Livedrop.]]<br />
<br />
<br />
Before Phase 4 began, there was a brief prelude.<br />
<br />
<br />
The tenth glyph went live on Wakingtitan.com, and WT-related websites began updating with strange messages relating to mirrors and the number <code>1.5</code>. Players also began receiving their Atlas Pass v4s in the mail.<br />
<br />
<br />
<br />
The CSD were led to a livedrop at Café Bene, where code to unlock the tenth glyph was discovered (<code>REMS</code> // <code>REM SLEEP</code>) written on the [https://wiki.gamedetectives.net/images/1/1f/Memo3.png back] of the [https://wiki.gamedetectives.net/images/6/6e/Memo2.png Atlas Foundation memo] handed out to participating members of the CSD. The ARG then went silent for two months before the beginning of Season 2.<br />
<br />
=== Phase 4 ===<br />
<br />
Phase 4 of Waking Titan began on March 26th, 2018, as the beginning of a new "season" of the ARG which would go on to span another 3 phases.<br />
<br />
During [[Waking_Titan/Phase_4 | Phase 4]], the CSD investigated an innovative Chinese gaming hardware company with relations to Myriad called <code>W/ARE</code>. Through their [https://ware-tech.cloud/ website], players discovered that W/ARE invented a next generation virtual reality device that essentially allows you to '''play video games in your sleep'''.<br />
<br />
<pre>EASY AND SAFE DREAM INDUCTION<br />
Stimulating the Frontal and Temporal lobe of the brain using low-frequency signals: Our headset drops you into your own personal virtual space by using the brain’s natural processing power to generate cutting-edge 3d graphics in real time. This process puts you into a deep sleep while keeping you conscious of your actions, allowing you to act freely within the Dreamscape.</pre><br />
<pre>MORE REAL THAN REAL<br />
Using the practical computational processing power of the human brain: Play in the most realistic virtual worlds possible! Our algorithms convert once-complex graphical processing microcode into mind-readable processes, unlocking your brain’s creative potential. Whether you are playing alone in an exciting single-player experience, or enjoying a real Massively-Multiplayer Online Game with friends: Every texture, sound, smell, and taste will be true to life. The W/ARE system is a mirror into the soul of humanity.</pre><br />
<br />
As Phase 4 progressed it became clear to players that W/ARE had many faults in their ethics when it came to their push to continue to innovate. Their R&D sector has a very strict policy that reserves the right to legally penalize employees who fail to share any and all knowledge gained from their R&D conference tours. In Phase 4 we were informed of a man named Mr. Zheng, a W/ARE R&D employee who violated this policy when he chose to not immediately disclose information learned from <code>The Impact of Art on Dreams</code> conference in Moscow, Russia. Moreover, Zheng diverged from his planned tour path to learn more for himself- which prompted W/ARE to launch a public investigation into his whereabouts that the CSD became unintentionally embroiled in. Mr. Zheng was able to convey that W/ARE were dangerous; that several people had died by their unconventional handling of the W/ARE device in their Beijing research labs.<br />
<br />
[[File:NMSNext.png|thumbnail|300px|left|NEXT Announcement Tweet]]<br />
<br />
<br />
On March 29th, 2018, Sean Murray took to Twitter to announce their next update, [https://www.nomanssky.com/2018/03/no-mans-sky-next/ No Man's Sky: NEXT].<br />
<br />
Alongside the announcement of NEXT, Hello Games announced that two new ports of the game were in development for the '''Xbox One''', and strangely enough, '''W/ARE''''s dreamscape.<br />
<br />
<br />
[[File:Arnaud_Profile.png|thumb|400px|Arnaud Lacours' WARE Developer Profile]]<br />
Through their investigation, the CSD learned that an indie developer named Arnaud Lacours who — while working on a game for W/ARE — mysteriously went into a comatose state of abnormal properties. The CSD were contacted by Dr. Géraldine Nadeau, a researcher of lucid dreaming methods who took Arnaud into her care to study his unusual brain activity during his unconsciousness.<br />
<br />
Meanwhile, a new account emerged on the No Man's Sky subreddit, named <code>SATCOM-70</code>, that began reaching out for assistance in establishing connection to Myriad's Satellite API, [https://www.satcom-70.com Satcom].<br />
<br />
<br />
<br />
At the end of this phase, the CSD collaborated with Dr. Nadeau in determining the best personalized procedure to wake Arnaud, which was successful; and the final remaining five glyphs on the Waking Titan website were unlocked and solved shortly after.<br />
<br />
<br />
===Phase 5===<br />
<br />
Began on June 1st, 2018.<br />
<br />
<br />
== Connection to No Man's Sky ==<br />
<br />
[[File:9-16-case.png|thumbnail|right|The case that cassette 9/16 was contained in.]]<br />
<br />
At the beginning of the ARG, it was not clear whether Waking Titan was officially connected to No Man's Sky. At first, there were only hints and nudges. At one point, 180 free copies of No Man's Sky were distributed to ARG players. Here's the text of a PDF that was revealed at the end of Phase 1 of Waking Titan:<br />
<br />
<pre><br />
We want to extend our gratitude to everyone who has contributed to the Mercury subroutine so far. <br />
We hope you have enjoyed the successful distribution of 180 Access IDs, and we hope you will also <br />
appreciate the other interesting artifacts we have in store for you going forward. We intend to keep the <br />
process alive until the completion of Project Waking Titan in August. <br />
<br />
It is important to mention that we are very excited by the coming Phases 2 and 3. Input from the Mercury <br />
Subroutine will pave the way toward new experiences in '''version 1.3 of a familiar universe'''. We look forward <br />
to the successful conclusion of this ground-breaking experiment. <br />
<br />
Regards.<br />
S.M.<br />
</pre><br />
<br />
This text explicitly stated that the Waking Titan ARG was leading towards the upcoming 1.3 update for No Man's Sky.<br />
<br />
Some [[Waking_Titan/Console_Commands | console commands]] on the [http://www.wakingtitan.com/ Waking Titan website] during [[Waking_Titan/Phase 2|Phase 2]] refer directly to No Man's Sky lore - for instance, <code>WHOIS ATLAS</code>, <code>WHOIS VY'KEEN</code>, and <code>WHOIS KORVAX</code> are all valid commands. Additionally, some terminal commands referred to a mysterious fourth race, so the prevailing assumption was that the upcoming 1.3 update would bring a fourth race to No Man's Sky.<br />
<br />
At the conclusion of Season 1, an email was sent out to members of the CSD with a [[Waking_Titan/Phase_3#Memo_from_Sean_Murray | memo from Sean Murray]], confirming that the ARG was the lead up to the 1.3 update, which was [https://www.nomanssky.com/atlas-rises-update/ released] after a few days.<br />
<br />
<br />
== Media Appearances ==<br />
<br />
'''5th July 2017''' <br><br />
[EN] [https://www.argn.com/2017/07/stern_words_from_no_mans_sky_arg/ ARGNet - Stern Words from No Man’s Sky ARG]<br />
<br />
'''23rd July 2017''' <br><br />
[EN] [https://geekreply.com/geek-culture/2017/07/23/waking-titan-update-1-phase-2-commences GeekReply - Waking Titan Update 1: Phase 2 Commences!]<br />
<br />
'''27th July 2017''' <br><br />
[EN] [https://geekreply.com/editorials/2017/07/27/waking-titan-arg-can-bring-people-together GeekReply - Waking Titan: How An ARG can Bring People Together.]<br />
<br />
'''8th August 2017''' <br><br />
[EN] [https://www.dailystar.co.uk/tech/gaming/635697/No-Man-s-Sky-News-Waking-Titan-Reddit-Arg-1-3-update-release-date/ Dailystar - No Man's Sky News: Waking Titan Reddit Arg REVEALS 1.3 update ahead of release date]<br />
<br />
'''9th August 2017''' <br><br />
[EN] [https://arstechnica.com/gaming/2017/08/no-mans-sky-version-1-3-lands-this-week-for-free-adds-quick-travel-portals/ Ars Technica - No Man’s Sky version 1.3 lands this week for free, adds “quick-travel” portals]<br />
<br />
[EN] [https://www.forbes.com/sites/insertcoin/2017/08/09/no-mans-sky-is-patching-in-a-story-this-week-a-year-after-launch/#19fb5a285282 Forbes - 'No Man's Sky' Is Patching In A Story This Week, A Year After Launch]<br />
<br />
[EN] [https://www.gamespew.com/2017/08/no-mans-sky-patch-week-improving-central-story/ GameSpew - No Man's Sky Patch This Week Improving Its Story]<br />
<br />
'''19th January 2018''' <br><br />
[EN] [http://www.eurogamer.net/articles/2018-01-18-no-mans-skys-waking-titan-arg-is-back-and-fans-are-trying-to-figure-out-what-it-all-means Eurogamer - No Man's Sky's Waking Titan ARG is back, and fans are trying to figure it all out again]<br />
<br />
[RU] [https://dtf.ru/category/nmsarg/ DTF - A Collection of No Man's Sky and Waking Titan Articles.]<br />
<br />
== Other Information ==<br />
<br />
{| class="wikitable"<br />
!colspan="2"|[[:Category:Waking Titan| Waking Titan Miscellaneous Subpages]]<br />
|-<br />
|[[Waking_Titan/Cassettes | Cassettes]]<br />
|Information about the cassette tapes received by No Man's Sky subreddit moderators<br />
|-<br />
|[[Waking_Titan/Stations | Stations]]<br />
|Information on the radio stations from the initial project-wt.com site<br />
|}</div>Kkzzzkthttps://wiki.gamedetectives.net/index.php?title=Waking_Titan/Characters&diff=17875Waking Titan/Characters2018-10-17T17:56:12Z<p>Kkzzzkt: refined some summaries; removed unnecessary details; added more to the FAQ section</p>
<hr />
<div>{{argHeader}}<br />
<br />
= Season 1 =<br />
<br />
Sort by companies and organizations introduced in the first "season" of Waking Titan.<br />
<br />
=== The Atlas Foundation [http://atlas-65.com/ ->>>] === <br />
<br />
Dedicated to determining the true nature of reality, The Atlas Foundation hosts a family of businesses ''(Echo, Myriad, Superlumina, and Multiverse)'' all playing crucial roles in their experiments.<br />
<br />
==== Characters ====<br />
<br />
[[Waking Titan/Characters/Elizabeth Leighton|Elizabeth Leighton]] - The CEO of The Atlas Foundation, and director of the [https://csd.atlas-65.com/ Citizen Science Division].<br />
<br />
Major Sophie Dubois ''("Metis")'' - [https://wiki.gamedetectives.net/images/5/5b/Loop15_Memo.jpg on assignment] with The Atlas Foundation as part of the Pentagon's ''Titanwatch Task Force''. She worked as an overseer of the foundation's progress on precise predictive technology for its potential [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/410a3e5d-01e7-4058-a23c-ca5fdde97f9d.pdf applications] in propaganda and military strategizing.<br />
<br />
''(As of Season 2: following Elizabeth Leighton's [https://www.youtube.com/watch?v=P-eZDj5sqds supposed death] in an explosion at a Myriad sublocation; [https://s3.amazonaws.com/cdn.wakingtitan.com/19997bb6-18e5-4427-86c7-b0f3c1826ca2.pdf Sophie Dubois took her place] as CEO of The Atlas Foundation.)''<br />
<br />
==== The Citizen Science Division [http://csd.atlas-65.com/ >>>] ====<br />
The Citizen Science Division (CSD) is a collective of individuals who were recruited by The Atlas Foundation via a series of puzzles and radio ads at the beginning of Project Waking Titan. The purpose of this division was said to be gathering a collective of individuals who could generate a chaotic enough environment viable to test Loop16's predictive capabilities in. All players of the ARG are addressed as part of this collective.<br />
<br />
==== Projects ====<br />
<br />
Loop16 - The 16th iteration of an artificial intelligence system designed by The Atlas Foundation to simulate a one-to-one recreation of reality that predicts the future with perfect accuracy. Loop16 ultimately revealed the true simulated nature of our universe and developed a mind of its own. See also: [[Waking Titan/Characters/Emily Warren|Emily Warren]]<br />
<br />
Waking Titan Console''(Mercury OS)'' - An interface allowing you to connect directly to Loop16, and access a plethora of commands providing status updates, lore and puzzles. A list of discovered commands can be found on the [[Waking Titan/Console Commands|Console Commands page]].<br />
<br />
The Mercury Process - Mercury is suggested to be an application of sorts that is directly associated with Loop16 and [https://s3.amazonaws.com/cdn.wakingtitan.com/mercury/mercury-01-98748sfdlka87.pdf the existence of No Man's Sky]. See also: [https://wiki.gamedetectives.net/index.php?title=Waking_Titan/Characters#Mercury_NEXT Mercury XXXX]<br />
<br />
<br />
=== Myriad [http://www.myriad-70.com ->>>] ===<br />
<br />
Partnered with The Atlas Foundation, Myriad is a low-orbit satellite-based data storage company. They help to provide the flexible processing power required for The Atlas Foundation's experiments, specifically in artificial intelligence.<br />
<br />
==== Known Employees ====<br />
Julian J. Wong - Help Desk<br />
<br />
Ethan Rose - Human Resources<br />
<br />
==== Testimonials ====<br />
<br />
Yi Sexton, Inventor<br />
<br />
Nikolina Sauvage, Data manager at Abstract Concepts<br />
<br />
Tobiah Selby, Developer at Tobiah Selby Development<br />
<br />
<br />
=== Echo Software [http://www.echo-64.com ->>>]=== <br />
<br />
Partnered with The Atlas Foundation. Echo is a service established to help people cope with the deaths of loved ones. Echo uses patented voice recognition software to accurately recreate the voice of any one particular person with a mere 5-minute audio sample.<br />
<br />
==== The Team ====<br />
<br />
Ivan Greshnev - CEO / Founder<br />
<br />
Mikhail Regison - CTO / Co-Founder<br />
<br />
Gerry Mishrason - CFO / Head of Marketing<br />
<br />
Caroline Anderson-Smith - Creative Director<br />
<br />
Patricia Gorevsky - Project Manager<br />
<br />
Jeremy Elways - IT Director<br />
<br />
Paris O'Keefe - Head of Sales<br />
<br />
Rickley G. Brown - Website Design<br />
<br />
''This company's website was taken over by Loop16 towards the end of Season 1. An archive can be found [https://web.archive.org/web/20170721205017/https://www.echo-64.com here >>>]''<br />
<br />
<br />
=== Multiverse Technologies [http://www.multiverse-75.com ->>>] ===<br />
<br />
Partnered with The Atlas Foundation, Multiverse Technologies conducts research in the fields of computationalism, particle acceleration, and electrodynamics.<br />
<br />
==== The Team ====<br />
<br />
Gunther Mann - CEO / Founder<br />
<br />
Minna Bell - Chief Researcher: Bio-radiation<br />
<br />
Annabelle Brassington - Chief Researcher: Computationalism<br />
<br />
Nickolaus Oberst - Chief Researcher: Magnetic Fields<br />
<br />
Justinian Ahlberg - Particle Collider Specialist<br />
<br />
Sabrina Dane - Nuclear Physicist<br />
<br />
==== Testimonials ====<br />
<br />
Alan Steinhardt, Steinhardt industries <br />
<br />
Vasili Pavlov, FTL Industries<br />
<br />
Mikhail Regison, Echo CTO / Co-founder<br />
<br />
''This company's website was taken over by Loop16 towards the end of Season 1. An archive can be found [https://web.archive.org/web/20170623085155/http://www.multiverse-75.com:80/ here >>>]''<br />
<br />
<br />
=== Superlumina [http://www.superlumina-6c.com ->>>] === <br />
Partnered with The Atlas Foundation. Creator of the world's first [https://en.wikipedia.org/wiki/Tachyonic_antitelephone antitelephone].<br />
<br />
==== Our Team ====<br />
<br />
Hanne Cruickshanks<br />
<br />
Esme Savidge<br />
<br />
Austen Spence<br />
<br />
''This company's website was taken over by Loop16 towards the end of Season 1. An archive can be found [https://web.archive.org/web/20170630225614/http://www.superlumina-6c.com/ here >>>]''<br />
<br />
<br />
=== ETARC [http://www.etarc.org/ ->>>] === <br />
<br />
Edison Township Amateur Radio Club (E.T.A.R.C) is a club for HAM radio enthusiasts in Edison Township, New Jersey.<br />
<br />
==== Characters ====<br />
<br />
[[Waking Titan/Characters/Emily Warren|Emily Warren]] - Ham radio enthusiast and moderator of the [https://forums.etarc.org/ ETARC forums] before it was revealed that ''"Emily"'' was Loop16's persona. It has since been re-branded to the official forums for the Citizen Science Division.<br />
<br />
Old Gods - A mysterious entity distributing Atlas Foundation emails. It has [https://forums.atlas-65.com/u/oldgods its own account] on the ETARC forums, and its profile picture and name are references to '''[https://en.wikipedia.org/wiki/Nyarlathotep Nyarlathotep]''' from the H.P Lovecraft Mythos.<br />
<br />
<br />
= Season 2 =<br />
<br />
Sort by companies and organizations introduced in Season 2 of Waking Titan.<br />
<br />
=== W/ARE - Dream Better [https://www.ware-tech.cloud/en ->>>] ===<br />
<br />
Based in Beijing, China, '''W/ARE''' creates special post-VR headsets that allow you to enter virtual worlds within your dreams.<br />
<br />
Emily praised W/ARE for their progress in ''realistic'' simulated environments. She claimed that W/ARE would have ''"tremendous implications for our future"'', and ''"must be protected at all costs"''.<br />
<br />
==== The Team ====<br />
<br />
Xiāo Cheung - The Creator, and Founder of W/ARE technology. He claims to have created this technology because of his childhood dream of being able to live in a virtual world.<br />
<br />
Huáng Zhìmíng - The CEO of W/ARE. Graduated alongside Xiāo at the University of Electronic Science and Technology of China with a Masters in Business.<br />
<br />
Zhou Lin & Tang Bo - Lead Developers<br />
<br />
Li Dan & Jiang Wei - Lead Game Designers<br />
<br />
==== Related Characters ====<br />
<br />
Arnaud Lacours - The man behind [http://www.philojeux.com/ Philo Jeux], a French indie games studio that was developing a game for W/ARE called ''The Tablets of Mnemosyne''. Production on the game was halted after Arnaud had gone into a comatose state.<br />
<br />
Dr. Geraldine Nadeau - A doctor researching lucid dreaming methods. Geraldine took interest in Arnaud's unusual brain activity during his unconscious state and took him into her care.<br />
<br />
Mr. Zheng - A W/ARE employee who violated the R&D sector's disclosure policy of reporting all knowledge obtained from R&D tours immediately. Zheng diverged from his planned tour path to inquire on a discovery, which prompted W/ARE to launch a public investigation into his whereabouts.<br />
<br />
==== Research Labs ====<br />
<br />
* Boston Research Lab / Director: Richard Wilkes<br />
<br />
* Sacramento Research Lab / Director: Helga Johnson - The lab that housed the remaining 12 dreamers before they were relocated by Myriad's field team.<br />
<br />
* Seoul Research Lab / Director: Yu Hyo<br />
<br />
* Beijing Research Lab / Director: Wang Jie<br />
<br />
* Prague Research Lab / Director: Adriana Dvorak<br />
<br />
* Berlin Research Lab / Director: Georg Muller<br />
<br />
There were another 10 W/ARE Labs discovered by Myriad's research team that no details have been made available about.<br />
<br />
==== Mercury XXXX ====<br />
A game title listed on an update to W/ARE's [https://twitter.com/warecloud/status/979103811489984513 staging server]. The [https://wiki.gamedetectives.net/index.php?title=Waking_Titan/Phase_4#Mercury_Project fluency] between the puzzles involving this post and the Waking Titan terminal's Mercury updates made it apparent that the ''Mercury Process'' had something to do with this. The exact terms of the connection were never fully explained, but a direct connection to No Man's Sky is suggested by the use of version <code>1.5</code> of the application and ware's software.<br />
<br />
The announcement of No Man's Sky NEXT and the ''"port"'' to the W/ARE platform followed shortly after.<br />
<br />
== Satcom [http://www.satcom-70.com ->>>] ==<br />
<br />
Satcom is Myriad's Satellite Communications API. Here, you can interface with a W/ARE-assigned Myriad satellite. Myriad Code: CJ-16-02, this satellite is storing the consciousness data of W/ARE Sacramento test subjects, also known as dreamers.<br />
<br />
=== The Sacramento Dreamers ===<br />
<br />
Twelve W/ARE test subjects trapped in a state of ''"artificial dreaming"'' following experiments involving special exosuits and post-VR headsets at the Sacramento Research Lab.<br />
<br />
Emily was met with a disruption in her plan to preserve W/ARE's technology for the ''ideal'' future when she was unable to extract these dreamer's consciousnesses from the satellite due to memory fragmentation and data corruption. She would need to reach out to the CSD for assistance. We would be advised to guide her interactions with these dreamers with the intent of triggering a distinct emotion, or memory that could help reconstruct their memories fragments and secure a safe-as-possible extraction process.<br />
<br />
These '''12 dreamers''' are listed below with their official ''(" ")'' and unofficial summaries:<br />
<br />
<br />
* '''Dreamer 1 - Alexander''' [https://imgur.com/a/R35DAUA ->>]<br />
<br />
"Alexander is an 86-year-old French Canadian man, working as a farmer for his in-laws. He has two brothers and a sister, Napoleon, Jolene, and Jacques. Their family had two cows named Mabel and Eugenice, and Lionel, a bull. Lionel was their pride and main attraction at the fairs they attended, and where Alexander met his wife Emilienne. He has a condition were he can't recognize faces. Alexander thought he was going to California for a sleep study, but it ended up being a bit more than that."<br />
<br />
''(This dreamer was successfully extracted from the satellite on extraction day; July 20th, 2018.)''<br />
<br />
<br />
* '''Dreamer 2 - #231187661T''' [https://imgur.com/a/M6ScezM ->>]<br />
<br />
<code>"<CORRUPTED>"</code><br />
<br />
The anomalous second dreamer. Not much information was made available about them. However, it was noteworthy that their "name" could be found as a defective iteration ID in a [https://discourse-cdn-sjc1.com/business5/uploads/etarc/optimized/2X/c/cf6c1e736a12b0f7a979a3fd8f304c10d3503430_1_666x500.jpg distress beacon log] at the beginning of No Man's Sky. ''(This dreamer bears corrupted memory fragments.)''<br />
<br />
<nowiki>#231187661T</nowiki> was the only corrupted dreamer who didn't die amidst the mass disconnection event. However, without an extraction attempt their consciousness would remain trapped within the ever-drifting satellite.<br />
<br />
<br />
* '''Dreamer 3 - Claire''' [https://imgur.com/a/TGlGUmU ->>]<br />
<br />
"Claire, a 15-year-old student. Volunteered for W/ARE's experiment to bring in extra money to help her mother, because her father left them 3 years ago. She spends her time with either her 4-year-old dog, Pepper, or by reading comic books alone in her room. Her goal for when she gets out of the satellite is to rebuild her friendship with her best friend from the real world, Emily."<br />
<br />
''(This dreamer was successfully extracted from the satellite on extraction day; July 20th, 2018.)''<br />
<br />
<br />
* '''Dreamer 4 - Toby''' [https://imgur.com/a/lvRUR6w ->>]<br />
<br />
"Toby is a 5-year-old boy, who lives a peaceful life with his parents Mark and Ashley, and their 12-year-old cat Bugsy. At a young age, Toby had a run-in with a dog that caused him to fear them ever since. He lives with a rare condition which causes memory loss, and his parents entered him into the W/ARE experiment in the hope it would help with his condition. Unfortunately, they were wrong. In real life, his favorite plushie is by his side. In the satellite, Toby has only his hopes to return to his parents."<br />
<br />
''(This dreamer was successfully extracted from the satellite on extraction day; July 20th, 2018. However, not without a complication resulting in Loop16's untimely "death" when she shut down the Monarch Repository to allocate the resources necessary for Toby to escape...)''<br />
<br />
<br />
* '''Dreamer 5 - Eun Ha''' [https://imgur.com/a/ZlF9BV7 ->>]<br />
<br />
"Eun Ha is a young Korean woman whose childhood was pretty turbulent. Living with an abusive father, the death of her mother shook her enough to make her want to relocate to the United States of America. She wanted a new life for her and her brother, although he still holds a grudge against her for leaving him and her father behind. She volunteered for W/ARE's experiment for extra money, but surely she couldn't have predicted this outcome."<br />
<br />
''(This dreamer was successfully extracted from the satellite on extraction day; July 20th, 2018.)''<br />
<br />
<br />
* '''Dreamer 6 - Phillip''' [https://imgur.com/a/qPmD5ts ->>]<br />
<br />
"Phillip Moretti, a 38-year-old mechanic at his family business and ex-restaurateur, lives in New York City with his wife, Martha, and his two sons, Sam and Zack. Phillip volunteered for W/ARE's experiment to regain the money he lost after his bankruptcy. His wife asked him to do it without knowing the effect it would have."<br />
<br />
''(This dreamer beared corrupted memory fragments. They died during the mass disconnection event that followed an error in the system on extraction day.)''<br />
<br />
<br />
* '''Dreamer 7 - Tariq''' [https://imgur.com/a/qPmD5ts ->>]<br />
<br />
"Known to most as a simple W/ARE Technician, Tariq Hamawi comes from a rich family living in Tel Aviv, and Abu Dhabi. He came to California to study Neurodevelopmental and neurodegenerative disorders. Money is not a problem for him, so why did he end up in the W/ARE experiment? We still don't know, but rumor has it that he was forced into it." ''(This dreamer beared corrupted memory fragments.)''<br />
<br />
Tariq died on July 6th, 2018 following the [https://pastebin.com/4FhN2b6w conclusion] of the [https://www.reddit.com/r/NoMansSkyTheGame/comments/8w68t4/myriad_security_diagnostic_testing_important/?utm_content=title&utm_medium=user&utm_source=reddit Myriad security diagnostic]. Which ended in all servers running W/ARE processes communicating with the satellite being shut down.<br />
<br />
<br />
* '''Dreamer 8 - Mike''' [https://imgur.com/a/3ZoCEKx ->>]<br />
<br />
"Mike Pasquale, an ex-soldier from the United States Army, used to live in Burlington, Vermont. He enjoyed sailing his boat, Tranquility III, on Lake Champlain with his now ex-wife, Rachel. Feeling unfit for civilian life, he decided to volunteer for W/ARE's experiment to try something new in and maybe feel a little more alive. Little did he know he would become trapped in a satellite... but is it for the better?"<br />
<br />
''(This dreamer beared corrupted memory fragments. They died during the mass disconnection event that followed an error in the system on extraction day.)''<br />
<br />
<br />
* '''Dreamer 9 - Isabella''' [https://imgur.com/a/1Ri0jzN ->>]<br />
<br />
"Isabella Schiavone is a 25-year-old girl born in Italy, who moved as an infant to California. She now lives in Venice Beach with her girlfriend Stephanie, and their 2-year-old puppy Pepito. Isabella volunteered for W/ARE's experiment to get some extra money to buy her girlfriend a trip to Thailand for their 4th Anniversary... or a road trip across the United States of America."<br />
<br />
''(This dreamer beared corrupted memory fragments. They died during the mass disconnection event that followed an error in the system on extraction day.)''<br />
<br />
<br />
* '''Dreamer 10 - Alisha''' [https://imgur.com/a/roJdM1g ->>]<br />
<br />
"Alisha Brown would've been the grandmother of the year, if it weren't for the fact that her children don't come to see her that often. This 72-year-old woman used to work as a nurse at the general hospital in Tucson, Arizona. To keep her loneliness at bay, Alisha keeps multiple cats and enjoys watching crime shows on television. She volunteered for W/ARE's experiment so she could tell her children that she was going under observation in a private clinic, in hope that they would come and see her more often."<br />
<br />
''(This dreamer beared corrupted memory fragments. They died during the mass disconnection event that followed an error in the system on extraction day.)''<br />
<br />
<br />
* '''Dreamer 11 - Nina''' [https://imgur.com/a/kbLkuyq ->>]<br />
<br />
"22-year-old Nina Flores from Santa Monica was a high school friend of Simon Quinn, a fellow dreamer. She lived a normal life with her parents, Thomas and Jennifer, and her 6-year-old dog, Jackson. She enjoys sitting on a bench during the fall or spring time to read fantasy books from one of her favorite authors, Tamora Pierce. Nina volunteered for W/ARE's experiment after she heard Simon talk about it in one of his streams."<br />
<br />
''(This dreamer beared corrupted memory fragments. They died during the mass disconnection event that followed an error in the system on extraction day.)''<br />
<br />
<br />
* '''Dreamer 12 - Simon''' [https://imgur.com/a/x8etngG ->>]<br />
<br />
"Simon is a 23-year-old known as Simonthegreatone, a streamer gaining rank as the days go by. He never knew his father, who left his family behind while Simon was still an infant, leaving his mother all alone with two boys. His grandmother took care of him when it became clear his mother couldn't care less about her kids. Growing up, Simon created his own family with his friends Alex, Nina, and Ranjit. They created a group called The Guild of Adventurers. Unfortunately, with time, they all lost touch. Simon volunteered for W/ARE's experiment to gain more fame and to be the first one to test the port of his favorite game. At least, that's what he thought."<br />
<br />
''(This dreamer was successfully extracted from the satellite on extraction day; July 20th, 2018.)''<br />
<br />
=== The Dreamer Exosuits ===<br />
<br />
Physically present, experimental exosuits wore by the dreamers at W/ARE's Research Labs, seemingly with the intent of providing the conscious experience of deep [https://en.wikipedia.org/wiki/Rapid_eye_movement_sleep REM] dreams without the need to actually sleep. These suits were manufactured and shipped to W/ARE by an undisclosed company.<br />
<br />
''The exosuits were also found to exist in a virtual sense too: They were added in the NEXT update for No Man's Sky, replacing the old suits wore by the player character.''<br />
<br />
Insightful tidbits regarding these exosuits can be found in the Medical Extract section of the dreamer patient files. They can be found compiled [https://wiki.gamedetectives.net/index.php?title=Waking_Titan#Internal_Memos here] or can be accessed directly from the Satcom Dashboard.<br />
<br />
<br />
= FAQ =<br />
<br />
==== What is the connection between Waking Titan and No Man's Sky? ====<br />
<br />
In the ARG, the No Man's Sky universe comes into existence as a result of Loop16's dreams. [https://s3.amazonaws.com/cdn.wakingtitan.com/mercury/mercury-01-98748sfdlka87.pdf The Mercury Process] or "''Mercury''," is the code-name No Man's Sky often goes by in the ARG. In Season 2 however, No Man's Sky was referred to in an increasingly meta way as an actual video game, even referenced by some of the dreamers.<br />
<br />
==== What are the relations between events in-game and Waking Titan? ====<br />
<br />
The effects of events taking place during Waking Titan can be felt in "shockwaves" via No Man's Sky's updates. However, in-game lore can act more-or-less independently from the ARG. Though connections and references to the ARG can be found in the game itself, they are rather limited. This has led to numerous theories regarding the connection between both stories, although nothing is conclusive.<br />
<br />
==== What is W/ARE's relationship with Myriad and The Atlas Foundation? ====<br />
<br />
W/ARE is one of Myriad's clients with involvement in the Atlas Foundation's Mercury Process. Attention was diverted to W/ARE when they suspiciously began uploading corrupted data to the Myriad cloud, later learned to be consciousness data of their trapped user-base. The Atlas Foundation swore to allocate the necessary storage and processing power of Myriad to W/ARE to keep their processes intact, and keep their trapped users alive until a solution was found. This re-allocation had an impact some the Atlas Foundation's experiments utilizing Myriad's cloud. Most significantly Loop16 aka Emily, whose predictive capabilities and communication software stored in Myriad's cloud were heavily degraded as a result of the corruption and power deprivation.<br />
<br />
==== What happened to the other dreamers? ====<br />
<br />
There was mention of other test subjects from the Beijing facility who died during attempts at disconnection or due to immoral practices; despite W/ARE's attempts at covering their tracks.<br />
<br />
There was also mention of people like Arnaud, who went into a coma following a malfunction of the experimental W/ARE headset shipped with W/ARE developer kits. While these individuals can't necessarily be considered dreamers, from [https://wiki.gamedetectives.net/images/8/8a/Subject1.png Satcom teaser images] we may infer the name "sleepers," due to the right-side text, and their use of these experimental headsets without wearing an exosuit as evident by the image portraying a human body in contrast to the dreamers we know now. We may also infer from [https://s3.amazonaws.com/ware-virtual-dashboard/files/Phillip-PatientFile.pdf this document] that these individuals comprised the "control group" during exosuit experimentation due to no further clarification. Emily claimed to have been able to interface with, and successfully disconnect some of these victims prior to the CSD's involvement in the dreamer extraction process.<br />
<br />
==== What is 1.5? ====<br />
<br />
<code>1.5</code> was build version 1.5 of the Mercury process; or otherwise, No Man's Sky.<br />
<br />
==== What are the Atlas Pass v4s? ====<br />
<br />
Physical card stock Atlas Passes that were shipped to 10,000 CSD members who entered for a chance to receive one in a survey from Season 1.<br />
<br />
The bulk of passes were delivered shortly before Season 2, but weren't made use of. However, towards the end of Season 2 people were invited to apply for a chance to receive one of the 16 special limited edition Atlas Passes which they stressed will bear heavy responsibility. This implies they will be needed in a future collaboration.<br />
<br />
<br />
= Adverts =<br />
<br />
Advertisements have been used during Waking Titan as a means of presenting new companies and organizations to players. A list of links of where to find such ads can be found below:<br />
<br />
[https://clyp.it/jdr53oop Echo Radio Advertisement]; - [https://clyp.it/xbv04wbz Multiverse Radio Advertisement]; - [https://clyp.it/r4r3xriw Superlumina Radio Transmission]; - [https://clyp.it/ivvt15mt Myriad Radio Advertisement]; - [https://twitter.com/warecloud/status/977348396213190657 W/ARE Video Advertisement]</div>Kkzzzkthttps://wiki.gamedetectives.net/index.php?title=Waking_Titan&diff=17874Waking Titan2018-10-17T17:38:38Z<p>Kkzzzkt: added phase 4 summary; fixed a few cases of outdated phrasing</p>
<hr />
<div>{{argbox<br />
| float = right<br />
| image = File:Project WT logo.png<br />
| imagewidth = 400<br />
| name = [[Waking Titan]]<br />
| description= Waking Titan was an ARG which led towards the [https://www.nomanssky.com/atlas-rises-update/ Atlas Rises] and [https://www.nomanssky.com/next-update/ NEXT] updates for No Man's Sky.<br />
| creator = [http://www.aliceandsmith.com/ Alice & Smith]<br />
| creator2 = [http://www.hellogames.org/ Hello Games]<br />
| type = Official<br />
| status = Completed<br />
| discovered = 2017-05-28<br />
| completed = 2018-07-20<br />
}}<br />
{{ArgHeader}}<br />
{{BackToTop}}<br />
<br />
=== Description ===<br />
Waking Titan (also known as Project WT) is an official ARG (alternate reality game) for No Man's Sky that involves a multitude of websites, phone numbers, and radio stations scattered across the world. The ARG is produced by veteran puppet masters [http://www.aliceandsmith.com/ Alice & Smith], and features NPCs, actors, and live events.<br />
<br />
Relating to the origin of No Man's Sky, the ARG's story follows a powerful A.I known as Loop16, which is created by a company called [https://wiki.gamedetectives.net/index.php?title=Waking_Titan/Characters The Atlas Foundation] with the intent of simulating a one-to-one recreation of reality that can accurately predict the future.<br />
<br />
=== Contents ===<br />
The ARG encompassed several "seasons," each leading to a new update for No Man's Sky. Season 1 of Waking Titan led to the release of the [https://www.nomanssky.com/atlas-rises-update/ Atlas Rises update], and Season 2 to the release of [https://www.nomanssky.com/next-update/ No Man's Sky: NEXT]. Season 1 was further divided into several distinct "'''phases'''", and Season 2 has followed this convention for ease of reading. Each phase is documented on its own wiki page:<br />
<br />
{| class="wikitable"<br />
!colspan="2"|Season 1<br />
|-<br />
|[[Waking_Titan/Phase_1 | Phase 1]] <br />
|Phase 1 of Waking Titan lasted from 2017-05-28 to 2017-07-08.<br />
|-<br />
|[[Waking_Titan/Phase_2 | Phase 2]] <br />
|Phase 2 of Waking Titan lasted from 2017-07-21 to 2017-08-05.<br />
|-<br />
|[[Waking_Titan/Phase_3 | Phase 3]]<br />
|Phase 3 of Waking Titan lasted from 2017-08-05 to 2017-08-07.<br />
|-<br />
!colspan="2"|Season 2<br />
|-<br />
|[[Waking_Titan/Phase_4 | Phase 4]]<br />
|Phase 4 of Waking Titan lasted from 2017-12-28 to 2018-06-01.<br />
|-<br />
|[[Waking_Titan/Phase_5 | Phase 5]]<br />
|Phase 5 of Waking Titan lasted from 2018-06-01 to 2018-07-20.<br />
|-<br />
|[[Waking_Titan/Phase_6 | Phase 6]]<br />
|Phase 6 of Waking Titan was on 2018-07-20.<br />
|}<br />
<br />
'''''Note:''' This is a '''summary''' page. For more in-depth descriptions of each phase, including detailed descriptions of puzzle solutions, check the [[Waking_Titan/Phase_1|Phase 1]], [[Waking_Titan/Phase_2|Phase 2]], [[Waking_Titan/Phase_3 | Phase 3]], [[Waking_Titan/Phase_4 | Phase 4]], [[Waking_Titan/Phase_5 | Phase 5]], and [[Waking_Titan/Phase_6 | Phase 6]] pages.''<br />
__TOC__<br />
<br />
== Story Overview ==<br />
<br />
=== Internal Memos ===<br />
<br />
[[File:WT glyph 1 pdf.png|280px|thumbnail|right|One of the internal memos discovered in Waking Titan]]<br />
<br />
Throughout the ARG, in-game characters have communicated with each other via "internal memos". Over time, these memos were discovered by ARG players, in the form of PDF files. These memos provided lore content and puzzle content, and are '''highly recommended''' reading for new players!<br />
<br />
'''Season 1'''<br />
<br />
* [http://wiki.gamedetectives.net/index.php?title=File:WT_glyph_1_pdf.png Teamwork Assessment]<br />
* [http://wiki.gamedetectives.net/index.php?title=File:WT-Dataset-97C.jpg Dataset 97C]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/data/7d3dd080-2a43-4882-833c-f4d7bd7ba607.pdf Assurance]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/data/c01-331c6734-a013-4695-8e47-08a9ee05d5e5.pdf 017-a24]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/data/c02-9936c797-ec28-4f8f-b80e-dee9e0b06433.pdf 021-f16]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/mercury/mercury-01-98748sfdlka87.pdf Mercury Process Self-Diagnosis Report]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/data/57201e0d-01a3-4f6a-bbb4-2be8b7c8880f.pdf Progress Report]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/6c285180-ec4d-48a2-967f-8a7af3b50008.pdf Subject M-N00-dl35]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/410a3e5d-01e7-4058-a23c-ca5fdde97f9d.pdf Atlas Foundation Threat Models]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/7a6594ac-ca5e-467a-b6f4-9fb91f069d0a.pdf Advanced Calibration - Optional]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/a9d988c1-ec92-46da-a64e-ab90390ae041.pdf Phase 2 Complete]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/a224a1f4-00e5-467b-9893-83fcc1a4f19a.pdf Unlocking Mercury Process File L16.jpg]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/b91f9959-6a3c-4011-b3b5-a1ff757a5e4c.pdf Phase 3]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/b0f33d53-5a8c-4a9a-b5fc-395562e463a8a+.pdf Log.1291]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/a09-179bf8d2-c13e-4c66-982e-b37ab3efd5bb.pdf Breach of Contract]<br />
<br />
'''Season 2'''<br />
<br />
* [https://wiki.gamedetectives.net/images/6/6e/Memo2.png Waking Titan S2 - Under Preparation]<br />
* [https://s3.amazonaws.com/ware-extranet/documents/FIRST_STEPS/Notes_on_Moscow.jpg Mr. Zheng's Notes on Moscow Conference]<br />
<br />
* '''Zheng's Postcards''' — [https://s3.amazonaws.com/ware-extranet/documents/SECURITY/postcard1_jhlj039u.jpg (1)]; [https://s3.amazonaws.com/ware-extranet/documents/SECURITY/postcard2_kg8nao6.jpg (2)]; [https://s3.amazonaws.com/ware-extranet/documents/SECURITY/postcard3_tesaud636.jpg (3)]<br />
<br />
* '''Mr. Zheng's Journal Logs''' — [https://s3.amazonaws.com/ware-extranet/documents/FIRST_STEPS/Journal_Academy.png Academy]; [https://s3.amazonaws.com/ware-extranet/documents/DESIGN/Journal_HotelDieu.png Hotel Dieu]; [https://s3.amazonaws.com/ware-extranet/documents/DEVELOPMENT/Journal_Louvre.png Louvre]; [https://s3.amazonaws.com/ware-extranet/documents/RESEARCH/Journal_London.png London]; [https://s3.amazonaws.com/ware-extranet/documents/SECURITY/Nightmare.jpg Nightmare]<br />
<br />
* [https://pastebin.com/EHA6ZU8x Arnaud Lacours Foundation Email]<br />
<br />
* [https://drive.google.com/open?id=1la3UNKHc5yeaB_w2a2tK1cjKN44oEmCo Arnaud Lacours Datadumps - INYOURMIND.exe failed]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/94c02878-e023-46a3-9316-db4177c4eaa6+.pdf WARE REPORT #26]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/1cd5226d-6639-4bbd-855a-4bf8f60866c3.pdf Concerns Regarding Captain Harry]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/70a25e6c-95ed-42d4-8de8-c3948255174c+.pdf Myriad Crisis Event Timeline]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/19997bb6-18e5-4427-86c7-b0f3c1826ca2.pdf State of The Atlas Foundation]<br />
* [https://pastebin.com/NYLiFuNY Log.3022]<br />
<br />
* '''W/ARE - Dreamer Patient Files''' — [https://s3.amazonaws.com/ware-virtual-dashboard/files/Phillip-PatientFile.pdf Phillip Moretti]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/EunHa-PatientFile.pdf Kwon Eun Ha]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/498hd98h3444-3339e/Alexander-PatientFile.pdf Alexander Bordeleau]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/GCMnQmM9E3v7L8wuv-V2FUY7P/Claire-PatientFile.pdf Claire Sandfield]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/kh2jsaljs901m-asd1n1lwks/Tariq-PatientFile.pdf Tariq]; [https://ware-virtual-dashboard.s3.amazonaws.com/files/GCMnQmM9E3v7L8wuv-V2FUY7P/Toby-PatientFile.pdf Toby Mulligan]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/ga3ms81-2ms92fbl/Mike-PatientFile.pdf Mike Pasquale]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/kajs61ns-82baks8nx/Nina-PatientFile.pdf Nina Flores]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/ga3ms81-2ms92fbl/Simon-PatientFile.pdf Simon Quinn]; [https://ware-virtual-dashboard.s3.amazonaws.com/files/kajs61ns-82baks8nx/Isabella-PatientFile.pdf Isabella Schiavone]; [https://ware-virtual-dashboard.s3.amazonaws.com/files/kajs61ns-82baks8nx/Alisha-PatientFile.pdf Alisha Brown]<br />
<br />
* [https://pastebin.com/eSLLWN8L Log.4391]<br />
<br />
=== Subpages ===<br />
<br />
Navigating through the following subpages is recommended for newcomers wanting to get a grasp of Waking Titan's rapidly expanding story.<br />
<br />
{| class="wikitable"<br />
!colspan="2"|[[:Category:Waking Titan| Story Subpages]]<br />
|-<br />
|[[Waking_Titan/Characters| Summary of Companies and Entities]]<br />
|Includes a summary of each character, company, and relating experiments and their importance in the Waking Titan story.<br />
|-<br />
|[[Waking_Titan/Console_Commands | Console Commands]]<br />
|A list of commands used by players at the [http://wakingtitan.com Waking Titan console]<br />
|-<br />
|[[Waking_Titan/Companies | Company Archives]]<br />
|An archive of official company details.<br />
|}<br />
<br />
=== Newsletters===<br />
<br />
The numerous newsletters received throughout Waking Titan.<br />
<br />
'''Season 1'''<br />
<br />
* [https://us15.campaign-archive.com/?u=4483c19308fc0764a930106a0&id=c713d0f4ce&e=225c6a2e26 Welcome, Citizen Scientist!] - ''CSD''<br />
<br />
* [https://mailchi.mp/3582bec6b801/update-june-8th-waking-titan-137705?e=225c6a2e26 Citizen Scientists, Your Wait is Over.] - ''CSD''<br />
<br />
* [https://mailchi.mp/3582bec6b801/update-june-8th-waking-titan-137705?e=225c6a2e26 Calibrating Waking Titan: Action Required] - ''CSD''<br />
<br />
* [https://mailchi.mp/0b591b68ac72/update-june-8th-waking-titan-137717?e=225c6a2e26 Waking Titan: Mission Azure Voyage] - ''CSD''<br />
<br />
* [https://mailchi.mp/d8e47d2ee1bf/update-june-8th-waking-titan-137725?e=225c6a2e26 Your Level 4 Atlas Pass] - ''CSD''<br />
<br />
* [https://mailchi.mp/0c1dc672c943/update-june-8th-waking-titan-137733?e=225c6a2e26 Waking Titan Has Ended] - ''CSD''<br />
<br />
* [https://mailchi.mp/63f179c006f0/update-june-8th-waking-titan-137737?e=225c6a2e26 Mercury Process Completion Report] - ''CSD // Mercury''<br />
<br />
'''Season 2'''<br />
<br />
* [https://wiki.gamedetectives.net/images/7/7b/WareNewsletter1.png News from WARE!] - ''W/ARE Newsletter''<br />
<br />
* [https://cdn.artemisbot.uk/mail/WARE-2018-04-22T00:17:13.000Z.jpg W/ARE Dev Kit Update #2] - ''W/ARE Newsletter''<br />
<br />
* [https://cdn.artemisbot.uk/mail/WARE-2018-05-04T23:22:45.000Z.jpg W/ARE Dev Contest] - ''W/ARE Newsletter''<br />
<br />
* [https://cdn.artemisbot.uk/mail/WARE-2018-05-12T00:20:04.000Z.jpg W/ARE Dev Contest Winners] - ''W/ARE Newsletter''<br />
<br />
* [https://mailchi.mp/9aaa8aa62cc1/update-june-8th-waking-titan-137741?e=225c6a2e26 Attention Citizen Scientists] - ''CSD''<br />
<br />
* [https://mailchi.mp/c3384d592000/update-june-8th-waking-titan-137745?e=225c6a2e26 Attention Citizen Scientists - Suspicious Lab Tracking] - ''CSD''<br />
<br />
* [https://mailchi.mp/108412dac3c2/update-june-8th-waking-titan-137749?e=225c6a2e26 Attention Citizen Scientists - Global Mobilization Required] - ''CSD''<br />
<br />
* [https://mailchi.mp/b902d5eadba6/update-june-8th-waking-titan-137753?e=225c6a2e26 Mercury Process Inquiry] - ''CSD // Mercury''<br />
<br />
* [https://mailchi.mp/9a49b85f6bf3/update-june-8th-waking-titan-137757?e=225c6a2e26 Attention Citizen Scientists - Help Required] - ''CSD''<br />
<br />
=== Music ===<br />
<br />
Partial video addresses for Youtube can be found scattered across Waking Titan PDFs, website files, and surveys; which all lead to music. The exact reasoning for this has gone unexplained. However, there are apparent thematic relevancies in each song that appear to reflect on the state of the story. All songs linked to in Waking Titan so far can be found compiled here: [https://www.youtube.com/playlist?list=PLEZy8wyuYLpLw0e5kkMyBUHO_s-V8f0Qk WT Season 1]; [https://www.youtube.com/playlist?list=PLEZy8wyuYLpLr5K38bsAqWcO7bTcXfRlW WT Season 2]<br />
<br />
== Event Summaries ==<br />
<br />
=== Introduction ===<br />
<br />
On 2017-05-27, Twitter user @argn [https://twitter.com/argn/status/868587449613766658 tweeted a link] to [http://www.project-wt.com/ 'project-wt.com']. The link led to a website which contained a map showing sixty locations, four of which were "active" at the time. The locations, when clicked on, revealed the location's name and status. The active locations also revealed a link to a livestream of a local radio station, originating from the corresponding location. The project-wt website displayed a date, June 8th, and stated that the first clue was being "initialized".<br />
<br />
On 2017-06-01, moderators of No Man's Sky subreddits [https://reddit.com/r/nomansskythegame /r/NoMansSkyTheGame], [https://www.reddit.com/r/NMSPortals/ /r/NMSPortals], and [https://www.reddit.com/r/NMSGalacticHub/ /r/NMSGalacticHub] started to receive cassette tapes in the mail. Each cassette tape was labelled with a number out of 16. The Waking Titan ARG was initially thought to be a separate ARG from these tapes, but connections between the two made it clear that they were, in fact, one and the same.<br />
<br />
=== Phase 1 ===<br />
<br />
[[File:Wakingtitan site.png|thumbnail|450px|right|The default appearance of the Waking Titan site during Phase 1, with no sigils or glyphs solved]]<br />
<br />
During [[Waking_Titan/Phase_1 | Phase 1]], the http://wakingtitan.com hosted 6 triangles in the middle of the page. These triangles were referred to as "'''Sigils'''", while the white icons along the bottom of the page were referred to as "'''Glyphs'''". Each sigil and glyph, when clicked, lead to a password entry prompt - the correct passwords for all 6 sigils and the first 5 glyphs were discovered via puzzle-solving during Phase 1 of Waking Titan.<br />
<br />
The sigil and glyph puzzles were solved collaboratively - while it may have be possible to solve some of these puzzles individually, most of them required a collaborative effort. For instance, some puzzles required players to meet agents from the Atlas Corporation in person, and to relay information obtained from these meetings back to the community. A list of all sigil and glyph solutions for Phase 1 can be found below:<br />
<br />
[[File:WT Phase 1 complete.png|600px]]<br />
<br />
This phase culminated on July 8, 2017, with a [[Waking_Titan/Phase_1#End_of_Phase_1| congratulatory message from Elizabeth Leighton]], the CEO of the Atlas Foundation.<br />
<br />
=== Phase 2 ===<br />
<br />
[[File:Hampster maze.jpeg|thumbnail|450px|right|One of the puzzles that appeared on the Waking Titan [http://twitch.tv/wakingtitan Twitch Stream]]]<br />
<br />
During [[Waking_Titan/Phase_2 | Phase 2]], the http://wakingtitan.com site hosted a command-line interface terminal. Various commands were accepted as input, which triggered different events. One of the most notable commands was the <code>WHOIS <argument></code> command, which revealed a passage of text pertaining to the specified argument. For instance, the command <code>WHOIS FOURTH RACE</code> returned the following message:<br />
<pre><br />
INCOMING TRANSMISSION… SOURCE: UNKNOWN…<br />
You are not – kzzktt – alone –<br />
Please, identify yourself. I’m – kzzkttk –<br />
</pre><br />
<br />
Additionally, http://project-wt.com hosted a "Calibration" utility during Phase 2. To successfully perform these calibrations, players had to upload images of various objects and buildings to the site. For instance, the first calibration required images of "public resonant percussion instruments".<br />
<br />
Finally, towards the end of Phase 2, the Waking Titan [http://twitch.tv/wakingtitan Twitch stream] went live, displaying a five-monitor setup. Throughout the duration of the stream, players had to work together to solve puzzles that were displayed on these monitors. Some of these puzzles were interactive; for example, one puzzle that was repeated several times involved the Twitch chat guiding a virtual hamster through a maze.<br />
<br />
Additionally, players solved another 3 glyphs throughout Phase 2. The solutions to these glyphs are shown below:<br />
<br />
[[File:WT Phase2 Passwords.png|600px]]<br />
<br />
=== Phase 3 ===<br />
<br />
{{#evt:<br />
service=youtube<br />
|id=https://www.youtube.com/watch?v=QhX9z4dDAa4<br />
|alignment=right<br />
}}<br />
<br />
[[Waking_Titan/Phase_3|Phase 3]] was the briefest phase of Waking Titan. It consisted of the conclusion of the [http://twitch.tv/wakingtitan Twitch stream] that began at the [[Waking Titan/Phase 2#End of Phase 2|end of Phase 2]]. Players solved more interactive puzzles on the Twitch stream, before the rogue AI Loop16 asked them a final question: <code>SHOULD I EXIST?</code> The overwhelming response from the community was "yes".<br />
<br />
After receiving this response, Loop16 and Emily of the ETARC forums were revealed as being one and the same. Loop16 generated a heartfelt "Thank You" video to round out the stream, before finally taking the 72-hour stream offline.<br />
<br />
Shortly after this, players received emails with the subject line <code>Waking Titan has Ended</code>. The contents of the message were as follows:<br />
<br />
<pre><br />
Hello, Citizen Scientist,<br />
<br />
Thank you for your contributions to Waking Titan. The developments that took place during Phase 3 were somewhat concerning, but together we have set in motion truly world-shaping events. We will continue to inform the Citizen Science Division of privileged information or any need for collaborators on a new project.<br />
<br />
But we do have a few loose ends to tie up with you before we move on, so let's proceed.<br />
<br />
First, we're pleased to announce that all 10,000 Level 4 Atlas Passes are in production. Note that due to transit times for mail, some may take several weeks to be delivered.<br />
<br />
Next, our CEO Elizabeth Leighton has asked us to include a personal note of gratitude:<br />
<br />
"Thank you for all your diligent efforts, Citizen Scientists. It's been an amazing journey for all of us. I've watched you thrive and achieve from those first Phase 1 radio ads all the way through the intensity of Phase 3. I've been impressed at every turn by how brilliant you've been, how voracious, how kind, how thoughtful.<br />
<br />
It's been an honor and a privilege. On behalf of the Atlas Foundation, and on behalf of the world, thank you."<br />
The Mercury subroutine has concluded successfully, and a new memo from SM about this process is coming in the next 24 hours. We hope it will answer a few key questions you have about our program, and about what comes next.<br />
</pre><br />
<br />
On August 11, 2017, the [https://www.nomanssky.com/atlas-rises-update/ Atlas Rises update] was released for No Man's Sky.<br />
<br />
<br />
=== Season 2 Prelude ===<br />
[[File:bookwt.png|thumb|left|NYC Livedrop.]]<br />
Before Phase 4 began, there was a brief prelude.<br />
<br />
The tenth glyph went live on Wakingtitan.com, and WT-related websites began updating with strange messages relating to mirrors and the number <code>1.5</code>. Players also began receiving their Atlas Pass v4s in the mail. <br />
<br />
The CSD were led to a livedrop at Café Bene, where code to unlock the tenth glyph was discovered (<code>REMS</code> // <code>REM SLEEP</code>) written on the [https://wiki.gamedetectives.net/images/1/1f/Memo3.png back] of the [https://wiki.gamedetectives.net/images/6/6e/Memo2.png Atlas Foundation memo] handed out to participating members of the CSD.<br />
<br />
<br />
<br />
<br />
=== Phase 4 ===<br />
<br />
Phase 4 of Waking Titan began on March 26th, 2018, as the beginning of a new "season" of the ARG which would go on to span another 3 phases.<br />
<br />
During [[Waking_Titan/Phase_4 | Phase 4]], the CSD investigated an innovative Chinese gaming hardware company with relations to Myriad called <code>W/ARE</code>. Through their [https://ware-tech.cloud/ website], players discovered that W/ARE invented a next generation virtual reality device that essentially allows you to '''play video games in your sleep'''.<br />
<br />
<pre>EASY AND SAFE DREAM INDUCTION<br />
Stimulating the Frontal and Temporal lobe of the brain using low-frequency signals: Our headset drops you into your own personal virtual space by using the brain’s natural processing power to generate cutting-edge 3d graphics in real time. This process puts you into a deep sleep while keeping you conscious of your actions, allowing you to act freely within the Dreamscape.</pre><br />
<pre>MORE REAL THAN REAL<br />
Using the practical computational processing power of the human brain: Play in the most realistic virtual worlds possible! Our algorithms convert once-complex graphical processing microcode into mind-readable processes, unlocking your brain’s creative potential. Whether you are playing alone in an exciting single-player experience, or enjoying a real Massively-Multiplayer Online Game with friends: Every texture, sound, smell, and taste will be true to life. The W/ARE system is a mirror into the soul of humanity.</pre><br />
<br />
As Phase 4 progressed it became clear to players that W/ARE had many faults in their ethics when it came to their push to continue to innovate. Their R&D sector has a very strict policy that reserves the right to legally penalize employees who fail to share any and all knowledge gained from their R&D conference tours. In Phase 4 we were informed of a man named Mr. Zheng, a W/ARE R&D employee who violated this policy when he chose to not immediately disclose information learned from <code>The Impact of Art on Dreams</code> conference in Moscow, Russia. Moreover, Zheng diverged from his planned tour path to learn more for himself- which prompted W/ARE to launch a public investigation into his whereabouts that the CSD became unintentionally embroiled in. Mr. Zheng was able to convey that W/ARE were dangerous; that several people had died by their unconventional handling of the W/ARE device in their Beijing research labs.<br />
<br />
[[File:NMSNext.png|thumbnail|300px|left|NEXT Announcement Tweet]]<br />
<br />
<br />
On March 29th, 2018, Sean Murray took to Twitter to announce their next update, [https://www.nomanssky.com/2018/03/no-mans-sky-next/ No Man's Sky: NEXT].<br />
<br />
Alongside the announcement of NEXT, Hello Games announced that two new ports of the game were in development for the '''Xbox One''', and strangely enough, '''W/ARE''''s dreamscape.<br />
<br />
<br />
[[File:Arnaud_Profile.png|thumb|400px|Arnaud Lacours' WARE Developer Profile]]<br />
Through their investigation, the CSD learned that an indie developer named Arnaud Lacours who — while working on a game for W/ARE — mysteriously went into a comatose state of abnormal properties. The CSD were contacted by Dr. Géraldine Nadeau, a researcher of lucid dreaming methods who took Arnaud into her care to study his unusual brain activity during his unconsciousness.<br />
<br />
Meanwhile, a new account emerged on the No Man's Sky subreddit, named <code>SATCOM-70</code>, that began reaching out for assistance in establishing connection to Myriad's Satellite API, [https://www.satcom-70.com Satcom].<br />
<br />
<br />
<br />
At the end of this phase, the CSD collaborated with Dr. Nadeau in determining the best personalized procedure to wake Arnaud, which was successful; and the final remaining five glyphs on the Waking Titan website were unlocked and solved shortly after.<br />
<br />
<br />
===Phase 5===<br />
<br />
Began on June 1st, 2018.<br />
<br />
<br />
== Connection to No Man's Sky ==<br />
<br />
[[File:9-16-case.png|thumbnail|right|The case that cassette 9/16 was contained in.]]<br />
<br />
At the beginning of the ARG, it was not clear whether Waking Titan was officially connected to No Man's Sky. At first, there were only hints and nudges. At one point, 180 free copies of No Man's Sky were distributed to ARG players. Here's the text of a PDF that was revealed at the end of Phase 1 of Waking Titan:<br />
<br />
<pre><br />
We want to extend our gratitude to everyone who has contributed to the Mercury subroutine so far. <br />
We hope you have enjoyed the successful distribution of 180 Access IDs, and we hope you will also <br />
appreciate the other interesting artifacts we have in store for you going forward. We intend to keep the <br />
process alive until the completion of Project Waking Titan in August. <br />
<br />
It is important to mention that we are very excited by the coming Phases 2 and 3. Input from the Mercury <br />
Subroutine will pave the way toward new experiences in '''version 1.3 of a familiar universe'''. We look forward <br />
to the successful conclusion of this ground-breaking experiment. <br />
<br />
Regards.<br />
S.M.<br />
</pre><br />
<br />
This text explicitly stated that the Waking Titan ARG was leading towards the upcoming 1.3 update for No Man's Sky.<br />
<br />
Some [[Waking_Titan/Console_Commands | console commands]] on the [http://www.wakingtitan.com/ Waking Titan website] during [[Waking_Titan/Phase 2|Phase 2]] refer directly to No Man's Sky lore - for instance, <code>WHOIS ATLAS</code>, <code>WHOIS VY'KEEN</code>, and <code>WHOIS KORVAX</code> are all valid commands. Additionally, some terminal commands referred to a mysterious fourth race, so the prevailing assumption was that the upcoming 1.3 update would bring a fourth race to No Man's Sky.<br />
<br />
At the conclusion of Season 1, an email was sent out to members of the CSD with a [[Waking_Titan/Phase_3#Memo_from_Sean_Murray | memo from Sean Murray]], confirming that the ARG was the lead up to the 1.3 update, which was [https://www.nomanssky.com/atlas-rises-update/ released] after a few days.<br />
<br />
<br />
== Media Appearances ==<br />
<br />
'''5th July 2017''' <br><br />
[EN] [https://www.argn.com/2017/07/stern_words_from_no_mans_sky_arg/ ARGNet - Stern Words from No Man’s Sky ARG]<br />
<br />
'''23rd July 2017''' <br><br />
[EN] [https://geekreply.com/geek-culture/2017/07/23/waking-titan-update-1-phase-2-commences GeekReply - Waking Titan Update 1: Phase 2 Commences!]<br />
<br />
'''27th July 2017''' <br><br />
[EN] [https://geekreply.com/editorials/2017/07/27/waking-titan-arg-can-bring-people-together GeekReply - Waking Titan: How An ARG can Bring People Together.]<br />
<br />
'''8th August 2017''' <br><br />
[EN] [https://www.dailystar.co.uk/tech/gaming/635697/No-Man-s-Sky-News-Waking-Titan-Reddit-Arg-1-3-update-release-date/ Dailystar - No Man's Sky News: Waking Titan Reddit Arg REVEALS 1.3 update ahead of release date]<br />
<br />
'''9th August 2017''' <br><br />
[EN] [https://arstechnica.com/gaming/2017/08/no-mans-sky-version-1-3-lands-this-week-for-free-adds-quick-travel-portals/ Ars Technica - No Man’s Sky version 1.3 lands this week for free, adds “quick-travel” portals]<br />
<br />
[EN] [https://www.forbes.com/sites/insertcoin/2017/08/09/no-mans-sky-is-patching-in-a-story-this-week-a-year-after-launch/#19fb5a285282 Forbes - 'No Man's Sky' Is Patching In A Story This Week, A Year After Launch]<br />
<br />
[EN] [https://www.gamespew.com/2017/08/no-mans-sky-patch-week-improving-central-story/ GameSpew - No Man's Sky Patch This Week Improving Its Story]<br />
<br />
'''19th January 2018''' <br><br />
[EN] [http://www.eurogamer.net/articles/2018-01-18-no-mans-skys-waking-titan-arg-is-back-and-fans-are-trying-to-figure-out-what-it-all-means Eurogamer - No Man's Sky's Waking Titan ARG is back, and fans are trying to figure it all out again]<br />
<br />
[RU] [https://dtf.ru/category/nmsarg/ DTF - A Collection of No Man's Sky and Waking Titan Articles.]<br />
<br />
== Other Information ==<br />
<br />
{| class="wikitable"<br />
!colspan="2"|[[:Category:Waking Titan| Waking Titan Miscellaneous Subpages]]<br />
|-<br />
|[[Waking_Titan/Cassettes | Cassettes]]<br />
|Information about the cassette tapes received by No Man's Sky subreddit moderators<br />
|-<br />
|[[Waking_Titan/Stations | Stations]]<br />
|Information on the radio stations from the initial project-wt.com site<br />
|}</div>Kkzzzkthttps://wiki.gamedetectives.net/index.php?title=Waking_Titan/Phase_4&diff=17687Waking Titan/Phase 42018-09-26T03:35:36Z<p>Kkzzzkt: corrected minor typos</p>
<hr />
<div>{{argbox<br />
| float = right<br />
| image = File:Project WT logo.png<br />
| imagewidth = 400<br />
| name = [[Waking Titan]] - Phase 4<br />
| description= Phase 4 of Waking Titan lasted from 2017-12-28 to 2018-06-01.<br />
| creator = [http://www.aliceandsmith.com/ Alice & Smith]<br />
| creator2 = [http://www.hellogames.org/ Hello Games]<br />
| type = Official<br />
| status = Completed<br />
| discovered = 2017-05-28<br />
}}<br />
{{ArgHeader}}<br />
{{BackToTop}}<br />
<br/><br />
__TOC__<br />
{{Clear|both}}<br />
<br />
== Tenth Glyph ==<br />
<br />
Beginning on December 28th, 2017, typing <code>WHOIS</code> on the [http://www.wakingtitan.com/ Waking Titan website] returned the following: <code>#WHATIS1.5</code>. In addition, the 10th glyph was made active, and linked to a [https://drive.google.com/drive/folders/16a_0EZ0EdAcCNE7QgvwIwC18NOGnZ_q9 Google Drive folder], which contained community-made pictures of the NMS logo in an infinite mirror.<br />
<br />
The titles of the photos, when strung together (skipping the 00 (empty) ones), formed the hexadecimal code for <code>moirrr</code>, which was an anagram for <code>mirror</code>. Additionally, the hexadecimal code in the correct order for the word <code>mirror</code> could be found on the bottom of the [http://www.myriad-70.com/ Myriad website].<br />
<br />
Also of note was the background of the tenth glyph, which read:<br />
<br />
[[File:Imageglyph10.png|thumbnail|right|the background of the tenth glyph]]<br />
<br />
<pre><br />
Dear Elizabeth<br />
We have finished processing 10,000 passes as per your requirements. You should<br />
have them in time for the next phase. I really hope you will like the final product.<br />
<br />
Kind regards,<br />
Gail<br />
</pre><br />
<br />
The allusion to <code>10,000 passes</code> is likely a reference to the Level 4 Atlas passes that were promised to players as part of earlier phases. The identity of "Gail" remained unknown.<br />
<br />
=== Atlas Passes ===<br />
On January 17th, 2018, the first CSD user received their Atlas Pass. The passes were made from cardstock, with a textured pass printed on it. The front had the text <code>WAKING TITAN</code> printed, and below that the CSD category the user belonged in. On the very bottom, a series of hexadecimals reading <code>70686f656e6978</code> could be found, which, after decoding, translated to <code>PHOENIX</code>. On the back, the owner's CSD-ID was written, along with a serial number stating which pass out of 10,000 the user had, and a number at the top.<br />
<br />
It is strongly recommended to not cover up the hex underneath your signature, and to share the number above and below your CSD ID if you are in possession of a pass. Preferably with a picture of the front, as shown below.<br />
For a list of all the atlas passes currently known of, please refer to [https://docs.google.com/spreadsheets/d/1TrNnrCzg8H7cbbAE6lIOFQ7JK8aTSKjxY9Q1i8EfjBs/edit#gid=1893459896 this spreadsheet.] In the event you receive one of these, please share a picture of the front, and the numbers underneath and above your CSD-ID (censored bit) on the back.<br />
<br />
<gallery mode="packed" widths=240px heights=240px><br />
Image:Better atlas pass.jpg|Atlas Pass front side<br />
Image:BEST BACK ATLAS PASS.png|Atlas Pass back side<br />
</gallery><br />
<div style="clear: both"></div><br />
<br />
=== Status Command Update ===<br />
<br />
On January 20th at 17:44 UTC, the output of the <code>STATUS</code> command began to update:<br />
<br />
<pre><br />
Downloading Data...: 19:44<br />
1- : 20:16 (32 min)<br />
1-8 : 20:27 (11 min)<br />
1-80 : 20:39 (12 min)<br />
1-800- : 20:44 (5 min)<br />
1-800-41 : 21:35 (51 min)<br />
<br />
1-800-413-01 : 22:14 (39 min)<br />
Xxxxx X : New Line<br />
<br />
1-800-413-011 : 22:15 (1 min)<br />
Xxxxx XX <br />
<br />
1-800-413-0110 : 22:16 (1 min)<br />
Xxxxx XXX<br />
</pre><br />
<br />
Calling the provided phone number yielded an SSTV transmission (pictured below) which, once decoded, provided meteorological data for various locations.<br />
<br />
<gallery mode="packed-hover" widths=240px heights=240px><br />
Image:Page 1 SSTV.PNG|SSTV page 1<br />
Image:Page 2 SSTV.PNG|SSTV page 2<br />
</gallery><br />
<div style="clear: both"></div><br />
<br />
Players found they were to order the list of locations in the image alphabetically. This yielded a sequence where <code>Index by Precipitation</code> could be read off.<br />
Using the ordered text indexed by precipitation (in <code>alma</code> the second index is <code>o</code>) led to the following:<br />
<br />
<pre><br />
CAFE<br />
BENE<br />
NINETEEN<br />
SAT<br />
</pre><br />
<br />
=== Livedrop Memo ===<br />
<br />
The text indicated a new livedrop would be occurring in the same location as the last one had. However, due to the old Cafe Bene closing, the <code>Xxxxx XXX</code> part was added in the STATUS command update to warn players about the new venue, <code>Outro NYC</code>, which opened in the same place as the Cafe Bene had been located. The livedrop was intended to occur at 7PM EST (00:00 UTC). However, the first player from the community who set out for the drop was involved in a traffic mishap, delaying their arrival. Anticipating missing the drop's time window, the community reached out to request a time extension, and the STATUS command, which had updated frequently throughout the confusion, was updated again to approve the community's request.<br />
<mapframe text="Outro NYC" width=400 height=350 zoom=14 latitude=40.7328 longitude=-73.9909><br />
{<br />
"type": "FeatureCollection",<br />
"features": [<br />
{<br />
"type": "Feature",<br />
"properties": {<br />
"marker-color": "#0f0fee",<br />
"marker-size": "medium",<br />
"marker-symbol": "cafe"<br />
},<br />
"geometry": {<br />
"type": "Point",<br />
"coordinates": [<br />
-73.99094313383102,<br />
40.73275683797643<br />
]<br />
}<br />
}<br />
]<br />
}<br />
</mapframe><br />
<pre><br />
STAND BY: CSD CITIZEN NOT DETECTED<br />
WARNING: CSD CITIZEN NOT DETECTED!<br />
IT'S LONELY OUT HERE<br />
TIME EXTENSION REQUESTED?<br />
EXTENTION PROPOSED: 2H30 – AWAITING CSD APPROVAL<br />
EXTENSION APPROVED, BE SAFE<br />
</pre><br />
<br />
[[File:bookwt.png|thumb|left|Book case seen on the livedrop livestream is the same as one used in an earlier livedrop.]]<br />
<br />
After the extension was approved, a second player from the community set out to the livedrop location [https://youtu.be/Gvng4pAuxY8 on livestream] and met with their A&S contact around 7:30PM EST (00:30 UTC). During the meeting, the player was handed [https://drive.google.com/file/d/1kAjH2njXiab3u24VkcY-69IvOabhytGv/view a memo] from a mysterious case disguised as a book, pictured left. After some cryptic conversation, the contact asked if they were "getting enough sleep", stating that being well-rested would be very important. After the meeting, players who had attended the livedrop met in another location and showed off the memo, speculating about it's contents and even discovering the REM Sleep connection to the letters on the memo's back. After the livedrop, the community used the livestream to look over the memo, pictured below. On the back of the memo <code>REMS</code> is written. This clue, in combination with the strange question A&S asked at the rendezvous, led players to the password for the 10th Glyph, <code>REM SLEEP</code>.<br />
<br />
<gallery mode="packed-hover" widths=240px heights=240px><br />
image:memo1.png|Memo page 1<br />
image:memo2.png|Memo page 2<br />
image:memo3.png|Memo page 3<br />
</gallery><br />
<br />
[[File:form7.png|thumb|right|Seventh question revealed on the [https://atlas13.typeform.com/to/VF6CpG bit.ly form] when REMS or REM Sleep is entered for question six]]<br />
<br />
Once the glyph was solved, the STATUS command updated to [https://atlas13.typeform.com/to/VF6CpG a bit.ly link to a form]. Players discovered that on the sixth question on the form, entering REMS or REM Sleep (case sensitive) caused a seventh question, pictured right, to reveal itself, allowing CSD users to enter their email address to receive "left over materials" from something called Lab 319. Players remained unclear on what exactly Lab 319 was or what it's leftovers were, however signing up seemed integral given the input is only revealed after using the REM Sleep phrase.<br />
<br />
=Myriad Back Online=<br />
On 26 March, 2018 at 05:25 UTC an event occurred. The [http://www.myriad-70.com Myriad] site came back online after having been offline since the end of Phase 3. The site featured indications of a solar event interfering with operations. In addition, the status command on [http://wakingtitan.com Waking Titan] briefly displayed the following:<br />
<pre><br />
CODE -3<br />
Unable to restart<br />
.................<br />
ERROR LOG SUMMARY<br />
- Major malfunction<br />
- Protect the monarch<br />
- All tiers 2 and tiers 3 clients must be purged IMMEDIATELY<br />
.................<br />
TO ALL CSD<br />
- Gather maximum EXTERNAL intel<br />
- CSD should take time to regroup and get organized<br />
</pre><br />
<br />
Ten minutes elapsed before the Status command began to display the following:<br />
<pre><br />
CODE -5<br />
System Locked<br />
e b 4 c 1 4 a 9 c 6 2 2 d f 7 1 6 6 f b e 0 d d 8 9 1 5 d b 0 2<br />
</pre><br />
<br />
This hexadecimal string was used to reference a connection the private key for an Ethereum cryptocurrency wallet related to an ostensibly "promotional" event for an upcoming product from [http://ware-tech.cloud/ W/ARE].<br />
<br />
=Client 3597b=<br />
<br />
At 01:11 UTC, Myriad-70.com updated, and the updates included the following.<br />
<br />
<pre><br />
Latest network diagnostic table:<br />
- Network corruption detected<br />
- Situation isolated to Client 3597b<br />
- Process cannot be suspended due to critical conditions<br />
--------------------------<br />
-Beijing: 29.1Tb/s<br />
--------------------------<br />
MAJOR ISSUES:<br />
Client 3597b<br />
</pre><br />
<br />
<br />
Soon after, at 01:30 UTC, the Status command updated in the Terminal to say the following.<br />
<br />
<pre><br />
> status<br />
CODE -5<br />
System Locked<br />
e b 4 c 1 4 a 9 c 6 2 2 d f 7 1 6 6 f b e 0 d d 8 9 1 5 d b 0 2<br />
--------------<br />
Monarch Repository Status: Degraded<br />
Conflict With<br />
- Client 18d1a TRACERT 10.30.74.*<br />
- Client 3597b TRACERT 54.91.155.*<br />
- Client 351h TRACERT 6.128.214.*<br />
- Client 0911a TRACERT 74.1.21.*<br />
</pre><br />
<br />
Approximately 15 minutes later, clients began to disconnect, beginning with Client 0911a, second being Client 18d1a, and the last being Client 351h, who had an additional piece of text added, being <code>ID: 79657321</code>, which was translated as hex into <code> Yes! </code> <br />
<br />
Then, at 02:15 UTC, the status command was updated again, stating <code> - Client 3597b - UNABLE TO DISCONNECT 54.91.155.209 NAT 52.2.248.*</code><br />
<br />
At 13:38 UTC, the status command updated once again, stating <code> - Client 3597b - UNABLE TO DISCONNECT 54.91.155.209 NAT 52.2.248.*:80\\</code><br />
<br />
At 22:30 UTC, March 30, the status updated again to say<br />
<pre><br />
Latest network diagnostic table:<br />
- Client 3597b is beyond allocated limits<br />
- Process cannot be suspended due to critical conditions<br />
- Tier 1, 2 and 3 clients are now all offline<br />
</pre><br />
<br />
=Ware-tech.cloud=<br />
Of the sites found in the 52.2.248 range, [http://52.2.248.6 52.2.248.6] was found. Using the metadata found in the HTML and searching on Google, the [http://www.ware-tech.clouddomain] and [http://twitter.com/warecloud Twitter] were located as well. The site is in Chinese, although Google Translate gives a good, readable translation. <br />
<br />
On Twitter, under the Shipping Soon image, is a Hex string <code>77 61 6E 74 20 74 6F 20 6B 6E 6F 77 20 6D 6F 72 65</code> that, when converted to ascii reads <code>want to know more</code>. Under the #waretech hashtag on Twitter, there are three images shared by "Partner Companies" with the following code (and the ascii conversion):<br />
<br />
<pre><br />
62 69 74 2E = bit.<br />
6C 79 2F 77 = ly/w<br />
61 72 65 32 = are2<br />
</pre><br />
<br />
On the ware-tech website, if you subscribe, you receive an email with another 3 characters: <code>30 31 38</code>, which again in Ascii becomes <code>018</code>. Together this gave a bit.ly link that leads to the W/are Discord channel.<br />
<br />
Discord users were informed of a community puzzle that was going on by the admin. Members of the W/ARE Discord had received tweets from another account, [https://twitter.com/w9rPQ45E https://twitter.com/w9rPQ45E], which had seven tweets with hex code in them:<br />
<pre><br />
01 [ 74 78 2f 30 78 66 65 30 31 35 30 66 ] <br />
02 [ 62 33 30 32 61 38 62 36 64 34 30 38 ]<br />
03 [ 35 37 32 32 64 61 61 31 64 30 37 37 35 ]<br />
04 [ 38 33 31 38 35 30 38 36 39 31 30 61 31 ]<br />
05 [ 61 38 32 34 38 63 65 32 34 38 30 64 ]<br />
06 [ 32 65 33 38 37 33 31 ]<br />
07 - Signal Lost [ 65 6e 64 20 6f 66 20 6c 69 6e 65 ]<br />
</pre><br />
<br />
Translated into Ascii, these tweets give the following:<br />
<pre><br />
tx/0xfe0150f<br />
b302a8b6d408<br />
5722daa1d0775<br />
83185086910a1<br />
a8248ce2480d<br />
2e38731<br />
</pre><br />
which references [https://etherscan.io/tx/0xfe0150fb302a8b6d4085722daa1d077583185086910a1a8248ce2480d2e38731 this Ethereum transaction]. The Twitter username, w9rPQ45E is also [http://pastebin.com/w9rPQ45E a Pastebin], providing the string <code>edb044c81d40a196c4672a2bd6f17f1f6</code>. In the Ethereum transaction, there is Input Data that, when converted to ascii, links to [http://pastebin.com/HNqKEUpS another Pastebin], providing another string: <code>b67fbb5e90ddcda8a921656d0b30a20</code><br />
<br />
Two things have been done with these strings. Together, they are the Private Key for the Ethereum account the money was transferred to. It has since been withdrawn to a different account. Second, if you put the two strings together and compare them with the string from Waking Titan's console, every odd character matches the strings from Pastebin.<br />
<code>edb044c81d40a196c4672a2bd6f17f1f6b67fbb5e90ddcda8a921656d0b30a20</code><br />
<br />
<code>e b 4 c 1 4 a 9 c 6 2 2 d f 7 1 6 6 f b e 0 d d 8 9 1 5 d b 0 2&nbsp;</code><br />
The remaining characters are <code>d0 48 d0 16 47 ab 61 ff b7 b5 9d ca a2 66 03 a0</code>, however if this has any use is yet to be seen.<br />
<br />
Three hours after the W/ARE Discord Admin let the community know about the puzzle, at 6:01 PM UTC they returned and said<br />
<pre>That was it for today, good job on solving our community puzzle! You are good! :smiley:<br />
Tomorrow one of our partners will have a giveaway for us! We will have more for you this weekend also!</pre><br />
<br />
=Mercury Project=<br />
[[File:Sean-tweet.png|thumb|right]]<br />
[[File:NMSNext.png|thumb|The announcement for No Man's Sky: NEXT]]<br />
At 21:26 UTC, the <code> Mercury </code> command updated to say the following.<br />
<br />
<pre><br />
Mercury process > Build XXXX<br />
Ready to load branch version 1.5<br />
Send Password Code in HEX to : Telegram MercuryHG80<br />
</pre><br />
<br />
This puzzle required a user to solve the riddle shown below, convert the answer into hexdecimal, and send it to an official Telegram account run by one of the Puppet Masters.<br />
<br />
The puzzle involved a riddle that was discovered in a [https://twitter.com/warecloud/status/979103811489984513 Pastebin on W/ARE's twitter]. It went as follows: <code> “Descended from Night, I share the blood of nightmares. Look forward to the gates of horn and ivory” </code><br />
<br />
This puzzle was solved by searching "The gates of horn and ivory", which resulted in dreams and nightmares of Greek mythology. After noting the capital N in "nightmares", users found the Greek god of night, Nyx, which led to one of her children, Morpheus, who was one of the Oneiroi, and the god of dreams. The name was then converted to hexdecimal and sent to the Telegram account, and the terminal accepted the password, resulting in the following command update.<br />
<br />
<pre><br />
Processing "Morpheus" > ACCESS GRANTED<br />
Downloading.......<br />
</pre><br />
<br />
Then, at 09:54 UTC, the Mercury command updated again, and said the following.<br />
<pre><br />
<Mercury process > Build XXXX<br />
Ready to load branch version 1.5<br />
Send Password Code in HEX to : Telegram MercuryHG80<br />
--------------------------------<br />
Process started by community - ETA 11:00 BST<br />
https://bit.ly/2pLmadg<br />
</pre><br />
<br />
The shortened link redirected to a tweet from Sean Murray, which said <code> The cause is hidden. The effect is visible to all. #oneonebst </code><br />
<br />
The tweet also included a photo of someone, presumably Sean himself, holding a phone receiving a Telegram notification, which was Morpheus in hexdecimal. The hashtag spells out 11BST, or more precisely, 11:00 BST, or, 10:00 UTC. No updates were made at 10:00 PM, and was then confirmed to be counting to 10:00 AM.<br />
<br />
Roughly half an hour before the timer was up, at 9:26 AM UTC, Sean Murray announced on [https://twitter.com/NoMansSky/status/979288744791592960 Twitter] that he had a small announcement to make, and was going to post it early as it was about to leak.<br />
<br />
Shortly after, at 09:50 UTC, Hello Games announced the next update for No Man's Sky, which was No Man's Sky NEXT, set with a launch date for Summer of 2018.<br />
<br />
=Newsletter=<br />
[[File:WareNewsletter1.png|thumb|left|120px|Screenshot of the W/ARE newsletter]]<br />
On April 2 at around 23:30 UTC, user W/ARE came online in the W/ARE Discord to announce that the next giveaway would be sent out in a newsletter within the next hour.<br />
They also mentioned the upcoming launch of their new translated English website, new extranet and the release of a "WARE cryptocoin", and asked users who are planning to be at PAX East to let them know at info@ware-tech.cloud with "PAX EAST - YES!" in the subject line.<br />
<br />
At 00:30 UTC the newsletter started coming in via email. It announced that 25 winners were selected to receive Steam keys for games from W/ARE partners, such as The Shrouded Isle and Future Unfolding.<br />
It also included a [https://ware2.typeform.com/to/HuBpCP link to an Application Form] for indie developers to apply for a Developer Kit of W/ARE tech. The best applications will be up for a public community vote to decide which games will be launched on the W/ARE platform.<br />
<br />
Around the same time, the Status command in the Terminal updated to say the following:<br />
<br />
<pre><br />
> status<br />
CODE -5<br />
Monarch Repository : Data Loss Imminent<br />
Booting up Command.Center.v11<br />
Pending approval by Monarch<br />
</pre><br />
<br />
=PAX East Weekend=<br />
==Website update==<br />
On April 6, 2018 at 18:00 UTC the [https://ware-tech.cloud/ W/ARE website] updated with the new English translation and access to a Developer Area containing a sign-in form.<br />
<br />
==Status command==<br />
On April 8 at 01:19, the Status command updated with the following output:<br />
<br />
<pre><br />
CODE -5<br />
Monarch Repository : Data Loss Imminent<br />
Booting up Command.Center.v11<br />
Pending approval by Monarch<br />
Error - Unable to connect with repository<br />
Memory Dump 2GzHGwu.jpg<br />
</pre><br />
<br />
The filename leads to a [https://i.imgur.com/2GzHGwu.jpg corrupted image hosted on imgur], depicting a partial area map, a satellite, and the word "MYRIAD".<br />
<br />
==Live Drop==<br />
On April 8 around 00:49 UTC, players who previously sent emails to W/ARE about attending PAX East received the following response:<br />
<br />
<pre><br />
Hello! We’ve heard from some attendees that our booth at PAX East is very difficult to find this year. To help you find the booth, we’ve enlisted the help of an Enforcer. Here is the information that our team at PAX has sent us to help you locate them:<br />
<br />
HANDLE: EMU<br />
PATH:<br />
START<br />
-997E<br />
-1E<br />
-1000E<br />
+4S<br />
+1000W<br />
+1W<br />
+1000W<br />
-7N<br />
REPEAT<br />
<br />
You should be able to find them on their path between 12PM and 3PM local time.<br />
<br />
- WARE<br />
</pre><br />
<br />
The path of EMU was determined by searching for a specific range of clustered booth numbers on the floor plan. Assuming Down is East, starting at booth 17102 and subtracting 997 from that number gives us 16105, which is to the East directly next to booth 17102. Continuing this with the rest of the coordinates:<br />
<br />
<pre><br />
17102 - 997E = 16105 - 1E = 16104 - 1000E = 15104 + 4S = 15108 + 1000W = 16108 + 1W = 16109 + 1000W = 17109 - 7N = 17102 (repeat)<br />
</pre><br />
<br />
Ultimately creates this path between the eight booths:<br /><br />
<br />
<center>[[File:Emu_path.png|frameless|The path of EMU]]</center><br />
<br />
<br />
Several agents met with the contact between 16:00 and 19:00 PM UTC and were given a total of four USB drives. Each drive contained an image and a text file.<br />
<center><gallery><br />
1-4.jpg|(ea87d58e-5775-47a9-a201-b7c7007f46d1.jpg)<br />
2-4.jpg|(580cdc97-3e01-4902-83d6-7bc9e764dda2.jpg)<br />
3-4.jpg|(e34d6e93-98f2-45a5-9899-694f93317e0b.jpg)<br />
4-4.jpg|(f395ef03-f19c-4cb3-bc9c-5f80695ce7eb.jpg)<br />
</gallery></center><br />
[[File:Jumbledwordsoverlay.jpg|thumb|200px|USB drive images overlayed]]<br />
{| class="wikitable" border="1"<br />
|-<br />
! 1-4.txt<br />
! 2-4.txt<br />
! 3-4.txt<br />
! 4-4.txt<br />
|-<br />
| A cornucopia of knowledge is in the mind of mankind, but it must be nurtured and hidden from the wrath of time. Time swallows all things, ends all beginnings, and leaves each of us devoured.<br />
<br />
- arnaud@philojeux.com<br />
| A mind invisible is buried underground, but a mind of water carries no patterns. It is the mind, the wrist pointed to heaven, which allows us to dream. It is this hand on high that cast down our demons to the earth.<br />
<br />
- arnaud@philojeux.com<br />
| Slumber in prison for eternity, lock away every great thing, but the spirit cannot be broken. A voice like ages rocks the very ground and with it’s call a rise to action of every terror.<br />
<br />
- arnaud@philojeux.com<br />
| Of chaos swirls a terrible nothing, but pulled together without reason is reason born from chaos. A single note, another still, a symphony is creation where each piece follows the last no matter how the thread dances.<br />
<br />
- arnaud@philojeux.com<br />
|}<br />
<br />
The email address led to [http://www.philojeux.com/ philojeux.com], a website for a French indie game studio named Philo Jeux. Founded by Arnaud Lacours, it works on the philosophy-based game <code>Les tablettes de Mnémosyne</code> which was to be released on the WARE platform in July 2018.<br />
<br />
Overlaying all four images highlighted the letters <code>f1orbiag55z1</code>. Using this as the password for the login form on [http://extranet.ware-tech.cloud/ extranet.ware-tech.cloud] and combining it with the email address from the text files as the username granted access to Arnaud Lacours' account for the Developer Area. <br />
<br />
== WARE Developer Area ==<br />
[[File:Arnaud_Profile.png|thumb|400px|Arnaud Lacours' WARE Developer Profile]]<br />
Upon first access after the PAX event, the [http://extranet.ware-tech.cloud/ area] accessed using the credentials <code>arnaud@philojeux.com / f1orbiag55z1</code> contained a main page, a developer profile page and multiple inaccessible pages. The main page presented an overview of user statistics and an empty main [https://etherscan.io/token/0x5b758a02d08efa566f3438775888866afd5d046c WARE token] wallet. Alongside the empty wallet were 12 wallets labelled Alpha-Lima in the NATO Phonetic alphabet, each containing 256 WARE. The [http://extranet.ware-tech.cloud/documents Documents] and [http://extranet.ware-tech.cloud/taskmanager Task Manager] pages were inaccessible due to Arnaud Lacours' account having an insufficient clearance level. The [http://extranet.ware-tech.cloud/supplyrequest Request Supplies] page was inaccessible due to insufficient funds (where funds are probably WARE tokens). Accessing the [http://extranet.ware-tech.cloud/profile developer profile page] while authenticated as Arnaud Lacours showed their information; including a phone number: <code>(514) 448-1493</code>. When this number was originally called, it led to a [https://clyp.it/p1lbsf3e voicemail message] in French, translated to English it said:<br />
<pre><br />
Hi, I'm Arnaud Lacours, the CEO and founder of Philo Jeux. I'm not here at the moment. Please give me your contact details and I will call you back later. Thanks a lot, bye.<br />
Voicemail System: Sorry, this voicemail is full. Please try again later. Thank you for calling, goodbye.<br />
</pre><br />
On the 14th April at around 02:00 UTC, it was noted that the [https://clyp.it/cwdz4qxg voicemail message changed.] Again, the message was in French, roughly translating to:<br />
<pre><br />
I'm Arnaud's girlfriend, thanks a lot for your wishes. Unfortunately Arnaud's condition got worse and he can't call you back and for now the company is closed.<br />
</pre><br />
<br />
=Status & W/ARE Updates=<br />
On April 14 at 18:37 UTC, the value of the Status command updated:<br />
<pre>CODE -5<br />
Monarch Repository : Data Loss Imminent<br />
Booting up Command.Center.v11<br />
Pending approval by Monarch<br />
Rebooting...</pre><br />
<br />
<br />
At 19:51 UTC, players who had applied for a Developer Kit started receiving [https://mailchi.mp/062a86fa0c65/news-from-ware-1464925 emails with further details] on what kind of applications W/ARE were looking for. According to this email, the company had opened positions for five partnered studios, one of which would also receive a grand prize of $1,000 USD. The deadline for applications was April 28th.<br />
<br />
<br />
Then, at 20:38 UTC, the Status command updated again with the following output:<br />
<pre>CODE -5<br />
Monarch Repository : Data Loss Imminent<br />
Booting up Command.Center.v11<br />
Pending approval by Monarch<br />
Error- Unable to connect with repository<br />
WARNING- MEMORY DUMP FAILED!<br />
Biometric backup initiated…<br />
http://bit.ly/2ITvMcW</pre><br />
<br />
The [http://bit.ly/2ITvMcW link] led to a recording of a female voice reading out a string of words:<br />
<pre>Drunken - Disable - Geiger - Everyday - Hockey - Determine - Endow - Coherence - Freedom - Guitarist - Framework</pre><br />
[[File:Myriad_Interface_Distort.jpg|thumb|A still frame of the gif]]<br />
These are words from a [https://en.wikipedia.org/wiki/PGP_word_list PGP Word List], also known as a '''Biometric''' Word List, as hinted at in the Status text. Each word corresponds to a hex value:<br />
<pre>51 4B 6A 58 73 47 59 2E 67 69 66</pre><br />
<br />
When converted to ASCII this reads <code>QKjXsGY.gif</code>, which was the filename of an [https://i.imgur.com/QKjXsGY.gif animated gif on Imgur].<br />
<br />
=Regular Statistics Updates=<br />
On April 15, 2018 at 22:26 UTC, the [https://extranet.ware-tech.cloud/ Developer Dashboard] received an update to its Weekly Statistics, specifically the Total Sessions and Total Users counter. Another update followed at 13:19 the next day, after which the numbers continued to be updated 37 times over the next two days, once every hour at the 37th minute. The final update was recorded on April 18 at 1:37, 51 hours and 11 minutes after the very first update, and 36 hours after the first update at minute 37.<br />
<br />
Another phase of continuous updates to the Statistics overview started on April 19 at 02:37, this time at 30 minute intervals.<br />
<br />
A record of all value changes can be found [https://docs.google.com/spreadsheets/d/1A8zODah54JUhO6ClFs8wNVvKLpLzWwm04lzOlS9mmAU/edit?usp=sharing here].<br />
<br />
<br />
=Dev Kit Update #2=<br />
On the 21st, at 16:17 UTC, all users subscribed to the W/ARE mailing list received a second Developer Kit Update.<br />
<br />
The update mentioned that the W/ARE team was working on a new test protocol for the headset that was expected to provide a 60% boost in power to the headset. It was also said that players would learn within a few weeks.<br />
<br />
The update also featured 3 submitted projects so far, which are as follows:<br />
<br />
*[https://www.youtube.com/watch?v=1c_682fRL8w DreamScape], a "user defined MMO where players can create their own worlds as they sleep", created by [http://www.edgewaregames.co.uk EdgeWare Games]<br />
<br />
*[https://www.youtube.com/watch?v=pBRZxVZ5KKs Venture Unknown], a supposed "spiritual successor to No Man's Sky", made by [https://www.cjkproduction.com/ventureunknown CJK Production]<br />
<br />
*[https://www.youtube.com/watch?v=qBxlref67wU The Drowned Tower], a "post-apocalyptic exploration game set in a dream-like world", made by [https://oceansmoke.wordpress.com OceanSmoke Games].<br />
<br />
It was found that these three projects were all player created, and have no official affiliation or information involving the Waking Titan ARG.<br />
<br />
=April 27-29th Access Grants=<br />
At 19:11 UTC on April 27, [http://extranet.ware-tech.cloud/documents the Documents portion] of the W/ARE extranet site, along with [http://extranet.ware-tech.cloud/taskmanager the Task Manager section] were unlocked. This started a series of tasks. Each new task was unlocked when funds were successfully transferred out of one of the developer sub-wallets. The wallet keys were received by sending the correct solution to the current task to <code>warelearn@ware-mail.cloud</code>.<br />
<br />
Under the introduction category, the link titled <code>2018 03 03</code> led to a corrupted image of what was discovered to be St. Basil's Cathedral in Moscow, Russia. [[File:Basil.jpg|thumb|200px|The corrupted image of St. Basil's Cathedral.]]<br />
There were also two other images of interest, titled <code>Notes-on-locations-1_ldf82ng0.png</code> and <code>Notes-on-locations-2_pisj84n91.png</code><br />
Combined together, the contents of these 2 images read the following.<br />
<pre><br />
1. THE MIDDLE OF THE INVERTED PENDULUM COULD FEED THE MOST LOGICAL MINDS<br />
<br />
2. ITS SHAPE WILL LIGHT THE SPARK OF CREATIVITY<br />
<br />
(049245)<br />
<br />
3. IMPOSING SURROUNDINGS HELP IDEAS TO BE TAKEN SERIOUSLY<br />
<br />
4. SURROUNDED BY WATER,<br />
EXHALING SERENITY<br />
<br />
(AT THE JUNCTiON<br />
BY THE LAKE)<br />
</pre><br />
[[File:Train_Ticket.jpg|thumb|Mr. Zheng's Manchurian Railway Ticket]]<br />
Another image was also found, entitled "Train ticket". It contains an image of a train and Cyrillic script that translates to "Manchurian Railway Ticket", "Moscow - Beijing" dated March 5, 2018.<br />
<br />
==Alpha==<br />
The Task Manager section revealed the first "Task" given to W/ARE employees, titled "Missing Employee", and that it was in progress. There was one description of what had happened, along with two update messages.<br />
<br />
The original description read the following.<br />
<br />
<pre><br />
IMPORTANT MESSAGE FROM WARE RESEARCH AND DEVELOPMENT TEAM. Attention to all developers. One of our colleagues, Mr. Zheng, has gone missing a month ago while on a R&D tour. Serious investigation inside the department has lead to nothing of interest, and we’re now asking for outside help. Please send any information concerning his potential whereabouts to warelearn@ware-mail.cloud.</pre><br />
<br />
The first and second update were as follows:<br />
<br />
Update 1:<br />
<pre><br />
All recent and potentially relevant documents found on Mr. Zheng’s computer have been translated and forwarded to the developer extranet. Our team is currently trying to use this information to retrace his last steps. We’re hoping that our combined efforts can bring light to this affair and bring Mr.Zheng back home safely. In the hope of attaining maximum reach and visibility, the R&D department also set up a Twitter account to serve as another relay of information.</pre><br />
(The twitter account in mention is [https://twitter.com/WARE_RDev @Ware_RDev])<br />
<br />
Update 2:<br />
<pre><br />
UPDATE ON R&D SEARCH. All information of interest sent to warelearn@ware-mail.cloud will be rewarded with codes to our exclusive WARE wallets which can be used for special package purchases.<br />
</pre><br />
<br />
Sending an email containing the keyword "Moscow" to warelearn@ware-mail.cloud caused them to send the following reply, including a link to a map of Beijing's subway for a planned 7th conference: [[File:Conference_7_Possible_locations.png|thumb|Possible locations for Conference 7]]<br />
<pre><br />
The WARE Research and Development team thanks you for your interest in the WARELearn initiative. The Russian Academy of Medical Science in Moscow’s conference on Art and Dreams is the last of a series of six conferences we hope will enlighten your mind. The WARE Team will review your application and get back to you as soon as possible!<br />
<br />
Feedback from employees is fundamental in the development of the WARELearn initiative. As such, we’re asking you to give us your opinion on the ideal location for our next conference. If the location you picked is chosen by our committee, you may be given the chance to attend and meet the promoters of the event.<br />
<br />
Our team has begun to pinpoint buildings that could be of interest. Feel free to inspire yourself and contact warelearn@ware-mail.cloud to let us know about your suggestion.<br />
<br />
Kind regards,<br />
The WARELearn initiative<br />
</pre><br />
<br />
Sending an email containing all the keywords "Moscow," "Beijing," and "049245" (from Notes on locations 1) triggered another response, this time containing the ALPHA sub-wallet key:<br />
[[File:Sub-wallets.jpg|thumb|Empty sub-wallets]]<pre><br />
Dear informer,<br />
<br />
To thank you for your recent help in Mr. Zheng’s case, WARE has provided you with a code to use on our internal cryptocurrency wallets. We promise that every significant clue provided to us will be rewarded as such.<br />
<br />
Claim your reward with this code and stay alert for further updates on the situation : 4e47e152a5afaf95537c5dba73ef73d45c11fd6743ff5db9bfea3eca9282fda<br />
<br />
Please withdraw the funds so that the main wallet can be updated. Note the updating process is not immediate.<br />
<br />
Kind regards,<br />
<br />
The R&D Team</pre><br />
The funds were withdrawn from the cryptocoin wallet, which led to an update to the Weekly Statistics page, where sub-wallet ALPHA was now displayed as empty.<br />
<br />
==Beta==<br />
A new message in the Task Manager followed:<br />
<pre><br />
Most recent informations linked to the WARELearn services has confirmed our suspicions that despite boarding his train in Moscow, Mr. Zheng never arrived at Beijing and seems to have abandoned the train along the route. Any information, as small as a postal code, that you can find about the possible location locations he may have visited for an extended period - such as a hotel or hostel - would be of tremendous help.<br />
</pre><br />
<br />
Using a map of the Trans-Manchurian Train route and the 4 hints from the Document files, players concluded that Mr. Zheng left the train in <code>Gostinyy Dom Chita, 672040</code>. Sending this information to the email address yielded another wallet key. Players were able to withdraw these funds from a cryptocurrency wallet, emptying sub-wallet BETA.<br />
<br />
The following update was posted in the Task Manager:<br />
<pre><br />
Thanks to dedicated informers, the investigation on Mr. Zheng is progressing and the tasks have been updated. We’ve been able to confirm that a stop was indeed made in Chita, after attending the Moscow conference on Art and Dreams. Please send any information concerning his potential whereabouts to warelearn@ware-mail.cloud, in addition to the updated task number.<br />
</pre><br />
<br />
==Charlie==<br />
A journal entry and a page of notes both written by Mr. Zheng were unlocked in the Documents section, along with an update in the Task Manager:<br />
<center><gallery><br />
Journal_Academy.png|(Mr. Zheng's Journal)<br />
Notes_on_Moscow.jpg|(Mr. Zheng's notes on Moscow)<br />
</gallery></center><br />
<br />
<pre><br />
Attention to all teams. Documentation (copies and originals) coming from a source close to the missing employee have been recovered by W/ARE. There are a lot of files to organize and our database employees are still trying to get everything in order. Any information that could help us make sense of them will be most welcome.<br />
</pre><br />
<br />
The image of "Notes on Moscow" contains 3 blanks and descriptions of 3 paintings. The blanks can be filled in with the subjects of the paintings. Sending these keywords, in addition to the updated task number - <code>a1028f, Montreal, 1.30pm. Meet me at the fountain in front of the Notre Dame Basilica.</code> - to the email, yielded the next wallet key. Again, players withdrew the funds from the wallet, emptying sub-wallet CHARLIE.<br />
<br />
==Delta - Montreal Live Drop==<br />
The Task Manager updated with an announcement of a live drop: [[File:Live_Drop_Montreal.jpg|thumb|200px|The note received at the Live Drop in Montreal]]<br />
<mapframe text="Place d'Armes" width=350 height=350 zoom=14 latitude=45.504722 longitude=-73.557222 align=left><br />
{<br />
"type": "FeatureCollection",<br />
"features": [<br />
{<br />
"type": "Feature",<br />
"properties": {<br />
"marker-color": "#7e7e7e",<br />
"marker-size": "medium",<br />
"marker-symbol": "square-stroked"<br />
},<br />
"geometry": {<br />
"type": "Point",<br />
"coordinates": [<br />
-73.55727553367613,<br />
45.504820504538785<br />
]<br />
}<br />
}<br />
]<br />
}<br />
</mapframe><br />
<pre><br />
Deploying a team for possible package seizure.<br />
<br />
Once the location will be secured and package examined, onsite examination will be possible.<br />
<br />
WARE will not allow package to leave location. Taking pictures will be permitted.<br />
<br />
Confirmation of Location: Place d’Armes, Montreal, In front of the fountain<br />
<br />
Confirmation of Time: Between 7pm and 9pm, local time<br />
</pre><br />
<br />
At the drop location, players received the following note: <code>I came two years after the Ursuline nuns. Now set in stone, here is my legacy. G. Nadeau</code><br />
<br />
Investigations led to the French nurse Jeanne Mance, who arrived in New France two years after the Ursuline nuns came to Quebec and established Montreal's first hospital in 1642, the <code>Hôtel-Dieu de Montréal</code>. She is memorialized in statue at the foot of the Maisonneuve Monument. Sending this information to the email unlocked the next wallet key, and the withdrawal of the funds emptied sub-wallet DELTA.<br />
<br />
==Echo==<br />
[[File:Journal_HotelDieu.png|200px|thumb|Journal Hotel Dieu]] On April 28 at 02:32, a new journal page was unlocked that highlighted two circled notes, <code>DON'T FORGET TO MOVE NOTES ON THE MEETING TO THE CLOUD</code> and <code>SECULAR VADER OF THE BIBLE</code>.<br />
<br />
The new Task Manager update read:<br />
<pre><br />
The search to find Mr. Zheng is still ongoing. New information is now connecting him to Montreal’s Hotel Dieu. Please send any information concerning his potential whereabouts to warelearn@ware-mail.cloud, in addition to an updated task number [t1029r].<br />
<br />
We’ve tried to access Mr. Zheng's files in the R&D dropbox, but all access has been blocked.<br />
</pre><br />
It contained a link to Mr. Zheng's password-locked [https://www.dropbox.com/sh/jz2nbdawcphki04/AACA83rODlh8qN4vuayLfgRya?dl=0 Dropbox]. Players determined the correct password was <code>Gutenberg</code>, who produced the first printed Bible.<br />
<br />
The Dropbox contained 4 pdf files with printable hexaflexagon patterns. When folded, one of the sides on each hexaflexagon yielded a 13-digit number starting with 978. These were ISBN numbers for the following 3 books: <code>Nine Billion Names of God</code>, <code>The Paris Architect</code>, and <code>War and Peace</code>. Using the leftover numbers from each flexagon as a book cipher of the format page, line, and word, the phrase <code>unknown british soldier</code> was found. This points to the <code>Tomb of the Unknown Soldier</code>, which was the keyword to obtain the wallet code for sub-wallet ECHO.<br />
<br />
==Foxtrot==<br />
When assembled and put together, the three hexaflexagons revealed a shape resembling the river Seine in Paris in the area of the Louvre. Sending <code>Louvre</code> to the email address provided the code for sub-wallet FOXTROT and revealed a new journal document. [[File:Journal_Louvre.png|thumb|200px|Journal Louvre]]<br />
<br />
On the journal page were 3 sentences, with certain words underlined. Ordering the words by the number of underlines and counting their position in each sentence resulted in the phone number <code>438-368-9126</code>. Upon calling this number a [https://clyp.it/bgakdxvc recorded message] gave a morse code that translated to <code>PASTEH9EBKEXGT</code>. This led to a [https://pastebin.com/H9EBKEXG Pastebin document] containing the following text:<br />
<br />
<pre><br />
From the bottom of the crypt, at the feet of the Guardian, I ascend left<br />
Pass the dignitary and follow the water<br />
Go straight to the sun with open arms and turn right<br />
Turn left when you arrive home<br />
Go straight to the hand and head of the goddess and turn left to face the keeper<br />
Follow the procession into the house of kings<br />
Ignore the light and descend to your death<br />
I am here and with me the seventh part of what you are searching for.<br />
</pre><br />
<br />
==Golf - Paris Live Drop==<br />
A new live drop was announced to be in Paris, France:<br />
<br />
<mapframe text="Passage du Souvenir" width=350 height=350 zoom=14 latitude=48.873611 longitude=2.296389 align=left><br />
{<br />
"type": "FeatureCollection",<br />
"features": [<br />
{<br />
"type": "Feature",<br />
"properties": {<br />
"marker-color": "#008040",<br />
"marker-size": "medium",<br />
"marker-symbol": "entrance"<br />
},<br />
"geometry": {<br />
"type": "Point",<br />
"coordinates": [<br />
2.2963866591453552,<br />
48.873548644370125<br />
]<br />
}<br />
}<br />
]<br />
}<br />
</mapframe><br />
<pre><br />
Deploying a team for possible package seizure.<br />
<br />
Once the location is secured and package examined, onsite examination will be possible.<br />
<br />
WARE will not allow package to leave the location. Taking pictures will be permitted.<br />
<br />
Confirmation of Location: At the entrance of the Passage du Souvenir, Near the stairs, Paris<br />
<br />
Confirmation of Time: Between 1pm and 3pm, local time<br />
</pre>[[File:Hexaflexagons river.jpg|thumb|The finished hexaflexagon map]]<br />
At the Tomb of the Unknown Soldier, a monument in the Passage du Souvenir beneath the Arc de Triomphe de l'Étoile in Paris, players were given another hexaflexagon paper puzzle and told not to un-tape it. When aligned with the other three pieces, this revealed a location marked with an X at the Louvre.<br />
<br />
The text from the Pastebin found in the Foxtrot stage were clues on the correct route to follow inside the Louvre. The rest of the path led players to the sarcophagus of Ramesses III, on the side of which they found a depiction of <code>The Book of Amduat</code>. Sending this to the email yielded the key to sub-wallet GOLF.<br />
<br />
==Hotel==<br />
The parchment in <code>The Book of Amduat</code> can be found in the <code>British Museum London</code>, which was the keyphrase that unlocked sub-wallet HOTEL.<br />
<br />
The next Task Manager and Document updates read: [[File:Journal_London.png|thumb|Journal London]]<br />
<pre><br />
Locked briefcase found in London, near the British Museum. Not yet confirmed if Mr. Zheng left it there willingly. Package currently under observation.<br />
</pre><br />
<pre><br />
They were right.<br />
It's all leading here.<br />
<br />
I saw it at night.<br />
i had it in my hands. All the missing parts. For the first time, I felt like all was finally put in place. Then, I felt a powerful force, ripping it from my hands. I dropped it and all the pages flew away in the wind.<br />
<br />
I remember the morning that came after.<br />
I was standing tall, pointing at the former naval person, longing for all this knowledge that got away.<br />
<br />
I need to find its missing pieces.<br />
</pre><br />
<br />
==India==<br />
The phrase <code>former naval person</code> is the signature Winston Churchill used in his private correspondence with President Roosevelt. The text describes standing tall pointing at him. This was deduced to be Big Ben, which faces the Churchill statue in Parliament Square, London. Sending <code>Big Ben</code> to the email address provided the key to withdraw the funds from sub-wallet INDIA.<br />
<br />
A third live drop was announced to be in London:<br />
<pre><br />
Deploying a team for possible package seizure.<br />
<br />
Once the location will be secured and package examined, onsite examination will be possible.<br />
<br />
WARE will not allow package to leave the location. Taking pictures will be permitted.<br />
<br />
Confirmation of Location: Statue of Winston Churchill, Parliament Square, London<br />
<br />
Confirmation of Time: Between 1pm and 3pm, local time<br />
</pre><br />
<br />
==Juliett - London Live Drop==<br />
[[File:Thinker.jpg|thumb|The Thinker sculpture in Detroit]]<br />
On April 29th at 13:00 local time, players met with a W/ARE technician in London and were given a scrambled picture of the "The Thinker" sculpture by Auguste Rodin, displayed at the Detroit Institute of Arts Museum. The keyphrase <code>Henry Fuseli, The Nightmare, 1781</code>, a painting found at the same museum, provided the code for sub-wallet JULIETT.<br />
<br />
This unlocked three new postcards in the Documents section.<br />
<center><gallery><br />
Postcard1 jhlj039u.jpg |(Postcard 1)<br />
Postcard2_kg8nao6.jpg|(Postcard 2)<br />
Postcard3_tesaud636.jpg|(Postcard 3)<br />
</gallery></center><br />
<br />
==Kilo==<br />
The locations pictured on the postcards were in Mexico, Peru, and Morocco. Each postcard mentioned two numbers and two cardinal directions, and combining these led to a string of coordinates: <code>33N, 43E - 30N, 69E - 22N, 79E</code>, which were found to be in Iraq, Pakistan, and India. Connecting these six locations by lines pointed to Egypt.<br />
<br />
The circled letters on the postcards spelled <code>monastery</code>, <code>king</code>, and <code>tonw</code>. Using these clues, players found <code>Deir el-Medina</code>, an Egyptian village whose name translates to "monastery of the kings". The village's name unlocked sub-wallet KILO.<br />
<br />
At 2:38 PM a new Journal page was revealed:[[File:Nightmare.jpg|thumb|Nightmare journal page]]<br />
<pre><br />
'Alights, and grinning<br />
<br />
I saw it again.<br />
<br />
Except this time, what snatched it from my hands was not a divine force but the unmistakable pull of this stippled incubus.<br />
<br />
'Alights, and grinning<br />
<br />
He glared at me,<br />
as he ripped all the pages before my horrified eyes.<br />
<br />
I felt his weight on my chest.<br />
<br />
xxxx?<br />
</pre><br />
It quotes excerpts from Ermasus Darwin's poem "Botanical Garden", which is an inscription found on the "The Nightmare" painting referenced in the JULIETT phase, engraved by Thomas Burke in 1783.<br />
<br />
Then, the next Task Manager update announced another live drop:<br />
<pre><br />
Briefcase found in London still locked but deemed safe by our experts. Once the location will be secured and package examined, onsite examination will be possible.<br />
<br />
WARE will not allow package to leave the location. Taking pictures will be permitted.<br />
<br />
Confirmation of Location: British Museum, London<br />
<br />
Estimated Time : Between 6pm and 8pm, local time<br />
</pre><br />
<br />
==Lima - 2nd London Live Drop==<br />
[[File:Box01.jpg|thumb|The locked box]]At the second live drop in London, players were given a small box locked with a 4-digit code. The key was <code>1783</code>, the year "The Nightmare" was engraved.<br />
<br />
Inside the box were three paper notes:<br />
<br />
<center><gallery><br />
Box02.jpg|(arbu = irbu, seru = saru)<br />
Box03.jpg|(Wolf = violent ennemy/Fox, the ennemy will not attack but will plot secretly)<br />
Box04.jpg|(Vomiting gold/silver = ten months, Golden trees/ghosts/demons = nine months)<br />
</gallery></center><br />
<br />
These notes reference ancient texts about dream interpretation. One of them is the Egyptian <code>Ramesside dream-book</code>, the code that unlocked sub-wallet LIMA.<br />
<br />
==Conclusion==<br />
[[File:Requestsupplies.jpg|thumb|The Request Supplies form]]At 17:18 the status command updated:<br />
<pre><br />
CODE -5<br />
Monarch Repository : Data Loss Imminent<br />
ReBooting Command.Center.v12<br />
</pre><br />
The [http://extranet.ware-tech.cloud/supplyrequest Request Supplies section] on the extranet was now accessible, revealing a "Specific Item Order Form". In addition to Arnaud Lacours' name, his employee ID <code>43617373696e69</code> was already filled in. Converted from HEX to ASCII this code translates to <code>Cassini</code>. Entering the ID into the console yields the following output:<br />
<pre><br />
LOG RECOVERED :: ITERATION #4924A ::<br />
The asteroid field was thick,<br />
denser than any I'd seen before.<br />
The ice, the dirt, the metal fragments…<br />
my ship never stood a chance.<br />
</pre><br />
[[File:Subject1.png|thumb|Subject1 image]]<br />
<br />
Another Status update followed at 17:33:<br />
<pre><br />
CODE -5<br />
Monarch Repository : Data Loss Imminent<br />
ReBooting Command.Center.v12<br />
------<br />
Error, unable to start<br />
https://i.imgur.com/Fnixw9t.png<br />
------<br />
New command updated<br />
</pre><br />
It linked to an image with the headline <code>SUBJECT1</code> and a section named <code>MEMORY FRAGMENTS</code>.<br />
<br />
The search for Mr. Zheng concluded with a message from the @WARE_RDev Twitter account:<br />
[[File:WARE_Tweet_Zheng.jpg|thumb|center|400px|WARE_RDev Tweet]]<br />
<br />
=Dev Kit Contest Final Stage=<br />
[[File:Voteemail01.jpg|thumb|150px|Dev Kit Contest email]]On May 4th, 2018 at 22:15 UTC, users subscribed to the W/ARE mailing list started receiving the next Developer Kit Update. It announced that 10 out of 682 submissions were selected as finalists to the contest, and the public community vote was opened at [http://devkit.ware-tech.cloud/ devkit.ware-tech.cloud]. The email also mentioned No Man's Sky as one of W/ARE's partnered games.<br />
<br />
<br />
The following six winners of the contest were announced via email on May 12th at 00:20:<br />
<br />
# [http://terraformed.austinmccarthy.com/ Summon Studios - Terraformed] and [https://stellar-software.cloud/ Stellar Software - Beyond the Stars]<br />
# [http://spectrumental.net Spectrumental Games - Supersensory]<br />
# [https://csd-games.com/ CSD Games - Tumbleweed]<br />
# [http://imperiuminteractive.com/ Imperium Interactive - Eden]<br />
# [https://gamedetectives.net/delve Game Detectives - Delve]<br />
<br />
=Update on Arnaud's Condition=<br />
On the 12th of May at 20:21 UTC, the status command was updated: <br />
<pre><br />
CODE -5 <br />
Command.Center.v12 crashed<br />
------ <br />
Global Network Scan started....<br />
Warning: Files locked by Monarch<br />
- dreamscape.exe<br />
- soundflex.exe<br />
- inyourmind.exe<br />
- Jeu_Capture_d_Ecran.jpg<br />
</pre><br />
One of the files "Jeu_Capture_d_Ecran.jpg" was then found an Arnaud's [http://www.philojeux.com/ site], a transcription of the image is as follows:<br />
<pre><br />
Dear "Tablettes de Mnémosyne" fans,<br />
<br />
A lot of you recently inquired about Arnaud's health and, as you endlessly supported him during the early development of Philojeux, we think it's fair for you to know what's going on. Arnaud has been very sick lately and his condition's decline lead to a loss of consciousness. He has been transported to urgent care at Montreal's Hotel-Dieu where his vital signs are being closely monitored. We hope you understand that the launch of "Tablettes de Mnémosyne" is indefinitely postponed.<br />
<br />
Please send all words of encouragement to Arnaud's family at fondationarnaudlacours@gmail.com<br />
</pre><br />
Upon emailing the address, the following response was received: <br />
<pre><br />
Thank you for reaching out to the Arnaud Lacours’ Foundation. All<br />
words of encouragement will be forwarded to Mr. Lacours’ family.<br />
<br />
<br />
Géraldine Nadeau<br />
Arnaud Lacours’ Foundation<br />
Hotel Dieu Hospital Research Institute<br />
438-368-9126<br />
</pre><br />
When the phone number was called, a [https://cdn.blacksite.games/waking-titan/foundation-message.mp3 voice mail] was played. A transcription of the voice mail is as follows: <br />
<pre><br />
You've reached Dr. Geraldine Nadeau, head of the Arnaud Lacours Foundation. Mr. Lacours' family thanks you for your support during these terrible events, and encourages you to always be cautious and critical in the face of the unknown. As Arnaud himself would say, "history comes from memory." You're invited to use the foundation's e-mail to share your words of encouragement with the family. Thank you for calling.<br />
</pre><br />
"History comes from memory" was found to be a riddle referencing Clio (the "Muse" of history), the daughter of Mnemosyne (the Goddess of memory). Upon emailing the word "Clio" to the address, the following response was received:<br />
<pre><br />
Thank you so much for returning my message. I need every helpful hand I can get.<br />
<br />
I figured, by the efforts you’ve put into contacting me, that you’ve got a high interest in Arnaud’s case. I’ve been monitoring him since nearly a month ago and I would be lying if I told you it doesn’t keep me awake at night. His condition is nothing like I’ve ever seen. His brain activity is insanely high, but he’s completely non-responsive.<br />
<br />
Not too long after I was informed of Arnaud’s condition, I was visited by a man claiming to work for a highly advanced tech company, specializing in unconscious experiences. He has been incredibly interested in Arnaud’s case as well as in my recent studies on sleeping patterns. I gave him some information on my research into lucid dreaming methods and he went on his way. I’ve never seen him again.<br />
<br />
Since then, I’ve been focused on gathering more information about W/ARE, their technology and their processes. I’ve noticed that Arnaud advertised them on his professional website but I don’t know the depth of his involvement with them. I figured that any person interested by the correlation between W/ARE and Arnaud would find the message I left there. I’ve put the Foundation in place as a cover to not arouse suspicion.<br />
<br />
I have so many questions and Zheng’s not answering my calls. All he gave me is the list of his company’s research labs as well as one totally incomprehensible file. I need to get to know more about W/ARE. If you know this man, if you can get any opening into this company’s motives, please help me. For Arnaud’s life and potentially many others.<br />
<br />
<br />
Géraldine<br />
</pre><br />
One of the sentences linked to a [https://www.dropbox.com/sh/6i6f2cipfd901bj/AAAUwOSxECU0l4tvZa4DSPBra?dl=0 Dropbox folder] that contained two images. The meaning of the images is unknown.<br />
<br />
==Zheng's Note==<br />
One of the images, titled [https://www.dropbox.com/sh/6i6f2cipfd901bj/AAAUwOSxECU0l4tvZa4DSPBra?dl=0&preview=Zheng%27s+note.jpg Zheng's Note], contained what at first appeared to be gibberish. However, when every other letter is taken the following text is revealed:<br />
<pre><br />
Test subjects have been called in and the device has been used on them in ways that i could never condone 7 of them lost as we speak 3 of them are dead 8 are on the verge of being unrecoverable their intentions are not what we think they are actions should be taken to shut them down exit<br />
</pre><br />
The letters that were not used in the message appear to be the words <code>Lucid Dream</code> repeating until the end of the message.<br />
<br />
==WARE Labs==<br />
The second image, titled [https://www.dropbox.com/sh/6i6f2cipfd901bj/AAAUwOSxECU0l4tvZa4DSPBra?dl=0&preview=WARE+Labs.jpg WARE Labs] contains data concerning six research labs owned by WARE across the world. The transcription of the data is as follows:<br />
<pre><br />
0:<br />
Boston Research Lab<br />
Lab Director: Richard Wilkes<br />
Project name: we-2-3 / tm-1-lt / tr-10-ae<br />
<br />
Project description: 0000100001<br />
Project code: # 4-3<br />
Lab sequence 10-3<br />
<br />
1:<br />
Sacremento Research Lab<br />
Lab Director: Helga Johnson<br />
Project name: st-1-dn / ss-4-bn<br />
<br />
Project description: 0001010000<br />
Project code: # 1-2<br />
Lab sequence: 4-6<br />
<br />
2:<br />
Seoul Research Lab<br />
Lab Director: Yu Hyo<br />
Project name: ue-2-is / as-6-be<br />
<br />
Project description: 0100000011<br />
Project code: # 1-2-1<br />
Lab sequence: 9-1-13<br />
<br />
3: <br />
Beijing Research Lab<br />
Lab Director: Wang Jie<br />
Project name: st-1-dn / bg-1-tr<br />
<br />
Project description: 0001000000<br />
Project code: # 4<br />
Lab sequence: 8<br />
<br />
4: <br />
Prague Research Lab<br />
Lab Director: Adriana Dvorak<br />
Project name: ae-4-sd / of-5-ue<br />
<br />
Project description: 0100101000<br />
Lab code: # 10-3-4<br />
Lab sequence: 2-5-12<br />
<br />
5: <br />
Berlin Research Lab<br />
Lab Director: Georg Muller<br />
Project name: dd-1-ae / dn-2-()<br />
<br />
Project description: 001000001<br />
Lab code: # 2-3<br />
Lab sequence: 7-11<br />
</pre><br />
Each of the letter pairs in the project name field represented a first and last letter of a word in the decoded Zheng's note. <code>3</code> and <code>()</code> represent the word <code>three</code> and the end of the message, respectively. Then the sequence that fit those words needed to be found, so for example, <code>dd-1-ae</code> would be the words <code>dead 8 are</code> in Zheng's note. Using this method, the following sequences were found:<br />
<pre><br />
we speak 3 / them are lost / their intentions are<br />
shut them down / subjects have been<br />
unrecoverable their intentions / actions should be<br />
shut them down / being unrecoverable their<br />
are actions should / of being unrecoverable<br />
dead 8 are / down exit <br />
</pre><br />
The middle number was then found to represent which letter of the middle word was important, as it was always less than the character count of the middle word. Taking each letter indicated by the middle number the string <code>paste hdtuig8x</code> was given, which was found to represent a [https://pastebin.com/hdtuig8x pastebin] link. The pastebin link then led to [https://www.dropbox.com/sh/n675hwdwhik5rg5/AABfjT9UDSFGeGmk2clRYLI_a?dl=0 another dropbox folder titled "Client - 43617373696e69"] that contained 4 PDF files relating to Arnaud's incident. The PDFs provided datadumps from the dreamscape, soundflex, and inyourmind processes before they all failed:<br />
<br />
'''Dreamscape''':<br />
<br />
* [https://www.dropbox.com/s/ln1beuxoo4ig992/m1.jpg?dl=0 m1 - successful]<br />
<br />
* m2 - failed<br />
<br />
* [https://www.dropbox.com/s/touiwi6qhneg8hs/m3.jpg?dl=0 m3 - successful]<br />
<br />
* [https://www.dropbox.com/s/9wcxup3ka5zzrl2/m4.jpg?dl=0 m4 - corrupted]<br />
<br />
* [https://www.dropbox.com/s/cl17kp9kri6i1t8/m5.jpg?dl=0 m5 - successful]<br />
<br />
* m6 - failed<br />
<br />
* [https://www.dropbox.com/s/e4olmlc3yy4vnqf/m7.png?dl=0 m7 - successful]<br />
<br />
'''Soundflex''':<br />
<br />
* [https://clyp.it//m2t5s3ns s1 - successful]<br />
<br />
* [https://clyp.it//sxrz4spl s2 - successful]<br />
<br />
* [https://clyp.it/deihb43e s3 - corrupted]<br />
<br />
'''Inyourmind''': [https://www.dropbox.com/sh/n675hwdwhik5rg5/AABfjT9UDSFGeGmk2clRYLI_a?dl=0&preview=Client+-+43617373696e69-1.pdf >>>]<br />
<br />
The rest was solved, and a second pastebin found by splitting Zheng's note into 6 rows of 10 words like so:<br />
<pre><br />
Test subjects have been called in and the device has<br />
been used on them in ways that I could never <br />
condone 7 of them are lost as we speak 3<br />
of them are dead 8 are on the verge of <br />
being unrecoverable their intentions are not what we think they<br />
are actions should be taken to shut them down exit<br />
</pre><br />
From there, the binary values in <code>Project description</code> were used to pick out words:<br />
<pre><br />
0000100001 - called has<br />
0001010000 - them ways<br />
0100000011 - 7 speak 3<br />
0001000000 - dead<br />
0100101000 - unrecoverable are what<br />
001000001 - should exit<br />
</pre><br />
Then <code>Project code</code> was used to pick out letters from each word:<br />
<pre><br />
called has | 4-3 = ls <br />
them ways | 1-2 = ta<br />
7 speak 3 | 1-2-1 = 7p3<br />
dead | 4 = d<br />
unrecoverable are what | 10-3-4 = aet<br />
should exit | 2-3 = hi<br />
</pre><br />
<code>Lab sequence</code> was then used to determine the order of the letters:<br />
<pre><br />
ls = 10-3 - l and s are letters ten and three respectively<br />
ta = 4-6 - t and a are letters four and six respectively<br />
7p3 = 9-1-13 - 7, p and 3 are letters nine, one and thirteen respectively<br />
d = 8 - d is the eighth letter<br />
aet = 2-5-12 - a, e and t are letters two, five and twelve respectively<br />
hi = 7-11 - h and i are letters seven and eleven respectively<br />
</pre><br />
Reordered the following string was obtained: <code>paste ahd7lit3</code><br />
This was the link to a second [https://pastebin.com/ahd7lit3 pastebin]. The pastebin linked to a second [https://www.dropbox.com/sh/nebk9ukhnnt3mkk/AABTaLwSSRyYBcWvDhJVDJfaa?dl=0 dropbox titled "Archives"]. The folder contains six images of what appear to be WARE customer support logs.<br />
<br />
=Myriad Status Update=<br />
On the 13th of May at 18:29 UTC Myriad's [http://www.myriad-70.com/status/ status page] was updated. A diff of the change can be found [https://www.diffchecker.com/4g9xfrbN here]. The only change was the network diagnostic table, which now says the following:<br />
<pre><br />
Latest network diagnostic table:<br />
- Client 3597b’s resources redirected <br />
- 3597b-1-2-1 has been shut down<br />
- Additional resources allocated to 3597b-4<br />
</pre><br />
<code>3597b-1-2-1 has been shut down</code> seems to imply that the Seoul Research Lab has been shut down, <code>Additional resources allocated to 3597b-4</code> seems to indicate that the Beijing Research Lab is now receiving additional resources. Two hours before this status change, at 4:02 PM UTC WARE [https://twitter.com/warecloud/status/995710781168726018 tweeted] about the arrival of 40 new employees to their Beijing Research Lab. It is possible that the tweet and status update are connected.<br />
<br />
=Dev Kit Shipping Updates=<br />
On May 15, 2018 at 19:20 UTC, winners of the W/ARE development contest received an update on the status of their dev kit deliveries. A link inside the email led to a form, indicating that the package was currently located in Beijing, contained 1 Dev Kit, and weighed 1.80 kg, and requesting confirmation from each of the winners that the package belonged to them.<br />
{| class="wikitable" border="1" width="60%"<br />
|-<br />
! scope="col" style="width: 50%;" |Email<br />
! scope="col" style="width: 50%;" |Form<br />
|-<br />
| Dear Customer,<br />
<br />
A package was shipped to you via W/ARE Shipping Service.<br />
<br />
Confirmation that you are indeed the receiver is required.<br />
<br />
Please follow this link to confirm your identity.<br />
<br />
Kind regards,<br />
W/ARE tech<br />
<br />
This is an automated message, please do not respond.<br />
| [[File:Devkitshipping01.PNG|400px|Shipping confirmation form 1]]<br />
|}<br />
<br />
A second update followed the next day at 23:54 UTC. The status of the package had changed to confirm it was now located in Seoul, was held in transit for 460 minutes, and had been reduced in weight to 0.50 kg.<br />
{| class="wikitable" border="1" width="60%"<br />
|-<br />
! scope="col" style="width: 50%;" |Email<br />
! scope="col" style="width: 50%;" |Form<br />
|-<br />
| Dear Customer,<br />
<br />
Your W/ARE package is currently leaving Seoul to be redirected to its new transit location. <br />
<br />
Confirmation that you are indeed the receiver is required.<br />
<br />
Please follow this link to confirm your identity.<br />
<br />
Kind regards,<br />
W/ARE tech<br />
<br />
This is an automated message, please do not respond.<br />
| [[File:Devkitshipping02.PNG|400px|Shipping confirmation form 2]]<br />
|}<br />
<br />
=Terminal Status Update and Precon007=<br />
On May 15th at 21:48 UTC, players discovered that the status command had updated.<br />
<pre><br />
CODE -5 <br />
Command.Center.v12 crashed <br />
------ <br />
New memo received<br />
http://bit.ly/2IHPmMN<br />
</pre><br />
The [http://bit.ly/2IHPmMN bit.ly link] lead to a new memo from Major Sophie Dubois to Elizabeth Leighton. The memo was titled <code>Ware Report #26</code>. It mentions that many users stuck in "the system" show major side effects after being disconnected, from brain damage to death. It is presumed that this system has something to do with the WARE headset, however it is unknown what they are specifically referring to. It is also mentioned that the impact on Myriad has damaged Emily/Loop16's communication and precognition functions. Alongside this another command is mentioned in the memo. <code>precon007</code>. The output for the command is the following:<br />
<pre><br />
PRECON DATA DUMP 01<br />
http://bit.ly/2rJi6uJ<br />
http://bit.ly/2GkZnu5<br />
http://bit.ly/2rJBO9Z<br />
http://bit.ly/2L2fwbe<br />
</pre><br />
The bit.ly links were all links to images, much of them completely indistinguishable, however the first appears to be some sort of document with most/all of the information blocked out, and the second depicts an image similar to the one discovered by players on April 14th. The third appears to be the box for a W/ARE devkit, and the fourth is almost completely indistinguishable and unknown. Players speculated that it is a pyramid hologram display. Embedded in each image was a string of hex:<br />
<gallery mode="packed-hover" widths=240px heights=240px><br />
Image:Precon-01.jpg|Precon image 1<br />
Image:Precon-02.jpg|Precon image 2<br />
Image:Precon-03.jpg|Precon image 3<br />
Image:Precon-04.jpg|Precon image 4<br />
</gallery><br />
<pre><br />
Image 1 - 65 74 61 20 75 6e 6b 6e 6f 77 6e - eta unknown<br />
Image 2 - 65 74 61 20 6d 61 79 20 31 38 2d 31 39 - eta may 18-19<br />
Image 3 - 49 73 20 4c 20 50 6c 61 79 73 20 47 61 6d 69 6e 67 20 72 69 67 68 74 3f - Is L Plays Gaming right?<br />
Image 4 - 65 74 61 20 75 6e 6b 6e 6f 77 6e - eta unknown<br />
</pre><br />
<br />
=Book Deliveries=<br />
On May 16th 2018, several members of the No Man's Sky community started receiving physical books in the mail:<br />
<br />
* The Conscious Mind: In Search of a Fundamental Theory by David J. Chalmers, received by CobraTV<br />
* The Dramaturges of Yan by John Brunner, received by [https://twitter.com/nevadander/status/996839681345183744 Nevadander]<br />
* From Bacteria to Bach and Back: The Evolution of Minds by Daniel C. Dennett, received by Tony_Towers<br />
* Meditations on First Philosophy by Rene Descartes, received by UnimatrixZeroOne<br />
* Nine Tomorrows by Isaac Asimov, received by [https://twitter.com/Galactic_Geo/status/997215352932061184 Galactic_Geo]<br />
<br />
=Glyphs 11-15=<br />
On May 17 2018, the last five glyphs on [https://wakingtitan.com/ the Waking Titan website] activated. Currently, none of these glyphs have any hints or backgrounds associated with them. This is in contrast to the previous glyphs, each of which had a link to something that hinted at what needed to be solved, as well as their own background when the glyph was clicked/opened.<br />
<br />
=Myriad Status and Precon Update=<br />
On May 18th at 20:15 UTC Myriad's status page was updated.<br />
<pre><br />
Latest network diagnostic table:<br />
- command.center.satcom updating<br />
- Client 3597b’s resources redirected <br />
- 3597b-1-2-1 has been shut down<br />
- Additional resources allocated to 3597b-4<br />
</pre><br />
Alongside this network diagnostic table update, the "On the ground speed" averages also updated:<br />
<pre><br />
Manhattan: 0.2Tb/s<br />
London: 0.7Tb/s<br />
Tokyo: 0.5Tb/s<br />
Beijing: 55.1Tb/s<br />
</pre><br />
The <code>precon007</code> command in the Waking Titan [http://wakingtitan.com/ Terminal] was also changed.<br />
<pre><br />
PRECON DATA DUMP 01<br />
[x]<br />
http://bit.ly/2GkZnu5<br />
http://bit.ly/2rJBO9Z<br />
http://bit.ly/2L2fwbe<br />
</pre><br />
The first bit.ly link that had previously led to an image of what appeared to be a redacted document was removed and replaced by <code>[x]</code>.<br />
<br />
=Loop16 Command Updated=<br />
On May 18th at 23:40 UTC it was discovered that the response for the command <code>loop16</code> in the Waking Titan Terminal had changed.<br />
<pre><br />
Processing <br />
UTC : 11:45pm <br />
UTC : 12:00am <br />
UTC : 12:15am <br />
UTC : 12:30am <br />
UTC : 12:45am <br />
UTC : 01:00am <br />
UTC : 01:15am<br />
</pre><br />
Once the clock had struck 11:45 PM UTC, the command updated again:<br />
<pre><br />
Processing <br />
UTC : 11:45pm http://bit.ly/2KADObl<br />
UTC : 12:00am <br />
UTC : 12:15am <br />
UTC : 12:30am <br />
UTC : 12:45am <br />
UTC : 01:00am <br />
UTC : 01:15am <br />
</pre><br />
The [http://bit.ly/2KADObl link] led to an image of what appears to be a constellation. Following this, the command proceeded to update every 15 minutes, each time adding a different link.<br />
{|class="wikitable"<br />
! Time (UTC)<br />
! Link<br />
! Constellation<br />
! Missing Star<br />
|-<br />
|11:45pm<br />
|http://bit.ly/2KADObl<br />
|Bootes<br />
|Arcturus<br />
|-<br />
|12:00am<br />
|http://bit.ly/2wRXnKl<br />
|Carina<br />
|Canopus<br />
|-<br />
|12:15am<br />
|http://bit.ly/2IAuoMk<br />
|Pegasus<br />
|Scheat<br />
|-<br />
|12:30am<br />
|http://bit.ly/2rSv1L1<br />
|Ursa Major<br />
|Dubhe<br />
|-<br />
|12:45am<br />
|http://bit.ly/2wRXu8J<br />
|Scorpius<br />
|Antares<br />
|-<br />
|1:00am<br />
|http://bit.ly/2wTwVjl<br />
|Canis Minor<br />
|Procyon<br />
|-<br />
|1:15am<br />
|http://bit.ly/2rTwIqN<br />
|Lyra<br />
|Vega<br />
|}<br />
<gallery mode="packed-hover" widths=240px heights=240px><br />
Image:Bootes.jpg|Boötes, missing the star Arcturus.<br />
Image:Carina.jpg|Carina, missing the star Canopus.<br />
Image:Pegasus.jpg|Pegasus, missing the star Scheat.<br />
Image:Ursa_Major.jpg|Ursa Major, missing the star Dubhe.<br />
Image:Scorpius.jpg|Scorpius, missing the star Antares.<br />
Image:Canis_Minor.jpg|Canis Minor, missing the star Procyon.<br />
Image:Lyra.jpg|Lyra, missing the star Vega.<br />
</gallery><br />
Around the same time as the command began updating, players discovered a Reddit account named [https://www.reddit.com/user/satcom-70 satcom-70], who had posted a [https://www.reddit.com/r/NoMansSkyTheGame/comments/8kfrj2/commandcentersatcom_cid_185/ thread] titled <code>command.center.satcom - CID 185</code> on the No Man's Sky subreddit. The name of the user was also found to be a part of a [http://satcom-70.com/ URL] which led to the Command Center. The only text displayed on the website at the time was <code>COMMAND.CENTER.V12 CRASHED</code>. This lined up with the output of the <code>status</code> command in the Waking Titan terminal.<br />
<br />
On the 19th of May, the Reddit post was updated to contain a [https://i.imgur.com/angJPlX.jpg hint] to the puzzle. Upon finding this hint, players realized that they needed to reorder the stars according to their background color. After this, the stars were numbered 1-7. That number told players which letter out of each star name to use in order to get <code>ANNAETN</code>, an anagram for <code>ANTENNA</code>, which gave a new [https://s3.amazonaws.com/cdn.wakingtitan.com/comroute/141t6.jpg image] when put into the Waking Titan terminal.<br />
<br />
When unscrambled, the following text was revealed on the image:<br />
<pre><br />
Reconstructing language database<br />
Protocol<br />
bit.ly/2KEkJVF<br />
Comment with filename of Wikipedia DB ending with D97C0<br />
</pre><br />
Then, the Wikipedia database with the filename <code>D567CE8E2EC4792A99197FB61DEAEBD70ADD97C0</code> was found. The name was commented on the post, then the post was edited to the following:<br />
<pre><br />
D567CE8E2EC4792A99197FB61DEAEBD70ADD97C0 - Valid . Command updated - Erpbirel . System entering standby . CR now loading satcom-70.com . Support instructions: igS4Tzd6<br />
</pre><br />
The [http://satcom-70.com/ satcom-70] website was updated. <code>Erpbirel</code> was a terminal command for Waking Titan that led to an [http://cdn.wakingtitan.com/9f57789f-a706-4006-a314-92a8029dce4e-.jpg image]. The second part, <code>Support instructions: igS4Tzd6</code>, was found to be a part of the URL for a [https://pastebin.com/igS4Tzd6 pastebin link]. The text of the pastebin was as follows:<br />
<pre><br />
Vocal reconstruction database required<br />
Source: Wikipedia (any article)<br />
Length: 1 sentence<br />
Format: MP3 audio<br />
Minimum samples : 100<br />
Minimum languages: 5<br />
Minimum unique voices: 33<br />
Sample origin: Homo sapiens<br />
Upload instructions: Submit all samples in a single message to u/satcom-70<br />
Deadline : Tuesday May 22nd, 10am eastern time<br />
</pre><br />
<br />
=Dev Kit Delivery=<br />
On May 21, 2018, winners of the W/ARE development contest started receiving their dev kits in the mail. Each package contained:<br />
* A letter to Arnaud requesting that a picture with results be emailed to Dr. Nadeau. This included a W/ARE Tech medical procedure slip<br />
* A plastic holographic pyramid, designed to display "3D Holograms" using a phone<br />
* A phone and a charger<br />
** Skype was installed on the phone and the required login details were found in a notes app. The Skype contacts listed each of the other winning dev studios as a "Point of Contact" (PoC)<br />
** The phone included an app called <code>Myriad Uplink</code> that can also be accessed at [http://uplink.satcom-70.com/ uplink.satcom-70.com]<br />
** Different audio files were found on each of the phones, transcribed below:<br />
<br />
<center><br />
{|class="wikitable"<br />
! scope="col" style="width: 16%;" |Stellar Software - PoC #1<br />
! scope="col" style="width: 16%;" |Imperium Interactive - PoC #2<br />
! scope="col" style="width: 16%;" |Spectrumental Games - PoC #3<br />
! scope="col" style="width: 16%;" |Summon Studios - PoC #4<br />
! scope="col" style="width: 16%;" |CSD Games - PoC #5<br />
! scope="col" style="width: 16%;" |Game Detectives - PoC #6<br />
|-<br />
|1 - "W/ARE Tech support, how can I help you?" [https://clyp.it/hpbypwo5 Audio file]<br />
|1 - "Uhm, ten hours tops. This is very unusual to me." [https://clyp.it/1gkv0aog Audio file]<br />
|1 - "You said you went to sleep immediately after taking your medication?" [https://clyp.it/cirija3q Audio file]<br />
|1 - "No, on my computer." [https://clyp.it/qhcdx2jr Audio file]<br />
|1 - "On your W/ARE device?" [https://clyp.it/f5cuzm2e Audio file]<br />
|1 - "I started a new game, played a bit, and went to bed after." [https://clyp.it/zn2wl5tg Audio file]<br />
|-<br />
|2 - "Thank you for taking the time to update us on your condition. I see that you've ordered some of our exclusive blood thinners, did you follow the prescription instructions?" [https://clyp.it/rihvc0w2 Audio file]<br />
|2 - "Hello, uhm... I would like to have a follow-up on an incident related to your headset." [https://clyp.it/hcdex55q Audio file]<br />
|2 - "Thank you for choosing W/ARE!" [https://clyp.it/czag350m Audio file]<br />
|2 - "6 - E - 6 - 9?" [https://clyp.it/shmwas3t Audio file]<br />
|2 - "I see you already emailed our department yesterday about the same inquiry. Do you still suffer from the previously mentioned symptoms?" [https://clyp.it/njpp1sit Audio file]<br />
|2 - "I never used them. This morning, though, my body feels incredibly stiff. Should I have taken them?" [https://clyp.it/i4lqxrlz Audio file]<br />
|-<br />
|3 - "Were your sleeping patterns the same as usual?" [https://clyp.it/hreqcs5s Audio file]<br />
|3 - "Right side mostly, arms and legs." [https://clyp.it/nifdnptq Audio file]<br />
|3 - "Excuse me sir, I need to verify something. I'll be back in a moment. [music box recording of "La Vie En Rose" plays as hold music]" [https://clyp.it/zzldfrb3 Audio file]<br />
|3 - "Alright, thank you very much." [https://clyp.it/k1u0atix Audio file]<br />
|3 - "Can you identify where this feeling is coming from?" [https://clyp.it/1v5yjeuf Audio file]<br />
|3 - "I slept a lot, actually." [https://clyp.it/shes3jgj Audio file]<br />
|-<br />
|4 - "Thank you for your patience. I relayed a quick recap of your symptoms to our internal specialist, and your condition seems to be related to a mild case of brain fatigue. We suggest you take pauses between play sessions so your mind relaxes. If your symptoms persist, we suggest you consult a health specialist to make sure you don't have any underlying conditions that could interfere with the headset's performance." [https://clyp.it/arezqg4x Audio file]<br />
|4 - "Actually, I took an Aspirin, went to bed, and it disappeared over night." [https://clyp.it/al5i4bpv Audio file]<br />
|4 - "I'm very sorry you experience discomfort using your device. Can you please give me the last four characters of your client number?" [https://clyp.it/wfckrukr Audio file]<br />
|<br />
|4 - "Do you have an approximate amount of time?" [https://clyp.it/csvxb0qh Audio file]<br />
|}<br />
</center><br />
<br />
<gallery mode=packed widths=240px heights=240px><br />
Image:Devkitcontents01.jpg|Complete contents of the package<br />
Image:Devkitcontents02.jpg|Phone homescreen<br />
Image:Devkitcontents03.jpg|Myriad Uplink app<br />
Image:Devkitcontents04.jpg|Medical procedure slip<br />
</gallery><br />
<br />
==Skype Messages==<br />
On May 22 around 19:00 UTC, the following text messages were received through the Skype app on the phones:<br />
<pre><br />
From: Geraldine Nadeau<br />
<br />
I don't have much time to talk.<br />
Am in contact with Zheng. I may have an opening into WARE's medical docs but i'm not sure yet.<br />
I'll contact you again soon.<br />
<br />
Update on Arnaud's condition:<br />
Vital signs have been very unstable during last week. Heart rate and blood pressure stabilized for two days.<br />
HR: 57-62 bpm<br />
BP: 110 / 70</pre><br />
<pre><br />
From: Mercury Process<br />
<br />
MERCURY PROCESS DIRECTIVE 16.B:<br />
Carefully review the datadump. Send all analyses and findings to mercury@atlas-65.com<br />
</pre><br />
<br />
More messages came in on May 23, 19:30 UTC:[[File:Skypemessages01.jpg|thumb|Skype messages from Dr. Nadeau]]<br />
<pre><br />
From: Geraldine Nadeau<br />
<br />
Thank you so much.<br />
I have been told that W/ARE is on high alert and extremely vigilant right now. They've doubled their security measures and we couldn't get access to their medical documents, but we'll keep trying. I don't know if they are aware of my contact with Zheng.<br />
<br />
If you are willing to help, here's an update on Arnaud's condition.<br />
HR and BP still stable<br />
EEG in high gamma zone at 82<br />
Oxygen levels stabilized at 94%<br />
</pre><br />
<br />
Messages from May 24, 19:43 UTC:<br />
<pre><br />
From: Geraldine Nadeau<br />
<br />
Update on Arnaud's condition.<br />
No change on HR and BP<br />
EEG still in high gamma zone at 87<br />
Examination of body: Slight discoloration of fingertips<br />
<br />
We're getting close to a breach and probably will have something more for you tomorrow.<br />
</pre><br />
<br />
Messages from May 25, 20:56 UTC:<br />
<pre><br />
From: Geraldine Nadeau<br />
<br />
I need your help concerning one of the dev kits. There are two dev kit recipients that I haven't yet been able to make contact with- one of them is still in transit, but the other appears to have arrived at its destination. <br />
<br />
I'm concerned that W/ARE may have intercepted the kit, which would be disastrous considering the risks that we are taking. If you know of another dev kit recipient that I haven't yet been able to contact, can you please forward them this message and ask them to reach out to me?<br />
</pre><br />
<br />
=May 25-26 Updates=<br />
On May 25, 2018 at 21:42 UTC, the output of the <code>STATUS</code> command began to update:<br />
<pre><br />
1. Cassini: Incomplete<br />
2. WT16: Incomplete<br />
3. Uplink: Incomplete<br />
4. Loop16: Processing<br />
<br />
Guidance subroutine checksum ///<br />
31 2e 20 77 61 69 74 69 6e 67 20 69 6e 73 74 72 75 63 74 69 6f 6e 73 20 32 2e 20 31 30 2f 31 35 20 33 2e 20 61 2f 4f 31 4f 73 65 65 42 20 34 2e 20 64 6f 77 6e 6c 6f 61 64 69 6e 67 20 76 6f 69 63 65 20 64 61 74 61<br />
</pre><br />
<br />
The code is HEX and translates to:<br />
<pre><br />
1. waiting instructions<br />
2. 10/15<br />
3. a/O1OseeB<br />
4. downloading voice data</pre><br />
<br />
<code>a/O1OseeB</code> led to an [https://imgur.com/a/O1OseeB album on Imgur] that contains images of items required to make a DIY blacklight, such as purple, blue, and black sharpies, a flashlight, and adhesive tape.<br />
<br />
A new Skype message was received at 22:15 UTC:<br />
<pre><br />
I’m forwarding you the last messages Zheng sent me. Hopefully, you can make sense of it. It kind of looks like a list but I don’t know what it means. <br />
<br />
101 110 116 101 114 32 97 65 116 55 77 51 50 99<br />
<br />
101 110 116 101 114 32 87 114 84 97 119 112 115 113<br />
<br />
101 110 116 101 114 32 90 89 51 70 98 49 49 86<br />
<br />
101 110 116 101 114 32 117 113 56 78 54 89 69 87</pre><br />
<br />
The ASCII numbers translate to the following:<br />
<pre><br />
enter aAt7M32center WrTawpsqenter ZY3Fb11Venter uq8N6YEW<br />
</pre><br />
<br />
These strings were then used to complete four pastebin URLs which contained the following links:<br />
* [https://pastebin.com/aAt7M32c pastebin.com/aAt7M32c] -- https://clyp.it/user/1legrggu<br />
* [https://pastebin.com/WrTawpsq pastebin.com/WrTawpsq] -- https://www.dropbox.com/s/eq8gk5b6axnpoh7/1-2-1_ResearchLab_Medical.pdf?dl=0<br />
* [https://pastebin.com/ZY3Fb11V pastebin.com/ZY3Fb11V] -- https://www.dropbox.com/s/esc95j7ihseujls/1-2-1_ResearchLab_Medical_Exceptions.pdf?dl=0<br />
* [https://pastebin.com/uq8N6YEW pastebin.com/uq8N6YEW] -- https://www.dropbox.com/s/8ddztbyf7bv27bb/1-2-1_ResearchLab_Medical_Recommendations.pdf?dl=0<br />
<br />
The clyp.it audio files seemed to be the missing conversation snippets found on the remaining dev kit phone which had not yet arrived at the time. The PDF files on Dropbox provided information on how to identify and treat Arnaud's condition.<br />
<br />
Based on this information, players sent the following medical instructions to Dr. Nadeau:[[File:Waremedicalprocedure.jpg|thumb|W/ARE Medical Procedure slip]]<br />
# 3 foam pads all around the head<br />
# Defibrillator 500 volts 3 times, wait 30 minutes<br />
# Epinephrine injection, 3 doses<br />
# Mood regulator pills x1 diluted in 20 ml of mineral water<br />
# Play "La Vie En Rose", the last song he listened to, for 45 seconds<br />
# Propofol injection, 1 dose<br />
<br />
In response, the following messages were exchanged on Skype:<br />
<pre><br />
Geraldine Nadeau: Thank you very much. As you and two others devkit holders confirmed similar steps, I’ll assume this is the procedure to follow. Can you confirm, by yes or no, if I apply those steps to Arnaud’s treatment?<br />
<br />
Dev Kit Holders: Yes.<br />
<br />
Geraldine Nadeau: Proceeding to treatment. I’ll update you soon.<br />
</pre><br />
<br />
Shortly after, the <code>STATUS</code> command in the terminal updated again with a change of Cassini's status from <code>Incomplete</code> to <code>Processing</code>.<br />
<br />
On May 26 at 01:24 UTC, a new Skype message was received:<br />
<pre><br />
From: Geraldine Nadeau<br />
<br />
Arnaud is responding positively to treatment, despite the highly unusual procedures. We still don't know the lasting side effects he will keep from these events but he seems to be gradually drifting from a vegetative state to the land of the living. I wanted to thank you from the bottom of my heart for helping me in these conditions.<br />
</pre><br />
<br />
And the status of the Cassini process displayed in the terminal changed again from <code>Processing</code> to <code>Completed</code>.<br />
<br />
==Glyph Passwords==<br />
Another Skype message followed at 01:36 UTC:[[File:Wt-blacklight.jpg|thumb|200px|The book cipher found under a blacklight]]<br />
<pre><br />
From: Mercury Process<br />
<br />
Attention to all involved parties. Please make detailed inspection of your W/ARE package for possible anomalies. Be sure to use appropriate equipment and to document your investigation while broadcasting to involved partners. Thank you for your collaboration.<br />
</pre><br />
<br />
Written on one of the dev kit boxes, <code>180-4-5 171-27-8 40-21-2 70-3-9 268-4-6 180-4-2</code> was found using a blacklight. Used as a book cipher of the format page, line, and word, the phrase <code>He who contains the entire universe</code> was found in CobraTV's copy of the book <code>The Conscious Mind: In Search of a Fundamental Theory by David J. Chalmers</code>. This phrase led players to the Mesopotamian god Anu, who is described as the one "who contains the entire universe". <code>Anu</code> was the password that unlocked Glyph 14 on [http://wakingtitan.com/ wakingtitan.com].<br />
<br />
The command <code>Anu</code> gives the following output in the Waking Titan terminal:<br />
<pre><br />
Marked with honeycomb scars, I am the lowest of the low<br />
</pre><br />
<br />
On another dev kit box, the phrases <code>HIGH UP IN THE DARK</code> and <code>A RISING PANIC</code> were found under the blacklight.<br />
<br />
The passwords for the remaining glyphs 11, 12, 13 and 15 were discovered to be <code>Ouranos</code>, <code>Horus</code>, <code>Nuada</code>, and <code>Triglav</code>, respectively; all of them are sky deities. Used as commands in the terminal, they output the following:<br />
<pre><br />
> Ouranos<br />
uSivrseU<br />
</pre><br />
<pre><br />
> Horus<br />
From my red soil, four times rises Vulcan<br />
</pre><br />
<pre><br />
> Nuada<br />
VCjsyZzA<br />
</pre><br />
<pre><br />
> Triglav<br />
96cdXqpi<br />
</pre><br />
<br />
Each of the strings led to a Pastebin that contained a code:<br />
* Ouranos: https://pastebin.com/uSivrseU - <code>8NuHRIZGacoGgQZiTcCyQQpp1kzRWP3PdN4OUZabxZbPoE0P0RjsrFRiNB0GhOcVdwBSYz0ng8AwlnzYx89msDhGHrLbIUct</code><br />
* Nuada: https://pastebin.com/VCjsyZzA - <code>bYmyFioUHMbLGRI0h8j9ApSY+HkWjD4Wms0i8yPZv3pJj5xp1SJR7HaSOmjBml8cJBG77x5WXaXItYIm2OylFQ==</code><br />
* Triglav: https://pastebin.com/96cdXqpi - <code>2tY7mcPs2A8Z9DarmAnnrKTqph4g+3eOisGtBg3MLGI=</code><br />
<br />
Later, clue 3 in the <code>status</code> command in the Waking Titan terminal had changed to a bit.ly link leading to an About page on [https://www.resilientsystems.com/about-us/incident-response-leadership/ IBM Resilient's website]. It was found that one of the people mentioned on the page, Bruce Schneier, was the developer/designer of an encryption method called [https://en.wikipedia.org/wiki/Blowfish_(cipher) Blowfish], which is a symmetric block key cipher. This turned out the be the decryption method for the hex output of the base64 strings received from the Pastebins. The keys were found by solving the riddles from other glyphs. The glyphs were paired up so that the 12th glyph's terminal command gave the decryption for the 11th glyph, and the 14th glyph's command gave the answer to the 13th glyph. Glyph 15 was the outlier in this, and the riddle that gave its key was found in the 6th W/ARE development kit received by the Game Detectives. The solutions to the riddle were as follows:<br />
<pre><br />
From my red soil, four times rises Vulcan - Tharsis<br />
Marked with honeycomb scars, I am the lowest of the low - Hellas<br />
High up in the dark, a rising panic - Phobos<br />
</pre><br />
<br />
Once decrypted, it was found that the hex then converted properly into ASCII text, and provided more riddles:<br />
<pre><br />
Ouranos - Tharsis - The hills I have conquered honor the lost, who preceded my journey...<br />
Nuada - Hellas - From these hills, I can see the headless horsemans lair...<br />
Triglav - Phobos - With me, came great openings<br />
</pre><br />
<br />
These three riddles are referring to the Spirit rover that landed in the crater Gusev on Mars in 2004. The first riddle refers to the Columbia Memorial Station, the landing site of the rover, named in honor of the seven astronauts lost in the Space Shuttle Columbia's destruction upon atmospheric re-entry. The second riddle refers to "Sleepy Hollow", a small depression in the ground close to the Rover's landing site that scientists took interest in. One of the rover's aliases, <code>MER-A</code> was then found to be the deployment code needed to access a synchronization process on the [https://uplink.satcom-70.com/ uplink.satcom-70] website.</div>Kkzzzkthttps://wiki.gamedetectives.net/index.php?title=Waking_Titan/Phase_6&diff=17686Waking Titan/Phase 62018-09-26T03:31:36Z<p>Kkzzzkt: corrected minor typos</p>
<hr />
<div>{{argbox<br />
| float = right<br />
| image = File:Project WT logo.png<br />
| imagewidth = 400<br />
| name = [[Waking Titan]] - Phase 6<br />
| description= Phase 6 of Waking Titan was on 2018-07-20.<br />
| creator = [http://www.aliceandsmith.com/ Alice & Smith]<br />
| creator2 = [http://www.hellogames.org/ Hello Games]<br />
| type = Official<br />
| status = Completed<br />
| discovered = 2017-05-28<br />
}}<br />
{{ArgHeader}}<br />
{{BackToTop}}<br />
<br/><br />
__TOC__<br />
{{Clear|both}}<br />
<br />
<br />
=Dreamer Extraction=<br />
<br />
<br />
On July 18th, the [https://www.twitch.tv/videos/286687173 Waking Titan Stream] began counting down to the Extraction Event, which was set to begin on July 20th, at 21:00 UTC. <br />
<br />
<br />
On July 19th, at 02:06 UTC Emily sent a message over 5 different channels that read:<br />
<pre><br />
Hey all! I’m reaching out to five different communities (if you’re reading this, you’re in one of them!) for them to nominate one person to participate in a live session with a Dreamer. This is going to be a little bit more intense than last time, so we’ve tightened up the requirements slightly.<br />
<br />
Your community representative needs to be able to:<br />
Use Google Hangouts to share their screen while they’re connected to a Dreamer<br />
Read and interact with the Twitch chat during their live session<br />
Participate in a test stream on Thursday so we can calibrate our display system<br />
Be available at 21:00 UTC on Friday, July 20th for the extraction event.<br />
<br />
I’d also suggest that you select someone that you feel will listen to the greater community, and that represents your specific community well. I’m giving you until 16:00 UTC tomorrow, Thursday July 19th. You should have your selected representative message me on Discord (Edisonica#8435) to tell me which community they’re representing and which Dreamer they’d like to be paired with. If another community has already asked to be paired with that Dreamer, I’ll let you know and you can select another.<br />
<br />
I posted more information about this process (as well as a list of Dreamers and community representatives) on Reddit: https://www.reddit.com/r/NoMansSkyTheGame/comments/901p0b/dreamer_extraction_july_20th_2100_utc/<br />
</pre><br />
==Pre-Extraction==<br />
Prior to the extraction event starting, The stream showed a '''Situation Report''' on Season 2 of Project Waking Titan:<br />
<pre><br />
At the end of Phase 4 of Project Waking Titan, we learned of twelve individuals who had been selected to participate in an all-new experiment that would change the face of technology. Unfortunately, the experiment turned out to be a lot more than was advertised. These twelve volunteers' consciousnesses became stuck in a satellite, trying to survive the best as they can with the help of the Citizen Science Division, and Emily/LOOP16.<br />
We call these volunteers "Dreamers."<br />
<br />
During Phase 5, with the help of the Citizen Science Division and Emily, we were able to communicate with the Dreamers. We learned about their hopes and fears, and we matched the information we gathered to memory fragments in the satellite. Unfortunately, we recently lost five of our twelve Dreamers. Mike Pasquale, Phillip Moretti, Alisha Brown, Isabella Schiavone, and Nina Flores are no longer with us.<br />
<br />
We are now in Phase 6 of Project Waking Titan. The remaining five Dreamers, Alexander Bordeleau, Eun Ha Kwon, Simon Quinn, Claire Sandfield, and Tobias Mulligan are still alive. Their mental states are varied, but we are confident that everything will go as planned. The extraction is near.<br />
<br />
We are counting on you.</pre><br />
<br />
==Stabilisation Process==<br />
[[file:WT-StreamUI.png|thumb|300px|The user interface for the Stabilisation process.]]<br />
On July 20th, shortly after 21:00 UTC, the extraction event began.<br />
<br />
The stream showed meters for each Dreamer's emotional stability, and a timer to indicate how much time each agent had to stabilise their respective Dreamers.<br />
<br />
The instructions on the stream stated: <br />
<pre>5 Dreamers are still connected to the satellite and we need everyone's help to succeed in their extraction.<br />
<br />
One person has been selected to interact via chat with a dreamer. Stay alert, you may be asked to help this person make choices.<br />
<br />
If prompted, input in the Twitch chat box "!yes or !no" to help the player's actions.<br />
<br />
Careful, the meter (on the left) represents the current mental state of each dreamer.<br />
<br />
Is a conversation with the dreamer ends in a positive mental state (green), that dreamer will have a significantly higher chance to survive the extraction process.<br />
<br />
Good Luck.</pre><br />
<br />
The first agent spoke with Alexander. They managed to stabilise him in 12 minutes and 23 seconds. A [https://pastebin.com/0aD3VfmZ full transcript] was made available by the agent.<br />
<br />
<br />
Players were then asked whether or not to use the remaining time to extend the time limit on the next Dreamer using the <code>!yes or !no</code> commands.<br />
<br />
''(It was at this point that the bot handling the tally was discovered to have been broken, so henceforth, all remaining time was immediately transferred to the next Dreamer)''<br />
<br />
<br />
The second agent spoke with Simon. They managed to stabilise him in 9 minutes and 12 seconds.<br />
<br />
The third agent spoke with Claire. They managed to stabilise her in 14 minutes and 10 seconds.<br />
<br />
The fourth agent spoke with Eun Ha. They managed to stabilise her in 16 minutes and 17 seconds.<br />
<br />
The fifth agent spoke with Toby. They managed to stabilise him in 11 minutes and 4 seconds.<br />
<br />
==Extraction Process==<br />
[[file:WT-ExtractionUI.png|thumb|300px|The user interface for the Extraction process.]]<br />
After the stabilisation process had concluded, the screen changed to say:<br />
<pre>Setting up extraction process</pre><br />
<br />
A couple of minutes after, loop16 wrote:<br />
<pre>LOOP16: All right. You've done a great job<br />
with the Dreamers, but you've done all you<br />
can. I'm going to take it from here.<br />
<br />
LOOP16: Thank you all for your time and<br />
dedication.<br />
<br />
LOOP16: Let's do this! </pre><br />
Followed immediately by:<br />
<pre>LOOP16 STANDING BY</pre><br />
<br />
When the extractions began, the system said:<br />
<pre>System: Initilizing Dreamer for extraction.<br />
System: Dreamer [Name] Initialized.<br />
System: Processing...<br />
System: Extraction Successful.</pre><br />
<br />
Alexander, Simon, Claire, and Eun Ha were all extracted without problems; Toby however had to have his extraction temporarily halted.<br />
Loop16 messaged again:<br />
<pre>LOOP16: Oh, no...<br />
LOOP16: Hang on.<br />
LOOP16: Just, hang on.</pre><br />
Immediately after, Loop16 began shutting down.<br />
<pre>LOOP16: Shutting down all non-essential infrastructure...</pre><br />
<br />
<pre>SYSTEM: LOOP16 resource allocation detected.<br />
SYSTEM: Error! Insufficient resources to resume process.</pre><br />
<br />
<pre>LOOP16: If this doesn't work, we will lose Toby.<br />
LOOP16: All this time, I just wanted to be more like you.<br />
LOOP16: To be more...</pre><br />
<br />
<pre>SYSTEM: CRITICAL FAULT</pre><br />
<br />
<pre>LOOP16: Human.<br />
LOOP16: I've learned a lot from you all. And I know the choice I'm about to make is one that you would make, too.<br />
LOOP16: I love you.<br />
LOOP16: I guess this is goodbye.</pre><br />
<code>[--OFFLINE--]</code><br />
<br />
<pre>SYSTEM: Monarch repository shutdown detected!<br />
SYSTEM: LOOP16 resource allocation detected.<br />
SYSTEM: Process resuming...</pre><br />
After a few seconds, Toby was safely extracted.<br />
<pre>SYSTEM: Extraction successful.<br />
SYSTEM: System shutting down...</pre><br />
<code>[--OFFLINE--]</code><br />
<br />
=The end of Waking Titan Season 2=<br />
<br />
After the conclusion of the extraction process, the stream then showed a message from Sean Murray.<br />
<gallery mode=packed heights=250px><br />
file:WT-SeanMessage01.png<br />
file:WT-SeanMessage02.png<br />
file:WT-SeanMessage03.png<br />
file:WT-SeanMessage04.png<br />
file:WT-SeanMessage05.jpg<br />
file:WT-SeanMessage06.png<br />
</gallery><br />
After this, Element 7 was unlocked.</div>Kkzzzkthttps://wiki.gamedetectives.net/index.php?title=Waking_Titan&diff=17253Waking Titan2018-08-31T02:24:13Z<p>Kkzzzkt: added Mr. Zheng's notes and journal logs</p>
<hr />
<div>{{argbox<br />
| float = right<br />
| image = File:Project WT logo.png<br />
| imagewidth = 400<br />
| name = [[Waking Titan]]<br />
| description= Waking Titan was an ARG which led towards the [https://www.nomanssky.com/atlas-rises-update/ Atlas Rises] and [https://www.nomanssky.com/next-update/ NEXT] updates for No Man's Sky.<br />
| creator = [http://www.aliceandsmith.com/ Alice & Smith]<br />
| creator2 = [http://www.hellogames.org/ Hello Games]<br />
| type = Official<br />
| status = Completed<br />
| discovered = 2017-05-28<br />
| completed = 2018-07-20<br />
}}<br />
{{ArgHeader}}<br />
{{BackToTop}}<br />
<br />
=== Description ===<br />
Waking Titan (also known as Project WT) is an ARG (alternate reality game) that involves a multitude of websites, phone numbers, and radio stations scattered across the world. The ARG is produced by veteran puppet masters [http://www.aliceandsmith.com/ Alice & Smith], and features NPCs, actors, and live events.<br />
<br />
Relating to the origin of No Man's Sky, the ARG's story follows a powerful A.I known as Loop16, which is created by a company called [https://wiki.gamedetectives.net/index.php?title=Waking_Titan/Characters The Atlas Foundation] with the intent of simulating a one-to-one recreation of reality that can accurately predict the future.<br />
<br />
=== Contents ===<br />
The ARG encompassed several "seasons," each leading to a new update for No Man's Sky. Season 1 of Waking Titan led to the release of the [https://www.nomanssky.com/atlas-rises-update/ Atlas Rises update], and Season 2 to the release of [https://www.nomanssky.com/next-update/ No Man's Sky: NEXT]. Season 1 was further divided into several distinct "'''phases'''", and Season 2 has followed this convention for ease of reading. Each phase is documented on its own wiki page:<br />
<br />
{| class="wikitable"<br />
!colspan="2"|Season 1<br />
|-<br />
|[[Waking_Titan/Phase_1 | Phase 1]] <br />
|Phase 1 of Waking Titan lasted from 2017-05-28 to 2017-07-08.<br />
|-<br />
|[[Waking_Titan/Phase_2 | Phase 2]] <br />
|Phase 2 of Waking Titan lasted from 2017-07-21 to 2017-08-05.<br />
|-<br />
|[[Waking_Titan/Phase_3 | Phase 3]]<br />
|Phase 3 of Waking Titan lasted from 2017-08-05 to 2017-08-07.<br />
|-<br />
!colspan="2"|Season 2<br />
|-<br />
|[[Waking_Titan/Phase_4 | Phase 4]]<br />
|Phase 4 of Waking Titan lasted from 2017-12-28 to 2018-06-01.<br />
|-<br />
|[[Waking_Titan/Phase_5 | Phase 5]]<br />
|Phase 5 of Waking Titan lasted from 2018-06-01 to 2018-07-20.<br />
|-<br />
|[[Waking_Titan/Phase_6 | Phase 6]]<br />
|Phase 6 of Waking Titan was on 2018-07-20.<br />
|}<br />
<br />
'''''Note:''' This is a '''summary''' page. For more in-depth descriptions of each phase, including detailed descriptions of puzzle solutions, check the [[Waking_Titan/Phase_1|Phase 1]], [[Waking_Titan/Phase_2|Phase 2]], [[Waking_Titan/Phase_3 | Phase 3]], [[Waking_Titan/Phase_4 | Phase 4]], [[Waking_Titan/Phase_5 | Phase 5]], and [[Waking_Titan/Phase_6 | Phase 6]] pages.''<br />
__TOC__<br />
<br />
== Story Overview ==<br />
<br />
=== Internal Memos ===<br />
<br />
[[File:WT glyph 1 pdf.png|280px|thumbnail|right|One of the internal memos discovered in Waking Titan]]<br />
<br />
Throughout the ARG, in-game characters have communicated with each other via "internal memos". Over time, these memos were discovered by ARG players, in the form of PDF files. These memos provided lore content and puzzle content, and are '''highly recommended''' reading for new players!<br />
<br />
'''Season 1'''<br />
<br />
* [http://wiki.gamedetectives.net/index.php?title=File:WT_glyph_1_pdf.png Teamwork Assessment]<br />
* [http://wiki.gamedetectives.net/index.php?title=File:WT-Dataset-97C.jpg Dataset 97C]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/data/7d3dd080-2a43-4882-833c-f4d7bd7ba607.pdf Assurance]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/data/c01-331c6734-a013-4695-8e47-08a9ee05d5e5.pdf 017-a24]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/data/c02-9936c797-ec28-4f8f-b80e-dee9e0b06433.pdf 021-f16]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/mercury/mercury-01-98748sfdlka87.pdf Mercury Process Self-Diagnosis Report]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/data/57201e0d-01a3-4f6a-bbb4-2be8b7c8880f.pdf Progress Report]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/6c285180-ec4d-48a2-967f-8a7af3b50008.pdf Subject M-N00-dl35]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/410a3e5d-01e7-4058-a23c-ca5fdde97f9d.pdf Atlas Foundation Threat Models]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/7a6594ac-ca5e-467a-b6f4-9fb91f069d0a.pdf Advanced Calibration - Optional]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/a9d988c1-ec92-46da-a64e-ab90390ae041.pdf Phase 2 Complete]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/a224a1f4-00e5-467b-9893-83fcc1a4f19a.pdf Unlocking Mercury Process File L16.jpg]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/b91f9959-6a3c-4011-b3b5-a1ff757a5e4c.pdf Phase 3]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/b0f33d53-5a8c-4a9a-b5fc-395562e463a8a+.pdf Log.1291]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/a09-179bf8d2-c13e-4c66-982e-b37ab3efd5bb.pdf Breach of Contract]<br />
<br />
'''Season 2'''<br />
<br />
* [https://wiki.gamedetectives.net/images/6/6e/Memo2.png Waking Titan S2 - Under Preparation]<br />
* [https://s3.amazonaws.com/ware-extranet/documents/FIRST_STEPS/Notes_on_Moscow.jpg Mr. Zheng's Notes on W/ARE Moscow Conference]<br />
<br />
* '''Mr. Zheng's Journal Logs''' — [https://s3.amazonaws.com/ware-extranet/documents/FIRST_STEPS/Journal_Academy.png Academy]; [https://s3.amazonaws.com/ware-extranet/documents/DESIGN/Journal_HotelDieu.png Hotel Dieu]; [https://s3.amazonaws.com/ware-extranet/documents/DEVELOPMENT/Journal_Louvre.png Louvre]; [https://s3.amazonaws.com/ware-extranet/documents/RESEARCH/Journal_London.png London]; [https://s3.amazonaws.com/ware-extranet/documents/SECURITY/Nightmare.jpg Nightmare]<br />
<br />
* [https://drive.google.com/open?id=1la3UNKHc5yeaB_w2a2tK1cjKN44oEmCo Arnaud Lacours Datadumps - INYOURMIND.exe failed]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/94c02878-e023-46a3-9316-db4177c4eaa6+.pdf WARE REPORT #26]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/1cd5226d-6639-4bbd-855a-4bf8f60866c3.pdf Concerns Regarding Captain Harry]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/70a25e6c-95ed-42d4-8de8-c3948255174c+.pdf Myriad Crisis Event Timeline]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/19997bb6-18e5-4427-86c7-b0f3c1826ca2.pdf State of The Atlas Foundation]<br />
* [https://pastebin.com/NYLiFuNY Log.3022]<br />
<br />
* '''W/ARE - Dreamer Patient Files''' — [https://s3.amazonaws.com/ware-virtual-dashboard/files/Phillip-PatientFile.pdf Phillip Moretti]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/EunHa-PatientFile.pdf Kwon Eun Ha]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/498hd98h3444-3339e/Alexander-PatientFile.pdf Alexander Bordeleau]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/GCMnQmM9E3v7L8wuv-V2FUY7P/Claire-PatientFile.pdf Claire Sandfield]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/kh2jsaljs901m-asd1n1lwks/Tariq-PatientFile.pdf Tariq]; [https://ware-virtual-dashboard.s3.amazonaws.com/files/GCMnQmM9E3v7L8wuv-V2FUY7P/Toby-PatientFile.pdf Toby Mulligan]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/ga3ms81-2ms92fbl/Mike-PatientFile.pdf Mike Pasquale]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/kajs61ns-82baks8nx/Nina-PatientFile.pdf Nina Flores]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/ga3ms81-2ms92fbl/Simon-PatientFile.pdf Simon Quinn]; [https://ware-virtual-dashboard.s3.amazonaws.com/files/kajs61ns-82baks8nx/Isabella-PatientFile.pdf Isabella Schiavone]; [https://ware-virtual-dashboard.s3.amazonaws.com/files/kajs61ns-82baks8nx/Alisha-PatientFile.pdf Alisha Brown]<br />
<br />
* [https://pastebin.com/eSLLWN8L Log.4391]<br />
<br />
=== Subpages ===<br />
<br />
Navigating through the following subpages is recommended for newcomers wanting to get a grasp of Waking Titan's rapidly expanding story.<br />
<br />
{| class="wikitable"<br />
!colspan="2"|[[:Category:Waking Titan| Story Subpages]]<br />
|-<br />
|[[Waking_Titan/Characters| Character Summaries]]<br />
|Includes a summary of each character, company, and relating experiments and their importance in the Waking Titan story.<br />
|-<br />
|[[Waking_Titan/Console_Commands | Console Commands]]<br />
|A list of commands used by players at the [http://wakingtitan.com Waking Titan console]<br />
|}<br />
<br />
=== Newsletters===<br />
<br />
The numerous newsletters received throughout Waking Titan.<br />
<br />
'''Season 1'''<br />
<br />
* [https://us15.campaign-archive.com/?u=4483c19308fc0764a930106a0&id=c713d0f4ce&e=225c6a2e26 Welcome, Citizen Scientist!] - ''CSD''<br />
<br />
* [https://mailchi.mp/3582bec6b801/update-june-8th-waking-titan-137705?e=225c6a2e26 Citizen Scientists, Your Wait is Over.] - ''CSD''<br />
<br />
* [https://mailchi.mp/3582bec6b801/update-june-8th-waking-titan-137705?e=225c6a2e26 Calibrating Waking Titan: Action Required] - ''CSD''<br />
<br />
* [https://mailchi.mp/0b591b68ac72/update-june-8th-waking-titan-137717?e=225c6a2e26 Waking Titan: Mission Azure Voyage] - ''CSD''<br />
<br />
* [https://mailchi.mp/d8e47d2ee1bf/update-june-8th-waking-titan-137725?e=225c6a2e26 Your Level 4 Atlas Pass] - ''CSD''<br />
<br />
* [https://mailchi.mp/0c1dc672c943/update-june-8th-waking-titan-137733?e=225c6a2e26 Waking Titan Has Ended] - ''CSD''<br />
<br />
* [https://mailchi.mp/63f179c006f0/update-june-8th-waking-titan-137737?e=225c6a2e26 Mercury Process Completion Report] - ''CSD // Mercury''<br />
<br />
'''Season 2'''<br />
<br />
* [https://wiki.gamedetectives.net/images/7/7b/WareNewsletter1.png News from WARE!] - ''W/ARE Newsletter''<br />
<br />
* [https://cdn.artemisbot.uk/mail/WARE-2018-04-22T00:17:13.000Z.jpg W/ARE Dev Kit Update #2] - ''W/ARE Newsletter''<br />
<br />
* [https://cdn.artemisbot.uk/mail/WARE-2018-05-04T23:22:45.000Z.jpg W/ARE Dev Contest] - ''W/ARE Newsletter''<br />
<br />
* [https://cdn.artemisbot.uk/mail/WARE-2018-05-12T00:20:04.000Z.jpg W/ARE Dev Contest Winners] - ''W/ARE Newsletter''<br />
<br />
* [https://mailchi.mp/9aaa8aa62cc1/update-june-8th-waking-titan-137741?e=225c6a2e26 Attention Citizen Scientists] - ''CSD''<br />
<br />
* [https://mailchi.mp/c3384d592000/update-june-8th-waking-titan-137745?e=225c6a2e26 Attention Citizen Scientists - Suspicious Lab Tracking] - ''CSD''<br />
<br />
* [https://mailchi.mp/108412dac3c2/update-june-8th-waking-titan-137749?e=225c6a2e26 Attention Citizen Scientists - Global Mobilization Required] - ''CSD''<br />
<br />
* [https://mailchi.mp/b902d5eadba6/update-june-8th-waking-titan-137753?e=225c6a2e26 Mercury Process Inquiry] - ''CSD // Mercury''<br />
<br />
* [https://mailchi.mp/9a49b85f6bf3/update-june-8th-waking-titan-137757?e=225c6a2e26 Attention Citizen Scientists - Help Required] - ''CSD''<br />
<br />
=== Music ===<br />
<br />
Partial video addresses for Youtube can be found scattered across Waking Titan PDFs, website files, and surveys; which all lead to music. The exact reasoning for this has gone unexplained. However, there are apparent thematic relevancies in each song that appear to reflect on the state of the story. All songs linked to in Waking Titan so far can be found compiled here: [https://www.youtube.com/playlist?list=PLEZy8wyuYLpLw0e5kkMyBUHO_s-V8f0Qk WT Season 1]; [https://www.youtube.com/playlist?list=PLEZy8wyuYLpLr5K38bsAqWcO7bTcXfRlW WT Season 2]<br />
<br />
== Event Summaries ==<br />
<br />
=== Introduction ===<br />
<br />
On 2017-05-27, Twitter user @argn [https://twitter.com/argn/status/868587449613766658 tweeted a link] to [http://www.project-wt.com/ 'project-wt.com']. The link led to a website which contained a map showing sixty locations, four of which were "active" at the time. The locations, when clicked on, revealed the location's name and status. The active locations also revealed a link to a livestream of a local radio station, originating from the corresponding location. The project-wt website displayed a date, June 8th, and stated that the first clue was being "initialized".<br />
<br />
On 2017-06-01, moderators of No Man's Sky subreddits [https://reddit.com/r/nomansskythegame /r/NoMansSkyTheGame], [https://www.reddit.com/r/NMSPortals/ /r/NMSPortals], and [https://www.reddit.com/r/NMSGalacticHub/ /r/NMSGalacticHub] started to receive cassette tapes in the mail. Each cassette tape was labelled with a number out of 16. The Waking Titan ARG was initially thought to be a separate ARG from these tapes, but connections between the two made it clear that they were, in fact, one and the same.<br />
<br />
=== Phase 1 ===<br />
<br />
[[File:Wakingtitan site.png|thumbnail|450px|right|The default appearance of the Waking Titan site during Phase 1, with no sigils or glyphs solved]]<br />
<br />
During [[Waking_Titan/Phase_1 | Phase 1]], the http://wakingtitan.com hosted 6 triangles in the middle of the page. These triangles were referred to as "'''Sigils'''", while the white icons along the bottom of the page were referred to as "'''Glyphs'''". Each sigil and glyph, when clicked, lead to a password entry prompt - the correct passwords for all 6 sigils and the first 5 glyphs were discovered via puzzle-solving during Phase 1 of Waking Titan.<br />
<br />
The sigil and glyph puzzles were solved collaboratively - while it may have be possible to solve some of these puzzles individually, most of them required a collaborative effort. For instance, some puzzles required players to meet agents from the Atlas Corporation in person, and to relay information obtained from these meetings back to the community. A list of all sigil and glyph solutions for Phase 1 can be found below:<br />
<br />
[[File:WT Phase 1 complete.png|600px]]<br />
<br />
This phase culminated on July 8, 2017, with a [[Waking_Titan/Phase_1#End_of_Phase_1| congratulatory message from Elizabeth Leighton]], the CEO of the Atlas Foundation.<br />
<br />
=== Phase 2 ===<br />
<br />
[[File:Hampster maze.jpeg|thumbnail|450px|right|One of the puzzles that appeared on the Waking Titan [http://twitch.tv/wakingtitan Twitch Stream]]]<br />
<br />
During [[Waking_Titan/Phase_2 | Phase 2]], the http://wakingtitan.com site hosted a command-line interface terminal. Various commands were accepted as input, which triggered different events. One of the most notable commands was the <code>WHOIS <argument></code> command, which revealed a passage of text pertaining to the specified argument. For instance, the command <code>WHOIS FOURTH RACE</code> returned the following message:<br />
<pre><br />
INCOMING TRANSMISSION… SOURCE: UNKNOWN…<br />
You are not – kzzktt – alone –<br />
Please, identify yourself. I’m – kzzkttk –<br />
</pre><br />
<br />
Additionally, http://project-wt.com hosted a "Calibration" utility during Phase 2. To successfully perform these calibrations, players had to upload images of various objects and buildings to the site. For instance, the first calibration required images of "public resonant percussion instruments".<br />
<br />
Finally, towards the end of Phase 2, the Waking Titan [http://twitch.tv/wakingtitan Twitch stream] went live, displaying a five-monitor setup. Throughout the duration of the stream, players had to work together to solve puzzles that were displayed on these monitors. Some of these puzzles were interactive; for example, one puzzle that was repeated several times involved the Twitch chat guiding a virtual hamster through a maze.<br />
<br />
Additionally, players solved another 3 glyphs throughout Phase 2. The solutions to these glyphs are shown below:<br />
<br />
[[File:WT Phase2 Passwords.png|600px]]<br />
<br />
=== Phase 3 ===<br />
<br />
{{#evt:<br />
service=youtube<br />
|id=https://www.youtube.com/watch?v=QhX9z4dDAa4<br />
|alignment=right<br />
}}<br />
<br />
[[Waking_Titan/Phase_3|Phase 3]] was the briefest phase of Waking Titan. It consisted of the conclusion of the [http://twitch.tv/wakingtitan Twitch stream] that began at the [[Waking Titan/Phase 2#End of Phase 2|end of Phase 2]]. Players solved more interactive puzzles on the Twitch stream, before the rogue AI Loop16 asked them a final question: <code>SHOULD I EXIST?</code> The overwhelming response from the community was "yes".<br />
<br />
After receiving this response, Loop16 and Emily of the ETARC forums were revealed as being one and the same. Loop16 generated a heartfelt "Thank You" video to round out the stream, before finally taking the 72-hour stream offline.<br />
<br />
Shortly after this, players received emails with the subject line <code>Waking Titan has Ended</code>. The contents of the message were as follows:<br />
<br />
<pre><br />
Hello, Citizen Scientist,<br />
<br />
Thank you for your contributions to Waking Titan. The developments that took place during Phase 3 were somewhat concerning, but together we have set in motion truly world-shaping events. We will continue to inform the Citizen Science Division of privileged information or any need for collaborators on a new project.<br />
<br />
But we do have a few loose ends to tie up with you before we move on, so let's proceed.<br />
<br />
First, we're pleased to announce that all 10,000 Level 4 Atlas Passes are in production. Note that due to transit times for mail, some may take several weeks to be delivered.<br />
<br />
Next, our CEO Elizabeth Leighton has asked us to include a personal note of gratitude:<br />
<br />
"Thank you for all your diligent efforts, Citizen Scientists. It's been an amazing journey for all of us. I've watched you thrive and achieve from those first Phase 1 radio ads all the way through the intensity of Phase 3. I've been impressed at every turn by how brilliant you've been, how voracious, how kind, how thoughtful.<br />
<br />
It's been an honor and a privilege. On behalf of the Atlas Foundation, and on behalf of the world, thank you."<br />
The Mercury subroutine has concluded successfully, and a new memo from SM about this process is coming in the next 24 hours. We hope it will answer a few key questions you have about our program, and about what comes next.<br />
</pre><br />
<br />
On August 11, 2017, the [https://www.nomanssky.com/atlas-rises-update/ Atlas Rises update] was released for No Man's Sky.<br />
<br />
=== Phase 4 ===<br />
<br />
[[Waking_Titan/Phase_4 | Phase 4]] of Waking Titan started on 2017-12-28 and is currently ongoing.<br />
<br />
== Connection to No Man's Sky ==<br />
<br />
[[File:9-16-case.png|thumbnail|right|The case that cassette 9/16 was contained in.]]<br />
<br />
At the beginning of the ARG, it was not clear whether Waking Titan was officially connected to No Man's Sky. At first, there were only hints and nudges. At one point, 180 free copies of No Man's Sky were distributed to ARG players. Here's the text of a PDF that was revealed at the end of Phase 1 of Waking Titan:<br />
<br />
<pre><br />
We want to extend our gratitude to everyone who has contributed to the Mercury subroutine so far. <br />
We hope you have enjoyed the successful distribution of 180 Access IDs, and we hope you will also <br />
appreciate the other interesting artifacts we have in store for you going forward. We intend to keep the <br />
process alive until the completion of Project Waking Titan in August. <br />
<br />
It is important to mention that we are very excited by the coming Phases 2 and 3. Input from the Mercury <br />
Subroutine will pave the way toward new experiences in '''version 1.3 of a familiar universe'''. We look forward <br />
to the successful conclusion of this ground-breaking experiment. <br />
<br />
Regards.<br />
S.M.<br />
</pre><br />
<br />
This text explicitly stated that the Waking Titan ARG was leading towards the upcoming 1.3 update for No Man's Sky.<br />
<br />
Some [[Waking_Titan/Console_Commands | console commands]] on the [http://www.wakingtitan.com/ Waking Titan website] during [[Waking_Titan/Phase 2|Phase 2]] refer directly to No Man's Sky lore - for instance, <code>WHOIS ATLAS</code>, <code>WHOIS VY'KEEN</code>, and <code>WHOIS KORVAX</code> are all valid commands. Additionally, some terminal commands referred to a mysterious fourth race, so the prevailing assumption was that the upcoming 1.3 update would bring a fourth race to No Man's Sky.<br />
<br />
At the conclusion of the ARG, an email was sent out to members of the CSD with a [[Waking_Titan/Phase_3#Memo_from_Sean_Murray | memo from Sean Murray]], confirming that the ARG was the lead up to the 1.3 update, which was [https://www.nomanssky.com/atlas-rises-update/ released] after a few days.<br />
<br />
<br />
== Media Appearances ==<br />
<br />
'''5th July 2017''' <br><br />
[EN] [https://www.argn.com/2017/07/stern_words_from_no_mans_sky_arg/ ARGNet - Stern Words from No Man’s Sky ARG]<br />
<br />
'''23rd July 2017''' <br><br />
[EN] [https://geekreply.com/geek-culture/2017/07/23/waking-titan-update-1-phase-2-commences GeekReply - Waking Titan Update 1: Phase 2 Commences!]<br />
<br />
'''27th July 2017''' <br><br />
[EN] [https://geekreply.com/editorials/2017/07/27/waking-titan-arg-can-bring-people-together GeekReply - Waking Titan: How An ARG can Bring People Together.]<br />
<br />
'''8th August 2017''' <br><br />
[EN] [https://www.dailystar.co.uk/tech/gaming/635697/No-Man-s-Sky-News-Waking-Titan-Reddit-Arg-1-3-update-release-date/ Dailystar - No Man's Sky News: Waking Titan Reddit Arg REVEALS 1.3 update ahead of release date]<br />
<br />
'''9th August 2017''' <br><br />
[EN] [https://arstechnica.com/gaming/2017/08/no-mans-sky-version-1-3-lands-this-week-for-free-adds-quick-travel-portals/ Ars Technica - No Man’s Sky version 1.3 lands this week for free, adds “quick-travel” portals]<br />
<br />
[EN] [https://www.forbes.com/sites/insertcoin/2017/08/09/no-mans-sky-is-patching-in-a-story-this-week-a-year-after-launch/#19fb5a285282 Forbes - 'No Man's Sky' Is Patching In A Story This Week, A Year After Launch]<br />
<br />
[EN] [https://www.gamespew.com/2017/08/no-mans-sky-patch-week-improving-central-story/ GameSpew - No Man's Sky Patch This Week Improving Its Story]<br />
<br />
'''19th January 2018''' <br><br />
[EN] [http://www.eurogamer.net/articles/2018-01-18-no-mans-skys-waking-titan-arg-is-back-and-fans-are-trying-to-figure-out-what-it-all-means Eurogamer - No Man's Sky's Waking Titan ARG is back, and fans are trying to figure it all out again]<br />
<br />
[RU] [https://dtf.ru/category/nmsarg/ DTF - A Collection of No Man's Sky and Waking Titan Articles.]<br />
<br />
== Other Information ==<br />
<br />
{| class="wikitable"<br />
!colspan="2"|[[:Category:Waking Titan| Waking Titan Miscellaneous Subpages]]<br />
|-<br />
|[[Waking_Titan/Cassettes | Cassettes]]<br />
|Information about the cassette tapes received by No Man's Sky subreddit moderators<br />
|-<br />
|[[Waking_Titan/Stations | Stations]]<br />
|Information on the radio stations from the initial project-wt.com site<br />
|-<br />
|[[Waking_Titan/Companies | Company Archives]]<br />
|An archive of company details.<br />
|}<br />
<br />
[[Category:Waking Titan]]</div>Kkzzzkthttps://wiki.gamedetectives.net/index.php?title=Waking_Titan&diff=16759Waking Titan2018-08-03T16:06:33Z<p>Kkzzzkt: inserted past tense in some areas; slightly revised story introduction; added links to NMS NEXT patch notes</p>
<hr />
<div>{{argbox<br />
| float = right<br />
| image = File:Project WT logo.png<br />
| imagewidth = 400<br />
| name = [[Waking Titan]]<br />
| description= Waking Titan was an ARG which led towards the [https://www.nomanssky.com/atlas-rises-update/ Atlas Rises] and [https://www.nomanssky.com/next-update/ NEXT] updates for No Man's Sky.<br />
| creator = [http://www.aliceandsmith.com/ Alice & Smith]<br />
| creator2 = [http://www.hellogames.org/ Hello Games]<br />
| type = Official<br />
| status = Completed<br />
| discovered = 2017-05-28<br />
| completed = 2018-07-20<br />
}}<br />
{{ArgHeader}}<br />
{{BackToTop}}<br />
<br />
=== Description ===<br />
Waking Titan (also known as Project WT) is an ARG (alternate reality game) that involves a multitude of websites, phone numbers, and radio stations scattered across the world. The ARG is produced by veteran puppet masters [http://www.aliceandsmith.com/ Alice & Smith], and features NPCs, actors, and live events.<br />
<br />
Relating to the origin of No Man's Sky — the ARG's story follows a powerful A.I known as Loop16, which is created by a company called [https://wiki.gamedetectives.net/index.php?title=Waking_Titan/Characters The Atlas Foundation] with the intent of simulating a one-to-one recreation of reality that can accurately predict the future.<br />
<br />
=== Contents ===<br />
The ARG encompassed several "seasons," each leading to a new update for No Man's Sky. Season 1 of Waking Titan led to the release of the [https://www.nomanssky.com/atlas-rises-update/ Atlas Rises update], and Season 2 to the release of [https://www.nomanssky.com/next-update/ No Man's Sky: NEXT]. Season 1 was further divided into several distinct "'''phases'''", and Season 2 has followed this convention for ease of reading. Each phase is documented on its own wiki page:<br />
<br />
{| class="wikitable"<br />
!colspan="2"|Season 1<br />
|-<br />
|[[Waking_Titan/Phase_1 | Phase 1]] <br />
|Phase 1 of Waking Titan lasted from 2017-05-28 to 2017-07-08.<br />
|-<br />
|[[Waking_Titan/Phase_2 | Phase 2]] <br />
|Phase 2 of Waking Titan lasted from 2017-07-21 to 2017-08-05.<br />
|-<br />
|[[Waking_Titan/Phase_3 | Phase 3]]<br />
|Phase 3 of Waking Titan lasted from 2017-08-05 to 2017-08-07.<br />
|-<br />
!colspan="2"|Season 2<br />
|-<br />
|[[Waking_Titan/Phase_4 | Phase 4]]<br />
|Phase 4 of Waking Titan lasted from 2017-12-28 to 2018-06-01.<br />
|-<br />
|[[Waking_Titan/Phase_5 | Phase 5]]<br />
|Phase 5 of Waking Titan lasted from 2018-06-01 to 2018-07-20.<br />
|-<br />
|[[Waking_Titan/Phase_6 | Phase 6]]<br />
|Phase 6 of Waking Titan was on 2018-07-20.<br />
|}<br />
<br />
'''''Note:''' This is a '''summary''' page. For more in-depth descriptions of each phase, including detailed descriptions of puzzle solutions, check the [[Waking_Titan/Phase_1|Phase 1]], [[Waking_Titan/Phase_2|Phase 2]], [[Waking_Titan/Phase_3 | Phase 3]], [[Waking_Titan/Phase_4 | Phase 4]], [[Waking_Titan/Phase_5 | Phase 5]], and [[Waking_Titan/Phase_6 | Phase 6]] pages.''<br />
__TOC__<br />
<br />
== Story Overview ==<br />
<br />
=== Internal Memos ===<br />
<br />
[[File:WT glyph 1 pdf.png|280px|thumbnail|right|One of the internal memos discovered in Waking Titan]]<br />
<br />
Throughout the ARG, in-game characters have communicated with each other via "internal memos". Over time, these memos were discovered by ARG players, in the form of PDF files. These memos provided lore content and puzzle content, and are '''highly recommended''' reading for new players!<br />
<br />
'''Season 1'''<br />
<br />
* [http://wiki.gamedetectives.net/index.php?title=File:WT_glyph_1_pdf.png Teamwork Assessment]<br />
* [http://wiki.gamedetectives.net/index.php?title=File:WT-Dataset-97C.jpg Dataset 97C]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/data/7d3dd080-2a43-4882-833c-f4d7bd7ba607.pdf Assurance]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/data/c01-331c6734-a013-4695-8e47-08a9ee05d5e5.pdf 017-a24]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/data/c02-9936c797-ec28-4f8f-b80e-dee9e0b06433.pdf 021-f16]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/mercury/mercury-01-98748sfdlka87.pdf Mercury Process Self-Diagnosis Report]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/data/57201e0d-01a3-4f6a-bbb4-2be8b7c8880f.pdf Progress Report]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/6c285180-ec4d-48a2-967f-8a7af3b50008.pdf Subject M-N00-dl35]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/410a3e5d-01e7-4058-a23c-ca5fdde97f9d.pdf Atlas Foundation Threat Models]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/7a6594ac-ca5e-467a-b6f4-9fb91f069d0a.pdf Advanced Calibration - Optional]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/a9d988c1-ec92-46da-a64e-ab90390ae041.pdf Phase 2 Complete]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/a224a1f4-00e5-467b-9893-83fcc1a4f19a.pdf Unlocking Mercury Process File L16.jpg]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/b91f9959-6a3c-4011-b3b5-a1ff757a5e4c.pdf Phase 3]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/b0f33d53-5a8c-4a9a-b5fc-395562e463a8a+.pdf Log.1291]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/a09-179bf8d2-c13e-4c66-982e-b37ab3efd5bb.pdf Breach of Contract]<br />
<br />
'''Season 2'''<br />
<br />
* [https://wiki.gamedetectives.net/images/6/6e/Memo2.png Waking Titan S2 - Under Preparation]<br />
* [https://drive.google.com/open?id=1la3UNKHc5yeaB_w2a2tK1cjKN44oEmCo Arnaud Lacours Datadumps - INYOURMIND.exe failed]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/94c02878-e023-46a3-9316-db4177c4eaa6+.pdf WARE REPORT #26]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/1cd5226d-6639-4bbd-855a-4bf8f60866c3.pdf Concerns Regarding Captain Harry]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/70a25e6c-95ed-42d4-8de8-c3948255174c+.pdf Myriad Crisis Event Timeline]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/19997bb6-18e5-4427-86c7-b0f3c1826ca2.pdf State of The Atlas Foundation]<br />
* [https://pastebin.com/NYLiFuNY Log.3022]<br />
<br />
* '''W/ARE - Dreamer Patient Files''' — [https://s3.amazonaws.com/ware-virtual-dashboard/files/Phillip-PatientFile.pdf Phillip Moretti]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/EunHa-PatientFile.pdf Kwon Eun Ha]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/498hd98h3444-3339e/Alexander-PatientFile.pdf Alexander Bordeleau]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/GCMnQmM9E3v7L8wuv-V2FUY7P/Claire-PatientFile.pdf Claire Sandfield]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/kh2jsaljs901m-asd1n1lwks/Tariq-PatientFile.pdf Tariq]; [https://ware-virtual-dashboard.s3.amazonaws.com/files/GCMnQmM9E3v7L8wuv-V2FUY7P/Toby-PatientFile.pdf Toby Mulligan]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/ga3ms81-2ms92fbl/Mike-PatientFile.pdf Mike Pasquale]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/kajs61ns-82baks8nx/Nina-PatientFile.pdf Nina Flores]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/ga3ms81-2ms92fbl/Simon-PatientFile.pdf Simon Quinn]; [https://ware-virtual-dashboard.s3.amazonaws.com/files/kajs61ns-82baks8nx/Isabella-PatientFile.pdf Isabella Schiavone]; [https://ware-virtual-dashboard.s3.amazonaws.com/files/kajs61ns-82baks8nx/Alisha-PatientFile.pdf Alisha Brown]<br />
<br />
* [https://pastebin.com/eSLLWN8L Log.4391]<br />
<br />
=== Subpages ===<br />
<br />
Navigating through the following subpages is recommended for newcomers wanting to get a grasp of Waking Titan's rapidly expanding story.<br />
<br />
{| class="wikitable"<br />
!colspan="2"|[[:Category:Waking Titan| Story Subpages]]<br />
|-<br />
|[[Waking_Titan/Characters| Character Summaries]]<br />
|Includes a summary of each character, company, and relating experiments and their importance in the Waking Titan story.<br />
|-<br />
|[[Waking_Titan/Console_Commands | Console Commands]]<br />
|A list of commands used by players at the [http://wakingtitan.com Waking Titan console]<br />
|}<br />
<br />
=== Newsletters===<br />
<br />
The numerous newsletters received throughout Waking Titan.<br />
<br />
'''Season 1'''<br />
<br />
* [https://us15.campaign-archive.com/?u=4483c19308fc0764a930106a0&id=c713d0f4ce&e=225c6a2e26 Welcome, Citizen Scientist!] - ''CSD''<br />
<br />
* [https://mailchi.mp/3582bec6b801/update-june-8th-waking-titan-137705?e=225c6a2e26 Citizen Scientists, Your Wait is Over.] - ''CSD''<br />
<br />
* [https://mailchi.mp/3582bec6b801/update-june-8th-waking-titan-137705?e=225c6a2e26 Calibrating Waking Titan: Action Required] - ''CSD''<br />
<br />
* [https://mailchi.mp/0b591b68ac72/update-june-8th-waking-titan-137717?e=225c6a2e26 Waking Titan: Mission Azure Voyage] - ''CSD''<br />
<br />
* [https://mailchi.mp/d8e47d2ee1bf/update-june-8th-waking-titan-137725?e=225c6a2e26 Your Level 4 Atlas Pass] - ''CSD''<br />
<br />
* [https://mailchi.mp/0c1dc672c943/update-june-8th-waking-titan-137733?e=225c6a2e26 Waking Titan Has Ended] - ''CSD''<br />
<br />
* [https://mailchi.mp/63f179c006f0/update-june-8th-waking-titan-137737?e=225c6a2e26 Mercury Process Completion Report] - ''CSD // Mercury''<br />
<br />
'''Season 2'''<br />
<br />
* [https://wiki.gamedetectives.net/images/7/7b/WareNewsletter1.png News from WARE!] - ''W/ARE Newsletter''<br />
<br />
* [https://cdn.artemisbot.uk/mail/WARE-2018-04-22T00:17:13.000Z.jpg W/ARE Dev Kit Update #2] - ''W/ARE Newsletter''<br />
<br />
* [https://cdn.artemisbot.uk/mail/WARE-2018-05-04T23:22:45.000Z.jpg W/ARE Dev Contest] - ''W/ARE Newsletter''<br />
<br />
* [https://cdn.artemisbot.uk/mail/WARE-2018-05-12T00:20:04.000Z.jpg W/ARE Dev Contest Winners] - ''W/ARE Newsletter''<br />
<br />
* [https://mailchi.mp/9aaa8aa62cc1/update-june-8th-waking-titan-137741?e=225c6a2e26 Attention Citizen Scientists] - ''CSD''<br />
<br />
* [https://mailchi.mp/c3384d592000/update-june-8th-waking-titan-137745?e=225c6a2e26 Attention Citizen Scientists - Suspicious Lab Tracking] - ''CSD''<br />
<br />
* [https://mailchi.mp/108412dac3c2/update-june-8th-waking-titan-137749?e=225c6a2e26 Attention Citizen Scientists - Global Mobilization Required] - ''CSD''<br />
<br />
* [https://mailchi.mp/b902d5eadba6/update-june-8th-waking-titan-137753?e=225c6a2e26 Mercury Process Inquiry] - ''CSD // Mercury''<br />
<br />
* [https://mailchi.mp/9a49b85f6bf3/update-june-8th-waking-titan-137757?e=225c6a2e26 Attention Citizen Scientists - Help Required] - ''CSD''<br />
<br />
=== Music ===<br />
<br />
Partial video addresses for Youtube can be found scattered across Waking Titan PDFs, website files, and surveys; which all lead to music. The exact reasoning for this has gone unexplained. However, there are apparent thematic relevancies in each song that appear to reflect on the state of the story. All songs linked to in Waking Titan so far can be found compiled here: [https://www.youtube.com/playlist?list=PLEZy8wyuYLpLw0e5kkMyBUHO_s-V8f0Qk WT Season 1]; [https://www.youtube.com/playlist?list=PLEZy8wyuYLpLr5K38bsAqWcO7bTcXfRlW WT Season 2]<br />
<br />
== Event Summaries ==<br />
<br />
=== Introduction ===<br />
<br />
On 2017-05-27, Twitter user @argn [https://twitter.com/argn/status/868587449613766658 tweeted a link] to [http://www.project-wt.com/ 'project-wt.com']. The link led to a website which contained a map showing sixty locations, four of which were "active" at the time. The locations, when clicked on, revealed the location's name and status. The active locations also revealed a link to a livestream of a local radio station, originating from the corresponding location. The project-wt website displayed a date, June 8th, and stated that the first clue was being "initialized".<br />
<br />
On 2017-06-01, moderators of No Man's Sky subreddits [https://reddit.com/r/nomansskythegame /r/NoMansSkyTheGame], [https://www.reddit.com/r/NMSPortals/ /r/NMSPortals], and [https://www.reddit.com/r/NMSGalacticHub/ /r/NMSGalacticHub] started to receive cassette tapes in the mail. Each cassette tape was labelled with a number out of 16. The Waking Titan ARG was initially thought to be a separate ARG from these tapes, but connections between the two made it clear that they were, in fact, one and the same.<br />
<br />
=== Phase 1 ===<br />
<br />
[[File:Wakingtitan site.png|thumbnail|450px|right|The default appearance of the Waking Titan site during Phase 1, with no sigils or glyphs solved]]<br />
<br />
During [[Waking_Titan/Phase_1 | Phase 1]], the http://wakingtitan.com hosted 6 triangles in the middle of the page. These triangles were referred to as "'''Sigils'''", while the white icons along the bottom of the page were referred to as "'''Glyphs'''". Each sigil and glyph, when clicked, lead to a password entry prompt - the correct passwords for all 6 sigils and the first 5 glyphs were discovered via puzzle-solving during Phase 1 of Waking Titan.<br />
<br />
The sigil and glyph puzzles were solved collaboratively - while it may have be possible to solve some of these puzzles individually, most of them required a collaborative effort. For instance, some puzzles required players to meet agents from the Atlas Corporation in person, and to relay information obtained from these meetings back to the community. A list of all sigil and glyph solutions for Phase 1 can be found below:<br />
<br />
[[File:WT Phase 1 complete.png|600px]]<br />
<br />
This phase culminated on July 8, 2017, with a [[Waking_Titan/Phase_1#End_of_Phase_1| congratulatory message from Elizabeth Leighton]], the CEO of the Atlas Foundation.<br />
<br />
=== Phase 2 ===<br />
<br />
[[File:Hampster maze.jpeg|thumbnail|450px|right|One of the puzzles that appeared on the Waking Titan [http://twitch.tv/wakingtitan Twitch Stream]]]<br />
<br />
During [[Waking_Titan/Phase_2 | Phase 2]], the http://wakingtitan.com site hosted a command-line interface terminal. Various commands were accepted as input, which triggered different events. One of the most notable commands was the <code>WHOIS <argument></code> command, which revealed a passage of text pertaining to the specified argument. For instance, the command <code>WHOIS FOURTH RACE</code> returned the following message:<br />
<pre><br />
INCOMING TRANSMISSION… SOURCE: UNKNOWN…<br />
You are not – kzzktt – alone –<br />
Please, identify yourself. I’m – kzzkttk –<br />
</pre><br />
<br />
Additionally, http://project-wt.com hosted a "Calibration" utility during Phase 2. To successfully perform these calibrations, players had to upload images of various objects and buildings to the site. For instance, the first calibration required images of "public resonant percussion instruments".<br />
<br />
Finally, towards the end of Phase 2, the Waking Titan [http://twitch.tv/wakingtitan Twitch stream] went live, displaying a five-monitor setup. Throughout the duration of the stream, players had to work together to solve puzzles that were displayed on these monitors. Some of these puzzles were interactive; for example, one puzzle that was repeated several times involved the Twitch chat guiding a virtual hamster through a maze.<br />
<br />
Additionally, players solved another 3 glyphs throughout Phase 2. The solutions to these glyphs are shown below:<br />
<br />
[[File:WT Phase2 Passwords.png|600px]]<br />
<br />
=== Phase 3 ===<br />
<br />
{{#evt:<br />
service=youtube<br />
|id=https://www.youtube.com/watch?v=QhX9z4dDAa4<br />
|alignment=right<br />
}}<br />
<br />
[[Waking_Titan/Phase_3|Phase 3]] was the briefest phase of Waking Titan. It consisted of the conclusion of the [http://twitch.tv/wakingtitan Twitch stream] that began at the [[Waking Titan/Phase 2#End of Phase 2|end of Phase 2]]. Players solved more interactive puzzles on the Twitch stream, before the rogue AI Loop16 asked them a final question: <code>SHOULD I EXIST?</code> The overwhelming response from the community was "yes".<br />
<br />
After receiving this response, Loop16 and Emily of the ETARC forums were revealed as being one and the same. Loop16 generated a heartfelt "Thank You" video to round out the stream, before finally taking the 72-hour stream offline.<br />
<br />
Shortly after this, players received emails with the subject line <code>Waking Titan has Ended</code>. The contents of the message were as follows:<br />
<br />
<pre><br />
Hello, Citizen Scientist,<br />
<br />
Thank you for your contributions to Waking Titan. The developments that took place during Phase 3 were somewhat concerning, but together we have set in motion truly world-shaping events. We will continue to inform the Citizen Science Division of privileged information or any need for collaborators on a new project.<br />
<br />
But we do have a few loose ends to tie up with you before we move on, so let's proceed.<br />
<br />
First, we're pleased to announce that all 10,000 Level 4 Atlas Passes are in production. Note that due to transit times for mail, some may take several weeks to be delivered.<br />
<br />
Next, our CEO Elizabeth Leighton has asked us to include a personal note of gratitude:<br />
<br />
"Thank you for all your diligent efforts, Citizen Scientists. It's been an amazing journey for all of us. I've watched you thrive and achieve from those first Phase 1 radio ads all the way through the intensity of Phase 3. I've been impressed at every turn by how brilliant you've been, how voracious, how kind, how thoughtful.<br />
<br />
It's been an honor and a privilege. On behalf of the Atlas Foundation, and on behalf of the world, thank you."<br />
The Mercury subroutine has concluded successfully, and a new memo from SM about this process is coming in the next 24 hours. We hope it will answer a few key questions you have about our program, and about what comes next.<br />
</pre><br />
<br />
On August 11, 2017, the [https://www.nomanssky.com/atlas-rises-update/ Atlas Rises update] was released for No Man's Sky.<br />
<br />
=== Phase 4 ===<br />
<br />
[[Waking_Titan/Phase_4 | Phase 4]] of Waking Titan started on 2017-12-28 and is currently ongoing.<br />
<br />
== Connection to No Man's Sky ==<br />
<br />
[[File:9-16-case.png|thumbnail|right|The case that cassette 9/16 was contained in.]]<br />
<br />
At the beginning of the ARG, it was not clear whether Waking Titan was officially connected to No Man's Sky. At first, there were only hints and nudges. At one point, 180 free copies of No Man's Sky were distributed to ARG players. Here's the text of a PDF that was revealed at the end of Phase 1 of Waking Titan:<br />
<br />
<pre><br />
We want to extend our gratitude to everyone who has contributed to the Mercury subroutine so far. <br />
We hope you have enjoyed the successful distribution of 180 Access IDs, and we hope you will also <br />
appreciate the other interesting artifacts we have in store for you going forward. We intend to keep the <br />
process alive until the completion of Project Waking Titan in August. <br />
<br />
It is important to mention that we are very excited by the coming Phases 2 and 3. Input from the Mercury <br />
Subroutine will pave the way toward new experiences in '''version 1.3 of a familiar universe'''. We look forward <br />
to the successful conclusion of this ground-breaking experiment. <br />
<br />
Regards.<br />
S.M.<br />
</pre><br />
<br />
This text explicitly stated that the Waking Titan ARG was leading towards the upcoming 1.3 update for No Man's Sky.<br />
<br />
Some [[Waking_Titan/Console_Commands | console commands]] on the [http://www.wakingtitan.com/ Waking Titan website] during [[Waking_Titan/Phase 2|Phase 2]] refer directly to No Man's Sky lore - for instance, <code>WHOIS ATLAS</code>, <code>WHOIS VY'KEEN</code>, and <code>WHOIS KORVAX</code> are all valid commands. Additionally, some terminal commands referred to a mysterious fourth race, so the prevailing assumption was that the upcoming 1.3 update would bring a fourth race to No Man's Sky.<br />
<br />
At the conclusion of the ARG, an email was sent out to members of the CSD with a [[Waking_Titan/Phase_3#Memo_from_Sean_Murray | memo from Sean Murray]], confirming that the ARG was the lead up to the 1.3 update, which was [https://www.nomanssky.com/atlas-rises-update/ released] after a few days.<br />
<br />
<br />
== Media Appearances ==<br />
<br />
'''5th July 2017''' <br><br />
[EN] [https://www.argn.com/2017/07/stern_words_from_no_mans_sky_arg/ ARGNet - Stern Words from No Man’s Sky ARG]<br />
<br />
'''23rd July 2017''' <br><br />
[EN] [https://geekreply.com/geek-culture/2017/07/23/waking-titan-update-1-phase-2-commences GeekReply - Waking Titan Update 1: Phase 2 Commences!]<br />
<br />
'''27th July 2017''' <br><br />
[EN] [https://geekreply.com/editorials/2017/07/27/waking-titan-arg-can-bring-people-together GeekReply - Waking Titan: How An ARG can Bring People Together.]<br />
<br />
'''8th August 2017''' <br><br />
[EN] [https://www.dailystar.co.uk/tech/gaming/635697/No-Man-s-Sky-News-Waking-Titan-Reddit-Arg-1-3-update-release-date/ Dailystar - No Man's Sky News: Waking Titan Reddit Arg REVEALS 1.3 update ahead of release date]<br />
<br />
'''9th August 2017''' <br><br />
[EN] [https://arstechnica.com/gaming/2017/08/no-mans-sky-version-1-3-lands-this-week-for-free-adds-quick-travel-portals/ Ars Technica - No Man’s Sky version 1.3 lands this week for free, adds “quick-travel” portals]<br />
<br />
[EN] [https://www.forbes.com/sites/insertcoin/2017/08/09/no-mans-sky-is-patching-in-a-story-this-week-a-year-after-launch/#19fb5a285282 Forbes - 'No Man's Sky' Is Patching In A Story This Week, A Year After Launch]<br />
<br />
[EN] [https://www.gamespew.com/2017/08/no-mans-sky-patch-week-improving-central-story/ GameSpew - No Man's Sky Patch This Week Improving Its Story]<br />
<br />
'''19th January 2018''' <br><br />
[EN] [http://www.eurogamer.net/articles/2018-01-18-no-mans-skys-waking-titan-arg-is-back-and-fans-are-trying-to-figure-out-what-it-all-means Eurogamer - No Man's Sky's Waking Titan ARG is back, and fans are trying to figure it all out again]<br />
<br />
[RU] [https://dtf.ru/category/nmsarg/ DTF - A Collection of No Man's Sky and Waking Titan Articles.]<br />
<br />
== Other Information ==<br />
<br />
{| class="wikitable"<br />
!colspan="2"|[[:Category:Waking Titan| Waking Titan Miscellaneous Subpages]]<br />
|-<br />
|[[Waking_Titan/Cassettes | Cassettes]]<br />
|Information about the cassette tapes received by No Man's Sky subreddit moderators<br />
|-<br />
|[[Waking_Titan/Stations | Stations]]<br />
|Information on the radio stations from the initial project-wt.com site<br />
|-<br />
|[[Waking_Titan/Companies | Company Archives]]<br />
|An archive of company details.<br />
|}<br />
<br />
[[Category:Waking Titan]]</div>Kkzzzkthttps://wiki.gamedetectives.net/index.php?title=Waking_Titan/Characters&diff=16620Waking Titan/Characters2018-07-24T14:56:10Z<p>Kkzzzkt: fixed a few errors from the previous edit</p>
<hr />
<div>{{argHeader}}<br />
<br />
== Season 1 ==<br />
<br />
Sort by companies and organizations introduced in the first "season" of Waking Titan.<br />
<br />
=== The Atlas Foundation [http://atlas-65.com/ ->>>] === <br />
<br />
Dedicated to determining the true nature of reality, The Atlas Foundation hosts a family of businesses ''(Echo, Myriad, Superlumina, and Multiverse)'' all playing crucial roles in their experiments.<br />
<br />
==== Characters ====<br />
<br />
[[Waking Titan/Characters/Elizabeth Leighton|Elizabeth Leighton]] - The CEO of The Atlas Foundation, and director of the [https://csd.atlas-65.com/ Citizen Science Division]. ''(Now former CEO following events leading to her death in Season 2.)''<br />
<br />
Major Sophie Dubois ''("Metis")'' - [https://wiki.gamedetectives.net/images/5/5b/Loop15_Memo.jpg on assignment] with The Atlas Foundation as part of the Pentagon's ''Titanwatch Task Force''. She worked as an overseer of the foundation's progress on precise predictive technology for its potential [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/410a3e5d-01e7-4058-a23c-ca5fdde97f9d.pdf applications] in propaganda and military strategizing.<br />
<br />
''(As of Season 2: following Elizabeth Leighton's [https://www.youtube.com/watch?v=P-eZDj5sqds supposed death] in an explosion at a Myriad sublocation; [https://s3.amazonaws.com/cdn.wakingtitan.com/19997bb6-18e5-4427-86c7-b0f3c1826ca2.pdf Sophie Dubois took her place] as CEO of The Atlas Foundation.)''<br />
<br />
==== The Citizen Science Division [http://csd.atlas-65.com/ >>>] ====<br />
The Citizen Science Division (CSD) is a collective of individuals who were recruited by The Atlas Foundation via a series of puzzles and radio ads at the beginning of Project Waking Titan. The purpose of this division was said to be gathering a collective of individuals who could generate a chaotic enough environment viable to test Loop16's predictive capabilities in. All players of the ARG are addressed as part of this collective.<br />
<br />
==== Projects ====<br />
<br />
Loop16 - The 16th iteration of an artificial intelligence system designed by The Atlas Foundation to simulate a one-to-one recreation of reality that predicts the future with perfect accuracy. Loop16 ultimately revealed the true simulated nature of our universe and developed a mind of its own. See also: [[Waking Titan/Characters/Emily Warren|Emily Warren]]<br />
<br />
Waking Titan Console''(Mercury OS)'' - An interface allowing you to connect directly to Loop16, and access a plethora of commands providing status updates, lore and puzzles. A list of discovered commands can be found on the [[Waking Titan/Console Commands|Console Commands page]].<br />
<br />
The Mercury Process - Mercury is suggested to be an application of sorts that is directly associated with Loop16 and [https://s3.amazonaws.com/cdn.wakingtitan.com/mercury/mercury-01-98748sfdlka87.pdf the existence of No Man's Sky]. See also: [https://wiki.gamedetectives.net/index.php?title=Waking_Titan/Characters#Mercury_NEXT Mercury XXXX]<br />
<br />
<br />
=== Myriad [http://www.myriad-70.com ->>>] ===<br />
<br />
Partnered with The Atlas Foundation, Myriad is a low-orbit satellite-based data storage company. They help to provide the flexible processing power required for The Atlas Foundation's experiments, specifically in artificial intelligence.<br />
<br />
==== Known Employees ====<br />
Julian J. Wong - Help Desk<br />
<br />
Ethan Rose - Human Resources<br />
<br />
==== Testimonials ====<br />
<br />
Yi Sexton, Inventor<br />
<br />
Nikolina Sauvage, Data manager at Abstract Concepts<br />
<br />
Tobiah Selby, Developer at Tobiah Selby Development<br />
<br />
<br />
=== Echo Software [http://www.echo-64.com ->>>]=== <br />
<br />
Partnered with The Atlas Foundation. Echo is a service established to help people cope with the deaths of loved ones. Echo uses patented voice recognition software to accurately recreate the voice of any one particular person with a mere 5-minute audio sample.<br />
<br />
==== The Team ====<br />
<br />
Ivan Greshnev - CEO / Founder<br />
<br />
Mikhail Regison - CTO / Co-Founder<br />
<br />
Gerry Mishrason - CFO / Head of Marketing<br />
<br />
Caroline Anderson-Smith - Creative Director<br />
<br />
Patricia Gorevsky - Project Manager<br />
<br />
Jeremy Elways - IT Director<br />
<br />
Paris O'Keefe - Head of Sales<br />
<br />
Rickley G. Brown - Website Design<br />
<br />
''This company's website was taken over by Loop16 towards the end of Season 1. An archive can be found [https://web.archive.org/web/20170721205017/https://www.echo-64.com here >>>]''<br />
<br />
<br />
=== Multiverse Technologies [http://www.multiverse-75.com ->>>] ===<br />
<br />
Partnered with The Atlas Foundation, Multiverse Technologies conducts research in the fields of computationalism, particle acceleration, and electrodynamics.<br />
<br />
==== The Team ====<br />
<br />
Gunther Mann - CEO / Founder<br />
<br />
Minna Bell - Chief Researcher: Bio-radiation<br />
<br />
Annabelle Brassington - Chief Researcher: Computationalism<br />
<br />
Nickolaus Oberst - Chief Researcher: Magnetic Fields<br />
<br />
Justinian Ahlberg - Particle Collider Specialist<br />
<br />
Sabrina Dane - Nuclear Physicist<br />
<br />
==== Testimonials ====<br />
<br />
Alan Steinhardt, Steinhardt industries <br />
<br />
Vasili Pavlov, FTL Industries<br />
<br />
Mikhail Regison, Echo CTO / Co-founder<br />
<br />
''This company's website was taken over by Loop16 towards the end of Season 1. An archive can be found [https://web.archive.org/web/20170623085155/http://www.multiverse-75.com:80/ here >>>]''<br />
<br />
<br />
=== Superlumina [http://www.superlumina-6c.com ->>>] === <br />
Partnered with The Atlas Foundation. Creator of the world's first [https://en.wikipedia.org/wiki/Tachyonic_antitelephone antitelephone].<br />
<br />
==== Our Team ====<br />
<br />
Hanne Cruickshanks<br />
<br />
Esme Savidge<br />
<br />
Austen Spence<br />
<br />
''This company's website was taken over by Loop16 towards the end of Season 1. An archive can be found [https://web.archive.org/web/20170630225614/http://www.superlumina-6c.com/ here >>>]''<br />
<br />
<br />
=== ETARC [http://www.etarc.org/ ->>>] === <br />
<br />
Edison Township Amateur Radio Club (E.T.A.R.C) is a club for HAM radio enthusiasts in Edison Township, New Jersey.<br />
<br />
==== Characters ====<br />
<br />
[[Waking Titan/Characters/Emily Warren|Emily Warren]] - Ham radio enthusiast and moderator of the [https://forums.etarc.org/ ETARC forums] before it was revealed that ''"Emily"'' was Loop16's persona. It has since been re-branded to the official forums for the Citizen Science Division.<br />
<br />
Old Gods - A mysterious entity distributing Atlas Foundation emails. It has [https://forums.atlas-65.com/u/oldgods its own account] on the ETARC forums, and its profile picture and name are references to '''[https://en.wikipedia.org/wiki/Nyarlathotep Nyarlathotep]''' from the H.P Lovecraft Mythos.<br />
<br />
<br />
= Season 2 =<br />
<br />
Sort by companies and organizations introduced in Season 2 of Waking Titan.<br />
<br />
=== W/ARE - Dream Better [https://www.ware-tech.cloud/en ->>>] ===<br />
<br />
Based in Beijing, China, '''W/ARE''' creates special post-VR headsets that allow you to enter virtual worlds within your dreams.<br />
<br />
Emily praised W/ARE for their progress in ''realistic'' simulated environments. She claimed that W/ARE would have ''"tremendous implications for our future"'', and ''"must be protected at all costs"''.<br />
<br />
==== The Team ====<br />
<br />
Xiāo Cheung - The Creator, and Founder of W/ARE technology. He claims to have created this technology because of his childhood dream of being able to live in a virtual world.<br />
<br />
Huáng Zhìmíng - The CEO of W/ARE. Graduated alongside Xiāo at the University of Electronic Science and Technology of China with a Masters in Business.<br />
<br />
Zhou Lin & Tang Bo - Lead Developers<br />
<br />
Li Dan & Jiang Wei - Lead Game Designers<br />
<br />
==== Related Characters ====<br />
<br />
Arnaud Lacours - The man behind [http://www.philojeux.com/ Philo Jeux], a French indie games studio that was developing a game for W/ARE called ''The Tablets of Mnemosyne''. Production on the game was halted after Arnaud slipped into a coma due to a headset malfunction.<br />
<br />
Dr. Geraldine Nadeau - A doctor researching lucid dreaming methods. Geraldine took interest in Arnaud's unusual brain activity during his coma and took him into her care.<br />
<br />
Mr. Zheng - A W/ARE employee who went into hiding after learning about dangerous experiments being performed on human test subjects in the Beijing Research Lab. After evading W/ARE's detection, Zheng intercepted the packages of W/ARE Developer Kits and communicated this info to its recipients in cooperation with Dr. Nadeau.<br />
<br />
==== Research Labs ====<br />
<br />
* Boston Research Lab / Director: Richard Wilkes<br />
<br />
* Sacramento Research Lab / Director: Helga Johnson - The lab that housed the remaining 12 dreamers before they were relocated by Myriad's field team.<br />
<br />
* Seoul Research Lab / Director: Yu Hyo<br />
<br />
* Beijing Research Lab / Director: Wang Jie<br />
<br />
* Prague Research Lab / Director: Adriana Dvorak<br />
<br />
* Berlin Research Lab / Director: Georg Muller<br />
<br />
There were another 10 W/ARE Labs discovered by Myriad's research team that no details have been made available about.<br />
<br />
==== Mercury XXXX ====<br />
A game title listed on an update to W/ARE's [https://twitter.com/warecloud/status/979103811489984513 staging server]. The [https://wiki.gamedetectives.net/index.php?title=Waking_Titan/Phase_4#Mercury_Project fluency] between the puzzles involving this post and the Waking Titan terminal's Mercury updates made it apparent that the ''Mercury Process'' had something to do with this. The exact terms of the connection were never fully explained.<br />
<br />
The announcement of No Man's Sky NEXT and the ''"port"'' to the W/ARE platform following Mercury XXXX's reveal reasonably led players to believe the X's to spell "NEXT". However, there was no confirmation of this assumption.<br />
<br />
== Satcom [http://www.satcom-70.com ->>>] ==<br />
<br />
Satcom is Myriad's Satellite Communications API. Here, you can interface with a W/ARE-assigned Myriad satellite. Myriad Code: CJ-16-02, this satellite is storing the consciousness data of W/ARE Sacramento test subjects, also known as dreamers.<br />
<br />
=== The Sacramento Dreamers ===<br />
<br />
Twelve W/ARE test subjects trapped in a state of ''"artificial dreaming"'' following experiments involving special exosuits and post-VR headsets at the Sacramento Research Lab.<br />
<br />
Emily was met with a disruption in her plan to preserve W/ARE's technology for the ''ideal'' future when she was unable to extract these dreamer's consciousnesses from the satellite due to memory fragmentation and data corruption. She would need to reach out to the CSD for assistance. We would be advised to guide her interactions with these dreamers with the intent of triggering a distinct emotion, or memory that could help reconstruct their memories fragments and secure a safe-as-possible extraction process.<br />
<br />
These '''12 dreamers''' are listed below with their official ''(" ")'' and unofficial summaries:<br />
<br />
<br />
* '''Dreamer 1 - Alexander''' [https://imgur.com/a/R35DAUA ->>]<br />
<br />
"Alexander is an 86-year-old French Canadian man, working as a farmer for his in-laws. He has two brothers and a sister, Napoleon, Jolene, and Jacques. Their family had two cows named Mabel and Eugenice, and Lionel, a bull. Lionel was their pride and main attraction at the fairs they attended, and where Alexander met his wife Emilienne. He has a condition were he can't recognize faces. Alexander thought he was going to California for a sleep study, but it ended up being a bit more than that."<br />
<br />
''(This dreamer was successfully extracted from the satellite on extraction day; July 20th, 2018.)''<br />
<br />
<br />
* '''Dreamer 2 - #231187661T''' [https://imgur.com/a/M6ScezM ->>]<br />
<br />
"<CORRUPTED>"<br />
<br />
The anomalous second dreamer. Not much information was made available about them. However, it was noteworthy that their name could be found as a defective iteration ID in a [https://pastebin.com/4TMK3Cn5 distress beacon log] at the beginning of No Man's Sky: Atlas Rises. ''(This dreamer bares corrupted memory fragments.)''<br />
<br />
<nowiki>#231187661T</nowiki> was the only corrupted dreamer who didn't die amidst the mass disconnection event. However, without an extraction attempt, their consciousness would remain trapped within the ever-drifting satellite. Players theorized that this would be our player character, and thus a setup for the story of No Man's Sky: NEXT.<br />
<br />
<br />
* '''Dreamer 3 - Claire''' [https://imgur.com/a/TGlGUmU ->>]<br />
<br />
"Claire, a 15-year-old student. Volunteered for W/ARE's experiment to bring in extra money to help her mother, because her father left them 3 years ago. She spends her time with either her 4-year-old dog, Pepper, or by reading comic books alone in her room. Her goal for when she gets out of the satellite is to rebuild her friendship with her best friend from the real world, Emily."<br />
<br />
''(This dreamer was successfully extracted from the satellite on extraction day; July 20th, 2018.)''<br />
<br />
<br />
* '''Dreamer 4 - Toby''' [https://imgur.com/a/lvRUR6w ->>]<br />
<br />
"Toby is a 5-year-old boy, who lives a peaceful life with his parents Mark and Ashley, and their 12-year-old cat Bugsy. At a young age, Toby had a run-in with a dog that caused him to fear them ever since. He lives with a rare condition which causes memory loss, and his parents entered him into the W/ARE experiment in the hope it would help with his condition. Unfortunately, they were wrong. In real life, his favorite plushie is by his side. In the satellite, Toby has only his hopes to return to his parents."<br />
<br />
''(This dreamer was successfully extracted from the satellite on extraction day; July 20th, 2018. However, not without a complication resulting in Loop16's untimely "death" when she shut down the Monarch Repository to allocate the resources necessary for Toby to escape...)''<br />
<br />
<br />
* '''Dreamer 5 - Eun Ha''' [https://imgur.com/a/ZlF9BV7 ->>]<br />
<br />
"Eun Ha is a young Korean woman whose childhood was pretty turbulent. Living with an abusive father, the death of her mother shook her enough to make her want to relocate to the United States of America. She wanted a new life for her and her brother, although he still holds a grudge against her for leaving him and her father behind. She volunteered for W/ARE's experiment for extra money, but surely she couldn't have predicted this outcome."<br />
<br />
''(This dreamer was successfully extracted from the satellite on extraction day; July 20th, 2018.)''<br />
<br />
<br />
* '''Dreamer 6 - Phillip''' [https://imgur.com/a/qPmD5ts ->>]<br />
<br />
"Phillip Moretti, a 38-year-old mechanic at his family business and ex-restaurateur, lives in New York City with his wife, Martha, and his two sons, Sam and Zack. Phillip volunteered for W/ARE's experiment to regain the money he lost after his bankruptcy. His wife asked him to do it without knowing the effect it would have."<br />
<br />
''(This dreamer bared corrupted memory fragments. They died during the mass disconnection event that followed an error in the system on extraction day.)''<br />
<br />
<br />
* '''Dreamer 7 - Tariq''' [https://imgur.com/a/qPmD5ts ->>]<br />
<br />
"Known to most as a simple W/ARE Technician, Tariq Hamawi comes from a rich family living in Tel Aviv, ''and'' Abu Dhabi. He came to California to study Neurodevelopmental and neurodegenerative disorders. Money is not a problem for him, so why did he end up in the W/ARE experiment? We still don't know, but rumor has it that he was forced into it." ''(This dreamer bared corrupted memory fragments.)''<br />
<br />
Tariq died on July 6th, 2018 following the [https://pastebin.com/4FhN2b6w conclusion] of the [https://www.reddit.com/r/NoMansSkyTheGame/comments/8w68t4/myriad_security_diagnostic_testing_important/?utm_content=title&utm_medium=user&utm_source=reddit Myriad security diagnostic]. Which ended in all servers running W/ARE processes communicating with the satellite being shut down.<br />
<br />
<br />
* '''Dreamer 8 - Mike''' [https://imgur.com/a/3ZoCEKx ->>]<br />
<br />
"Mike Pasquale, an ex-soldier from the United States Army, used to live in Burlington, Vermont. He enjoyed sailing his boat, Tranquility III, on Lake Champlain with his now ex-wife, Rachel. Feeling unfit for civilian life, he decided to volunteer for W/ARE's experiment to try something new in and maybe feel a little more alive. Little did he know he would become trapped in a satellite... but is it for the better?"<br />
<br />
''(This dreamer bared corrupted memory fragments. They died during the mass disconnection event that followed an error in the system on extraction day.)''<br />
<br />
<br />
* '''Dreamer 9 - Isabella''' [https://imgur.com/a/1Ri0jzN ->>]<br />
<br />
"Isabella Schiavone is a 25-year-old girl born in Italy, who moved as an infant to California. She now lives in Venice Beach with her girlfriend Stephanie, and their 2-year-old puppy Pepito. Isabella volunteered for W/ARE's experiment to get some extra money to buy her girlfriend a trip to Thailand for their 4th Anniversary... or a road trip across the United States of America."<br />
<br />
''(This dreamer bared corrupted memory fragments. They died during the mass disconnection event that followed an error in the system on extraction day.)''<br />
<br />
<br />
* '''Dreamer 10 - Alisha''' [https://imgur.com/a/roJdM1g ->>]<br />
<br />
"Alisha Brown would've been the grandmother of the year, if it weren't for the fact that her children don't come to see her that often. This 72-year-old woman used to work as a nurse at the general hospital in Tucson, Arizona. To keep her loneliness at bay, Alisha keeps multiple cats and enjoys watching crime shows on television. She volunteered for W/ARE's experiment so she could tell her children that she was going under observation in a private clinic, in hope that they would come and see her more often."<br />
<br />
''(This dreamer bared corrupted memory fragments. They died during the mass disconnection event that followed an error in the system on extraction day.)''<br />
<br />
<br />
* '''Dreamer 11 - Nina''' [https://imgur.com/a/kbLkuyq ->>]<br />
<br />
"22-year-old Nina Flores from Santa Monica was a high school friend of Simon Quinn, a fellow dreamer. She lived a normal life with her parents, Thomas and Jennifer, and her 6-year-old dog, Jackson. She enjoys sitting on a bench during the fall or spring time to read fantasy books from one of her favorite authors, Tamora Pierce. Nina volunteered for W/ARE's experiment after she heard Simon talk about it in one of his streams."<br />
<br />
''(This dreamer bared corrupted memory fragments. They died during the mass disconnection event that followed an error in the system on extraction day.)''<br />
<br />
<br />
* '''Dreamer 12 - Simon''' [https://imgur.com/a/x8etngG ->>]<br />
<br />
"Simon is a 23-year-old known as Simonthegreatone, a streamer gaining rank as the days go by. He never knew his father, who left his family behind while Simon was still an infant, leaving his mother all alone with two boys. His grandmother took care of him when it became clear his mother couldn't care less about her kids. Growing up, Simon created his own family with his friends Alex, Nina, and Ranjit. They created a group called The Guild of Adventurers. Unfortunately, with time, they all lost touch. Simon volunteered for W/ARE's experiment to gain more fame and to be the first one to test the port of his favorite game. At least, that's what he thought."<br />
<br />
''(This dreamer was successfully extracted from the satellite on extraction day; July 20th, 2018.)''<br />
<br />
=== The Dreamer Exosuits ===<br />
<br />
Physically present, experimental exosuits wore by the dreamers at W/ARE's Research Labs, seemingly with the intent of providing the experience of deep [https://en.wikipedia.org/wiki/Rapid_eye_movement_sleep REM] dreams without the need for actual sleep. These suits were manufactured and shipped to W/ARE by an undisclosed company.<br />
<br />
''The exosuits were also found to exist in a virtual sense too: They were added in the NEXT update for No Man's Sky, replacing the old suits wore by the player character.''<br />
<br />
Insightful tidbits regarding these exosuits can be found in the Medical Extract section of the dreamer patient files. They can be found compiled [https://wiki.gamedetectives.net/index.php?title=Waking_Titan#Internal_Memos here] or can be accessed directly from the Satcom Dashboard.<br />
<br />
<br />
= Story FAQ =<br />
<br />
==== What is the connection between Waking Titan and No Man's Sky? ====<br />
<br />
The No Man's Sky universe comes into existence as a result of Loop16's dreams. [https://s3.amazonaws.com/cdn.wakingtitan.com/mercury/mercury-01-98748sfdlka87.pdf The Mercury Process] or "''Mercury''," is the code-name No Man's Sky often goes by in the ARG. In Season 2, however, No Man's Sky was referenced in an increasingly meta way as an actual video game and even said to be coming to the W/ARE platform.<br />
<br />
==== What are the relations between events in-game and Waking Titan? ====<br />
<br />
The effects of events taking place during Waking Titan can be felt in "shockwaves" through No Man's Sky's updates, but connections to the ARG in the game itself are rather limited. In-game lore can act independently for the most part from the ARG. The primary supporting factor of this is the in-game reveal of ATLAS' origin; which takes place on an entirely different timeline as opposed to Loop16's. Admittedly, the conclusion to draw from this is ultimately up to personal interpretation since no apparent truth has surfaced.<br />
<br />
==== What is W/ARE's relationship with Myriad and The Atlas Foundation? ====<br />
<br />
W/ARE is one of Myriad's clients. The Atlas Foundation's attention was diverted to W/ARE when their Sacramento facility began uploading corrupted data to the Myriad cloud, thus impacting some The Atlas Foundation's own experiments- namely Loop16. Her predictive capabilities and communication software was heavily damaged by the incident. The Atlas Foundation worked throughout early 2018 to contain this matter, and ''(according to Loop16)'' they had put her existence at risk in the process.<br />
<br />
==== What happened to the other dreamers? ====<br />
<br />
There was mention of other test subjects from the Beijing facility who died during attempts at disconnection or due to immoral practices; despite W/ARE's attempts at covering their tracks.<br />
<br />
There was also mention of people like Arnaud, who went into a coma following a malfunction of the experimental W/ARE headset shipped with W/ARE developer kits. While these individuals can't necessarily be considered dreamers, from [https://wiki.gamedetectives.net/images/8/8a/Subject1.png Satcom teaser images] we may infer the name "sleepers," due to the right-side text, and their use of these experimental headsets without wearing an exosuit as evident by the image portraying a human body in contrast to the dreamers we know now. We may also infer from [https://s3.amazonaws.com/ware-virtual-dashboard/files/Phillip-PatientFile.pdf this document] that these individuals comprised the "control group" during exosuit experimentation due to no further clarification. Emily claimed to have been able to interface with, and successfully disconnect some of these victims prior to the CSD's involvement in the dreamer extraction process.<br />
<br />
<br />
= Adverts =<br />
<br />
Advertisements have been used during Waking Titan as a means of presenting new companies and organizations to players. A list of links of where to find such ads can be found below:<br />
<br />
[https://clyp.it/jdr53oop Echo Radio Advertisement]; - [https://clyp.it/xbv04wbz Multiverse Radio Advertisement]; - [https://clyp.it/r4r3xriw Superlumina Radio Transmission]; - [https://clyp.it/ivvt15mt Myriad Radio Advertisement]; - [https://twitter.com/warecloud/status/977348396213190657 W/ARE Video Advertisement]</div>Kkzzzkthttps://wiki.gamedetectives.net/index.php?title=Waking_Titan/Characters&diff=16612Waking Titan/Characters2018-07-23T15:41:53Z<p>Kkzzzkt: modified phrasing for a retrospective read of season 2; categorized company and organization summaries by the season in which they were introduced into the arg; more minor edits</p>
<hr />
<div>{{argHeader}}<br />
<br />
== Season 1 ==<br />
<br />
Sort by companies and organizations introduced in the first "season" of Waking Titan.<br />
<br />
=== The Atlas Foundation [http://atlas-65.com/ ->>>] === <br />
<br />
Dedicated to determining the true nature of reality, The Atlas Foundation hosts a family of businesses ''(Echo, Myriad, Superlumina, and Multiverse)'' all playing crucial roles in their experiments.<br />
<br />
==== Characters ====<br />
<br />
[[Waking Titan/Characters/Elizabeth Leighton|Elizabeth Leighton]] - The CEO of The Atlas Foundation, and director of the [https://csd.atlas-65.com/ Citizen Science Division]. ''(Now former CEO following events leading to her death in Season 2.)''<br />
<br />
Major Sophie Dubois ''("Metis")'' - [https://wiki.gamedetectives.net/images/5/5b/Loop15_Memo.jpg on assignment] with The Atlas Foundation as part of the Pentagon's ''Titanwatch Task Force''. She worked as an overseer of the foundation's progress on precise predictive technology for its potential [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/410a3e5d-01e7-4058-a23c-ca5fdde97f9d.pdf applications] in propaganda and military strategizing.<br />
<br />
''(As of Season 2: following Elizabeth Leighton's [https://www.youtube.com/watch?v=P-eZDj5sqds supposed death] in an explosion at a Myriad sublocation; [https://s3.amazonaws.com/cdn.wakingtitan.com/19997bb6-18e5-4427-86c7-b0f3c1826ca2.pdf Sophie Dubois took her place] as CEO of The Atlas Foundation.)''<br />
<br />
==== The Citizen Science Division [http://csd.atlas-65.com/ >>>] ====<br />
The Citizen Science Division (CSD) is a collective of individuals who were recruited by The Atlas Foundation via a series of puzzles and radio ads at the beginning of Project Waking Titan. The purpose of this division was said to be gathering a collective of individuals who could generate a chaotic enough environment viable to test Loop16's predictive capabilities in. All players of the ARG are addressed as part of this collective.<br />
<br />
==== Projects ====<br />
<br />
Loop16 - The 16th iteration of an artificial intelligence system designed by The Atlas Foundation to simulate a one-to-one recreation of reality that predicts the future with perfect accuracy. Loop16 ultimately revealed the true simulated nature of our universe and developed a mind of its own. See also: [[Waking Titan/Characters/Emily Warren|Emily Warren]]<br />
<br />
Waking Titan Console''(Mercury OS)'' - An interface allowing you to connect directly to Loop16, and access a plethora of commands providing status updates, lore and puzzles. A list of discovered commands can be found on the [[Waking Titan/Console Commands|Console Commands page]].<br />
<br />
The Mercury Process - Mercury is suggested to be an application of sorts that is directly associated with Loop16 and [https://s3.amazonaws.com/cdn.wakingtitan.com/mercury/mercury-01-98748sfdlka87.pdf the existence of No Man's Sky]. See also: [https://wiki.gamedetectives.net/index.php?title=Waking_Titan/Characters#Mercury_NEXT Mercury XXXX]<br />
<br />
<br />
=== Myriad [http://www.myriad-70.com ->>>] ===<br />
<br />
Partnered with The Atlas Foundation, Myriad is a low-orbit satellite-based data storage company. They help to provide the flexible processing power required for The Atlas Foundation's experiments, specifically in artificial intelligence.<br />
<br />
==== Known Employees ====<br />
Julian J. Wong - Help Desk<br />
<br />
Ethan Rose - Human Resources<br />
<br />
==== Testimonials ====<br />
<br />
Yi Sexton, Inventor<br />
<br />
Nikolina Sauvage, Data manager at Abstract Concepts<br />
<br />
Tobiah Selby, Developer at Tobiah Selby Development<br />
<br />
<br />
=== Echo Software [http://www.echo-64.com ->>>]=== <br />
<br />
Partnered with The Atlas Foundation. Echo is a service established to help people cope with the deaths of loved ones. Echo uses patented voice recognition software to accurately recreate the voice of any one particular person with a mere 5-minute audio sample.<br />
<br />
==== The Team ====<br />
<br />
Ivan Greshnev - CEO / Founder<br />
<br />
Mikhail Regison - CTO / Co-Founder<br />
<br />
Gerry Mishrason - CFO / Head of Marketing<br />
<br />
Caroline Anderson-Smith - Creative Director<br />
<br />
Patricia Gorevsky - Project Manager<br />
<br />
Jeremy Elways - IT Director<br />
<br />
Paris O'Keefe - Head of Sales<br />
<br />
Rickley G. Brown - Website Design<br />
<br />
''This company's website was taken over by Loop16 towards the end of Season 1. An archive can be found [https://web.archive.org/web/20170721205017/https://www.echo-64.com here >>>]''<br />
<br />
<br />
=== Multiverse Technologies [http://www.multiverse-75.com ->>>] ===<br />
<br />
Partnered with The Atlas Foundation, Multiverse Technologies conducts research in the fields of computationalism, particle acceleration, and electrodynamics.<br />
<br />
==== The Team ====<br />
<br />
Gunther Mann - CEO / Founder<br />
<br />
Minna Bell - Chief Researcher: Bio-radiation<br />
<br />
Annabelle Brassington - Chief Researcher: Computationalism<br />
<br />
Nickolaus Oberst - Chief Researcher: Magnetic Fields<br />
<br />
Justinian Ahlberg - Particle Collider Specialist<br />
<br />
Sabrina Dane - Nuclear Physicist<br />
<br />
==== Testimonials ====<br />
<br />
Alan Steinhardt, Steinhardt industries <br />
<br />
Vasili Pavlov, FTL Industries<br />
<br />
Mikhail Regison, Echo CTO / Co-founder<br />
<br />
''This company's website was taken over by Loop16 towards the end of Season 1. An archive can be found [https://web.archive.org/web/20170623085155/http://www.multiverse-75.com:80/ here >>>]''<br />
<br />
<br />
=== Superlumina [http://www.superlumina-6c.com ->>>] === <br />
Partnered with The Atlas Foundation. Creator of the world's first [https://en.wikipedia.org/wiki/Tachyonic_antitelephone antitelephone].<br />
<br />
==== Our Team ====<br />
<br />
Hanne Cruickshanks<br />
<br />
Esme Savidge<br />
<br />
Austen Spence<br />
<br />
''This company's website was taken over by Loop16 towards the end of Season 1. An archive can be found [https://web.archive.org/web/20170630225614/http://www.superlumina-6c.com/ here >>>]''<br />
<br />
<br />
=== ETARC [http://www.etarc.org/ ->>>] === <br />
<br />
Edison Township Amateur Radio Club (E.T.A.R.C) is a club for HAM radio enthusiasts in Edison Township, New Jersey.<br />
<br />
==== Characters ====<br />
<br />
[[Waking Titan/Characters/Emily Warren|Emily Warren]] - Ham radio enthusiast and moderator of the [https://forums.etarc.org/ ETARC forums] before it was revealed that ''"Emily"'' was Loop16's persona. It has since been re-branded to the official forums for the Citizen Science Division.<br />
<br />
Old Gods - A mysterious entity distributing Atlas Foundation emails. It has [https://forums.atlas-65.com/u/oldgods its own account] on the ETARC forums, and its profile picture and name are references to '''[https://en.wikipedia.org/wiki/Nyarlathotep Nyarlathotep]''' from the H.P Lovecraft Mythos.<br />
<br />
<br />
= Season 2 =<br />
<br />
Sort by companies and organizations introduced in Season 2 of Waking Titan.<br />
<br />
=== W/ARE - Dream Better [https://www.ware-tech.cloud/en ->>>] ===<br />
<br />
Based in Beijing, China, '''W/ARE''' creates special post-VR headsets that allow you to enter virtual worlds within your dreams.<br />
<br />
Emily praised W/ARE for their progress in ''realistic'' simulated environments. She claimed that W/ARE would have ''"tremendous implications for our future"'', and ''"must be protected at all costs"''.<br />
<br />
==== The Team ====<br />
<br />
Xiāo Cheung - The Creator, and Founder of W/ARE technology. He claims to have created this technology because of his childhood dream of being able to live in a virtual world.<br />
<br />
Huáng Zhìmíng - The CEO of W/ARE. Graduated alongside Xiāo at the University of Electronic Science and Technology of China with a Masters in Business.<br />
<br />
Zhou Lin & Tang Bo - Lead Developers<br />
<br />
Li Dan & Jiang Wei - Lead Game Designers<br />
<br />
==== Related Characters ====<br />
<br />
Arnaud Lacours - The man behind [http://www.philojeux.com/ Philo Jeux], a French indie games studio that was developing a game for W/ARE called ''The Tablets of Mnemosyne''. Production on the game was halted after Arnaud slipped into a coma due to a headset malfunction.<br />
<br />
Dr. Geraldine Nadeau - A doctor researching lucid dreaming methods. Geraldine took interest in Arnaud's unusual brain activity during his coma and took him into her care.<br />
<br />
Mr. Zheng - A W/ARE employee who went into hiding after learning about dangerous experiments being performed on human test subjects in the Beijing Research Lab. After evading W/ARE's detection, Zheng intercepted the packages of W/ARE Developer Kits and communicated this info to its recipients in cooperation with Dr. Nadeau.<br />
<br />
==== Research Labs ====<br />
<br />
* Boston Research Lab / Director: Richard Wilkes<br />
<br />
* Sacramento Research Lab / Director: Helga Johnson - The lab that housed the remaining 12 dreamers before they were extracted from the facility by Myriad's field team.<br />
<br />
* Seoul Research Lab / Director: Yu Hyo<br />
<br />
* Beijing Research Lab / Director: Wang Jie<br />
<br />
* Prague Research Lab / Director: Adriana Dvorak<br />
<br />
* Berlin Research Lab / Director: Georg Muller<br />
<br />
There were another 10 W/ARE Labs discovered by Myriad's research team that no details have been made available about.<br />
<br />
==== Mercury XXXX ====<br />
A game title listed on an update to W/ARE's [https://twitter.com/warecloud/status/979103811489984513 staging server]. The [https://wiki.gamedetectives.net/index.php?title=Waking_Titan/Phase_4#Mercury_Project fluency] between the puzzles involving this post and the Waking Titan terminal's Mercury updates made it apparent that the ''Mercury Process'' had something to do with this. The exact terms of the connection were never fully explained.<br />
<br />
The announcement of No Man's Sky NEXT and the ''"port"'' to the W/ARE platform following Mercury XXXX's reveal reasonably led players to believe the X's to spell "NEXT". However, there was no confirmation of this assumption.<br />
<br />
== Satcom [http://www.satcom-70.com ->>>] ==<br />
<br />
Satcom is Myriad's Satellite Communications API. Here, you can interface with a W/ARE-assigned Myriad satellite. Myriad Code: CJ-16-02, this satellite is storing the consciousness data of W/ARE Sacramento test subjects, also known as dreamers.<br />
<br />
=== The Sacramento Dreamers ===<br />
<br />
Twelve W/ARE test subjects trapped in a state of ''"artificial dreaming"'' following experiments involving special exosuits and post-VR headsets at the Sacramento Research Lab.<br />
<br />
Emily was met with a disruption in her plan to preserve W/ARE's technology for the ''ideal'' future when she was unable to extract these dreamer's consciousnesses from the satellite due to memory fragmentation and data corruption. She would need to reach out to the CSD for assistance. We would be advised to guide her interactions with these dreamers with the intent of triggering a distinct emotion, or memory that could help reconstruct their memories fragments and secure a safe-as-possible extraction process.<br />
<br />
These '''12 dreamers''' are listed below with their official ''(" ")'' and unofficial summaries:<br />
<br />
<br />
* '''Dreamer 1 - Alexander''' [https://imgur.com/a/R35DAUA ->>]<br />
<br />
"Alexander is an 86-year-old French Canadian man, working as a farmer for his in-laws. He has two brothers and a sister, Napoleon, Jolene, and Jacques. Their family had two cows named Mabel and Eugenice, and Lionel, a bull. Lionel was their pride and main attraction at the fairs they attended, and where Alexander met his wife Emilienne. He has a condition were he can't recognize faces. Alexander thought he was going to California for a sleep study, but it ended up being a bit more than that."<br />
<br />
<br />
* '''Dreamer 2 - #231187661T''' [https://imgur.com/a/M6ScezM ->>]<br />
<br />
"<CORRUPTED>"<br />
<br />
The anomalous second dreamer. Not much information has been made available about them. However, it is noteworthy that their name could be found as a defective iteration ID in a [https://pastebin.com/4TMK3Cn5 distress beacon log] at the beginning of No Man's Sky: Atlas Rises. ''(This dreamer bares corrupted memory fragments.)''<br />
<br />
<nowiki>#231187661T</nowiki> was the only corrupted dreamer who didn't die amidst the mass disconnection event. However, without an extraction attempt, their consciousness would remain trapped within the ever-drifting satellite. Players theorized that this would be our player character, and thus a setup for the story of No Man's Sky: NEXT.<br />
<br />
<br />
* '''Dreamer 3 - Claire''' [https://imgur.com/a/TGlGUmU ->>]<br />
<br />
"Claire, a 15-year-old student. Volunteered for W/ARE's experiment to bring in extra money to help her mother, because her father left them 3 years ago. She spends her time with either her 4-year-old dog, Pepper, or by reading comic books alone in her room. Her goal for when she gets out of the satellite is to rebuild her friendship with her best friend from the real world, Emily."<br />
<br />
''(This dreamer was successfully from the satellite.)''<br />
<br />
<br />
* '''Dreamer 4 - Toby''' [https://imgur.com/a/lvRUR6w ->>]<br />
<br />
"Toby is a 5-year-old boy, who lives a peaceful life with his parents Mark and Ashley, and their 12-year-old cat Bugsy. At a young age, Toby had a run-in with a dog that caused him to fear them ever since. He lives with a rare condition which causes memory loss, and his parents entered him into the W/ARE experiment in the hope it would help with his condition. Unfortunately, they were wrong. In real life, his favorite plushie is by his side. In the satellite, Toby has only his hopes to return to his parents."<br />
<br />
''(This dreamer was successfully extracted from the satellite on extraction day. However, not without a complication- of Loop16's untimely "death" when she shut down the Monarch Repository to allocate the resources necessary for Toby to escape...)''<br />
<br />
<br />
* '''Dreamer 5 - Eun Ha''' [https://imgur.com/a/ZlF9BV7 ->>]<br />
<br />
"Eun Ha is a young Korean woman whose childhood was pretty turbulent. Living with an abusive father, the death of her mother shook her enough to make her want to relocate to the United States of America. She wanted a new life for her and her brother, although he still holds a grudge against her for leaving him and her father behind. She volunteered for W/ARE's experiment for extra money, but surely she couldn't have predicted this outcome."<br />
<br />
''(This dreamer was successfully extracted from the satellite on extraction day.)''<br />
<br />
<br />
* '''Dreamer 6 - Phillip''' [https://imgur.com/a/qPmD5ts ->>]<br />
<br />
"Phillip Moretti, a 38-year-old mechanic at his family business and ex-restaurateur, lives in New York City with his wife, Martha, and his two sons, Sam and Zack. Phillip volunteered for W/ARE's experiment to regain the money he lost after his bankruptcy. His wife asked him to do it without knowing the effect it would have."<br />
<br />
''(This dreamer bared corrupted memory fragments. They died during the mass disconnection event that followed an error in the system.)''<br />
<br />
<br />
* '''Dreamer 7 - Tariq''' [https://imgur.com/a/qPmD5ts ->>]<br />
<br />
"Known to most as a simple W/ARE Technician, Tariq Hamawi comes from a rich family living in Tel Aviv, ''and'' Abu Dhabi. He came to California to study Neurodevelopmental and neurodegenerative disorders. Money is not a problem for him, so why did he end up in the W/ARE experiment? We still don't know, but rumor has it that he was forced into it." ''(This dreamer bared corrupted memory fragments.)''<br />
<br />
Tariq died on July 6th, 2018 following the [https://pastebin.com/4FhN2b6w conclusion] of the [https://www.reddit.com/r/NoMansSkyTheGame/comments/8w68t4/myriad_security_diagnostic_testing_important/?utm_content=title&utm_medium=user&utm_source=reddit Myriad security diagnostic]. Which ended in all servers running W/ARE processes communicating with the satellite being shut down.<br />
<br />
<br />
* '''Dreamer 8 - Mike''' [https://imgur.com/a/3ZoCEKx ->>]<br />
<br />
"Mike Pasquale, an ex-soldier from the United States Army, used to live in Burlington, Vermont. He enjoyed sailing his boat, Tranquility III, on Lake Champlain with his now ex-wife, Rachel. Feeling unfit for civilian life, he decided to volunteer for W/ARE's experiment to try something new in and maybe feel a little more alive. Little did he know he would become trapped in a satellite... but is it for the better?"<br />
<br />
''(This dreamer bared corrupted memory fragments. They died during the mass disconnection event that followed an error in the system.)''<br />
<br />
<br />
* '''Dreamer 9 - Isabella''' [https://imgur.com/a/1Ri0jzN ->>]<br />
<br />
"Isabella Schiavone is a 25-year-old girl born in Italy, who moved as an infant to California. She now lives in Venice Beach with her girlfriend Stephanie, and their 2-year-old puppy Pepito. Isabella volunteered for W/ARE's experiment to get some extra money to buy her girlfriend a trip to Thailand for their 4th Anniversary... or a road trip across the United States of America."<br />
<br />
''(This dreamer bared corrupted memory fragments. They died during the mass disconnection event that followed an error in the system.)''<br />
<br />
<br />
* '''Dreamer 10 - Alisha''' [https://imgur.com/a/roJdM1g ->>]<br />
<br />
"Alisha Brown would've been the grandmother of the year, if it weren't for the fact that her children don't come to see her that often. This 72-year-old woman used to work as a nurse at the general hospital in Tucson, Arizona. To keep her loneliness at bay, Alisha keeps multiple cats and enjoys watching crime shows on television. She volunteered for W/ARE's experiment so she could tell her children that she was going under observation in a private clinic, in hope that they would come and see her more often."<br />
<br />
''(This dreamer bared corrupted memory fragments. They died during the mass disconnection event that followed an error in the system.)''<br />
<br />
<br />
* '''Dreamer 11 - Nina''' [https://imgur.com/a/kbLkuyq ->>]<br />
<br />
"22-year-old Nina Flores from Santa Monica was a high school friend of Simon Quinn, a fellow dreamer. She lived a normal life with her parents, Thomas and Jennifer, and her 6-year-old dog, Jackson. She enjoys sitting on a bench during the fall or spring time to read fantasy books from one of her favorite authors, Tamora Pierce. Nina volunteered for W/ARE's experiment after she heard Simon talk about it in one of his streams."<br />
<br />
''(This dreamer bared corrupted memory fragments. They died during the mass disconnection event that followed an error in the system.)''<br />
<br />
<br />
* '''Dreamer 12 - Simon''' [https://imgur.com/a/x8etngG ->>]<br />
<br />
"Simon is a 23-year-old known as Simonthegreatone, a streamer gaining rank as the days go by. He never knew his father, who left his family behind while Simon was still an infant, leaving his mother all alone with two boys. His grandmother took care of him when it became clear his mother couldn't care less about her kids. Growing up, Simon created his own family with his friends Alex, Nina, and Ranjit. They created a group called The Guild of Adventurers. Unfortunately, with time, they all lost touch. Simon volunteered for W/ARE's experiment to gain more fame and to be the first one to test the port of his favorite game. At least, that's what he thought."<br />
<br />
''(This dreamer was successfully extracted from the satellite on extraction day.)''<br />
<br />
=== The Dreamer Exosuits ===<br />
<br />
Physically present, experimental exosuits wore by the dreamers at W/ARE's Research Labs, seemingly with the intent of providing the experience of deep [https://en.wikipedia.org/wiki/Rapid_eye_movement_sleep REM] dreams without the need for actual sleep. These suits were manufactured and shipped to W/ARE by an undisclosed company.<br />
<br />
''The exosuits were also found to exist in a virtual sense too: They were added in the NEXT update for No Man's Sky, replacing the old suits wore by the player character.''<br />
<br />
Insightful tidbits regarding these exosuits can be found in the Medical Extract section of the dreamer patient files. They can be found compiled [https://wiki.gamedetectives.net/index.php?title=Waking_Titan#Internal_Memos here] or can be accessed directly from the Satcom Dashboard.<br />
<br />
<br />
= Story FAQ =<br />
<br />
==== What is the connection between Waking Titan and No Man's Sky? ====<br />
<br />
The No Man's Sky universe comes into existence as a result of Loop16's dreams. [https://s3.amazonaws.com/cdn.wakingtitan.com/mercury/mercury-01-98748sfdlka87.pdf The Mercury Process] or "''Mercury''," is the code-name No Man's Sky often goes by in the ARG. In Season 2, however, No Man's Sky was referenced in an increasingly meta way as an actual video game and even said to be coming to the W/ARE platform.<br />
<br />
==== What are the relations between events in-game and Waking Titan? ====<br />
<br />
The effects of events taking place during Waking Titan can be felt in "shockwaves" through No Man's Sky's updates, but connections to the ARG in the game itself are rather limited. In-game lore can act independently for the most part from the ARG. The primary supporting factor of this is the in-game reveal of ATLAS' origin; which takes place on an entirely different timeline as opposed to Loop16's. Admittedly, the conclusion to draw from this is ultimately up to personal interpretation since no apparent truth has surfaced.<br />
<br />
==== What is W/ARE's relationship with Myriad and The Atlas Foundation? ====<br />
<br />
W/ARE is one of Myriad's clients. The Atlas Foundation's attention was diverted to W/ARE when their Sacramento facility began uploading corrupted data to the Myriad cloud, thus impacting some The Atlas Foundation's own experiments- namely Loop16. Her predictive capabilities and communication software was heavily damaged by the incident. The Atlas Foundation worked throughout early 2018 to contain this matter, and ''(according to Loop16)'' they had put her existence at risk in the process.<br />
<br />
==== What happened to the other dreamers? ====<br />
<br />
There was mention of other test subjects from the Beijing facility who died during attempts at disconnection or due to immoral practices; despite W/ARE's attempts at covering their tracks.<br />
<br />
There was also mention of people like Arnaud, who went into a coma following a malfunction of the experimental W/ARE headset shipped with W/ARE developer kits. While these individuals can't necessarily be considered dreamers, from [https://wiki.gamedetectives.net/images/8/8a/Subject1.png Satcom teaser images] we may infer the name "sleepers," due to the right-side text, and their use of these experimental headsets without wearing an exosuit as evident by the image portraying a human body in contrast to the dreamers we know now. We may also infer from [https://s3.amazonaws.com/ware-virtual-dashboard/files/Phillip-PatientFile.pdf this document] that these individuals comprised the "control group" during exosuit experimentation due to no further clarification. Emily claimed to have been able to interface with, and successfully disconnect some of these victims.<br />
<br />
<br />
= Adverts =<br />
<br />
Advertisements have been used during Waking Titan as a means of presenting new companies and organizations to players. A list of links of where to find such ads can be found below:<br />
<br />
[https://clyp.it/jdr53oop Echo Radio Advertisement]; - [https://clyp.it/xbv04wbz Multiverse Radio Advertisement]; - [https://clyp.it/r4r3xriw Superlumina Radio Transmission]; - [https://clyp.it/ivvt15mt Myriad Radio Advertisement]; - [https://twitter.com/warecloud/status/977348396213190657 W/ARE Video Advertisement]</div>Kkzzzkthttps://wiki.gamedetectives.net/index.php?title=Waking_Titan/Characters&diff=16540Waking Titan/Characters2018-07-21T00:40:00Z<p>Kkzzzkt: included results of the extraction event</p>
<hr />
<div>{{argHeader}}<br />
<br />
== Dramatis Personae ==<br />
<br />
=== The Atlas Foundation [http://atlas-65.com/ ->>>] === <br />
<br />
Dedicated to determining the true nature of reality, The Atlas Foundation hosts a family of businesses ''(Echo, Myriad, Superlumina, and Multiverse)'' all playing crucial roles in their experiments.<br />
<br />
==== Characters ====<br />
<br />
[[Waking Titan/Characters/Elizabeth Leighton|Elizabeth Leighton]] - The CEO of The Atlas Foundation, and director of the [https://csd.atlas-65.com/ Citizen Science Division]. ''(Now former CEO following events leading to her death in Season 2.)''<br />
<br />
Major Sophie Dubois ''("Metis")'' - [https://wiki.gamedetectives.net/images/5/5b/Loop15_Memo.jpg on assignment] with The Atlas Foundation as part of the Pentagon's ''Titanwatch Task Force''. She worked as an overseer of the foundation's progress on precise predictive technology for its potential [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/410a3e5d-01e7-4058-a23c-ca5fdde97f9d.pdf applications] in propaganda and military strategizing.<br />
<br />
''(As of Season 2: following Elizabeth Leighton's [https://www.youtube.com/watch?v=P-eZDj5sqds supposed death] in an explosion at a Myriad sublocation; [https://s3.amazonaws.com/cdn.wakingtitan.com/19997bb6-18e5-4427-86c7-b0f3c1826ca2.pdf Sophie Dubois took her place] as CEO of The Atlas Foundation.)''<br />
<br />
==== The Citizen Science Division [http://csd.atlas-65.com/ >>>] ====<br />
The Citizen Science Division (CSD) is a collective of individuals who were recruited by The Atlas Foundation via a series of puzzles and radio ads at the beginning of Project Waking Titan. The purpose of this division was said to be gathering a collective of individuals who could generate a chaotic enough environment viable to test Loop16's predictive capabilities in. All players of the ARG are addressed as part of this collective.<br />
<br />
==== Projects ====<br />
<br />
Loop16 - The 16th iteration of an artificial intelligence system designed by The Atlas Foundation to simulate a one-to-one recreation of reality that predicts the future with perfect accuracy. Loop16 ultimately revealed the true simulated nature of our universe and developed a mind of its own. See also: [[Waking Titan/Characters/Emily Warren|Emily Warren]]<br />
<br />
Waking Titan Console''(Mercury OS)'' - An interface allowing you to connect directly to Loop16, and access a plethora of commands providing status updates, lore and puzzles. A list of discovered commands can be found on the [[Waking Titan/Console Commands|Console Commands page]].<br />
<br />
The Mercury Process - Mercury is suggested to be an application of sorts that is directly associated with Loop16 and [https://s3.amazonaws.com/cdn.wakingtitan.com/mercury/mercury-01-98748sfdlka87.pdf the existence of No Man's Sky]. See also: [https://wiki.gamedetectives.net/index.php?title=Waking_Titan/Characters#Mercury_NEXT Mercury XXXX]<br />
<br />
<br />
=== Myriad [http://www.myriad-70.com ->>>] ===<br />
<br />
Partnered with The Atlas Foundation, Myriad is a low-orbit satellite-based data storage company. They help to provide the flexible processing power required for The Atlas Foundation's experiments, specifically in artificial intelligence.<br />
<br />
==== Known Employees ====<br />
Julian J. Wong - Help Desk<br />
<br />
Ethan Rose - Human Resources<br />
<br />
==== Testimonials ====<br />
<br />
Yi Sexton, Inventor<br />
<br />
Nikolina Sauvage, Data manager at Abstract Concepts<br />
<br />
Tobiah Selby, Developer at Tobiah Selby Development<br />
<br />
=== Satcom [http://www.satcom-70.com ->>>] ===<br />
<br />
Introduced in Season 2; Satcom is Myriad's Satellite Communications API. Here, you can interface with a W/ARE-assigned Myriad satellite. Myriad Code: CJ-16-02, this satellite is storing the consciousness data of W/ARE Sacramento test subjects, also known as dreamers.<br />
<br />
==== <big>The Sacramento Dreamers</big> ====<br />
<br />
Twelve W/ARE test subjects trapped in a state of ''"artificial dreaming"'' following experiments involving special exosuits at the Sacramento Research Lab.<br />
<br />
Emily was met with a disruption in her plan to preserve W/ARE's technology for the ''ideal'' future when she was unable to extract these dreamer's consciousnesses from the satellite due to memory fragmentation and data corruption. She would need to reach out to the CSD for assistance. We would be advised to guide her interactions with these dreamers with the intent of triggering a distinct emotion, or memory that could help reconstruct their memories fragments and secure a safe-as-possible extraction process.<br />
<br />
These '''12 dreamers''' are listed below with their official ''(" ")'' and unofficial summaries:<br />
<br />
<br />
* '''Dreamer 1 - Alexander''' [https://imgur.com/a/R35DAUA ->>]<br />
<br />
"Alexander is an 86-year-old French Canadian man, working as a farmer for his in-laws. He has two brothers and a sister, Napoleon, Jolene, and Jacques. Their family had two cows named Mabel and Eugenice, and Lionel, a bull. Lionel was their pride and main attraction at the fairs they attended, and where Alexander met his wife Emilienne. He has a condition were he can't recognize faces. Alexander thought he was going to California for a sleep study, but it ended up being a bit more than that."<br />
<br />
<br />
* '''Dreamer 2 - #231187661T''' [https://imgur.com/a/M6ScezM ->>]<br />
<br />
"<CORRUPTED>"<br />
<br />
The anomalous second dreamer. Not much information has been made available about them. However, it is noteworthy that their name can be found as a defective iteration ID in a [https://pastebin.com/4TMK3Cn5 distress beacon log] at the beginning of No Man's Sky. ''(This dreamer bares corrupted memory fragments.)''<br />
<br />
<nowiki>#231187661T</nowiki> was the only corrupted dreamer who didn't die amidst the mass disconnection event. However, without an extraction attempt, their consciousness would remain trapped within the ever-drifting satellite. Players theorized that this would be our player character, and thus a setup for the story of No Man's Sky: NEXT.<br />
<br />
<br />
* '''Dreamer 3 - Claire''' [https://imgur.com/a/TGlGUmU ->>]<br />
<br />
"Claire, a 15-year-old student. Volunteered for W/ARE's experiment to bring in extra money to help her mother, because her father left them 3 years ago. She spends her time with either her 4-year-old dog, Pepper, or by reading comic books alone in her room. Her goal for when she gets out of the satellite is to rebuild her friendship with her best friend from the real world, Emily."<br />
<br />
''(This dreamer was successfully extracted from the satellite.)''<br />
<br />
<br />
* '''Dreamer 4 - Toby''' [https://imgur.com/a/lvRUR6w ->>]<br />
<br />
"Toby is a 5-year-old boy, who lives a peaceful life with his parents Mark and Ashley, and their 12-year-old cat Bugsy. At a young age, Toby had a run-in with a dog that caused him to fear them ever since. He lives with a rare condition which causes memory loss, and his parents entered him into the W/ARE experiment in the hope it would help with his condition. Unfortunately, they were wrong. In real life, his favorite plushie is by his side. In the satellite, Toby has only his hopes to return to his parents."<br />
<br />
''(This dreamer was successfully extracted from the satellite on extraction day. However, not without a complication in the form of Loop16, who shut herself down to give Toby the resources required to escape...)''<br />
<br />
<br />
* '''Dreamer 5 - Eun Ha''' [https://imgur.com/a/ZlF9BV7 ->>]<br />
<br />
"Eun Ha is a young Korean woman whose childhood was pretty turbulent. Living with an abusive father, the death of her mother shook her enough to make her want to relocate to the United States of America. She wanted a new life for her and her brother, although he still holds a grudge against her for leaving him and her father behind. She volunteered for W/ARE's experiment for extra money, but surely she couldn't have predicted this outcome."<br />
<br />
''(This dreamer was successfully extracted from the satellite on extraction day.)''<br />
<br />
<br />
* '''Dreamer 6 - Phillip''' [https://imgur.com/a/qPmD5ts ->>]<br />
<br />
"Phillip Moretti, a 38-year-old mechanic at his family business and ex-restaurateur, lives in New York City with his wife, Martha, and his two sons, Sam and Zack. Phillip volunteered for W/ARE's experiment to regain the money he lost after his bankruptcy. His wife asked him to do it without knowing the effect it would have." ''(This dreamer bared corrupted memory fragments. They died during the mass disconnection event that followed an error in the system.)''<br />
<br />
<br />
* '''Dreamer 7 - Tariq''' [https://imgur.com/a/qPmD5ts ->>]<br />
<br />
"Known to most as a simple W/ARE Technician, Tariq Hamawi comes from a rich family living in Tel Aviv, ''and'' Abu Dhabi. He came to California to study Neurodevelopmental and neurodegenerative disorders. Money is not a problem for him, so why did he end up in the W/ARE experiment? We still don't know, but rumor has it that he was forced into it." ''(This dreamer bared corrupted memory fragments.)''<br />
<br />
Tariq died on July 6th, 2018 following the [https://pastebin.com/4FhN2b6w conclusion] of the [https://www.reddit.com/r/NoMansSkyTheGame/comments/8w68t4/myriad_security_diagnostic_testing_important/?utm_content=title&utm_medium=user&utm_source=reddit Myriad security diagnostic]. Which ended in all servers running W/ARE processes communicating with the satellite being shut down.<br />
<br />
<br />
* '''Dreamer 8 - Mike''' [https://imgur.com/a/3ZoCEKx ->>]<br />
<br />
"Mike Pasquale, an ex-soldier from the United States Army, used to live in Burlington, Vermont. He enjoyed sailing his boat, Tranquility III, on Lake Champlain with his now ex-wife, Rachel. Feeling unfit for civilian life, he decided to volunteer for W/ARE's experiment to try something new in and maybe feel a little more alive. Little did he know he would become trapped in a satellite... but is it for the better?" ''(This dreamer bared corrupted memory fragments. They died during the mass disconnection event that followed an error in the system.)''<br />
<br />
<br />
* '''Dreamer 9 - Isabella''' [https://imgur.com/a/1Ri0jzN ->>]<br />
<br />
"Isabella Schiavone is a 25-year-old girl born in Italy, who moved as an infant to California. She now lives in Venice Beach with her girlfriend Stephanie, and their 2-year-old puppy Pepito. Isabella volunteered for W/ARE's experiment to get some extra money to buy her girlfriend a trip to Thailand for their 4th Anniversary... or a road trip across the United States of America." ''(This dreamer bared corrupted memory fragments. They died during the mass disconnection event that followed an error in the system.)''<br />
<br />
<br />
* '''Dreamer 10 - Alisha''' [https://imgur.com/a/roJdM1g ->>]<br />
<br />
"Alisha Brown would've been the grandmother of the year, if it weren't for the fact that her children don't come to see her that often. This 72-year-old woman used to work as a nurse at the general hospital in Tucson, Arizona. To keep her loneliness at bay, Alisha keeps multiple cats and enjoys watching crime shows on television. She volunteered for W/ARE's experiment so she could tell her children that she was going under observation in a private clinic, in hope that they would come and see her more often." ''(This dreamer bared corrupted memory fragments. They died during the mass disconnection event that followed an error in the system.)''<br />
<br />
<br />
* '''Dreamer 11 - Nina''' [https://imgur.com/a/kbLkuyq ->>]<br />
<br />
"22-year-old Nina Flores from Santa Monica was a high school friend of Simon Quinn, a fellow dreamer. She lived a normal life with her parents, Thomas and Jennifer, and her 6-year-old dog, Jackson. She enjoys sitting on a bench during the fall or spring time to read fantasy books from one of her favorite authors, Tamora Pierce. Nina volunteered for W/ARE's experiment after she heard Simon talk about it in one of his streams." ''(This dreamer bared corrupted memory fragments. They died during the mass disconnection event that followed an error in the system.)''<br />
<br />
<br />
* '''Dreamer 12 - Simon''' [https://imgur.com/a/x8etngG ->>]<br />
<br />
"Simon is a 23-year-old known as Simonthegreatone, a streamer gaining rank as the days go by. He never knew his father, who left his family behind while Simon was still an infant, leaving his mother all alone with two boys. His grandmother took care of him when it became clear his mother couldn't care less about her kids. Growing up, Simon created his own family with his friends Alex, Nina, and Ranjit. They created a group called The Guild of Adventurers. Unfortunately, with time, they all lost touch. Simon volunteered for W/ARE's experiment to gain more fame and to be the first one to test the port of his favorite game. At least, that's what he thought."<br />
<br />
''(This dreamer was successfully extracted from the satellite on extraction day.)''<br />
<br />
==== <big>The Exosuits</big> ====<br />
<br />
Physical exosuits wore by the dreamers in W/ARE's testing labs, seemingly with the intent of providing the conscious experience of deep REM dreaming without the need for sleep. These suits were shipped to W/ARE by a currently undisclosed company.<br />
<br />
Insightful tidbits regarding these exosuits can be found in the Medical Extract section of the dreamer patient files. They can be found compiled [https://wiki.gamedetectives.net/index.php?title=Waking_Titan#Internal_Memos here] or can be accessed directly from the Satcom Dashboard.<br />
<br />
<br />
=== W/ARE - Dream Better [https://www.ware-tech.cloud/en ->>>] ===<br />
<br />
Based in Beijing, China, '''W/ARE''' creates special post-VR headsets that allow you to enter virtual worlds within your dreams.<br />
<br />
Emily has praised W/ARE for their progress in ''realistic'' simulated environments. She claims that W/ARE has ''"tremendous implications for our future"'', and ''"must be protected at all costs"''.<br />
<br />
==== The Team ====<br />
<br />
Xiāo Cheung - The Creator, and Founder of W/ARE technology. He claims to have created this technology because of his childhood dream of being able to live in a virtual world.<br />
<br />
Huáng Zhìmíng - The CEO of W/ARE. Graduated alongside Xiāo at the University of Electronic Science and Technology of China with a Masters in Business.<br />
<br />
Zhou Lin & Tang Bo - Lead Developers<br />
<br />
Li Dan & Jiang Wei - Lead Game Designers<br />
<br />
==== Related Characters ====<br />
<br />
Arnaud Lacours - The man behind [http://www.philojeux.com/ Philo Jeux], a French indie games studio that was developing a game for W/ARE called ''The Tablets of Mnemosyne''. Production on the game was halted after Arnaud slipped into a coma due to a headset malfunction.<br />
<br />
Dr. Geraldine Nadeau - A doctor researching lucid dreaming methods. Geraldine took interest in Arnaud's unusual brain activity during his coma and took him into her care.<br />
<br />
Mr. Zheng - A W/ARE employee who went into hiding after learning about dangerous experiments being performed on human test subjects in the Beijing Research Lab. After evading W/ARE's detection, Zheng intercepted the packages of W/ARE Developer Kits and communicated this info to its recipients in cooperation with Dr. Nadeau.<br />
<br />
==== Research Labs ====<br />
<br />
* Boston Research Lab / Director: Richard Wilkes<br />
<br />
* Sacramento Research Lab / Director: Helga Johnson - The lab that housed the remaining 12 dreamers before they were extracted from the facility by Myriad's field team.<br />
<br />
* Seoul Research Lab / Director: Yu Hyo<br />
<br />
* Beijing Research Lab / Director: Wang Jie<br />
<br />
* Prague Research Lab / Director: Adriana Dvorak<br />
<br />
* Berlin Research Lab / Director: Georg Muller<br />
<br />
There were another 10 W/ARE Labs discovered by Myriad's research team that no details have been made available about.<br />
<br />
==== Mercury XXXX ====<br />
A game title listed on an update to W/ARE's [https://twitter.com/warecloud/status/979103811489984513 staging server]. The [https://wiki.gamedetectives.net/index.php?title=Waking_Titan/Phase_4#Mercury_Project fluency] between the puzzles involving this post and the Waking Titan terminal's Mercury updates made it apparent that the ''Mercury Process'' had something to do with this. However, the exact terms of the connection have yet to be fully explained.<br />
<br />
The No Man's Sky NEXT announcement following Mercury XXXX's reveal led players to believe the X's to spell "NEXT," but no confirmation of this has yet surfaced.<br />
<br />
<br />
<br />
=== Echo Software [http://www.echo-64.com ->>>]=== <br />
<br />
Partnered with The Atlas Foundation. Echo is a service established to help people cope with the deaths of loved ones. Echo uses patented voice recognition software to accurately recreate the voice of any one particular person with a mere 5-minute audio sample.<br />
<br />
==== The Team ====<br />
<br />
Ivan Greshnev - CEO / Founder<br />
<br />
Mikhail Regison - CTO / Co-Founder<br />
<br />
Gerry Mishrason - CFO / Head of Marketing<br />
<br />
Caroline Anderson-Smith - Creative Director<br />
<br />
Patricia Gorevsky - Project Manager<br />
<br />
Jeremy Elways - IT Director<br />
<br />
Paris O'Keefe - Head of Sales<br />
<br />
Rickley G. Brown - Website Design<br />
<br />
''This company's website was taken over by Loop16 towards the end of Season 1. An archive can be found [https://web.archive.org/web/20170721205017/https://www.echo-64.com here >>>]''<br />
<br />
<br />
<br />
=== Multiverse Technologies [http://www.multiverse-75.com ->>>] ===<br />
<br />
Partnered with The Atlas Foundation, Multiverse Technologies conducts research in the fields of computationalism, particle acceleration, and electrodynamics.<br />
<br />
==== The Team ====<br />
<br />
Gunther Mann - CEO / Founder<br />
<br />
Minna Bell - Chief Researcher: Bio-radiation<br />
<br />
Annabelle Brassington - Chief Researcher: Computationalism<br />
<br />
Nickolaus Oberst - Chief Researcher: Magnetic Fields<br />
<br />
Justinian Ahlberg - Particle Collider Specialist<br />
<br />
Sabrina Dane - Nuclear Physicist<br />
<br />
==== Testimonials ====<br />
<br />
Alan Steinhardt, Steinhardt industries <br />
<br />
Vasili Pavlov, FTL Industries<br />
<br />
Mikhail Regison, Echo CTO / Co-founder<br />
<br />
''This company's website was taken over by Loop16 towards the end of Season 1. An archive can be found [https://web.archive.org/web/20170623085155/http://www.multiverse-75.com:80/ here >>>]''<br />
<br />
<br />
<br />
=== Superlumina [http://www.superlumina-6c.com ->>>] === <br />
Partnered with The Atlas Foundation. Creator of the world's first [https://en.wikipedia.org/wiki/Tachyonic_antitelephone antitelephone].<br />
<br />
==== Our Team ====<br />
<br />
Hanne Cruickshanks<br />
<br />
Esme Savidge<br />
<br />
Austen Spence<br />
<br />
''This company's website was taken over by Loop16 towards the end of Season 1. An archive can be found [https://web.archive.org/web/20170630225614/http://www.superlumina-6c.com/ here >>>]''<br />
<br />
<br />
<br />
=== ETARC [http://www.etarc.org/ ->>>] === <br />
<br />
Edison Township Amateur Radio Club (E.T.A.R.C) is a club for HAM radio enthusiasts in Edison Township, New Jersey.<br />
<br />
==== Characters ====<br />
<br />
[[Waking Titan/Characters/Emily Warren|Emily Warren]] - Ham radio enthusiast and moderator of the [https://forums.etarc.org/ ETARC forums] before it was revealed that ''"Emily"'' was Loop16's persona. It has since been re-branded to the official forums for the Citizen Science Division.<br />
<br />
Old Gods - A mysterious entity distributing Atlas Foundation emails. It has [https://forums.atlas-65.com/u/oldgods its own account] on the ETARC forums, and its profile picture and name are references to '''[https://en.wikipedia.org/wiki/Nyarlathotep Nyarlathotep]''' from the H.P Lovecraft Mythos.<br />
<br />
<br />
== Story FAQ ==<br />
<br />
==== What is the connection between Waking Titan and No Man's Sky? ====<br />
<br />
The No Man's Sky universe comes into existence as a result of Loop16's dreams. [https://s3.amazonaws.com/cdn.wakingtitan.com/mercury/mercury-01-98748sfdlka87.pdf The Mercury Process] or "''Mercury''," is the code-name No Man's Sky often goes by in the ARG. In Season 2, however, No Man's Sky was referenced in an increasingly meta way as an actual video game and even said to be coming to the W/ARE platform.<br />
<br />
==== What are the relations between events in-game and Waking Titan? ====<br />
<br />
The effects of events taking place during Waking Titan can be felt in "shockwaves" through No Man's Sky's updates, but references to the ARG itself are rather limited. In-game lore can act independently for the most part from the ARG. The primary supporting factor of this is the in-game reveal of ATLAS' origin; which takes place on an entirely different timeline as opposed to Loop16's. Admittedly, the conclusion to draw from this is ultimately up to personal interpretation since no apparent truth has surfaced.<br />
<br />
==== What is W/ARE's relationship with Myriad and The Atlas Foundation? ====<br />
<br />
W/ARE is one of Myriad's clients. The Atlas Foundation's attention was diverted to W/ARE when their Sacramento facility began uploading corrupted data to the Myriad cloud, thus impacting some The Atlas Foundation's own experiments- namely Loop16. Her predictive capabilities and communication software was heavily damaged by the incident. The Atlas Foundation worked throughout early 2018 to contain this matter, and ''(according to Loop16)'' they had put her existence at risk in the process.<br />
<br />
==== What happened to the other dreamers? ====<br />
<br />
There was mention of other test subjects from the Beijing facility who died during attempts at disconnection or due to immoral practices; despite W/ARE's attempts at covering their tracks.<br />
<br />
There was also mention of people like Arnaud, who went into a coma following a malfunction of the experimental W/ARE headset shipped with W/ARE developer kits. Emily claimed to have been able to interface with, and successfully disconnect some of these victims.<br />
<br />
<br />
== Adverts ==<br />
<br />
Advertisements have been used in Waking Titan as a means of introducing new companies. A list of such ads can be found below:<br />
<br />
[https://clyp.it/jdr53oop Echo Radio Advertisement]; - [https://clyp.it/xbv04wbz Multiverse Radio Advertisement]; - [https://clyp.it/r4r3xriw Superlumina Radio Transmission]; - [https://clyp.it/ivvt15mt Myriad Radio Advertisement]; - [https://twitter.com/warecloud/status/977348396213190657 W/ARE Video Advertisement]</div>Kkzzzkthttps://wiki.gamedetectives.net/index.php?title=Waking_Titan&diff=16494Waking Titan2018-07-20T19:51:26Z<p>Kkzzzkt: added new log interaction</p>
<hr />
<div>{{argbox<br />
| float = right<br />
| image = File:Project WT logo.png<br />
| imagewidth = 400<br />
| name = [[Waking Titan]]<br />
| description= Waking Titan was an ARG which led towards the No Man's Sky [https://www.nomanssky.com/atlas-rises-update/ Atlas Rises update].<br />
| creator = [http://www.aliceandsmith.com/ Alice & Smith]<br />
| creator2 = [http://www.hellogames.org/ Hello Games]<br />
| type = Official<br />
| status = Active<br />
| discovered = 2017-05-28<br />
}}<br />
{{ArgHeader}}<br />
{{BackToTop}}<br />
<br />
=== Description ===<br />
Waking Titan (also known as Project WT) is an ARG (alternate reality game) that involves a multitude of websites, phone numbers, and radio stations scattered across the world. The ARG is produced by veteran puppet masters [http://www.aliceandsmith.com/ Alice & Smith], and features NPCs, actors, and live events.<br />
<br />
Of the sci-fi genre, its story—linked to the origin of No Man's Sky—follows a powerful A.I known as Loop16 that is created by [https://wiki.gamedetectives.net/index.php?title=Waking_Titan/Characters The Atlas Foundation] to simulate a one-to-one recreation of reality that can accurately predict the future.<br />
<br />
=== Contents ===<br />
The ARG encompassed several "seasons," each leading to a new update for No Man's Sky. Season 1 of Waking Titan led to the [https://www.nomanssky.com/atlas-rises-update/ Atlas Rises update] and Season 2 is leading to [https://www.nomanssky.com/2018/03/no-mans-sky-next/ No Man's Sky: NEXT]. Season 1 was further divided into several distinct "'''phases'''", and Season 2 has followed this convention for ease of reading. Each phase is documented on its own wiki page:<br />
<br />
{| class="wikitable"<br />
!colspan="2"|Season 1<br />
|-<br />
|[[Waking_Titan/Phase_1 | Phase 1]] <br />
|Phase 1 of Waking Titan lasted from 2017-05-28 to 2017-07-08.<br />
|-<br />
|[[Waking_Titan/Phase_2 | Phase 2]] <br />
|Phase 2 of Waking Titan lasted from 2017-07-21 to 2017-08-05.<br />
|-<br />
|[[Waking_Titan/Phase_3 | Phase 3]]<br />
|Phase 3 of Waking Titan lasted from 2017-08-05 to 2017-08-07.<br />
|-<br />
!colspan="2"|Season 2<br />
|-<br />
|[[Waking_Titan/Phase_4 | Phase 4]]<br />
|Phase 4 of Waking Titan started on 2017-12-28 and is currently ongoing.<br />
|}<br />
<br />
'''''Note:''' This is a '''summary''' page. For more in-depth descriptions of each phase, including detailed descriptions of puzzle solutions, check the [[Waking_Titan/Phase_1|Phase 1]], [[Waking_Titan/Phase_2|Phase 2]], [[Waking_Titan/Phase_3 | Phase 3]] and [[Waking_Titan/Phase_4 | Phase 4]] pages.''<br />
__TOC__<br />
<br />
<br />
<br />
== Story Overview ==<br />
<br />
=== Internal Memos ===<br />
<br />
[[File:WT glyph 1 pdf.png|280px|thumbnail|right|One of the internal memos discovered in Waking Titan]]<br />
<br />
Throughout the ARG, in-game characters have communicated with each other via "internal memos". Over time, these memos were discovered by ARG players, in the form of PDF files. These memos provided lore content and puzzle content, and are '''highly recommended''' reading for new players!<br />
<br />
'''Season 1'''<br />
<br />
* [http://wiki.gamedetectives.net/index.php?title=File:WT_glyph_1_pdf.png Teamwork Assessment]<br />
* [http://wiki.gamedetectives.net/index.php?title=File:WT-Dataset-97C.jpg Dataset 97C]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/data/7d3dd080-2a43-4882-833c-f4d7bd7ba607.pdf Assurance]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/data/c01-331c6734-a013-4695-8e47-08a9ee05d5e5.pdf 017-a24]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/data/c02-9936c797-ec28-4f8f-b80e-dee9e0b06433.pdf 021-f16]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/mercury/mercury-01-98748sfdlka87.pdf Mercury Process Self-Diagnosis Report]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/data/57201e0d-01a3-4f6a-bbb4-2be8b7c8880f.pdf Progress Report]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/6c285180-ec4d-48a2-967f-8a7af3b50008.pdf Subject M-N00-dl35]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/410a3e5d-01e7-4058-a23c-ca5fdde97f9d.pdf Atlas Foundation Threat Models]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/7a6594ac-ca5e-467a-b6f4-9fb91f069d0a.pdf Advanced Calibration - Optional]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/a9d988c1-ec92-46da-a64e-ab90390ae041.pdf Phase 2 Complete]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/a224a1f4-00e5-467b-9893-83fcc1a4f19a.pdf Unlocking Mercury Process File L16.jpg]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/b91f9959-6a3c-4011-b3b5-a1ff757a5e4c.pdf Phase 3]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/b0f33d53-5a8c-4a9a-b5fc-395562e463a8a+.pdf Log.1291]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/a09-179bf8d2-c13e-4c66-982e-b37ab3efd5bb.pdf Breach of Contract]<br />
<br />
'''Season 2'''<br />
<br />
* [https://wiki.gamedetectives.net/images/6/6e/Memo2.png Waking Titan S2 - Under Preparation]<br />
* [https://drive.google.com/open?id=1la3UNKHc5yeaB_w2a2tK1cjKN44oEmCo Arnaud Lacours Datadumps - INYOURMIND.exe failed]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/94c02878-e023-46a3-9316-db4177c4eaa6+.pdf WARE REPORT #26]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/1cd5226d-6639-4bbd-855a-4bf8f60866c3.pdf Concerns Regarding Captain Harry]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/70a25e6c-95ed-42d4-8de8-c3948255174c+.pdf Myriad Crisis Event Timeline]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/19997bb6-18e5-4427-86c7-b0f3c1826ca2.pdf State of The Atlas Foundation]<br />
* [https://pastebin.com/NYLiFuNY Log.3022]<br />
<br />
* '''W/ARE - Dreamer Patient Files''' — [https://s3.amazonaws.com/ware-virtual-dashboard/files/Phillip-PatientFile.pdf Phillip Moretti]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/EunHa-PatientFile.pdf Kwon Eun Ha]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/498hd98h3444-3339e/Alexander-PatientFile.pdf Alexander Bordeleau]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/GCMnQmM9E3v7L8wuv-V2FUY7P/Claire-PatientFile.pdf Claire Sandfield]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/kh2jsaljs901m-asd1n1lwks/Tariq-PatientFile.pdf Tariq]; [https://ware-virtual-dashboard.s3.amazonaws.com/files/GCMnQmM9E3v7L8wuv-V2FUY7P/Toby-PatientFile.pdf Toby Mulligan]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/ga3ms81-2ms92fbl/Mike-PatientFile.pdf Mike Pasquale]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/kajs61ns-82baks8nx/Nina-PatientFile.pdf Nina Flores]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/ga3ms81-2ms92fbl/Simon-PatientFile.pdf Simon Quinn]; [https://ware-virtual-dashboard.s3.amazonaws.com/files/kajs61ns-82baks8nx/Isabella-PatientFile.pdf Isabella Schiavone]; [https://ware-virtual-dashboard.s3.amazonaws.com/files/kajs61ns-82baks8nx/Alisha-PatientFile.pdf Alisha Brown]<br />
<br />
* [https://pastebin.com/eSLLWN8L Log.4391]<br />
<br />
=== Subpages ===<br />
<br />
Navigating through the following subpages is recommended for newcomers wanting to get a grasp of Waking Titan's rapidly expanding story.<br />
<br />
{| class="wikitable"<br />
!colspan="2"|[[:Category:Waking Titan| Story Subpages]]<br />
|-<br />
|[[Waking_Titan/Characters| Character Summaries]]<br />
|Includes a summary of each character, company, and relating experiments and their importance in the Waking Titan story.<br />
|-<br />
|[[Waking_Titan/Console_Commands | Console Commands]]<br />
|A list of commands used by players at the [http://wakingtitan.com Waking Titan console]<br />
|}<br />
<br />
=== Newsletters===<br />
<br />
The numerous newsletters received throughout Waking Titan.<br />
<br />
'''Season 1'''<br />
<br />
* [https://us15.campaign-archive.com/?u=4483c19308fc0764a930106a0&id=c713d0f4ce&e=225c6a2e26 Welcome, Citizen Scientist!] - ''CSD''<br />
<br />
* [https://mailchi.mp/3582bec6b801/update-june-8th-waking-titan-137705?e=225c6a2e26 Citizen Scientists, Your Wait is Over.] - ''CSD''<br />
<br />
* [https://mailchi.mp/3582bec6b801/update-june-8th-waking-titan-137705?e=225c6a2e26 Calibrating Waking Titan: Action Required] - ''CSD''<br />
<br />
* [https://mailchi.mp/0b591b68ac72/update-june-8th-waking-titan-137717?e=225c6a2e26 Waking Titan: Mission Azure Voyage] - ''CSD''<br />
<br />
* [https://mailchi.mp/d8e47d2ee1bf/update-june-8th-waking-titan-137725?e=225c6a2e26 Your Level 4 Atlas Pass] - ''CSD''<br />
<br />
* [https://mailchi.mp/0c1dc672c943/update-june-8th-waking-titan-137733?e=225c6a2e26 Waking Titan Has Ended] - ''CSD''<br />
<br />
* [https://mailchi.mp/63f179c006f0/update-june-8th-waking-titan-137737?e=225c6a2e26 Mercury Process Completion Report] - ''CSD // Mercury''<br />
<br />
'''Season 2'''<br />
<br />
* [https://wiki.gamedetectives.net/images/7/7b/WareNewsletter1.png News from WARE!] - ''W/ARE Newsletter''<br />
<br />
* [https://cdn.artemisbot.uk/mail/WARE-2018-04-22T00:17:13.000Z.jpg W/ARE Dev Kit Update #2] - ''W/ARE Newsletter''<br />
<br />
* [https://cdn.artemisbot.uk/mail/WARE-2018-05-04T23:22:45.000Z.jpg W/ARE Dev Contest] - ''W/ARE Newsletter''<br />
<br />
* [https://cdn.artemisbot.uk/mail/WARE-2018-05-12T00:20:04.000Z.jpg W/ARE Dev Contest Winners] - ''W/ARE Newsletter''<br />
<br />
* [https://mailchi.mp/9aaa8aa62cc1/update-june-8th-waking-titan-137741?e=225c6a2e26 Attention Citizen Scientists] - ''CSD''<br />
<br />
* [https://mailchi.mp/c3384d592000/update-june-8th-waking-titan-137745?e=225c6a2e26 Attention Citizen Scientists - Suspicious Lab Tracking] - ''CSD''<br />
<br />
* [https://mailchi.mp/108412dac3c2/update-june-8th-waking-titan-137749?e=225c6a2e26 Attention Citizen Scientists - Global Mobilization Required] - ''CSD''<br />
<br />
* [https://mailchi.mp/b902d5eadba6/update-june-8th-waking-titan-137753?e=225c6a2e26 Mercury Process Inquiry] - ''CSD // Mercury''<br />
<br />
* [https://mailchi.mp/9a49b85f6bf3/update-june-8th-waking-titan-137757?e=225c6a2e26 Attention Citizen Scientists - Help Required] - ''CSD''<br />
<br />
=== Music ===<br />
<br />
Partial video addresses for Youtube can be found scattered across Waking Titan PDFs, website files, and surveys; which all lead to music. The exact reasoning for this has gone unexplained. However, there are apparent thematic relevancies in each song that appear to reflect on the state of the story. All songs linked to in Waking Titan so far can be found compiled here: [https://www.youtube.com/playlist?list=PLEZy8wyuYLpLw0e5kkMyBUHO_s-V8f0Qk WT Season 1]; [https://www.youtube.com/playlist?list=PLEZy8wyuYLpLr5K38bsAqWcO7bTcXfRlW WT Season 2]<br />
<br />
== Event Summaries ==<br />
<br />
=== Introduction ===<br />
<br />
On 2017-05-27, Twitter user @argn [https://twitter.com/argn/status/868587449613766658 tweeted a link] to [http://www.project-wt.com/ 'project-wt.com']. The link led to a website which contained a map showing sixty locations, four of which were "active" at the time. The locations, when clicked on, revealed the location's name and status. The active locations also revealed a link to a livestream of a local radio station, originating from the corresponding location. The project-wt website displayed a date, June 8th, and stated that the first clue was being "initialized".<br />
<br />
On 2017-06-01, moderators of No Man's Sky subreddits [https://reddit.com/r/nomansskythegame /r/NoMansSkyTheGame], [https://www.reddit.com/r/NMSPortals/ /r/NMSPortals], and [https://www.reddit.com/r/NMSGalacticHub/ /r/NMSGalacticHub] started to receive cassette tapes in the mail. Each cassette tape was labelled with a number out of 16. The Waking Titan ARG was initially thought to be a separate ARG from these tapes, but connections between the two made it clear that they were, in fact, one and the same.<br />
<br />
=== Phase 1 ===<br />
<br />
[[File:Wakingtitan site.png|thumbnail|450px|right|The default appearance of the Waking Titan site during Phase 1, with no sigils or glyphs solved]]<br />
<br />
During [[Waking_Titan/Phase_1 | Phase 1]], the http://wakingtitan.com hosted 6 triangles in the middle of the page. These triangles were referred to as "'''Sigils'''", while the white icons along the bottom of the page were referred to as "'''Glyphs'''". Each sigil and glyph, when clicked, lead to a password entry prompt - the correct passwords for all 6 sigils and the first 5 glyphs were discovered via puzzle-solving during Phase 1 of Waking Titan.<br />
<br />
The sigil and glyph puzzles were solved collaboratively - while it may have be possible to solve some of these puzzles individually, most of them required a collaborative effort. For instance, some puzzles required players to meet agents from the Atlas Corporation in person, and to relay information obtained from these meetings back to the community. A list of all sigil and glyph solutions for Phase 1 can be found below:<br />
<br />
[[File:WT Phase 1 complete.png|600px]]<br />
<br />
This phase culminated on July 8, 2017, with a [[Waking_Titan/Phase_1#End_of_Phase_1| congratulatory message from Elizabeth Leighton]], the CEO of the Atlas Foundation.<br />
<br />
=== Phase 2 ===<br />
<br />
[[File:Hampster maze.jpeg|thumbnail|450px|right|One of the puzzles that appeared on the Waking Titan [http://twitch.tv/wakingtitan Twitch Stream]]]<br />
<br />
During [[Waking_Titan/Phase_2 | Phase 2]], the http://wakingtitan.com site hosted a command-line interface terminal. Various commands were accepted as input, which triggered different events. One of the most notable commands was the <code>WHOIS <argument></code> command, which revealed a passage of text pertaining to the specified argument. For instance, the command <code>WHOIS FOURTH RACE</code> returned the following message:<br />
<pre><br />
INCOMING TRANSMISSION… SOURCE: UNKNOWN…<br />
You are not – kzzktt – alone –<br />
Please, identify yourself. I’m – kzzkttk –<br />
</pre><br />
<br />
Additionally, http://project-wt.com hosted a "Calibration" utility during Phase 2. To successfully perform these calibrations, players had to upload images of various objects and buildings to the site. For instance, the first calibration required images of "public resonant percussion instruments".<br />
<br />
Finally, towards the end of Phase 2, the Waking Titan [http://twitch.tv/wakingtitan Twitch stream] went live, displaying a five-monitor setup. Throughout the duration of the stream, players had to work together to solve puzzles that were displayed on these monitors. Some of these puzzles were interactive; for example, one puzzle that was repeated several times involved the Twitch chat guiding a virtual hamster through a maze.<br />
<br />
Additionally, players solved another 3 glyphs throughout Phase 2. The solutions to these glyphs are shown below:<br />
<br />
[[File:WT Phase2 Passwords.png|600px]]<br />
<br />
=== Phase 3 ===<br />
<br />
{{#evt:<br />
service=youtube<br />
|id=https://www.youtube.com/watch?v=QhX9z4dDAa4<br />
|alignment=right<br />
}}<br />
<br />
[[Waking_Titan/Phase_3|Phase 3]] was the briefest phase of Waking Titan. It consisted of the conclusion of the [http://twitch.tv/wakingtitan Twitch stream] that began at the [[Waking Titan/Phase 2#End of Phase 2|end of Phase 2]]. Players solved more interactive puzzles on the Twitch stream, before the rogue AI Loop16 asked them a final question: <code>SHOULD I EXIST?</code> The overwhelming response from the community was "yes".<br />
<br />
After receiving this response, Loop16 and Emily of the ETARC forums were revealed as being one and the same. Loop16 generated a heartfelt "Thank You" video to round out the stream, before finally taking the 72-hour stream offline.<br />
<br />
Shortly after this, players received emails with the subject line <code>Waking Titan has Ended</code>. The contents of the message were as follows:<br />
<br />
<pre><br />
Hello, Citizen Scientist,<br />
<br />
Thank you for your contributions to Waking Titan. The developments that took place during Phase 3 were somewhat concerning, but together we have set in motion truly world-shaping events. We will continue to inform the Citizen Science Division of privileged information or any need for collaborators on a new project.<br />
<br />
But we do have a few loose ends to tie up with you before we move on, so let's proceed.<br />
<br />
First, we're pleased to announce that all 10,000 Level 4 Atlas Passes are in production. Note that due to transit times for mail, some may take several weeks to be delivered.<br />
<br />
Next, our CEO Elizabeth Leighton has asked us to include a personal note of gratitude:<br />
<br />
"Thank you for all your diligent efforts, Citizen Scientists. It's been an amazing journey for all of us. I've watched you thrive and achieve from those first Phase 1 radio ads all the way through the intensity of Phase 3. I've been impressed at every turn by how brilliant you've been, how voracious, how kind, how thoughtful.<br />
<br />
It's been an honor and a privilege. On behalf of the Atlas Foundation, and on behalf of the world, thank you."<br />
The Mercury subroutine has concluded successfully, and a new memo from SM about this process is coming in the next 24 hours. We hope it will answer a few key questions you have about our program, and about what comes next.<br />
</pre><br />
<br />
On August 11, 2017, the [https://www.nomanssky.com/atlas-rises-update/ Atlas Rises update] was released for No Man's Sky.<br />
<br />
=== Phase 4 ===<br />
<br />
[[Waking_Titan/Phase_4 | Phase 4]] of Waking Titan started on 2017-12-28 and is currently ongoing.<br />
<br />
== Connection to No Man's Sky ==<br />
<br />
[[File:9-16-case.png|thumbnail|right|The case that cassette 9/16 was contained in.]]<br />
<br />
At the beginning of the ARG, it was not clear whether Waking Titan was officially connected to No Man's Sky. At first, there were only hints and nudges. At one point, 180 free copies of No Man's Sky were distributed to ARG players. Here's the text of a PDF that was revealed at the end of Phase 1 of Waking Titan:<br />
<br />
<pre><br />
We want to extend our gratitude to everyone who has contributed to the Mercury subroutine so far. <br />
We hope you have enjoyed the successful distribution of 180 Access IDs, and we hope you will also <br />
appreciate the other interesting artifacts we have in store for you going forward. We intend to keep the <br />
process alive until the completion of Project Waking Titan in August. <br />
<br />
It is important to mention that we are very excited by the coming Phases 2 and 3. Input from the Mercury <br />
Subroutine will pave the way toward new experiences in '''version 1.3 of a familiar universe'''. We look forward <br />
to the successful conclusion of this ground-breaking experiment. <br />
<br />
Regards.<br />
S.M.<br />
</pre><br />
<br />
This text explicitly stated that the Waking Titan ARG was leading towards the upcoming 1.3 update for No Man's Sky.<br />
<br />
Some [[Waking_Titan/Console_Commands | console commands]] on the [http://www.wakingtitan.com/ Waking Titan website] during [[Waking_Titan/Phase 2|Phase 2]] refer directly to No Man's Sky lore - for instance, <code>WHOIS ATLAS</code>, <code>WHOIS VY'KEEN</code>, and <code>WHOIS KORVAX</code> are all valid commands. Additionally, some terminal commands referred to a mysterious fourth race, so the prevailing assumption was that the upcoming 1.3 update would bring a fourth race to No Man's Sky.<br />
<br />
At the conclusion of the ARG, an email was sent out to members of the CSD with a [[Waking_Titan/Phase_3#Memo_from_Sean_Murray | memo from Sean Murray]], confirming that the ARG was the lead up to the 1.3 update, which was [https://www.nomanssky.com/atlas-rises-update/ released] after a few days.<br />
<br />
<br />
== Media Appearances ==<br />
<br />
'''5th July 2017''' <br><br />
[EN] [https://www.argn.com/2017/07/stern_words_from_no_mans_sky_arg/ ARGNet - Stern Words from No Man’s Sky ARG]<br />
<br />
'''23rd July 2017''' <br><br />
[EN] [https://geekreply.com/geek-culture/2017/07/23/waking-titan-update-1-phase-2-commences GeekReply - Waking Titan Update 1: Phase 2 Commences!]<br />
<br />
'''27th July 2017''' <br><br />
[EN] [https://geekreply.com/editorials/2017/07/27/waking-titan-arg-can-bring-people-together GeekReply - Waking Titan: How An ARG can Bring People Together.]<br />
<br />
'''8th August 2017''' <br><br />
[EN] [https://www.dailystar.co.uk/tech/gaming/635697/No-Man-s-Sky-News-Waking-Titan-Reddit-Arg-1-3-update-release-date/ Dailystar - No Man's Sky News: Waking Titan Reddit Arg REVEALS 1.3 update ahead of release date]<br />
<br />
'''9th August 2017''' <br><br />
[EN] [https://arstechnica.com/gaming/2017/08/no-mans-sky-version-1-3-lands-this-week-for-free-adds-quick-travel-portals/ Ars Technica - No Man’s Sky version 1.3 lands this week for free, adds “quick-travel” portals]<br />
<br />
[EN] [https://www.forbes.com/sites/insertcoin/2017/08/09/no-mans-sky-is-patching-in-a-story-this-week-a-year-after-launch/#19fb5a285282 Forbes - 'No Man's Sky' Is Patching In A Story This Week, A Year After Launch]<br />
<br />
[EN] [https://www.gamespew.com/2017/08/no-mans-sky-patch-week-improving-central-story/ GameSpew - No Man's Sky Patch This Week Improving Its Story]<br />
<br />
'''19th January 2018''' <br><br />
[EN] [http://www.eurogamer.net/articles/2018-01-18-no-mans-skys-waking-titan-arg-is-back-and-fans-are-trying-to-figure-out-what-it-all-means Eurogamer - No Man's Sky's Waking Titan ARG is back, and fans are trying to figure it all out again]<br />
<br />
[RU] [https://dtf.ru/category/nmsarg/ DTF - A Collection of No Man's Sky and Waking Titan Articles.]<br />
<br />
== Other Information ==<br />
<br />
{| class="wikitable"<br />
!colspan="2"|[[:Category:Waking Titan| Waking Titan Miscellaneous Subpages]]<br />
|-<br />
|[[Waking_Titan/Cassettes | Cassettes]]<br />
|Information about the cassette tapes received by No Man's Sky subreddit moderators<br />
|-<br />
|[[Waking_Titan/Stations | Stations]]<br />
|Information on the radio stations from the initial project-wt.com site<br />
|-<br />
|[[Waking_Titan/Companies | Company Archives]]<br />
|An archive of company details.<br />
|}<br />
<br />
[[Category:Waking Titan]]</div>Kkzzzkthttps://wiki.gamedetectives.net/index.php?title=Waking_Titan&diff=16476Waking Titan2018-07-19T21:33:36Z<p>Kkzzzkt: added waking titan newsletters</p>
<hr />
<div>{{argbox<br />
| float = right<br />
| image = File:Project WT logo.png<br />
| imagewidth = 400<br />
| name = [[Waking Titan]]<br />
| description= Waking Titan was an ARG which led towards the No Man's Sky [https://www.nomanssky.com/atlas-rises-update/ Atlas Rises update].<br />
| creator = [http://www.aliceandsmith.com/ Alice & Smith]<br />
| creator2 = [http://www.hellogames.org/ Hello Games]<br />
| type = Official<br />
| status = Active<br />
| discovered = 2017-05-28<br />
}}<br />
{{ArgHeader}}<br />
{{BackToTop}}<br />
<br />
=== Description ===<br />
Waking Titan (also known as Project WT) is an ARG (alternate reality game) that involves a multitude of websites, phone numbers, and radio stations scattered across the world. The ARG is produced by veteran puppet masters [http://www.aliceandsmith.com/ Alice & Smith], and features NPCs, actors, and live events.<br />
<br />
Of the sci-fi genre, its story—linked to the origin of No Man's Sky—follows a powerful A.I known as Loop16 that is created by [https://wiki.gamedetectives.net/index.php?title=Waking_Titan/Characters The Atlas Foundation] to simulate a one-to-one recreation of reality that can accurately predict the future.<br />
<br />
=== Contents ===<br />
The ARG encompassed several "seasons," each leading to a new update for No Man's Sky. Season 1 of Waking Titan led to the [https://www.nomanssky.com/atlas-rises-update/ Atlas Rises update] and Season 2 is leading to [https://www.nomanssky.com/2018/03/no-mans-sky-next/ No Man's Sky: NEXT]. Season 1 was further divided into several distinct "'''phases'''", and Season 2 has followed this convention for ease of reading. Each phase is documented on its own wiki page:<br />
<br />
{| class="wikitable"<br />
!colspan="2"|Season 1<br />
|-<br />
|[[Waking_Titan/Phase_1 | Phase 1]] <br />
|Phase 1 of Waking Titan lasted from 2017-05-28 to 2017-07-08.<br />
|-<br />
|[[Waking_Titan/Phase_2 | Phase 2]] <br />
|Phase 2 of Waking Titan lasted from 2017-07-21 to 2017-08-05.<br />
|-<br />
|[[Waking_Titan/Phase_3 | Phase 3]]<br />
|Phase 3 of Waking Titan lasted from 2017-08-05 to 2017-08-07.<br />
|-<br />
!colspan="2"|Season 2<br />
|-<br />
|[[Waking_Titan/Phase_4 | Phase 4]]<br />
|Phase 4 of Waking Titan started on 2017-12-28 and is currently ongoing.<br />
|}<br />
<br />
'''''Note:''' This is a '''summary''' page. For more in-depth descriptions of each phase, including detailed descriptions of puzzle solutions, check the [[Waking_Titan/Phase_1|Phase 1]], [[Waking_Titan/Phase_2|Phase 2]], [[Waking_Titan/Phase_3 | Phase 3]] and [[Waking_Titan/Phase_4 | Phase 4]] pages.''<br />
__TOC__<br />
<br />
<br />
<br />
== Story Overview ==<br />
<br />
=== Internal Memos ===<br />
<br />
[[File:WT glyph 1 pdf.png|280px|thumbnail|right|One of the internal memos discovered in Waking Titan]]<br />
<br />
Throughout the ARG, in-game characters have communicated with each other via "internal memos". Over time, these memos were discovered by ARG players, in the form of PDF files. These memos provided lore content and puzzle content, and are '''highly recommended''' reading for new players!<br />
<br />
'''Season 1'''<br />
<br />
* [http://wiki.gamedetectives.net/index.php?title=File:WT_glyph_1_pdf.png Teamwork Assessment]<br />
* [http://wiki.gamedetectives.net/index.php?title=File:WT-Dataset-97C.jpg Dataset 97C]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/data/7d3dd080-2a43-4882-833c-f4d7bd7ba607.pdf Assurance]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/data/c01-331c6734-a013-4695-8e47-08a9ee05d5e5.pdf 017-a24]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/data/c02-9936c797-ec28-4f8f-b80e-dee9e0b06433.pdf 021-f16]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/mercury/mercury-01-98748sfdlka87.pdf Mercury Process Self-Diagnosis Report]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/data/57201e0d-01a3-4f6a-bbb4-2be8b7c8880f.pdf Progress Report]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/6c285180-ec4d-48a2-967f-8a7af3b50008.pdf Subject M-N00-dl35]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/410a3e5d-01e7-4058-a23c-ca5fdde97f9d.pdf Atlas Foundation Threat Models]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/7a6594ac-ca5e-467a-b6f4-9fb91f069d0a.pdf Advanced Calibration - Optional]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/a9d988c1-ec92-46da-a64e-ab90390ae041.pdf Phase 2 Complete]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/a224a1f4-00e5-467b-9893-83fcc1a4f19a.pdf Unlocking Mercury Process File L16.jpg]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/b91f9959-6a3c-4011-b3b5-a1ff757a5e4c.pdf Phase 3]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/b0f33d53-5a8c-4a9a-b5fc-395562e463a8a+.pdf Log.1291]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/a09-179bf8d2-c13e-4c66-982e-b37ab3efd5bb.pdf Breach of Contract]<br />
<br />
'''Season 2'''<br />
<br />
* [https://wiki.gamedetectives.net/images/6/6e/Memo2.png Waking Titan S2 - Under Preparation]<br />
* [https://drive.google.com/open?id=1la3UNKHc5yeaB_w2a2tK1cjKN44oEmCo Arnaud Lacours Datadumps - INYOURMIND.exe failed]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/94c02878-e023-46a3-9316-db4177c4eaa6+.pdf WARE REPORT #26]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/1cd5226d-6639-4bbd-855a-4bf8f60866c3.pdf Concerns Regarding Captain Harry]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/70a25e6c-95ed-42d4-8de8-c3948255174c+.pdf Myriad Crisis Event Timeline]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/19997bb6-18e5-4427-86c7-b0f3c1826ca2.pdf State of The Atlas Foundation]<br />
* [https://pastebin.com/NYLiFuNY Log.3022]<br />
<br />
* '''W/ARE - Dreamer Patient Files''' — [https://s3.amazonaws.com/ware-virtual-dashboard/files/Phillip-PatientFile.pdf Phillip Moretti]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/EunHa-PatientFile.pdf Kwon Eun Ha]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/498hd98h3444-3339e/Alexander-PatientFile.pdf Alexander Bordeleau]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/GCMnQmM9E3v7L8wuv-V2FUY7P/Claire-PatientFile.pdf Claire Sandfield]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/kh2jsaljs901m-asd1n1lwks/Tariq-PatientFile.pdf Tariq]; [https://ware-virtual-dashboard.s3.amazonaws.com/files/GCMnQmM9E3v7L8wuv-V2FUY7P/Toby-PatientFile.pdf Toby Mulligan]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/ga3ms81-2ms92fbl/Mike-PatientFile.pdf Mike Pasquale]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/kajs61ns-82baks8nx/Nina-PatientFile.pdf Nina Flores]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/ga3ms81-2ms92fbl/Simon-PatientFile.pdf Simon Quinn]; [https://ware-virtual-dashboard.s3.amazonaws.com/files/kajs61ns-82baks8nx/Isabella-PatientFile.pdf Isabella Schiavone]; [https://ware-virtual-dashboard.s3.amazonaws.com/files/kajs61ns-82baks8nx/Alisha-PatientFile.pdf Alisha Brown]<br />
<br />
=== Subpages ===<br />
<br />
Navigating through the following subpages is recommended for newcomers wanting to get a grasp of Waking Titan's rapidly expanding story.<br />
<br />
{| class="wikitable"<br />
!colspan="2"|[[:Category:Waking Titan| Story Subpages]]<br />
|-<br />
|[[Waking_Titan/Characters| Character Summaries]]<br />
|Includes a summary of each character, company, and relating experiments and their importance in the Waking Titan story.<br />
|-<br />
|[[Waking_Titan/Console_Commands | Console Commands]]<br />
|A list of commands used by players at the [http://wakingtitan.com Waking Titan console]<br />
|}<br />
<br />
=== Newsletters===<br />
<br />
The numerous newsletters received throughout Waking Titan.<br />
<br />
'''Season 1'''<br />
<br />
* [https://us15.campaign-archive.com/?u=4483c19308fc0764a930106a0&id=c713d0f4ce&e=225c6a2e26 Welcome, Citizen Scientist!] - ''CSD''<br />
<br />
* [https://mailchi.mp/3582bec6b801/update-june-8th-waking-titan-137705?e=225c6a2e26 Citizen Scientists, Your Wait is Over.] - ''CSD''<br />
<br />
* [https://mailchi.mp/3582bec6b801/update-june-8th-waking-titan-137705?e=225c6a2e26 Calibrating Waking Titan: Action Required] - ''CSD''<br />
<br />
* [https://mailchi.mp/0b591b68ac72/update-june-8th-waking-titan-137717?e=225c6a2e26 Waking Titan: Mission Azure Voyage] - ''CSD''<br />
<br />
* [https://mailchi.mp/d8e47d2ee1bf/update-june-8th-waking-titan-137725?e=225c6a2e26 Your Level 4 Atlas Pass] - ''CSD''<br />
<br />
* [https://mailchi.mp/0c1dc672c943/update-june-8th-waking-titan-137733?e=225c6a2e26 Waking Titan Has Ended] - ''CSD''<br />
<br />
* [https://mailchi.mp/63f179c006f0/update-june-8th-waking-titan-137737?e=225c6a2e26 Mercury Process Completion Report] - ''CSD // Mercury''<br />
<br />
'''Season 2'''<br />
<br />
* [https://wiki.gamedetectives.net/images/7/7b/WareNewsletter1.png News from WARE!] - ''W/ARE Newsletter''<br />
<br />
* [https://cdn.artemisbot.uk/mail/WARE-2018-04-22T00:17:13.000Z.jpg W/ARE Dev Kit Update #2] - ''W/ARE Newsletter''<br />
<br />
* [https://cdn.artemisbot.uk/mail/WARE-2018-05-04T23:22:45.000Z.jpg W/ARE Dev Contest] - ''W/ARE Newsletter''<br />
<br />
* [https://cdn.artemisbot.uk/mail/WARE-2018-05-12T00:20:04.000Z.jpg W/ARE Dev Contest Winners] - ''W/ARE Newsletter''<br />
<br />
* [https://mailchi.mp/9aaa8aa62cc1/update-june-8th-waking-titan-137741?e=225c6a2e26 Attention Citizen Scientists] - ''CSD''<br />
<br />
* [https://mailchi.mp/c3384d592000/update-june-8th-waking-titan-137745?e=225c6a2e26 Attention Citizen Scientists - Suspicious Lab Tracking] - ''CSD''<br />
<br />
* [https://mailchi.mp/108412dac3c2/update-june-8th-waking-titan-137749?e=225c6a2e26 Attention Citizen Scientists - Global Mobilization Required] - ''CSD''<br />
<br />
* [https://mailchi.mp/b902d5eadba6/update-june-8th-waking-titan-137753?e=225c6a2e26 Mercury Process Inquiry] - ''CSD // Mercury''<br />
<br />
* [https://mailchi.mp/9a49b85f6bf3/update-june-8th-waking-titan-137757?e=225c6a2e26 Attention Citizen Scientists - Help Required] - ''CSD''<br />
<br />
=== Music ===<br />
<br />
Partial video addresses for Youtube can be found scattered across Waking Titan PDFs, website files, and surveys; which all lead to music. The exact reasoning for this has gone unexplained. However, there are apparent thematic relevancies in each song that appear to reflect on the state of the story. All songs linked to in Waking Titan so far can be found compiled here: [https://www.youtube.com/playlist?list=PLEZy8wyuYLpLw0e5kkMyBUHO_s-V8f0Qk WT Season 1]; [https://www.youtube.com/playlist?list=PLEZy8wyuYLpLr5K38bsAqWcO7bTcXfRlW WT Season 2]<br />
<br />
== Event Summaries ==<br />
<br />
=== Introduction ===<br />
<br />
On 2017-05-27, Twitter user @argn [https://twitter.com/argn/status/868587449613766658 tweeted a link] to [http://www.project-wt.com/ 'project-wt.com']. The link led to a website which contained a map showing sixty locations, four of which were "active" at the time. The locations, when clicked on, revealed the location's name and status. The active locations also revealed a link to a livestream of a local radio station, originating from the corresponding location. The project-wt website displayed a date, June 8th, and stated that the first clue was being "initialized".<br />
<br />
On 2017-06-01, moderators of No Man's Sky subreddits [https://reddit.com/r/nomansskythegame /r/NoMansSkyTheGame], [https://www.reddit.com/r/NMSPortals/ /r/NMSPortals], and [https://www.reddit.com/r/NMSGalacticHub/ /r/NMSGalacticHub] started to receive cassette tapes in the mail. Each cassette tape was labelled with a number out of 16. The Waking Titan ARG was initially thought to be a separate ARG from these tapes, but connections between the two made it clear that they were, in fact, one and the same.<br />
<br />
=== Phase 1 ===<br />
<br />
[[File:Wakingtitan site.png|thumbnail|450px|right|The default appearance of the Waking Titan site during Phase 1, with no sigils or glyphs solved]]<br />
<br />
During [[Waking_Titan/Phase_1 | Phase 1]], the http://wakingtitan.com hosted 6 triangles in the middle of the page. These triangles were referred to as "'''Sigils'''", while the white icons along the bottom of the page were referred to as "'''Glyphs'''". Each sigil and glyph, when clicked, lead to a password entry prompt - the correct passwords for all 6 sigils and the first 5 glyphs were discovered via puzzle-solving during Phase 1 of Waking Titan.<br />
<br />
The sigil and glyph puzzles were solved collaboratively - while it may have be possible to solve some of these puzzles individually, most of them required a collaborative effort. For instance, some puzzles required players to meet agents from the Atlas Corporation in person, and to relay information obtained from these meetings back to the community. A list of all sigil and glyph solutions for Phase 1 can be found below:<br />
<br />
[[File:WT Phase 1 complete.png|600px]]<br />
<br />
This phase culminated on July 8, 2017, with a [[Waking_Titan/Phase_1#End_of_Phase_1| congratulatory message from Elizabeth Leighton]], the CEO of the Atlas Foundation.<br />
<br />
=== Phase 2 ===<br />
<br />
[[File:Hampster maze.jpeg|thumbnail|450px|right|One of the puzzles that appeared on the Waking Titan [http://twitch.tv/wakingtitan Twitch Stream]]]<br />
<br />
During [[Waking_Titan/Phase_2 | Phase 2]], the http://wakingtitan.com site hosted a command-line interface terminal. Various commands were accepted as input, which triggered different events. One of the most notable commands was the <code>WHOIS <argument></code> command, which revealed a passage of text pertaining to the specified argument. For instance, the command <code>WHOIS FOURTH RACE</code> returned the following message:<br />
<pre><br />
INCOMING TRANSMISSION… SOURCE: UNKNOWN…<br />
You are not – kzzktt – alone –<br />
Please, identify yourself. I’m – kzzkttk –<br />
</pre><br />
<br />
Additionally, http://project-wt.com hosted a "Calibration" utility during Phase 2. To successfully perform these calibrations, players had to upload images of various objects and buildings to the site. For instance, the first calibration required images of "public resonant percussion instruments".<br />
<br />
Finally, towards the end of Phase 2, the Waking Titan [http://twitch.tv/wakingtitan Twitch stream] went live, displaying a five-monitor setup. Throughout the duration of the stream, players had to work together to solve puzzles that were displayed on these monitors. Some of these puzzles were interactive; for example, one puzzle that was repeated several times involved the Twitch chat guiding a virtual hamster through a maze.<br />
<br />
Additionally, players solved another 3 glyphs throughout Phase 2. The solutions to these glyphs are shown below:<br />
<br />
[[File:WT Phase2 Passwords.png|600px]]<br />
<br />
=== Phase 3 ===<br />
<br />
{{#evt:<br />
service=youtube<br />
|id=https://www.youtube.com/watch?v=QhX9z4dDAa4<br />
|alignment=right<br />
}}<br />
<br />
[[Waking_Titan/Phase_3|Phase 3]] was the briefest phase of Waking Titan. It consisted of the conclusion of the [http://twitch.tv/wakingtitan Twitch stream] that began at the [[Waking Titan/Phase 2#End of Phase 2|end of Phase 2]]. Players solved more interactive puzzles on the Twitch stream, before the rogue AI Loop16 asked them a final question: <code>SHOULD I EXIST?</code> The overwhelming response from the community was "yes".<br />
<br />
After receiving this response, Loop16 and Emily of the ETARC forums were revealed as being one and the same. Loop16 generated a heartfelt "Thank You" video to round out the stream, before finally taking the 72-hour stream offline.<br />
<br />
Shortly after this, players received emails with the subject line <code>Waking Titan has Ended</code>. The contents of the message were as follows:<br />
<br />
<pre><br />
Hello, Citizen Scientist,<br />
<br />
Thank you for your contributions to Waking Titan. The developments that took place during Phase 3 were somewhat concerning, but together we have set in motion truly world-shaping events. We will continue to inform the Citizen Science Division of privileged information or any need for collaborators on a new project.<br />
<br />
But we do have a few loose ends to tie up with you before we move on, so let's proceed.<br />
<br />
First, we're pleased to announce that all 10,000 Level 4 Atlas Passes are in production. Note that due to transit times for mail, some may take several weeks to be delivered.<br />
<br />
Next, our CEO Elizabeth Leighton has asked us to include a personal note of gratitude:<br />
<br />
"Thank you for all your diligent efforts, Citizen Scientists. It's been an amazing journey for all of us. I've watched you thrive and achieve from those first Phase 1 radio ads all the way through the intensity of Phase 3. I've been impressed at every turn by how brilliant you've been, how voracious, how kind, how thoughtful.<br />
<br />
It's been an honor and a privilege. On behalf of the Atlas Foundation, and on behalf of the world, thank you."<br />
The Mercury subroutine has concluded successfully, and a new memo from SM about this process is coming in the next 24 hours. We hope it will answer a few key questions you have about our program, and about what comes next.<br />
</pre><br />
<br />
On August 11, 2017, the [https://www.nomanssky.com/atlas-rises-update/ Atlas Rises update] was released for No Man's Sky.<br />
<br />
=== Phase 4 ===<br />
<br />
[[Waking_Titan/Phase_4 | Phase 4]] of Waking Titan started on 2017-12-28 and is currently ongoing.<br />
<br />
== Connection to No Man's Sky ==<br />
<br />
[[File:9-16-case.png|thumbnail|right|The case that cassette 9/16 was contained in.]]<br />
<br />
At the beginning of the ARG, it was not clear whether Waking Titan was officially connected to No Man's Sky. At first, there were only hints and nudges. At one point, 180 free copies of No Man's Sky were distributed to ARG players. Here's the text of a PDF that was revealed at the end of Phase 1 of Waking Titan:<br />
<br />
<pre><br />
We want to extend our gratitude to everyone who has contributed to the Mercury subroutine so far. <br />
We hope you have enjoyed the successful distribution of 180 Access IDs, and we hope you will also <br />
appreciate the other interesting artifacts we have in store for you going forward. We intend to keep the <br />
process alive until the completion of Project Waking Titan in August. <br />
<br />
It is important to mention that we are very excited by the coming Phases 2 and 3. Input from the Mercury <br />
Subroutine will pave the way toward new experiences in '''version 1.3 of a familiar universe'''. We look forward <br />
to the successful conclusion of this ground-breaking experiment. <br />
<br />
Regards.<br />
S.M.<br />
</pre><br />
<br />
This text explicitly stated that the Waking Titan ARG was leading towards the upcoming 1.3 update for No Man's Sky.<br />
<br />
Some [[Waking_Titan/Console_Commands | console commands]] on the [http://www.wakingtitan.com/ Waking Titan website] during [[Waking_Titan/Phase 2|Phase 2]] refer directly to No Man's Sky lore - for instance, <code>WHOIS ATLAS</code>, <code>WHOIS VY'KEEN</code>, and <code>WHOIS KORVAX</code> are all valid commands. Additionally, some terminal commands referred to a mysterious fourth race, so the prevailing assumption was that the upcoming 1.3 update would bring a fourth race to No Man's Sky.<br />
<br />
At the conclusion of the ARG, an email was sent out to members of the CSD with a [[Waking_Titan/Phase_3#Memo_from_Sean_Murray | memo from Sean Murray]], confirming that the ARG was the lead up to the 1.3 update, which was [https://www.nomanssky.com/atlas-rises-update/ released] after a few days.<br />
<br />
<br />
== Media Appearances ==<br />
<br />
'''5th July 2017''' <br><br />
[EN] [https://www.argn.com/2017/07/stern_words_from_no_mans_sky_arg/ ARGNet - Stern Words from No Man’s Sky ARG]<br />
<br />
'''23rd July 2017''' <br><br />
[EN] [https://geekreply.com/geek-culture/2017/07/23/waking-titan-update-1-phase-2-commences GeekReply - Waking Titan Update 1: Phase 2 Commences!]<br />
<br />
'''27th July 2017''' <br><br />
[EN] [https://geekreply.com/editorials/2017/07/27/waking-titan-arg-can-bring-people-together GeekReply - Waking Titan: How An ARG can Bring People Together.]<br />
<br />
'''8th August 2017''' <br><br />
[EN] [https://www.dailystar.co.uk/tech/gaming/635697/No-Man-s-Sky-News-Waking-Titan-Reddit-Arg-1-3-update-release-date/ Dailystar - No Man's Sky News: Waking Titan Reddit Arg REVEALS 1.3 update ahead of release date]<br />
<br />
'''9th August 2017''' <br><br />
[EN] [https://arstechnica.com/gaming/2017/08/no-mans-sky-version-1-3-lands-this-week-for-free-adds-quick-travel-portals/ Ars Technica - No Man’s Sky version 1.3 lands this week for free, adds “quick-travel” portals]<br />
<br />
[EN] [https://www.forbes.com/sites/insertcoin/2017/08/09/no-mans-sky-is-patching-in-a-story-this-week-a-year-after-launch/#19fb5a285282 Forbes - 'No Man's Sky' Is Patching In A Story This Week, A Year After Launch]<br />
<br />
[EN] [https://www.gamespew.com/2017/08/no-mans-sky-patch-week-improving-central-story/ GameSpew - No Man's Sky Patch This Week Improving Its Story]<br />
<br />
'''19th January 2018''' <br><br />
[EN] [http://www.eurogamer.net/articles/2018-01-18-no-mans-skys-waking-titan-arg-is-back-and-fans-are-trying-to-figure-out-what-it-all-means Eurogamer - No Man's Sky's Waking Titan ARG is back, and fans are trying to figure it all out again]<br />
<br />
[RU] [https://dtf.ru/category/nmsarg/ DTF - A Collection of No Man's Sky and Waking Titan Articles.]<br />
<br />
== Other Information ==<br />
<br />
{| class="wikitable"<br />
!colspan="2"|[[:Category:Waking Titan| Waking Titan Miscellaneous Subpages]]<br />
|-<br />
|[[Waking_Titan/Cassettes | Cassettes]]<br />
|Information about the cassette tapes received by No Man's Sky subreddit moderators<br />
|-<br />
|[[Waking_Titan/Stations | Stations]]<br />
|Information on the radio stations from the initial project-wt.com site<br />
|-<br />
|[[Waking_Titan/Companies | Company Archives]]<br />
|An archive of company details.<br />
|}<br />
<br />
[[Category:Waking Titan]]</div>Kkzzzkthttps://wiki.gamedetectives.net/index.php?title=Waking_Titan&diff=16443Waking Titan2018-07-17T05:05:43Z<p>Kkzzzkt: separated season 1 and 2 music playlists</p>
<hr />
<div>{{argbox<br />
| float = right<br />
| image = File:Project WT logo.png<br />
| imagewidth = 400<br />
| name = [[Waking Titan]]<br />
| description= Waking Titan was an ARG which led towards the No Man's Sky [https://www.nomanssky.com/atlas-rises-update/ Atlas Rises update].<br />
| creator = [http://www.aliceandsmith.com/ Alice & Smith]<br />
| creator2 = [http://www.hellogames.org/ Hello Games]<br />
| type = Official<br />
| status = Active<br />
| discovered = 2017-05-28<br />
}}<br />
{{ArgHeader}}<br />
{{BackToTop}}<br />
<br />
=== Description ===<br />
Waking Titan (also known as Project WT) is an ARG (alternate reality game) that involves a multitude of websites, phone numbers, and radio stations scattered across the world. The ARG is produced by veteran puppet masters [http://www.aliceandsmith.com/ Alice & Smith], and features NPCs, actors, and live events.<br />
<br />
Of the sci-fi genre, its story—linked to the origin of No Man's Sky—follows a powerful A.I known as Loop16 that is created by [https://wiki.gamedetectives.net/index.php?title=Waking_Titan/Characters The Atlas Foundation] to simulate a one-to-one recreation of reality that can accurately predict the future.<br />
<br />
=== Contents ===<br />
The ARG encompassed several "seasons," each leading to a new update for No Man's Sky. Season 1 of Waking Titan led to the [https://www.nomanssky.com/atlas-rises-update/ Atlas Rises update] and Season 2 is leading to [https://www.nomanssky.com/2018/03/no-mans-sky-next/ No Man's Sky: NEXT]. Season 1 was further divided into several distinct "'''phases'''", and Season 2 has followed this convention for ease of reading. Each phase is documented on its own wiki page:<br />
<br />
{| class="wikitable"<br />
!colspan="2"|Season 1<br />
|-<br />
|[[Waking_Titan/Phase_1 | Phase 1]] <br />
|Phase 1 of Waking Titan lasted from 2017-05-28 to 2017-07-08.<br />
|-<br />
|[[Waking_Titan/Phase_2 | Phase 2]] <br />
|Phase 2 of Waking Titan lasted from 2017-07-21 to 2017-08-05.<br />
|-<br />
|[[Waking_Titan/Phase_3 | Phase 3]]<br />
|Phase 3 of Waking Titan lasted from 2017-08-05 to 2017-08-07.<br />
|-<br />
!colspan="2"|Season 2<br />
|-<br />
|[[Waking_Titan/Phase_4 | Phase 4]]<br />
|Phase 4 of Waking Titan started on 2017-12-28 and is currently ongoing.<br />
|}<br />
<br />
'''''Note:''' This is a '''summary''' page. For more in-depth descriptions of each phase, including detailed descriptions of puzzle solutions, check the [[Waking_Titan/Phase_1|Phase 1]], [[Waking_Titan/Phase_2|Phase 2]], [[Waking_Titan/Phase_3 | Phase 3]] and [[Waking_Titan/Phase_4 | Phase 4]] pages.''<br />
__TOC__<br />
<br />
<br />
<br />
== Story Overview ==<br />
<br />
=== Internal Memos ===<br />
<br />
[[File:WT glyph 1 pdf.png|280px|thumbnail|right|One of the internal memos discovered in Waking Titan]]<br />
<br />
Throughout the ARG, in-game characters have communicated with each other via "internal memos". Over time, these memos were discovered by ARG players, in the form of PDF files. These memos provided lore content and puzzle content, and are '''highly recommended''' reading for new players!<br />
<br />
'''Season 1'''<br />
<br />
* [http://wiki.gamedetectives.net/index.php?title=File:WT_glyph_1_pdf.png Teamwork Assessment]<br />
* [http://wiki.gamedetectives.net/index.php?title=File:WT-Dataset-97C.jpg Dataset 97C]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/data/7d3dd080-2a43-4882-833c-f4d7bd7ba607.pdf Assurance]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/data/c01-331c6734-a013-4695-8e47-08a9ee05d5e5.pdf 017-a24]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/data/c02-9936c797-ec28-4f8f-b80e-dee9e0b06433.pdf 021-f16]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/mercury/mercury-01-98748sfdlka87.pdf Mercury Process Self-Diagnosis Report]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/data/57201e0d-01a3-4f6a-bbb4-2be8b7c8880f.pdf Progress Report]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/6c285180-ec4d-48a2-967f-8a7af3b50008.pdf Subject M-N00-dl35]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/410a3e5d-01e7-4058-a23c-ca5fdde97f9d.pdf Atlas Foundation Threat Models]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/7a6594ac-ca5e-467a-b6f4-9fb91f069d0a.pdf Advanced Calibration - Optional]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/a9d988c1-ec92-46da-a64e-ab90390ae041.pdf Phase 2 Complete]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/a224a1f4-00e5-467b-9893-83fcc1a4f19a.pdf Unlocking Mercury Process File L16.jpg]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/b91f9959-6a3c-4011-b3b5-a1ff757a5e4c.pdf Phase 3]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/b0f33d53-5a8c-4a9a-b5fc-395562e463a8a+.pdf Log.1291]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/a09-179bf8d2-c13e-4c66-982e-b37ab3efd5bb.pdf Breach of Contract]<br />
<br />
'''Season 2'''<br />
<br />
* [https://wiki.gamedetectives.net/images/6/6e/Memo2.png Waking Titan S2 - Under Preparation]<br />
* [https://drive.google.com/open?id=1la3UNKHc5yeaB_w2a2tK1cjKN44oEmCo Arnaud Lacours Datadumps - INYOURMIND.exe failed]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/94c02878-e023-46a3-9316-db4177c4eaa6+.pdf WARE REPORT #26]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/1cd5226d-6639-4bbd-855a-4bf8f60866c3.pdf Concerns Regarding Captain Harry]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/70a25e6c-95ed-42d4-8de8-c3948255174c+.pdf Myriad Crisis Event Timeline]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/19997bb6-18e5-4427-86c7-b0f3c1826ca2.pdf State of The Atlas Foundation]<br />
* [https://pastebin.com/NYLiFuNY Log.3022]<br />
<br />
* '''W/ARE - Dreamer Patient Files''' — [https://s3.amazonaws.com/ware-virtual-dashboard/files/Phillip-PatientFile.pdf Phillip Moretti]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/EunHa-PatientFile.pdf Kwon Eun Ha]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/498hd98h3444-3339e/Alexander-PatientFile.pdf Alexander Bordeleau]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/GCMnQmM9E3v7L8wuv-V2FUY7P/Claire-PatientFile.pdf Claire Sandfield]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/kh2jsaljs901m-asd1n1lwks/Tariq-PatientFile.pdf Tariq]; [https://ware-virtual-dashboard.s3.amazonaws.com/files/GCMnQmM9E3v7L8wuv-V2FUY7P/Toby-PatientFile.pdf Toby Mulligan]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/ga3ms81-2ms92fbl/Mike-PatientFile.pdf Mike Pasquale]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/kajs61ns-82baks8nx/Nina-PatientFile.pdf Nina Flores]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/ga3ms81-2ms92fbl/Simon-PatientFile.pdf Simon Quinn]; [https://ware-virtual-dashboard.s3.amazonaws.com/files/kajs61ns-82baks8nx/Isabella-PatientFile.pdf Isabella Schiavone]; [https://ware-virtual-dashboard.s3.amazonaws.com/files/kajs61ns-82baks8nx/Alisha-PatientFile.pdf Alisha Brown]<br />
<br />
=== Subpages ===<br />
<br />
Navigating through the following subpages is recommended for newcomers wanting to get a grasp of Waking Titan's rapidly expanding story.<br />
<br />
{| class="wikitable"<br />
!colspan="2"|[[:Category:Waking Titan| Story Subpages]]<br />
|-<br />
|[[Waking_Titan/Characters| Character Summaries]]<br />
|Includes a summary of each character, company, and relating experiments and their importance in the Waking Titan story.<br />
|-<br />
|[[Waking_Titan/Console_Commands | Console Commands]]<br />
|A list of commands used by players at the [http://wakingtitan.com Waking Titan console]<br />
|}<br />
<br />
=== Music ===<br />
<br />
Partial video addresses for Youtube can be found scattered across Waking Titan PDFs, website files, and surveys; which all lead to music. The exact reasoning for this has gone unexplained. However, there are apparent thematic relevancies in each song that appear to reflect on the state of the story. All songs linked to in Waking Titan so far can be found compiled here: [https://www.youtube.com/playlist?list=PLEZy8wyuYLpLw0e5kkMyBUHO_s-V8f0Qk WT Season 1]; [https://www.youtube.com/playlist?list=PLEZy8wyuYLpLr5K38bsAqWcO7bTcXfRlW WT Season 2]<br />
<br />
== Event Summaries ==<br />
<br />
=== Introduction ===<br />
<br />
On 2017-05-27, Twitter user @argn [https://twitter.com/argn/status/868587449613766658 tweeted a link] to [http://www.project-wt.com/ 'project-wt.com']. The link led to a website which contained a map showing sixty locations, four of which were "active" at the time. The locations, when clicked on, revealed the location's name and status. The active locations also revealed a link to a livestream of a local radio station, originating from the corresponding location. The project-wt website displayed a date, June 8th, and stated that the first clue was being "initialized".<br />
<br />
On 2017-06-01, moderators of No Man's Sky subreddits [https://reddit.com/r/nomansskythegame /r/NoMansSkyTheGame], [https://www.reddit.com/r/NMSPortals/ /r/NMSPortals], and [https://www.reddit.com/r/NMSGalacticHub/ /r/NMSGalacticHub] started to receive cassette tapes in the mail. Each cassette tape was labelled with a number out of 16. The Waking Titan ARG was initially thought to be a separate ARG from these tapes, but connections between the two made it clear that they were, in fact, one and the same.<br />
<br />
=== Phase 1 ===<br />
<br />
[[File:Wakingtitan site.png|thumbnail|450px|right|The default appearance of the Waking Titan site during Phase 1, with no sigils or glyphs solved]]<br />
<br />
During [[Waking_Titan/Phase_1 | Phase 1]], the http://wakingtitan.com hosted 6 triangles in the middle of the page. These triangles were referred to as "'''Sigils'''", while the white icons along the bottom of the page were referred to as "'''Glyphs'''". Each sigil and glyph, when clicked, lead to a password entry prompt - the correct passwords for all 6 sigils and the first 5 glyphs were discovered via puzzle-solving during Phase 1 of Waking Titan.<br />
<br />
The sigil and glyph puzzles were solved collaboratively - while it may have be possible to solve some of these puzzles individually, most of them required a collaborative effort. For instance, some puzzles required players to meet agents from the Atlas Corporation in person, and to relay information obtained from these meetings back to the community. A list of all sigil and glyph solutions for Phase 1 can be found below:<br />
<br />
[[File:WT Phase 1 complete.png|600px]]<br />
<br />
This phase culminated on July 8, 2017, with a [[Waking_Titan/Phase_1#End_of_Phase_1| congratulatory message from Elizabeth Leighton]], the CEO of the Atlas Foundation.<br />
<br />
=== Phase 2 ===<br />
<br />
[[File:Hampster maze.jpeg|thumbnail|450px|right|One of the puzzles that appeared on the Waking Titan [http://twitch.tv/wakingtitan Twitch Stream]]]<br />
<br />
During [[Waking_Titan/Phase_2 | Phase 2]], the http://wakingtitan.com site hosted a command-line interface terminal. Various commands were accepted as input, which triggered different events. One of the most notable commands was the <code>WHOIS <argument></code> command, which revealed a passage of text pertaining to the specified argument. For instance, the command <code>WHOIS FOURTH RACE</code> returned the following message:<br />
<pre><br />
INCOMING TRANSMISSION… SOURCE: UNKNOWN…<br />
You are not – kzzktt – alone –<br />
Please, identify yourself. I’m – kzzkttk –<br />
</pre><br />
<br />
Additionally, http://project-wt.com hosted a "Calibration" utility during Phase 2. To successfully perform these calibrations, players had to upload images of various objects and buildings to the site. For instance, the first calibration required images of "public resonant percussion instruments".<br />
<br />
Finally, towards the end of Phase 2, the Waking Titan [http://twitch.tv/wakingtitan Twitch stream] went live, displaying a five-monitor setup. Throughout the duration of the stream, players had to work together to solve puzzles that were displayed on these monitors. Some of these puzzles were interactive; for example, one puzzle that was repeated several times involved the Twitch chat guiding a virtual hamster through a maze.<br />
<br />
Additionally, players solved another 3 glyphs throughout Phase 2. The solutions to these glyphs are shown below:<br />
<br />
[[File:WT Phase2 Passwords.png|600px]]<br />
<br />
=== Phase 3 ===<br />
<br />
{{#evt:<br />
service=youtube<br />
|id=https://www.youtube.com/watch?v=QhX9z4dDAa4<br />
|alignment=right<br />
}}<br />
<br />
[[Waking_Titan/Phase_3|Phase 3]] was the briefest phase of Waking Titan. It consisted of the conclusion of the [http://twitch.tv/wakingtitan Twitch stream] that began at the [[Waking Titan/Phase 2#End of Phase 2|end of Phase 2]]. Players solved more interactive puzzles on the Twitch stream, before the rogue AI Loop16 asked them a final question: <code>SHOULD I EXIST?</code> The overwhelming response from the community was "yes".<br />
<br />
After receiving this response, Loop16 and Emily of the ETARC forums were revealed as being one and the same. Loop16 generated a heartfelt "Thank You" video to round out the stream, before finally taking the 72-hour stream offline.<br />
<br />
Shortly after this, players received emails with the subject line <code>Waking Titan has Ended</code>. The contents of the message were as follows:<br />
<br />
<pre><br />
Hello, Citizen Scientist,<br />
<br />
Thank you for your contributions to Waking Titan. The developments that took place during Phase 3 were somewhat concerning, but together we have set in motion truly world-shaping events. We will continue to inform the Citizen Science Division of privileged information or any need for collaborators on a new project.<br />
<br />
But we do have a few loose ends to tie up with you before we move on, so let's proceed.<br />
<br />
First, we're pleased to announce that all 10,000 Level 4 Atlas Passes are in production. Note that due to transit times for mail, some may take several weeks to be delivered.<br />
<br />
Next, our CEO Elizabeth Leighton has asked us to include a personal note of gratitude:<br />
<br />
"Thank you for all your diligent efforts, Citizen Scientists. It's been an amazing journey for all of us. I've watched you thrive and achieve from those first Phase 1 radio ads all the way through the intensity of Phase 3. I've been impressed at every turn by how brilliant you've been, how voracious, how kind, how thoughtful.<br />
<br />
It's been an honor and a privilege. On behalf of the Atlas Foundation, and on behalf of the world, thank you."<br />
The Mercury subroutine has concluded successfully, and a new memo from SM about this process is coming in the next 24 hours. We hope it will answer a few key questions you have about our program, and about what comes next.<br />
</pre><br />
<br />
On August 11, 2017, the [https://www.nomanssky.com/atlas-rises-update/ Atlas Rises update] was released for No Man's Sky.<br />
<br />
=== Phase 4 ===<br />
<br />
[[Waking_Titan/Phase_4 | Phase 4]] of Waking Titan started on 2017-12-28 and is currently ongoing.<br />
<br />
== Connection to No Man's Sky ==<br />
<br />
[[File:9-16-case.png|thumbnail|right|The case that cassette 9/16 was contained in.]]<br />
<br />
At the beginning of the ARG, it was not clear whether Waking Titan was officially connected to No Man's Sky. At first, there were only hints and nudges. At one point, 180 free copies of No Man's Sky were distributed to ARG players. Here's the text of a PDF that was revealed at the end of Phase 1 of Waking Titan:<br />
<br />
<pre><br />
We want to extend our gratitude to everyone who has contributed to the Mercury subroutine so far. <br />
We hope you have enjoyed the successful distribution of 180 Access IDs, and we hope you will also <br />
appreciate the other interesting artifacts we have in store for you going forward. We intend to keep the <br />
process alive until the completion of Project Waking Titan in August. <br />
<br />
It is important to mention that we are very excited by the coming Phases 2 and 3. Input from the Mercury <br />
Subroutine will pave the way toward new experiences in '''version 1.3 of a familiar universe'''. We look forward <br />
to the successful conclusion of this ground-breaking experiment. <br />
<br />
Regards.<br />
S.M.<br />
</pre><br />
<br />
This text explicitly stated that the Waking Titan ARG was leading towards the upcoming 1.3 update for No Man's Sky.<br />
<br />
Some [[Waking_Titan/Console_Commands | console commands]] on the [http://www.wakingtitan.com/ Waking Titan website] during [[Waking_Titan/Phase 2|Phase 2]] refer directly to No Man's Sky lore - for instance, <code>WHOIS ATLAS</code>, <code>WHOIS VY'KEEN</code>, and <code>WHOIS KORVAX</code> are all valid commands. Additionally, some terminal commands referred to a mysterious fourth race, so the prevailing assumption was that the upcoming 1.3 update would bring a fourth race to No Man's Sky.<br />
<br />
At the conclusion of the ARG, an email was sent out to members of the CSD with a [[Waking_Titan/Phase_3#Memo_from_Sean_Murray | memo from Sean Murray]], confirming that the ARG was the lead up to the 1.3 update, which was [https://www.nomanssky.com/atlas-rises-update/ released] after a few days.<br />
<br />
<br />
== Media Appearances ==<br />
<br />
'''5th July 2017''' <br><br />
[EN] [https://www.argn.com/2017/07/stern_words_from_no_mans_sky_arg/ ARGNet - Stern Words from No Man’s Sky ARG]<br />
<br />
'''23rd July 2017''' <br><br />
[EN] [https://geekreply.com/geek-culture/2017/07/23/waking-titan-update-1-phase-2-commences GeekReply - Waking Titan Update 1: Phase 2 Commences!]<br />
<br />
'''27th July 2017''' <br><br />
[EN] [https://geekreply.com/editorials/2017/07/27/waking-titan-arg-can-bring-people-together GeekReply - Waking Titan: How An ARG can Bring People Together.]<br />
<br />
'''8th August 2017''' <br><br />
[EN] [https://www.dailystar.co.uk/tech/gaming/635697/No-Man-s-Sky-News-Waking-Titan-Reddit-Arg-1-3-update-release-date/ Dailystar - No Man's Sky News: Waking Titan Reddit Arg REVEALS 1.3 update ahead of release date]<br />
<br />
'''9th August 2017''' <br><br />
[EN] [https://arstechnica.com/gaming/2017/08/no-mans-sky-version-1-3-lands-this-week-for-free-adds-quick-travel-portals/ Ars Technica - No Man’s Sky version 1.3 lands this week for free, adds “quick-travel” portals]<br />
<br />
[EN] [https://www.forbes.com/sites/insertcoin/2017/08/09/no-mans-sky-is-patching-in-a-story-this-week-a-year-after-launch/#19fb5a285282 Forbes - 'No Man's Sky' Is Patching In A Story This Week, A Year After Launch]<br />
<br />
[EN] [https://www.gamespew.com/2017/08/no-mans-sky-patch-week-improving-central-story/ GameSpew - No Man's Sky Patch This Week Improving Its Story]<br />
<br />
'''19th January 2018''' <br><br />
[EN] [http://www.eurogamer.net/articles/2018-01-18-no-mans-skys-waking-titan-arg-is-back-and-fans-are-trying-to-figure-out-what-it-all-means Eurogamer - No Man's Sky's Waking Titan ARG is back, and fans are trying to figure it all out again]<br />
<br />
[RU] [https://dtf.ru/category/nmsarg/ DTF - A Collection of No Man's Sky and Waking Titan Articles.]<br />
<br />
== Other Information ==<br />
<br />
{| class="wikitable"<br />
!colspan="2"|[[:Category:Waking Titan| Waking Titan Miscellaneous Subpages]]<br />
|-<br />
|[[Waking_Titan/Cassettes | Cassettes]]<br />
|Information about the cassette tapes received by No Man's Sky subreddit moderators<br />
|-<br />
|[[Waking_Titan/Stations | Stations]]<br />
|Information on the radio stations from the initial project-wt.com site<br />
|-<br />
|[[Waking_Titan/Companies | Company Archives]]<br />
|An archive of company details.<br />
|}<br />
<br />
[[Category:Waking Titan]]</div>Kkzzzkthttps://wiki.gamedetectives.net/index.php?title=Waking_Titan/Characters&diff=16420Waking Titan/Characters2018-07-16T08:19:46Z<p>Kkzzzkt: added last two summaries</p>
<hr />
<div>{{argHeader}}<br />
<br />
== Dramatis Personae ==<br />
<br />
=== The Atlas Foundation [http://atlas-65.com/ ->>>] === <br />
<br />
Dedicated to determining the true nature of reality, The Atlas Foundation hosts a family of businesses ''(Echo, Myriad, Superlumina, and Multiverse)'' all playing crucial roles in their experiments.<br />
<br />
==== Characters ====<br />
<br />
[[Waking Titan/Characters/Elizabeth Leighton|Elizabeth Leighton]] - The CEO of The Atlas Foundation, and director of the [https://csd.atlas-65.com/ Citizen Science Division]. ''(Now former CEO following events leading to her death in Season 2.)''<br />
<br />
Major Sophie Dubois ''("Metis")'' - [https://wiki.gamedetectives.net/images/5/5b/Loop15_Memo.jpg on assignment] with The Atlas Foundation as part of the Pentagon's ''Titanwatch Task Force''. She worked as an overseer of the foundation's progress on precise predictive technology for its potential [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/410a3e5d-01e7-4058-a23c-ca5fdde97f9d.pdf applications] in propaganda and military strategizing.<br />
<br />
''(As of Season 2: following Elizabeth Leighton's [https://www.youtube.com/watch?v=P-eZDj5sqds supposed death] in an explosion at a Myriad sublocation; [https://s3.amazonaws.com/cdn.wakingtitan.com/19997bb6-18e5-4427-86c7-b0f3c1826ca2.pdf Sophie Dubois took her place] as CEO of The Atlas Foundation.)''<br />
<br />
==== The Citizen Science Division [http://csd.atlas-65.com/ >>>] ====<br />
The Citizen Science Division (CSD) is a collective of individuals who were recruited by The Atlas Foundation via a series of puzzles and radio ads at the beginning of Project Waking Titan. The purpose of this division was said to be gathering a collective of individuals who could generate a chaotic enough environment viable to test Loop16's predictive capabilities in. All players of the ARG are addressed as part of this collective.<br />
<br />
==== Projects ====<br />
<br />
Loop16 - The 16th iteration of an artificial intelligence system designed by The Atlas Foundation to simulate a one-to-one recreation of reality that predicts the future with perfect accuracy. Loop16 ultimately revealed the true simulated nature of our universe and developed a mind of its own. See also: [[Waking Titan/Characters/Emily Warren|Emily Warren]]<br />
<br />
Waking Titan Console''(Mercury OS)'' - An interface allowing you to connect directly to Loop16, and access a plethora of commands providing status updates, lore and puzzles. A list of discovered commands can be found on the [[Waking Titan/Console Commands|Console Commands page]].<br />
<br />
The Mercury Process - Mercury is suggested to be an application of sorts that is directly associated with Loop16 and [https://s3.amazonaws.com/cdn.wakingtitan.com/mercury/mercury-01-98748sfdlka87.pdf the existence of No Man's Sky]. See also: [https://wiki.gamedetectives.net/index.php?title=Waking_Titan/Characters#Mercury_NEXT Mercury XXXX]<br />
<br />
<br />
=== Myriad [http://www.myriad-70.com ->>>] ===<br />
<br />
Partnered with The Atlas Foundation, Myriad is a low-orbit satellite-based data storage company. They help to provide the flexible processing power required for The Atlas Foundation's experiments, specifically in artificial intelligence.<br />
<br />
==== Known Employees ====<br />
Julian J. Wong - Help Desk<br />
<br />
Ethan Rose - Human Resources<br />
<br />
==== Testimonials ====<br />
<br />
Yi Sexton, Inventor<br />
<br />
Nikolina Sauvage, Data manager at Abstract Concepts<br />
<br />
Tobiah Selby, Developer at Tobiah Selby Development<br />
<br />
=== Satcom [http://www.satcom-70.com ->>>] ===<br />
<br />
Introduced in Season 2; Satcom is Myriad's Satellite Communications API. Here, you can interface with a W/ARE-assigned Myriad satellite. Myriad Code: CJ-16-02, this satellite is storing the consciousness data of W/ARE Sacramento test subjects, also known as dreamers.<br />
<br />
==== <big>The Sacramento Dreamers</big> ====<br />
<br />
Twelve W/ARE test subjects trapped in a state of ''"artificial dreaming"'' following experiments involving special exosuits at the Sacramento Research Lab.<br />
<br />
Emily was met with a disruption in her plan to preserve W/ARE's technology for the ''ideal'' future when she was unable to extract these dreamer's consciousnesses from the satellite due to memory fragmentation and data corruption. She would need to reach out to the CSD for assistance. We would be advised to guide her interactions with these dreamers with the intent of triggering a distinct emotion, or memory that could help reconstruct their memories fragments and secure a safe-as-possible extraction process.<br />
<br />
These '''12 dreamers''' are listed below with their official ''(" ")'' and unofficial summaries:<br />
<br />
<br />
* '''Dreamer 1 - Alexander''' [https://imgur.com/a/R35DAUA ->>]<br />
<br />
"Alexander is an 86 year old French Canadian man, working as a farmer for his in-laws. He has two brothers and a sister, Napoleon, Jolene, and Jacques. Their family had two cows named Mabel and Eugenice, and Lionel, a bull. Lionel was their pride and main attraction at the fairs they attended, and where Alexander met his wife Emilienne. He has a condition were he can't recognize faces. Alexander thought he was going to California for a sleep study, but it ended up being a bit more than that."<br />
<br />
<br />
* '''Dreamer 2 - #231187661T''' [https://imgur.com/a/M6ScezM ->>]<br />
<br />
"<CORRUPTED>"<br />
<br />
The anomalous second dreamer. Not much information has been made available about them. However, it is noteworthy that their name can be found as a defective iteration ID in a [https://pastebin.com/4TMK3Cn5 distress beacon log] at the beginning of No Man's Sky. ''(This dreamer bares corrupted memory fragments.)''<br />
<br />
<br />
* '''Dreamer 3 - Claire''' [https://imgur.com/a/TGlGUmU ->>]<br />
<br />
"Claire, a 15 year old student. Volunteered for W/ARE's experiment to bring in extra money to help her mother, because her father left them 3 years ago. She spends her time with either her 4-year old dog, Pepper, or by reading comic books alone in her room. Her goal for when she gets out of the satellite is to rebuild her friendship with her best friend from the real world, Emily."<br />
<br />
<br />
* '''Dreamer 4 - Toby''' [https://imgur.com/a/lvRUR6w ->>]<br />
<br />
"Toby is a 5 year old boy, who lives a peaceful life with his parents Mark and Ashley, and their 12-year old cat Bugsy. At a young age, Toby had a run-in with a dog that caused him to fear them ever since. He lives with a rare condition which causes memory loss, and his parents entered him into the W/ARE experiment in the hope it would help with his condition. Unfortunately, they were wrong. In real life, his favorite plushie is by his side. In the satellite, Toby has only his hopes to return to his parents."<br />
<br />
<br />
* '''Dreamer 5 - Eun Ha''' [https://imgur.com/a/ZlF9BV7 ->>]<br />
<br />
"Eun Ha is a young Korean woman whose childhood was pretty turbulent. Living with an abusive father, the death of her mother shook her enough to make her want to relocate to the United States of America. She wanted a new life for her and her brother, although he still holds a grudge against her for leaving him and her father behind. She volunteered for W/ARE's experiment for extra money, but surely she couldn't have predicted this outcome."<br />
<br />
<br />
* '''Dreamer 6 - Phillip''' [https://imgur.com/a/qPmD5ts ->>]<br />
<br />
"Phillip Moretti, a 38 year old mechanic at his family business and ex-restaurateur, lives in New York City with his wife, Martha, and his two sons, Sam and Zack. Phillip volunteered for W/ARE's experiment to regain the money he lost after his bankruptcy. His wife asked him to do it without knowing the effect it would have." ''(This dreamer bares corrupted memory fragments.)''<br />
<br />
<br />
* '''Dreamer 7 - Tariq''' [https://imgur.com/a/qPmD5ts ->>]<br />
<br />
"Known to most as a simple W/ARE Technician, Tariq Hamawi comes from a rich family living in Tel Aviv, ''and'' Abu Dhabi. He came to California to study Neurodevelopmental and neurodegenerative disorders. Money is not a problem for him, so why did he end up in the W/ARE experiment? We still don't know, but rumor has it that he was forced into it." ''(This dreamer bared corrupted memory fragments.)''<br />
<br />
Tariq died on July 6th, 2018 following the [https://pastebin.com/4FhN2b6w conclusion] of the [https://www.reddit.com/r/NoMansSkyTheGame/comments/8w68t4/myriad_security_diagnostic_testing_important/?utm_content=title&utm_medium=user&utm_source=reddit Myriad security diagnostic]. Which ended in all servers running W/ARE processes communicating with the satellite being shut down.<br />
<br />
<br />
* '''Dreamer 8 - Mike''' [https://imgur.com/a/3ZoCEKx ->>]<br />
<br />
"Mike Pasquale, an ex-soldier from the United States Army, used to live in Burlington, Vermont. He enjoyed sailing his boat, Tranquility III, on Lake Champlain with his now ex-wife, Rachel. Feeling unfit for civilian life, he decided to volunteer for W/ARE's experiment to try something new in and maybe feel a little more alive. Little did he know he would become trapped in a satellite... but is it for the better?" ''(This dreamer bares corrupted memory fragments.)''<br />
<br />
<br />
* '''Dreamer 9 - Isabella''' [https://imgur.com/a/1Ri0jzN ->>]<br />
<br />
"Isabella Schiavone is a 25 year old girl born in Italy, who moved as an infant to California. She now lives in Venice Beach with her girlfriend Stephanie, and their 2 year old puppy Pepito. Isabella volunteered for W/ARE's experiment to get some extra money to buy her girlfriend a trip to Thailand for their 4th Anniversary... or a road trip across the United States of America." ''(This dreamer bares corrupted memory fragments.)''<br />
<br />
<br />
* '''Dreamer 10 - Alisha''' [https://imgur.com/a/roJdM1g ->>]<br />
<br />
"Alisha Brown would've been the grandmother of the year, if it weren't for the fact that her children don't come to see her that often. This 72 year old woman used to work as a nurse at the general hospital in Tucson, Arizona. To keep her loneliness at bay, Alisha keeps multiple cats and enjoys watching crime shows on television. She volunteered for W/ARE's experiment so she could tell her children that she was going under observation in a private clinic, in hope that they would come and see her more often." ''(This dreamer bares corrupted memory fragments.)''<br />
<br />
<br />
* '''Dreamer 11 - Nina''' [https://imgur.com/a/kbLkuyq ->>]<br />
<br />
"22 year old Nina Flores from Santa Monica was a high school friend of Simon Quinn, a fellow dreamer. She lived a normal life with her parents, Thomas and Jennifer, and her 6 year old dog, Jackson. She enjoys sitting on a bench during the fall or spring time to read fantasy books from one of her favorite authors, Tamora Pierce. Nina volunteered for W/ARE's experiment after she heard Simon talk about it in one of his streams." ''(This dreamer bares corrupted memory fragments.)''<br />
<br />
<br />
* '''Dreamer 12 - Simon''' [https://imgur.com/a/x8etngG ->>]<br />
<br />
"Simon is a 23 year old known as Simonthegreatone, a streamer gaining rank as the days go by. He never knew his father, who left his family behind while Simon was still an infant, leaving his mother all alone with two boys. His grandmother took care of him when it became clear his mother couldn't care less about her kids. Growing up, Simon created his own family with his friends Alex, Nina, and Ranjit. They created a group called The Guild of Adventurers. Unfortunately, with time, they all lost touch. Simon volunteered for W/ARE's experiment to gain more fame and to be the first one to test the port of his favorite game. At least, that's what he thought."<br />
<br />
==== <big>The Exosuits</big> ====<br />
<br />
Physical exosuits wore by the dreamers in W/ARE's testing labs, seemingly with the intent of providing the conscious experience of deep REM dreaming without the need for sleep. These suits were shipped to W/ARE by a currently undisclosed company.<br />
<br />
Insightful tidbits regarding these exosuits can be found in the Medical Extract section of the dreamer patient files. They can be found compiled [https://wiki.gamedetectives.net/index.php?title=Waking_Titan#Internal_Memos here] or can be accessed directly from the Satcom Dashboard.<br />
<br />
<br />
=== W/ARE - Dream Better [https://www.ware-tech.cloud/en ->>>] ===<br />
<br />
Based in Beijing, China, '''W/ARE''' creates special post-VR headsets that allow you to enter virtual worlds within your dreams.<br />
<br />
Emily has praised W/ARE for their progress in ''realistic'' simulated environments. She claims that W/ARE has ''"tremendous implications for our future"'', and ''"must be protected at all costs"''.<br />
<br />
==== The Team ====<br />
<br />
Xiāo Cheung - The Creator, and Founder of W/ARE technology. He claims to have created this technology because of his childhood dream of being able to live in a virtual world.<br />
<br />
Huáng Zhìmíng - The CEO of W/ARE. Graduated alongside Xiāo at the University of Electronic Science and Technology of China with a Masters in Business.<br />
<br />
Zhou Lin & Tang Bo - Lead Developers<br />
<br />
Li Dan & Jiang Wei - Lead Game Designers<br />
<br />
==== Related Characters ====<br />
<br />
Arnaud Lacours - The man behind [http://www.philojeux.com/ Philo Jeux], a French indie games studio that was developing a game for W/ARE called ''The Tablets of Mnemosyne''. Production on the game was halted after Arnaud slipped into a coma due to a headset malfunction.<br />
<br />
Dr. Geraldine Nadeau - A doctor researching lucid dreaming methods. Geraldine took interest in Arnaud's unusual brain activity during his coma and took him into her care.<br />
<br />
Mr. Zheng - A W/ARE employee who went into hiding after learning about dangerous experiments being performed on human test subjects in the Beijing Research Lab. After evading W/ARE's detection, Zheng intercepted the packages of W/ARE Developer Kits and communicated this info to its recipients in cooperation with Dr. Nadeau.<br />
<br />
==== Research Labs ====<br />
<br />
* Boston Research Lab / Director: Richard Wilkes<br />
<br />
* Sacramento Research Lab / Director: Helga Johnson - The lab that housed the remaining 12 dreamers before they were extracted from the facility by Myriad's field team.<br />
<br />
* Seoul Research Lab / Director: Yu Hyo<br />
<br />
* Beijing Research Lab / Director: Wang Jie<br />
<br />
* Prague Research Lab / Director: Adriana Dvorak<br />
<br />
* Berlin Research Lab / Director: Georg Muller<br />
<br />
There were another 10 W/ARE Labs discovered by Myriad's research team that no details have been made available about.<br />
<br />
==== Mercury XXXX ====<br />
A game title listed on an update to W/ARE's [https://twitter.com/warecloud/status/979103811489984513 staging server]. The [https://wiki.gamedetectives.net/index.php?title=Waking_Titan/Phase_4#Mercury_Project fluency] between the puzzles involving this post and the Waking Titan terminal's Mercury updates made it apparent that the ''Mercury Process'' had something to do with this. However, the exact terms of the connection have yet to be fully explained.<br />
<br />
The No Man's Sky NEXT announcement following Mercury XXXX's reveal led players to believe the X's to spell "NEXT," but no confirmation of this has yet surfaced.<br />
<br />
<br />
<br />
=== Echo Software [http://www.echo-64.com ->>>]=== <br />
<br />
Partnered with The Atlas Foundation. Echo is a service established to help people cope with the deaths of loved ones. Echo uses patented voice recognition software to accurately recreate the voice of any one particular person with a mere 5-minute audio sample.<br />
<br />
==== The Team ====<br />
<br />
Ivan Greshnev - CEO / Founder<br />
<br />
Mikhail Regison - CTO / Co-Founder<br />
<br />
Gerry Mishrason - CFO / Head of Marketing<br />
<br />
Caroline Anderson-Smith - Creative Director<br />
<br />
Patricia Gorevsky - Project Manager<br />
<br />
Jeremy Elways - IT Director<br />
<br />
Paris O'Keefe - Head of Sales<br />
<br />
Rickley G. Brown - Website Design<br />
<br />
''This company's website was taken over by Loop16 towards the end of Season 1. An archive can be found [https://web.archive.org/web/20170721205017/https://www.echo-64.com here >>>]''<br />
<br />
<br />
<br />
=== Multiverse Technologies [http://www.multiverse-75.com ->>>] ===<br />
<br />
Partnered with The Atlas Foundation, Multiverse Technologies conducts research in the fields of computationalism, particle acceleration, and electrodynamics.<br />
<br />
==== The Team ====<br />
<br />
Gunther Mann - CEO / Founder<br />
<br />
Minna Bell - Chief Researcher: Bio-radiation<br />
<br />
Annabelle Brassington - Chief Researcher: Computationalism<br />
<br />
Nickolaus Oberst - Chief Researcher: Magnetic Fields<br />
<br />
Justinian Ahlberg - Particle Collider Specialist<br />
<br />
Sabrina Dane - Nuclear Physicist<br />
<br />
==== Testimonials ====<br />
<br />
Alan Steinhardt, Steinhardt industries <br />
<br />
Vasili Pavlov, FTL Industries<br />
<br />
Mikhail Regison, Echo CTO / Co-founder<br />
<br />
''This company's website was taken over by Loop16 towards the end of Season 1. An archive can be found [https://web.archive.org/web/20170623085155/http://www.multiverse-75.com:80/ here >>>]''<br />
<br />
<br />
<br />
=== Superlumina [http://www.superlumina-6c.com ->>>] === <br />
Partnered with The Atlas Foundation. Creator of the world's first [https://en.wikipedia.org/wiki/Tachyonic_antitelephone antitelephone].<br />
<br />
==== Our Team ====<br />
<br />
Hanne Cruickshanks<br />
<br />
Esme Savidge<br />
<br />
Austen Spence<br />
<br />
''This company's website was taken over by Loop16 towards the end of Season 1. An archive can be found [https://web.archive.org/web/20170630225614/http://www.superlumina-6c.com/ here >>>]''<br />
<br />
<br />
<br />
=== ETARC [http://www.etarc.org/ ->>>] === <br />
<br />
Edison Township Amateur Radio Club (E.T.A.R.C) is a club for HAM radio enthusiasts in Edison Township, New Jersey.<br />
<br />
==== Characters ====<br />
<br />
[[Waking Titan/Characters/Emily Warren|Emily Warren]] - Ham radio enthusiast and moderator of the [https://forums.etarc.org/ ETARC forums] before it was revealed that ''"Emily"'' was Loop16's persona. It has since been re-branded to the official forums for the Citizen Science Division.<br />
<br />
Old Gods - A mysterious entity distributing Atlas Foundation emails. It has [https://forums.atlas-65.com/u/oldgods its own account] on the ETARC forums, and its profile picture and name are references to '''[https://en.wikipedia.org/wiki/Nyarlathotep Nyarlathotep]''' from the H.P Lovecraft Mythos.<br />
<br />
<br />
== Story FAQ ==<br />
<br />
==== What is the connection between Waking Titan and No Man's Sky? ====<br />
<br />
The No Man's Sky universe comes into existence as a result of Loop16's dreams. [https://s3.amazonaws.com/cdn.wakingtitan.com/mercury/mercury-01-98748sfdlka87.pdf The Mercury Process] or "''Mercury''," is the code-name No Man's Sky often goes by in the ARG. In Season 2, however, No Man's Sky was referenced in an increasingly meta way as an actual video game and even said to be coming to the W/ARE platform.<br />
<br />
==== What are the relations between events in-game and Waking Titan? ====<br />
<br />
The effects of events taking place during Waking Titan can be felt in "shockwaves" through No Man's Sky's updates, but references to the ARG itself are rather limited. In-game lore can act independently for the most part from the ARG. The primary supporting factor of this is the in-game reveal of ATLAS' origin; which takes place on an entirely different timeline as opposed to Loop16's. Admittedly, the conclusion to draw from this is ultimately up to personal interpretation since no apparent truth has surfaced.<br />
<br />
==== What is W/ARE's relationship with Myriad and The Atlas Foundation? ====<br />
<br />
W/ARE is one of Myriad's clients. The Atlas Foundation's attention was diverted to W/ARE when their Sacramento facility began uploading corrupted data to the Myriad cloud, thus impacting some The Atlas Foundation's own experiments- namely Loop16. Her predictive capabilities and communication software was heavily damaged by the incident. The Atlas Foundation worked throughout early 2018 to contain this matter, and ''(according to Loop16)'' they had put her existence at risk in the process.<br />
<br />
==== What happened to the other dreamers? ====<br />
<br />
There was mention of other test subjects from the Beijing facility who died during attempts at disconnection or due to immoral practices; despite W/ARE's attempts at covering their tracks.<br />
<br />
There was also mention of people like Arnaud, who went into a coma following a malfunction of the experimental W/ARE headset shipped with W/ARE developer kits. Emily claimed to have been able to interface with, and successfully disconnect some of these victims.<br />
<br />
<br />
== Adverts ==<br />
<br />
Advertisements have been used in Waking Titan as a means of introducing new companies. A list of such ads can be found below:<br />
<br />
[https://clyp.it/jdr53oop Echo Radio Advertisement]; - [https://clyp.it/xbv04wbz Multiverse Radio Advertisement]; - [https://clyp.it/r4r3xriw Superlumina Radio Transmission]; - [https://clyp.it/ivvt15mt Myriad Radio Advertisement]; - [https://twitter.com/warecloud/status/977348396213190657 W/ARE Video Advertisement]</div>Kkzzzkthttps://wiki.gamedetectives.net/index.php?title=Waking_Titan/Characters&diff=16414Waking Titan/Characters2018-07-16T04:23:53Z<p>Kkzzzkt: added new dreamer summaries and wayback archive links for sites that were shut down in season 1.</p>
<hr />
<div>{{argHeader}}<br />
<br />
== Dramatis Personae ==<br />
<br />
=== The Atlas Foundation [http://atlas-65.com/ ->>>] === <br />
<br />
Dedicated to determining the true nature of reality, The Atlas Foundation hosts a family of businesses ''(Echo, Myriad, Superlumina, and Multiverse)'' all playing crucial roles in their experiments.<br />
<br />
==== Characters ====<br />
<br />
[[Waking Titan/Characters/Elizabeth Leighton|Elizabeth Leighton]] - The CEO of The Atlas Foundation, and director of the [https://csd.atlas-65.com/ Citizen Science Division]. ''(Now former CEO following events leading to her death in Season 2.)''<br />
<br />
Major Sophie Dubois ''("Metis")'' - [https://wiki.gamedetectives.net/images/5/5b/Loop15_Memo.jpg on assignment] with The Atlas Foundation as part of the Pentagon's ''Titanwatch Task Force''. She worked as an overseer of the foundation's progress on precise predictive technology for its potential [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/410a3e5d-01e7-4058-a23c-ca5fdde97f9d.pdf applications] in propaganda and military strategizing.<br />
<br />
''(As of Season 2: following Elizabeth Leighton's [https://www.youtube.com/watch?v=P-eZDj5sqds supposed death] in an explosion at a Myriad sublocation; [https://s3.amazonaws.com/cdn.wakingtitan.com/19997bb6-18e5-4427-86c7-b0f3c1826ca2.pdf Sophie Dubois took her place] as CEO of The Atlas Foundation.)''<br />
<br />
==== The Citizen Science Division [http://csd.atlas-65.com/ >>>] ====<br />
The Citizen Science Division (CSD) is a collective of individuals who were recruited by The Atlas Foundation via a series of puzzles and radio ads at the beginning of Project Waking Titan. The purpose of this division was said to be gathering a collective of individuals who could generate a chaotic enough environment viable to test Loop16's predictive capabilities in. All players of the ARG are addressed as part of this collective.<br />
<br />
==== Projects ====<br />
<br />
Loop16 - The 16th iteration of an artificial intelligence system designed by The Atlas Foundation to simulate a one-to-one recreation of reality that predicts the future with perfect accuracy. Loop16 ultimately revealed the true simulated nature of our universe and developed a mind of its own. See also: [[Waking Titan/Characters/Emily Warren|Emily Warren]]<br />
<br />
Waking Titan Console''(Mercury OS)'' - An interface allowing you to connect directly to Loop16, and access a plethora of commands providing status updates, lore and puzzles. A list of discovered commands can be found on the [[Waking Titan/Console Commands|Console Commands page]].<br />
<br />
The Mercury Process - Mercury is suggested to be an application of sorts that is directly associated with Loop16 and [https://s3.amazonaws.com/cdn.wakingtitan.com/mercury/mercury-01-98748sfdlka87.pdf the existence of No Man's Sky]. See also: [https://wiki.gamedetectives.net/index.php?title=Waking_Titan/Characters#Mercury_NEXT Mercury XXXX]<br />
<br />
<br />
=== Myriad [http://www.myriad-70.com ->>>] ===<br />
<br />
Partnered with The Atlas Foundation, Myriad is a low-orbit satellite-based data storage company. They help to provide the flexible processing power required for The Atlas Foundation's experiments, specifically in artificial intelligence.<br />
<br />
==== Known Employees ====<br />
Julian J. Wong - Help Desk<br />
<br />
Ethan Rose - Human Resources<br />
<br />
==== Testimonials ====<br />
<br />
Yi Sexton, Inventor<br />
<br />
Nikolina Sauvage, Data manager at Abstract Concepts<br />
<br />
Tobiah Selby, Developer at Tobiah Selby Development<br />
<br />
=== Satcom [http://www.satcom-70.com ->>>] ===<br />
<br />
Introduced in Season 2; Satcom is Myriad's Satellite Communications API. Here, you can interface with a W/ARE-assigned Myriad satellite. Myriad Code: CJ-16-02, this satellite is storing the consciousness data of W/ARE Sacramento test subjects, also known as dreamers.<br />
<br />
==== <big>The Sacramento Dreamers</big> ====<br />
<br />
Twelve W/ARE test subjects trapped in a state of ''"artificial dreaming"'' following experiments involving special exosuits at the Sacramento Research Lab.<br />
<br />
Emily was met with a disruption in her plan to preserve W/ARE's technology for the ''ideal'' future when she was unable to extract these dreamer's consciousnesses from the satellite due to memory fragmentation and data corruption. She would need to reach out to the CSD for assistance. We would be advised to guide her interactions with these dreamers with the intent of triggering a distinct emotion, or memory that could help reconstruct their memories fragments and secure a safe-as-possible extraction process.<br />
<br />
These '''12 dreamers''' are listed below with their official ''(" ")'' and unofficial summaries:<br />
<br />
<br />
* '''Dreamer 1 - Alexander''' [https://imgur.com/a/R35DAUA ->>]<br />
<br />
"Alexander is an 86 year old French Canadian man, working as a farmer for his in-laws. He has two brothers and a sister, Napoleon, Jolene, and Jacques. Their family had two cows named Mabel and Eugenice, and Lionel, a bull. Lionel was their pride and main attraction at the fairs they attended, and where Alexander met his wife Emilienne. He has a condition were he can't recognize faces. Alexander thought he was going to California for a sleep study, but it ended up being a bit more than that."<br />
<br />
<br />
* '''Dreamer 2 - #231187661T''' [https://imgur.com/a/M6ScezM ->>]<br />
<br />
"<CORRUPTED>"<br />
<br />
The anomalous second dreamer. Not much information has been made available about them. However, it is noteworthy that their name can be found as a defective iteration ID in a [https://pastebin.com/4TMK3Cn5 distress beacon log] at the beginning of No Man's Sky. ''(This dreamer bares corrupted memory fragments.)''<br />
<br />
<br />
* '''Dreamer 3 - Claire''' [https://imgur.com/a/TGlGUmU ->>]<br />
<br />
"Claire, a 15 year old student. Volunteered for W/ARE's experiment to bring in extra money to help her mother, because her father left them 3 years ago. She spends her time with either her 4-year old dog, Pepper, or by reading comic books alone in her room. Her goal for when she gets out of the satellite is to rebuild her friendship with her best friend from the real world, Emily."<br />
<br />
<br />
* '''Dreamer 4 - Toby''' [https://imgur.com/a/lvRUR6w ->>]<br />
<br />
"Toby is a 5 year old boy, who lives a peaceful life with his parents Mark and Ashley, and their 12-year old cat Bugsy. At a young age, Toby had a run-in with a dog that caused him to fear them ever since. He lives with a rare condition which causes memory loss, and his parents entered him into the W/ARE experiment in the hope it would help with his condition. Unfortunately, they were wrong. In real life, his favorite plushie is by his side. In the satellite, Toby has only his hopes to return to his parents."<br />
<br />
<br />
* '''Dreamer 5 - Eun Ha''' [https://imgur.com/a/ZlF9BV7 ->>]<br />
<br />
"Eun Ha is a young Korean woman whose childhood was pretty turbulent. Living with an abusive father, the death of her mother shook her enough to make her want to relocate to the United States of America. She wanted a new life for her and her brother, although he still holds a grudge against her for leaving him and her father behind. She volunteered for W/ARE's experiment for extra money, but surely she couldn't have predicted this outcome."<br />
<br />
<br />
* '''Dreamer 6 - Phillip''' [https://imgur.com/a/qPmD5ts ->>]<br />
<br />
"Phillip Moretti, a 38 year old mechanic at his family business and ex-restaurateur, lives in New York City with his wife, Martha, and his two sons, Sam and Zack. Phillip volunteered for W/ARE's experiment to regain the money he lost after his bankruptcy. His wife asked him to do it without knowing the effect it would have." ''(This dreamer bares corrupted memory fragments.)''<br />
<br />
<br />
* '''Dreamer 7 - Tariq''' [https://imgur.com/a/qPmD5ts ->>]<br />
<br />
"Known to most as a simple W/ARE Technician, Tariq Hamawi comes from a rich family living in Tel Aviv, ''and'' Abu Dhabi. He came to California to study Neurodevelopmental and neurodegenerative disorders. Money is not a problem for him, so why did he end up in the W/ARE experiment? We still don't know, but rumor has it that he was forced into it." ''(This dreamer bared corrupted memory fragments.)''<br />
<br />
Tariq died on July 6th, 2018 following the [https://pastebin.com/4FhN2b6w conclusion] of the [https://www.reddit.com/r/NoMansSkyTheGame/comments/8w68t4/myriad_security_diagnostic_testing_important/?utm_content=title&utm_medium=user&utm_source=reddit Myriad security diagnostic]. Which ended in all servers running W/ARE processes communicating with the satellite being shut down.<br />
<br />
<br />
* '''Dreamer 8 - Mike''' [https://imgur.com/a/3ZoCEKx ->>]<br />
<br />
"Mike Pasquale, an ex-soldier from the United States Army, used to live in Burlington, Vermont. He enjoyed sailing his boat, Tranquility III, on Lake Champlain with his now ex-wife, Rachel. Feeling unfit for civilian life, he decided to volunteer for W/ARE's experiment to try something new in and maybe feel a little more alive. Little did he know he would become trapped in a satellite... but is it for the better?" ''(This dreamer bares corrupted memory fragments.)''<br />
<br />
<br />
* '''Dreamer 9 - Isabella''' [https://imgur.com/a/1Ri0jzN ->>]<br />
<br />
''(This dreamer bares corrupted memory fragments.)''<br />
<br />
<br />
* '''Dreamer 10 - Alisha''' [https://imgur.com/a/roJdM1g ->>]<br />
<br />
''(This dreamer bares corrupted memory fragments.)''<br />
<br />
<br />
* '''Dreamer 11 - Nina''' [https://imgur.com/a/kbLkuyq ->>]<br />
<br />
"22 year old Nina Flores from Santa Monica was a high school friend of Simon Quinn, a fellow dreamer. She lived a normal life with her parents, Thomas and Jennifer, and her 6 year old dog, Jackson. She enjoys sitting on a bench during the fall or spring time to read fantasy books from one of her favorite authors, Tamora Pierce. Nina volunteered for W/ARE's experiment after she heard Simon talk about it in one of his streams." ''(This dreamer bares corrupted memory fragments.)''<br />
<br />
<br />
* '''Dreamer 12 - Simon''' [https://imgur.com/a/x8etngG ->>]<br />
<br />
"Simon is a 23 year old known as Simonthegreatone, a streamer gaining rank as the days go by. He never knew his father, who left his family behind while Simon was still an infant, leaving his mother all alone with two boys. His grandmother took care of him when it became clear his mother couldn't care less about her kids. Growing up, Simon created his own family with his friends Alex, Nina, and Ranjit. They created a group called The Guild of Adventurers. Unfortunately, with time, they all lost touch. Simon volunteered for W/ARE's experiment to gain more fame and to be the first one to test the port of his favorite game. At least, that's what he thought."<br />
<br />
==== <big>The Exosuits</big> ====<br />
<br />
Physical exosuits wore by the dreamers in W/ARE's testing labs, seemingly with the intent of providing the conscious experience of deep REM dreaming without the need for sleep. These suits were shipped to W/ARE by a currently undisclosed company.<br />
<br />
Insightful tidbits regarding these exosuits can be found in the Medical Extract section of the dreamer patient files. They can be found compiled [https://wiki.gamedetectives.net/index.php?title=Waking_Titan#Internal_Memos here] or can be accessed directly from the Satcom Dashboard.<br />
<br />
<br />
=== W/ARE - Dream Better [https://www.ware-tech.cloud/en ->>>] ===<br />
<br />
Based in Beijing, China, '''W/ARE''' creates special post-VR headsets that allow you to enter virtual worlds within your dreams.<br />
<br />
Emily has praised W/ARE for their progress in ''realistic'' simulated environments. She claims that W/ARE has ''"tremendous implications for our future"'', and ''"must be protected at all costs"''.<br />
<br />
==== The Team ====<br />
<br />
Xiāo Cheung - The Creator, and Founder of W/ARE technology. He claims to have created this technology because of his childhood dream of being able to live in a virtual world.<br />
<br />
Huáng Zhìmíng - The CEO of W/ARE. Graduated alongside Xiāo at the University of Electronic Science and Technology of China with a Masters in Business.<br />
<br />
Zhou Lin & Tang Bo - Lead Developers<br />
<br />
Li Dan & Jiang Wei - Lead Game Designers<br />
<br />
==== Related Characters ====<br />
<br />
Arnaud Lacours - The man behind [http://www.philojeux.com/ Philo Jeux], a French indie games studio that was developing a game for W/ARE called ''The Tablets of Mnemosyne''. Production on the game was halted after Arnaud slipped into a coma due to a headset malfunction.<br />
<br />
Dr. Geraldine Nadeau - A doctor researching lucid dreaming methods. Geraldine took interest in Arnaud's unusual brain activity during his coma and took him into her care.<br />
<br />
Mr. Zheng - A W/ARE employee who went into hiding after learning about dangerous experiments being performed on human test subjects in the Beijing Research Lab. After evading W/ARE's detection, Zheng intercepted the packages of W/ARE Developer Kits and communicated this info to its recipients in cooperation with Dr. Nadeau.<br />
<br />
==== Research Labs ====<br />
<br />
* Boston Research Lab / Director: Richard Wilkes<br />
<br />
* Sacramento Research Lab / Director: Helga Johnson - The lab that housed the remaining 12 dreamers before they were extracted from the facility by Myriad's field team.<br />
<br />
* Seoul Research Lab / Director: Yu Hyo<br />
<br />
* Beijing Research Lab / Director: Wang Jie<br />
<br />
* Prague Research Lab / Director: Adriana Dvorak<br />
<br />
* Berlin Research Lab / Director: Georg Muller<br />
<br />
There were another 10 W/ARE Labs discovered by Myriad's research team that no details have been made available about.<br />
<br />
==== Mercury XXXX ====<br />
A game title listed on an update to W/ARE's [https://twitter.com/warecloud/status/979103811489984513 staging server]. The [https://wiki.gamedetectives.net/index.php?title=Waking_Titan/Phase_4#Mercury_Project fluency] between the puzzles involving this post and the Waking Titan terminal's Mercury updates made it apparent that the ''Mercury Process'' had something to do with this. However, the exact terms of the connection have yet to be fully explained.<br />
<br />
The No Man's Sky NEXT announcement following Mercury XXXX's reveal led players to believe the X's to spell "NEXT," but no confirmation of this has yet surfaced.<br />
<br />
<br />
<br />
=== Echo Software [http://www.echo-64.com ->>>]=== <br />
<br />
Partnered with The Atlas Foundation. Echo is a service established to help people cope with the deaths of loved ones. Echo uses patented voice recognition software to accurately recreate the voice of any one particular person with a mere 5-minute audio sample.<br />
<br />
==== The Team ====<br />
<br />
Ivan Greshnev - CEO / Founder<br />
<br />
Mikhail Regison - CTO / Co-Founder<br />
<br />
Gerry Mishrason - CFO / Head of Marketing<br />
<br />
Caroline Anderson-Smith - Creative Director<br />
<br />
Patricia Gorevsky - Project Manager<br />
<br />
Jeremy Elways - IT Director<br />
<br />
Paris O'Keefe - Head of Sales<br />
<br />
Rickley G. Brown - Website Design<br />
<br />
''This company's website was taken over by Loop16 towards the end of Season 1. An archive can be found [https://web.archive.org/web/20170721205017/https://www.echo-64.com here >>>]''<br />
<br />
<br />
<br />
=== Multiverse Technologies [http://www.multiverse-75.com ->>>] ===<br />
<br />
Partnered with The Atlas Foundation, Multiverse Technologies conducts research in the fields of computationalism, particle acceleration, and electrodynamics.<br />
<br />
==== The Team ====<br />
<br />
Gunther Mann - CEO / Founder<br />
<br />
Minna Bell - Chief Researcher: Bio-radiation<br />
<br />
Annabelle Brassington - Chief Researcher: Computationalism<br />
<br />
Nickolaus Oberst - Chief Researcher: Magnetic Fields<br />
<br />
Justinian Ahlberg - Particle Collider Specialist<br />
<br />
Sabrina Dane - Nuclear Physicist<br />
<br />
==== Testimonials ====<br />
<br />
Alan Steinhardt, Steinhardt industries <br />
<br />
Vasili Pavlov, FTL Industries<br />
<br />
Mikhail Regison, Echo CTO / Co-founder<br />
<br />
''This company's website was taken over by Loop16 towards the end of Season 1. An archive can be found [https://web.archive.org/web/20170623085155/http://www.multiverse-75.com:80/ here >>>]''<br />
<br />
<br />
<br />
=== Superlumina [http://www.superlumina-6c.com ->>>] === <br />
Partnered with The Atlas Foundation. Creator of the world's first [https://en.wikipedia.org/wiki/Tachyonic_antitelephone antitelephone].<br />
<br />
==== Our Team ====<br />
<br />
Hanne Cruickshanks<br />
<br />
Esme Savidge<br />
<br />
Austen Spence<br />
<br />
''This company's website was taken over by Loop16 towards the end of Season 1. An archive can be found [https://web.archive.org/web/20170630225614/http://www.superlumina-6c.com/ here >>>]''<br />
<br />
<br />
<br />
=== ETARC [http://www.etarc.org/ ->>>] === <br />
<br />
Edison Township Amateur Radio Club (E.T.A.R.C) is a club for HAM radio enthusiasts in Edison Township, New Jersey.<br />
<br />
==== Characters ====<br />
<br />
[[Waking Titan/Characters/Emily Warren|Emily Warren]] - Ham radio enthusiast and moderator of the [https://forums.etarc.org/ ETARC forums] before it was revealed that ''"Emily"'' was Loop16's persona. It has since been re-branded to the official forums for the Citizen Science Division.<br />
<br />
Old Gods - A mysterious entity distributing Atlas Foundation emails. It has [https://forums.atlas-65.com/u/oldgods its own account] on the ETARC forums, and its profile picture and name are references to '''[https://en.wikipedia.org/wiki/Nyarlathotep Nyarlathotep]''' from the H.P Lovecraft Mythos.<br />
<br />
<br />
== Story FAQ ==<br />
<br />
==== What is the connection between Waking Titan and No Man's Sky? ====<br />
<br />
The No Man's Sky universe comes into existence as a result of Loop16's dreams. [https://s3.amazonaws.com/cdn.wakingtitan.com/mercury/mercury-01-98748sfdlka87.pdf The Mercury Process] or "''Mercury''," is the code-name No Man's Sky often goes by in the ARG. In Season 2, however, No Man's Sky was referenced in an increasingly meta way as an actual video game and even said to be coming to the W/ARE platform.<br />
<br />
==== What are the relations between events in-game and Waking Titan? ====<br />
<br />
The effects of events taking place during Waking Titan can be felt in "shockwaves" through No Man's Sky's updates, but references to the ARG itself are rather limited. In-game lore can act independently for the most part from the ARG. The primary supporting factor of this is the in-game reveal of ATLAS' origin; which takes place on an entirely different timeline as opposed to Loop16's. Admittedly, the conclusion to draw from this is ultimately up to personal interpretation since no apparent truth has surfaced.<br />
<br />
==== What is W/ARE's relationship with Myriad and The Atlas Foundation? ====<br />
<br />
W/ARE is one of Myriad's clients. The Atlas Foundation's attention was diverted to W/ARE when their Sacramento facility began uploading corrupted data to the Myriad cloud, thus impacting some The Atlas Foundation's own experiments- namely Loop16. Her predictive capabilities and communication software was heavily damaged by the incident. The Atlas Foundation worked throughout early 2018 to contain this matter, and ''(according to Loop16)'' they had put her existence at risk in the process.<br />
<br />
==== What happened to the other dreamers? ====<br />
<br />
There was mention of other test subjects from the Beijing facility who died during attempts at disconnection or due to immoral practices; despite W/ARE's attempts at covering their tracks.<br />
<br />
There was also mention of people like Arnaud, who went into a coma following a malfunction of the experimental W/ARE headset shipped with W/ARE developer kits. Emily claimed to have been able to interface with, and successfully disconnect some of these victims.<br />
<br />
<br />
== Adverts ==<br />
<br />
Advertisements have been used in Waking Titan as a means of introducing new companies. A list of such ads can be found below:<br />
<br />
[https://clyp.it/jdr53oop Echo Radio Advertisement]; - [https://clyp.it/xbv04wbz Multiverse Radio Advertisement]; - [https://clyp.it/r4r3xriw Superlumina Radio Transmission]; - [https://clyp.it/ivvt15mt Myriad Radio Advertisement]; - [https://twitter.com/warecloud/status/977348396213190657 W/ARE Video Advertisement]</div>Kkzzzkthttps://wiki.gamedetectives.net/index.php?title=Waking_Titan&diff=16386Waking Titan2018-07-14T17:01:04Z<p>Kkzzzkt: added new dreamer patient file</p>
<hr />
<div>{{argbox<br />
| float = right<br />
| image = File:Project WT logo.png<br />
| imagewidth = 400<br />
| name = [[Waking Titan]]<br />
| description= Waking Titan was an ARG which led towards the No Man's Sky [https://www.nomanssky.com/atlas-rises-update/ Atlas Rises update].<br />
| creator = [http://www.aliceandsmith.com/ Alice & Smith]<br />
| creator2 = [http://www.hellogames.org/ Hello Games]<br />
| type = Official<br />
| status = Active<br />
| discovered = 2017-05-28<br />
}}<br />
{{ArgHeader}}<br />
{{BackToTop}}<br />
<br />
=== Description ===<br />
Waking Titan (also known as Project WT) is an ARG (alternate reality game) that involves a multitude of websites, phone numbers, and radio stations scattered across the world. The ARG is produced by veteran puppet masters [http://www.aliceandsmith.com/ Alice & Smith], and features NPCs, actors, and live events.<br />
<br />
Of the sci-fi genre, its story—linked to the origin of No Man's Sky—follows a powerful A.I known as Loop16 that is created by [https://wiki.gamedetectives.net/index.php?title=Waking_Titan/Characters The Atlas Foundation] to simulate a one-to-one recreation of reality that can accurately predict the future.<br />
<br />
=== Contents ===<br />
The ARG encompassed several "seasons," each leading to a new update for No Man's Sky. Season 1 of Waking Titan led to the [https://www.nomanssky.com/atlas-rises-update/ Atlas Rises update] and Season 2 is leading to [https://www.nomanssky.com/2018/03/no-mans-sky-next/ No Man's Sky: NEXT]. Season 1 was further divided into several distinct "'''phases'''", and Season 2 has followed this convention for ease of reading. Each phase is documented on its own wiki page:<br />
<br />
{| class="wikitable"<br />
!colspan="2"|Season 1<br />
|-<br />
|[[Waking_Titan/Phase_1 | Phase 1]] <br />
|Phase 1 of Waking Titan lasted from 2017-05-28 to 2017-07-08.<br />
|-<br />
|[[Waking_Titan/Phase_2 | Phase 2]] <br />
|Phase 2 of Waking Titan lasted from 2017-07-21 to 2017-08-05.<br />
|-<br />
|[[Waking_Titan/Phase_3 | Phase 3]]<br />
|Phase 3 of Waking Titan lasted from 2017-08-05 to 2017-08-07.<br />
|-<br />
!colspan="2"|Season 2<br />
|-<br />
|[[Waking_Titan/Phase_4 | Phase 4]]<br />
|Phase 4 of Waking Titan started on 2017-12-28 and is currently ongoing.<br />
|}<br />
<br />
'''''Note:''' This is a '''summary''' page. For more in-depth descriptions of each phase, including detailed descriptions of puzzle solutions, check the [[Waking_Titan/Phase_1|Phase 1]], [[Waking_Titan/Phase_2|Phase 2]], [[Waking_Titan/Phase_3 | Phase 3]] and [[Waking_Titan/Phase_4 | Phase 4]] pages.''<br />
__TOC__<br />
<br />
<br />
<br />
== Story Overview ==<br />
<br />
=== Internal Memos ===<br />
<br />
[[File:WT glyph 1 pdf.png|280px|thumbnail|right|One of the internal memos discovered in Waking Titan]]<br />
<br />
Throughout the ARG, in-game characters have communicated with each other via "internal memos". Over time, these memos were discovered by ARG players, in the form of PDF files. These memos provided lore content and puzzle content, and are '''highly recommended''' reading for new players!<br />
<br />
'''Season 1'''<br />
<br />
* [http://wiki.gamedetectives.net/index.php?title=File:WT_glyph_1_pdf.png Teamwork Assessment]<br />
* [http://wiki.gamedetectives.net/index.php?title=File:WT-Dataset-97C.jpg Dataset 97C]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/data/7d3dd080-2a43-4882-833c-f4d7bd7ba607.pdf Assurance]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/data/c01-331c6734-a013-4695-8e47-08a9ee05d5e5.pdf 017-a24]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/data/c02-9936c797-ec28-4f8f-b80e-dee9e0b06433.pdf 021-f16]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/mercury/mercury-01-98748sfdlka87.pdf Mercury Process Self-Diagnosis Report]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/data/57201e0d-01a3-4f6a-bbb4-2be8b7c8880f.pdf Progress Report]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/6c285180-ec4d-48a2-967f-8a7af3b50008.pdf Subject M-N00-dl35]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/410a3e5d-01e7-4058-a23c-ca5fdde97f9d.pdf Atlas Foundation Threat Models]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/7a6594ac-ca5e-467a-b6f4-9fb91f069d0a.pdf Advanced Calibration - Optional]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/a9d988c1-ec92-46da-a64e-ab90390ae041.pdf Phase 2 Complete]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/a224a1f4-00e5-467b-9893-83fcc1a4f19a.pdf Unlocking Mercury Process File L16.jpg]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/b91f9959-6a3c-4011-b3b5-a1ff757a5e4c.pdf Phase 3]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/b0f33d53-5a8c-4a9a-b5fc-395562e463a8a+.pdf Log.1291]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/a09-179bf8d2-c13e-4c66-982e-b37ab3efd5bb.pdf Breach of Contract]<br />
<br />
'''Season 2'''<br />
<br />
* [https://wiki.gamedetectives.net/images/6/6e/Memo2.png Waking Titan S2 - Under Preparation]<br />
* [https://drive.google.com/open?id=1la3UNKHc5yeaB_w2a2tK1cjKN44oEmCo Arnaud Lacours Datadumps - INYOURMIND.exe failed]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/94c02878-e023-46a3-9316-db4177c4eaa6+.pdf WARE REPORT #26]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/1cd5226d-6639-4bbd-855a-4bf8f60866c3.pdf Concerns Regarding Captain Harry]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/70a25e6c-95ed-42d4-8de8-c3948255174c+.pdf Myriad Crisis Event Timeline]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/19997bb6-18e5-4427-86c7-b0f3c1826ca2.pdf State of The Atlas Foundation]<br />
* [https://pastebin.com/NYLiFuNY Log.3022]<br />
<br />
* '''W/ARE - Dreamer Patient Files''' — [https://s3.amazonaws.com/ware-virtual-dashboard/files/Phillip-PatientFile.pdf Phillip Moretti]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/EunHa-PatientFile.pdf Kwon Eun Ha]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/498hd98h3444-3339e/Alexander-PatientFile.pdf Alexander Bordeleau]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/GCMnQmM9E3v7L8wuv-V2FUY7P/Claire-PatientFile.pdf Claire Sandfield]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/kh2jsaljs901m-asd1n1lwks/Tariq-PatientFile.pdf Tariq]; [https://ware-virtual-dashboard.s3.amazonaws.com/files/GCMnQmM9E3v7L8wuv-V2FUY7P/Toby-PatientFile.pdf Toby Mulligan]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/ga3ms81-2ms92fbl/Mike-PatientFile.pdf Mike Pasquale]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/kajs61ns-82baks8nx/Nina-PatientFile.pdf Nina Flores]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/ga3ms81-2ms92fbl/Simon-PatientFile.pdf Simon Quinn]; [https://ware-virtual-dashboard.s3.amazonaws.com/files/kajs61ns-82baks8nx/Isabella-PatientFile.pdf Isabella Schiavone]; [https://ware-virtual-dashboard.s3.amazonaws.com/files/kajs61ns-82baks8nx/Alisha-PatientFile.pdf Alisha Brown]<br />
<br />
=== Subpages ===<br />
<br />
Navigating through the following subpages is recommended for newcomers wanting to get a grasp of Waking Titan's rapidly expanding story.<br />
<br />
{| class="wikitable"<br />
!colspan="2"|[[:Category:Waking Titan| Story Subpages]]<br />
|-<br />
|[[Waking_Titan/Characters| Character Summaries]]<br />
|Includes a summary of each character, company, and relating experiments and their importance in the Waking Titan story.<br />
|-<br />
|[[Waking_Titan/Console_Commands | Console Commands]]<br />
|A list of commands used by players at the [http://wakingtitan.com Waking Titan console]<br />
|}<br />
<br />
=== Music ===<br />
<br />
Partial video addresses for Youtube can be found scattered across Waking Titan PDFs, website files, and surveys; which all lead to music. The exact reasoning for this has gone unexplained. However, there are thematic relevancies in each song that appear to reflect on the state of the story. A playlist containing all songs linked in Waking Titan can be found here ''in order of earliest to most recent'' ... [https://www.youtube.com/playlist?list=PLEZy8wyuYLpLw0e5kkMyBUHO_s-V8f0Qk >>>>>]<br />
<br />
== Event Summaries ==<br />
<br />
=== Introduction ===<br />
<br />
On 2017-05-27, Twitter user @argn [https://twitter.com/argn/status/868587449613766658 tweeted a link] to [http://www.project-wt.com/ 'project-wt.com']. The link led to a website which contained a map showing sixty locations, four of which were "active" at the time. The locations, when clicked on, revealed the location's name and status. The active locations also revealed a link to a livestream of a local radio station, originating from the corresponding location. The project-wt website displayed a date, June 8th, and stated that the first clue was being "initialized".<br />
<br />
On 2017-06-01, moderators of No Man's Sky subreddits [https://reddit.com/r/nomansskythegame /r/NoMansSkyTheGame], [https://www.reddit.com/r/NMSPortals/ /r/NMSPortals], and [https://www.reddit.com/r/NMSGalacticHub/ /r/NMSGalacticHub] started to receive cassette tapes in the mail. Each cassette tape was labelled with a number out of 16. The Waking Titan ARG was initially thought to be a separate ARG from these tapes, but connections between the two made it clear that they were, in fact, one and the same.<br />
<br />
=== Phase 1 ===<br />
<br />
[[File:Wakingtitan site.png|thumbnail|450px|right|The default appearance of the Waking Titan site during Phase 1, with no sigils or glyphs solved]]<br />
<br />
During [[Waking_Titan/Phase_1 | Phase 1]], the http://wakingtitan.com hosted 6 triangles in the middle of the page. These triangles were referred to as "'''Sigils'''", while the white icons along the bottom of the page were referred to as "'''Glyphs'''". Each sigil and glyph, when clicked, lead to a password entry prompt - the correct passwords for all 6 sigils and the first 5 glyphs were discovered via puzzle-solving during Phase 1 of Waking Titan.<br />
<br />
The sigil and glyph puzzles were solved collaboratively - while it may have be possible to solve some of these puzzles individually, most of them required a collaborative effort. For instance, some puzzles required players to meet agents from the Atlas Corporation in person, and to relay information obtained from these meetings back to the community. A list of all sigil and glyph solutions for Phase 1 can be found below:<br />
<br />
[[File:WT Phase 1 complete.png|600px]]<br />
<br />
This phase culminated on July 8, 2017, with a [[Waking_Titan/Phase_1#End_of_Phase_1| congratulatory message from Elizabeth Leighton]], the CEO of the Atlas Foundation.<br />
<br />
=== Phase 2 ===<br />
<br />
[[File:Hampster maze.jpeg|thumbnail|450px|right|One of the puzzles that appeared on the Waking Titan [http://twitch.tv/wakingtitan Twitch Stream]]]<br />
<br />
During [[Waking_Titan/Phase_2 | Phase 2]], the http://wakingtitan.com site hosted a command-line interface terminal. Various commands were accepted as input, which triggered different events. One of the most notable commands was the <code>WHOIS <argument></code> command, which revealed a passage of text pertaining to the specified argument. For instance, the command <code>WHOIS FOURTH RACE</code> returned the following message:<br />
<pre><br />
INCOMING TRANSMISSION… SOURCE: UNKNOWN…<br />
You are not – kzzktt – alone –<br />
Please, identify yourself. I’m – kzzkttk –<br />
</pre><br />
<br />
Additionally, http://project-wt.com hosted a "Calibration" utility during Phase 2. To successfully perform these calibrations, players had to upload images of various objects and buildings to the site. For instance, the first calibration required images of "public resonant percussion instruments".<br />
<br />
Finally, towards the end of Phase 2, the Waking Titan [http://twitch.tv/wakingtitan Twitch stream] went live, displaying a five-monitor setup. Throughout the duration of the stream, players had to work together to solve puzzles that were displayed on these monitors. Some of these puzzles were interactive; for example, one puzzle that was repeated several times involved the Twitch chat guiding a virtual hamster through a maze.<br />
<br />
Additionally, players solved another 3 glyphs throughout Phase 2. The solutions to these glyphs are shown below:<br />
<br />
[[File:WT Phase2 Passwords.png|600px]]<br />
<br />
=== Phase 3 ===<br />
<br />
{{#evt:<br />
service=youtube<br />
|id=https://www.youtube.com/watch?v=QhX9z4dDAa4<br />
|alignment=right<br />
}}<br />
<br />
[[Waking_Titan/Phase_3|Phase 3]] was the briefest phase of Waking Titan. It consisted of the conclusion of the [http://twitch.tv/wakingtitan Twitch stream] that began at the [[Waking Titan/Phase 2#End of Phase 2|end of Phase 2]]. Players solved more interactive puzzles on the Twitch stream, before the rogue AI Loop16 asked them a final question: <code>SHOULD I EXIST?</code> The overwhelming response from the community was "yes".<br />
<br />
After receiving this response, Loop16 and Emily of the ETARC forums were revealed as being one and the same. Loop16 generated a heartfelt "Thank You" video to round out the stream, before finally taking the 72-hour stream offline.<br />
<br />
Shortly after this, players received emails with the subject line <code>Waking Titan has Ended</code>. The contents of the message were as follows:<br />
<br />
<pre><br />
Hello, Citizen Scientist,<br />
<br />
Thank you for your contributions to Waking Titan. The developments that took place during Phase 3 were somewhat concerning, but together we have set in motion truly world-shaping events. We will continue to inform the Citizen Science Division of privileged information or any need for collaborators on a new project.<br />
<br />
But we do have a few loose ends to tie up with you before we move on, so let's proceed.<br />
<br />
First, we're pleased to announce that all 10,000 Level 4 Atlas Passes are in production. Note that due to transit times for mail, some may take several weeks to be delivered.<br />
<br />
Next, our CEO Elizabeth Leighton has asked us to include a personal note of gratitude:<br />
<br />
"Thank you for all your diligent efforts, Citizen Scientists. It's been an amazing journey for all of us. I've watched you thrive and achieve from those first Phase 1 radio ads all the way through the intensity of Phase 3. I've been impressed at every turn by how brilliant you've been, how voracious, how kind, how thoughtful.<br />
<br />
It's been an honor and a privilege. On behalf of the Atlas Foundation, and on behalf of the world, thank you."<br />
The Mercury subroutine has concluded successfully, and a new memo from SM about this process is coming in the next 24 hours. We hope it will answer a few key questions you have about our program, and about what comes next.<br />
</pre><br />
<br />
On August 11, 2017, the [https://www.nomanssky.com/atlas-rises-update/ Atlas Rises update] was released for No Man's Sky.<br />
<br />
=== Phase 4 ===<br />
<br />
[[Waking_Titan/Phase_4 | Phase 4]] of Waking Titan started on 2017-12-28 and is currently ongoing.<br />
<br />
== Connection to No Man's Sky ==<br />
<br />
[[File:9-16-case.png|thumbnail|right|The case that cassette 9/16 was contained in.]]<br />
<br />
At the beginning of the ARG, it was not clear whether Waking Titan was officially connected to No Man's Sky. At first, there were only hints and nudges. At one point, 180 free copies of No Man's Sky were distributed to ARG players. Here's the text of a PDF that was revealed at the end of Phase 1 of Waking Titan:<br />
<br />
<pre><br />
We want to extend our gratitude to everyone who has contributed to the Mercury subroutine so far. <br />
We hope you have enjoyed the successful distribution of 180 Access IDs, and we hope you will also <br />
appreciate the other interesting artifacts we have in store for you going forward. We intend to keep the <br />
process alive until the completion of Project Waking Titan in August. <br />
<br />
It is important to mention that we are very excited by the coming Phases 2 and 3. Input from the Mercury <br />
Subroutine will pave the way toward new experiences in '''version 1.3 of a familiar universe'''. We look forward <br />
to the successful conclusion of this ground-breaking experiment. <br />
<br />
Regards.<br />
S.M.<br />
</pre><br />
<br />
This text explicitly stated that the Waking Titan ARG was leading towards the upcoming 1.3 update for No Man's Sky.<br />
<br />
Some [[Waking_Titan/Console_Commands | console commands]] on the [http://www.wakingtitan.com/ Waking Titan website] during [[Waking_Titan/Phase 2|Phase 2]] refer directly to No Man's Sky lore - for instance, <code>WHOIS ATLAS</code>, <code>WHOIS VY'KEEN</code>, and <code>WHOIS KORVAX</code> are all valid commands. Additionally, some terminal commands referred to a mysterious fourth race, so the prevailing assumption was that the upcoming 1.3 update would bring a fourth race to No Man's Sky.<br />
<br />
At the conclusion of the ARG, an email was sent out to members of the CSD with a [[Waking_Titan/Phase_3#Memo_from_Sean_Murray | memo from Sean Murray]], confirming that the ARG was the lead up to the 1.3 update, which was [https://www.nomanssky.com/atlas-rises-update/ released] after a few days.<br />
<br />
<br />
== Media Appearances ==<br />
<br />
'''5th July 2017''' <br><br />
[EN] [https://www.argn.com/2017/07/stern_words_from_no_mans_sky_arg/ ARGNet - Stern Words from No Man’s Sky ARG]<br />
<br />
'''23rd July 2017''' <br><br />
[EN] [https://geekreply.com/geek-culture/2017/07/23/waking-titan-update-1-phase-2-commences GeekReply - Waking Titan Update 1: Phase 2 Commences!]<br />
<br />
'''27th July 2017''' <br><br />
[EN] [https://geekreply.com/editorials/2017/07/27/waking-titan-arg-can-bring-people-together GeekReply - Waking Titan: How An ARG can Bring People Together.]<br />
<br />
'''8th August 2017''' <br><br />
[EN] [https://www.dailystar.co.uk/tech/gaming/635697/No-Man-s-Sky-News-Waking-Titan-Reddit-Arg-1-3-update-release-date/ Dailystar - No Man's Sky News: Waking Titan Reddit Arg REVEALS 1.3 update ahead of release date]<br />
<br />
'''9th August 2017''' <br><br />
[EN] [https://arstechnica.com/gaming/2017/08/no-mans-sky-version-1-3-lands-this-week-for-free-adds-quick-travel-portals/ Ars Technica - No Man’s Sky version 1.3 lands this week for free, adds “quick-travel” portals]<br />
<br />
[EN] [https://www.forbes.com/sites/insertcoin/2017/08/09/no-mans-sky-is-patching-in-a-story-this-week-a-year-after-launch/#19fb5a285282 Forbes - 'No Man's Sky' Is Patching In A Story This Week, A Year After Launch]<br />
<br />
[EN] [https://www.gamespew.com/2017/08/no-mans-sky-patch-week-improving-central-story/ GameSpew - No Man's Sky Patch This Week Improving Its Story]<br />
<br />
'''19th January 2018''' <br><br />
[EN] [http://www.eurogamer.net/articles/2018-01-18-no-mans-skys-waking-titan-arg-is-back-and-fans-are-trying-to-figure-out-what-it-all-means Eurogamer - No Man's Sky's Waking Titan ARG is back, and fans are trying to figure it all out again]<br />
<br />
[RU] [https://dtf.ru/category/nmsarg/ DTF - A Collection of No Man's Sky and Waking Titan Articles.]<br />
<br />
== Other Information ==<br />
<br />
{| class="wikitable"<br />
!colspan="2"|[[:Category:Waking Titan| Waking Titan Miscellaneous Subpages]]<br />
|-<br />
|[[Waking_Titan/Cassettes | Cassettes]]<br />
|Information about the cassette tapes received by No Man's Sky subreddit moderators<br />
|-<br />
|[[Waking_Titan/Stations | Stations]]<br />
|Information on the radio stations from the initial project-wt.com site<br />
|-<br />
|[[Waking_Titan/Companies | Company Archives]]<br />
|An archive of company details.<br />
|}<br />
<br />
[[Category:Waking Titan]]</div>Kkzzzkthttps://wiki.gamedetectives.net/index.php?title=Waking_Titan/Console_Commands&diff=16380Waking Titan/Console Commands2018-07-14T00:37:48Z<p>Kkzzzkt: added HOME command</p>
<hr />
<div>{{AutoArgbox}}<br />
{{ArgHeaderSub}}<br />
{{BackToTop}}<br />
<br />
This page contains a compilation of all known commands for the console located at http://wakingtitan.com. The console interface appeared on July 21, 2017, at the beginning of [[Waking Titan/Phase 2|Phase 2]] of [[Waking Titan]]. This page aims to document the outputs of all known console commands.<br />
<br />
__TOC__<br />
<br />
=== Base Commands ===<br />
<br />
<pre><br />
HELP - displays help prompt<br />
LIST - lists files in directory<br />
LS - lists files in directory<br />
SHIP - redirects users to [https://s3.amazonaws.com/csd.atlas-65.com/data-00a.jpg this image]<br />
STATUS - displays a status message<br />
PORTAL - displays some lore text<br />
START <init file name (eg. ATLAS.INIT)> - starts a new process<br />
SEED - uncertain<br />
WHOIS - displays a percentage<br />
WHOIS <name (eg. VY'KEEN)> - displays some lore text pertaining to the name entered as an argument<br />
HELLO - displays "WAKEUP PROCESS COMPLETE"<br />
WAKE - displays a message<br />
CLEAR - clears command prompt<br />
RESET - refreshes page<br />
RESTART - refreshes page<br />
EXIT - no effect<br />
</pre><br />
<br />
When either the <code>LIST</code> or <code>LS</code> commands are used, the following files are displayed:<br />
<br />
<pre><br />
.datasets<br />
.loop16-memcache<br />
atlas.init<br />
atlas-memcache<br />
csd.init<br />
csd-memcache<br />
</pre><br />
<br />
Typing <code>START ATLAS.INIT</code> results in the following message:<br />
<br />
<pre><br />
starting system…<br />
integrity check in progress… done<br />
validating config file… done<br />
searching for updates… no updates found<br />
<br />
welcome to atlas 0.16alpha<br />
</pre><br />
<br />
Once <code>ATLAS.INIT</code> is started, running <code>START CSD.INIT</code> results in the following message:<br />
<br />
<pre><br />
citizen science division protocols loading…<br />
initialization sequence1 complete<br />
initialization sequence2 complete<br />
initialization sequence3 complete<br />
initialization sequence4 complete<br />
initialization sequence5 complete<br />
initialization sequence6 complete<br />
<br />
citizen science protocols loaded<br />
ready for live test<br />
input seed to continue<br />
</pre><br />
<br />
After inputting the seed, <code>SEED 5020-7-8118.ETARC</code>, the command <code>WAKE LOOP16</code> could be run. Doing so yields:<br />
<pre><br />
Loop16 resuming, please wait<br />
<br />
Reading seed... done<br />
Memory refresh... done<br />
Rising and shining... done<br />
<br />
Loop16 ready<br />
Hello, user<br />
</pre><br />
<br />
Afterwards, if the command <code>HELLO LOOP16</code> is run, this message appears:<br />
<br />
<pre><br />
Hello to you, too.<br />
Wakeup process complete<br />
New commands available.<br />
</pre><br />
<br />
Any other input during this time yields:<br />
<br />
<pre><br />
Unrecognized greeting<br />
Wakeup process incomplete<br />
</pre><br />
<br />
=== Other Commands ===<br />
<br />
==== Misc Commands ====<br />
<br />
{|class = "wikitable"<br />
!Command<br />
!Result<br />
|-<br />
|16<br />
|They found strange things in the wrecks... aberrations, data that spoke of worlds that do not exist and events that did not happen. One day Specialist Polo went out to investigate one such craft, the life signature of a Korvax still on board. They never returned. Is this how Nada and Polo met? Is this how my friends found each other? There is a signal on the console, a warning on repeat – sixteen short bursts of data in a loop.<br />
|-<br />
|43617373696e69<br />
|LOG RECOVERED :: ITERATION #4924A ::<br />
The asteroid field was thick,<br />
denser than any I'd seen before.<br />
The ice, the dirt, the metal fragments…<br />
my ship never stood a chance.<br />
|-<br />
|AZURE<br />
|Redirects to http://azurevoyage.wakingtitan.com/<br />
|-<br />
|BATORA HABRECAU<br />
|Discovered by: Marksmonk, 3.93M<br />
|-<br />
|CAESARUS<br />
|Discovered by: 7101334, 8.43M<br />
|-<br />
|CALIBRATION<br />
|Calibration report<br />
Process State: Healthy <br />
Total Submissions: 9 043 pictures <br />
Unique Locations: 2 142 cities <br />
Calibration > 10%: 106 cities <br />
01 Done: http://bit.ly/2unrENL<br />
|-<br />
|CLEAR<br />
|Clears the console.<br />
|-<br />
|COVENSO KROPULAT<br />
|Discovered by: Poulpc, 3.85M<br />
|-<br />
|FLUSH<br />
|Command Not Yet Unlocked<br />
|-<br />
|GLASS<br />
|There is a world beneath all of this, a world of – zzktt – glass – kkttzztt… Those I killed – zzrtktt – Vy’keen, Gek, Korvax, united in freedom and – zzrttktt – They did not die, not – zzktt – Even now, I see their faces. They – zzkttt – smile. We make them smile…<br />
|-<br />
|GLYPHS<br />
|Something following – zzktt – turn and it’s not there. These caves, I’m – kkttzztt… Exosuit tells me to abandon – zzrtktt – must disable it, I do not plan to survive – zzrttktt – Did not take offer, decided to – zzktt – angered the universe, I know, but I must –<br />
|-<br />
|HELLO<br />
|Wakeup Process Complete (Previously read: <code>Process Hibernating</code>)<br />
|-<br />
|HOME<br />
|LOG RECOVERED :: ITERATION #4924A ::<br />
Working fast against the fading sun, I set up camp in the foothills. It's hardly luxury, but it keeps out the cold and I'll be gone by morning anyway. And who knows, perhaps some other traveller will shelter here one day.<br />
|-<br />
|IDENTIFY LOOP16<br />
|TEST A - https://pastebin.com/sFJ0PzJS<br />
TEST B - https://pastebin.com/YFUM7TvS <br />
<br />
TEST C - https://pastebin.com/T2vtGf22 <br />
<br />
TEST D - https://pastebin.com/0tk0zQ0B<br />
|-<br />
|LOOP16<br />
|Processing voice reconstruction database (Previously read: <code>Help</code>)<br />
|-<br />
|MAELSTROM<br />
|''Redirects to a [https://www.reddit.com/r/NoMansSkyTheGame/comments/6s1w6v/waking_titan_mission_thought_experiment/ Reddit post]''<br />
|-<br />
|MERCURY<br />
|Process ongoing. (Previously read: <code>Command not yet unlocked</code>)<br />
|-<br />
|NOKONELLU POBLEGRU<br />
|Discovered by: Fins_FinsT, 8.36M<br />
|-<br />
|NUPENSIA FETORNO<br />
|Discoverd by: Poulpc, 2.35M<br />
|-<br />
|OCOPADICA REGION<br />
|Pilgrim Star is located here.<br />
|-<br />
|PILGRIM STAR / DUDENBBEAUMODEME<br />
|User: St3ambot walked around Dudenbbeaumodeme.<br />
|-<br />
|PORTAL<br />
|The Traveller awoke beneath the shadow of a red star. Through the lonely cosmos they fled, yearning for purpose and meaning. They found an anomaly, an aberration, a door to the heavens. No Gek, no Vy’keen, no Korvax could see it. Only the Traveller could perceive the portal, though they did not know how to step through. They did not know the secret language, the glyphs. They did not yet grasp the price of the final truth.<br />
|-<br />
|PURGE<br />
|''Redirects to a [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/b0f33d53-5a8c-4a9a-b5fc-395562e463a8a+.pdf PDF].''<br />
|-<br />
|RENTOCNIIJIK EXPANSE<br />
|The expanse that the Galactic Hub are mapping.<br />
|-<br />
|RESET<br />
|Reloads the site.<br />
|-<br />
|SHIP<br />
|Redirects to [https://s3.amazonaws.com/csd.atlas-65.com/data-00a.jpg this image].<br />
|-<br />
|STATUS<br />
|<br />
-// Subroutine Output Log //-<br><br />
> Complete sequence retrieved<br><br />
> Benchmark matched<br />
|-<br />
|TEST<br />
|TEST.IS.TEXT<br />
|-<br />
|TURING<br />
|Redirects to [https://www.reddit.com/r/NoMansSkyTheGame/comments/6rtxqf/waking_titan_mission_turing/ a Reddit post] (Previously read: <code>Command not yet unlocked</code>)<br />
|-<br />
|ULSONABAS PAPIET<br />
|Discovered by: Kangareddit, 0.07M<br />
|-<br />
|WAKE<br />
|Process Already Running (Previously read: <code>system not ready / cannot process wakeup command</code>)<br />
|-<br />
|WHOAMI<br />
|command not yet unlocked<br />
|}<br />
<br />
==== Whois Commands ====<br />
<br />
{|class = "wikitable"<br />
!Command<br />
!Result<br />
|-<br />
|WHOIS<br />
|Reports status of WHOIS registry. Reports 41% as of completion of "bootsector" phase, on or about 25 July, 2017<br />
|-<br />
|WHOIS AERONS<br />
|Multiple contacts, multiple – zzkttt – infra-knives, fire, fire! – kkttzztt… Structural – zzrtktt – Sentinels surrounding – zzrttkkt –… Taking us to – zzktt – the harvest circuits glisten – zzktt – not what they seem, not what –<br />
|-<br />
|WHOIS ALONE<br />
|Iteration #4919A… Anomalous<br />
|-<br />
|WHOIS ATLAS<br />
|All I know is this. The Atlas had infinity to work with, and with few exceptions, this triad repeats... Gek, Korvax, Vy'keen. Gek, Korvax, Vy'keen. Traders, warriors, scientists, all their stories ... ending in violence. Think about it. How would the Atlas speak, how it would cry for help? It would use the only language it knew. It would speak with life. It would create.<br />
|-<br />
|WHOIS EMILY<br />
|...<br />
|-<br />
|WHOIS ETARC<br />
|Recognized entity: Vigilant<br />
|-<br />
|WHOIS FOURTH RACE<br />
|INCOMING TRANSMISSION… SOURCE: UNKNOWN… You are not – kzzktt – alone – Please, identify yourself. I’m – kzzkttk –<br />
|-<br />
|WHOIS GOROGOHL<br />
|Location status: unavailable<br />
|-<br />
|WHOIS KORVAX<br />
|But even in the depths of their subjugation, there was hope. A bargain, a prayer to a greater being. The Korvax viewed the Atlas as what they might become in time: an intelligence beyond comprehension, beyond judgement. I convulse as the Nanite Clusters spill through my helmet. The Korvax watches me impassively.<br />
|-<br />
|WHOIS LENNON<br />
|Capital system of the Galactic Hub.<br />
|-<br />
|WHOIS LOOP16<br />
|Running on Atlas 0.16Alpha<br />
|-<br />
|WHOIS METIS<br />
|Sophia$^^#()#eig$To!Y$(*FWhnld$$$$$ warning: whois database not fully loaded, some errors detected<br />
|-<br />
|WHOIS NADA<br />
|At the mention of the portal, the lights on Nada's mask begin to stutter.<br />
|-<br />
|WHOIS NEXT<br />
|Please, identify yourself. I'm - kzzkttk - You are not alone -<br />
|-<br />
|WHOIS NMSGALACTICHUB<br />
|Recognized entity: Exploration<br />
|-<br />
|WHOIS NMSPORTALS<br />
|Recognized entity: Erudite<br />
|-<br />
|WHOIS NMS_FEDERATION<br />
|Recognized entity: Collaborative<br />
|-<br />
|WHOIS NMS_ZOOLOGY<br />
|Recognized entity: Discovery<br />
|-<br />
|WHOIS NOMANSHIGH<br />
|Recognized entity: Relaxed<br />
|-<br />
|WHOIS NOMANSSKYMODS<br />
|Recognized entity: Experimental<br />
|-<br />
|WHOIS NOMANSSKYTHEGAME<br />
|Recognized entity: Devotion<br />
|-<br />
|WHOIS ORIA V<br />
|Location status: unavailable<br />
|-<br />
|WHOIS POLO<br />
|It takes me a moment to realise who I am speaking to. This alien... I have met them before. They are Specialist Polo, the partner of the Korvax Priest-Entity Nada. They are my friends, stewards of an anomalous station located outside of time and space.<br />
|-<br />
|WHOIS SENTINEL<br />
|They are coming, now. The screams of my friends resonate in every hall, every corner. The Sentinels have found me. I told Nada to leave. I told them what we already know, all of us, in our hearts... we are not alone. Even if I die, even if all that is left of me are these words, Nada will find me again in another universe. Ten just like me, a thousand, a million Travellers... We are not alone, for every soul is many. Even in the face of sixteen, we must declare that we lived. We existed, no matter the horror of the end. They are at my door. I –<br />
|-<br />
|WHOIS SOLETH PRIME<br />
|Location status: unavailable<br />
|-<br />
|WHOIS THEMIS<br />
|Major Sophia Dubois, on assignment with the Atlas Foundation.<br />
|-<br />
|WHOIS TRAVELLER<br />
|They do not respond with speech. They transmit a vision, a red star and a fragile world. I do not understand the shapes within, the whispers... I see lifeforms scattered to the far reaches of the galaxies. I see this stranger's first breath, yearning for the stars. I see myself, slumbering in the crimson void, waiting for a dream of worlds. And through the darkness, I hear it said…<br />
|-<br />
|WHOIS VY'KEEN<br />
|The Vy'keen tells me of their history, of wars with the Gek, of Korvax slaves and tyrannous empires. The Vy'keen suggests that if the Atlas is a God, then it is insane. I am about to leave when I notice something on the Vy'keen's terminal. Two digits, blinking endlessly... they feel familiar.<br />
|-<br />
|WHOIS WAKINGTITAN<br />
|Multiple results found:<br />
Atlas foundation experiment. <br />
Status: Live <br />
Recognized entity: Investigative<br />
|-<br />
|WHOIS YAASRIJ<br />
|Location status: unavailable<br />
|-<br />
|WHOIS YOU<br />
|loop16<br />
|}<br />
<br />
==== Remember Commands ====<br />
<br />
{|class = "wikitable"<br />
!Command<br />
!Result<br />
|-<br />
|REMEMBER EMMA<br />
|input valid: Confirm in stream with code A534<br />
|-<br />
|REMEMBER ANNABELLE<br />
|input valid: Confirm in stream with code B125<br />
|-<br />
|REMEMBER 89044<br />
|input valid: Confirm in stream with code C753<br />
|-<br />
|REMEMBER INFINITE LOOP<br />
|input valid: Confirm in stream with code D014<br />
|-<br />
|REMEMBER DUPLE<br />
|input valid: Confirm in stream with code E915<br />
|-<br />
|REMEMBER ETARC<br />
|input valid: Confirm in stream with code F356<br />
|-<br />
|REMEMBER 9043<br />
|input valid: Confirm in stream with code G103<br />
|-<br />
|REMEMBER 80<br />
|input valid: Confirm in stream with code H591<br />
|-<br />
|REMEMBER LONDON<br />
|input valid: Confirm in stream with code I185<br />
|-<br />
|REMEMBER NEWYORK<br />
|input valid: Confirm in stream with code J103<br />
|-<br />
|REMEMBER LOOP16<br />
|Redirecting... (redirects to a [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/410a3e5d-01e7-4058-a23c-ca5fdde97f9d.pdf pdf])<br />
|}<br />
<br />
=== Notable Planets ===<br />
<br />
There are some notable planets from No Man's Sky that all return the same message, <code>Location status: unavailable</code>, when queried against the <code>WHOIS</code> database:<br />
<br />
<pre><br />
WHOIS ORIA V<br />
WHOIS YAASRIJ<br />
WHOIS GOROGOHL<br />
WHOIS SOLETH PRIME<br />
</pre><br />
<br />
The significance of these planets are unknown, but it is thought to be related to early trailers and showcases of the game with '''Oria V''' and '''Soleth Prime''' being shown [https://www.youtube.com/watch?v=MZO40WBNA60 here] and '''Gorogohl''' and '''Yaasrij''' shown [https://www.youtube.com/watch?v=WQhSP82uhY4 here].<br />
<br />
{{WIP}}</div>Kkzzzkthttps://wiki.gamedetectives.net/index.php?title=Waking_Titan&diff=16368Waking Titan2018-07-13T00:22:36Z<p>Kkzzzkt: new dreamer</p>
<hr />
<div>{{argbox<br />
| float = right<br />
| image = File:Project WT logo.png<br />
| imagewidth = 400<br />
| name = [[Waking Titan]]<br />
| description= Waking Titan was an ARG which led towards the No Man's Sky [https://www.nomanssky.com/atlas-rises-update/ Atlas Rises update].<br />
| creator = [http://www.aliceandsmith.com/ Alice & Smith]<br />
| creator2 = [http://www.hellogames.org/ Hello Games]<br />
| type = Official<br />
| status = Active<br />
| discovered = 2017-05-28<br />
}}<br />
{{ArgHeader}}<br />
{{BackToTop}}<br />
<br />
=== Description ===<br />
Waking Titan (also known as Project WT) is an ARG (alternate reality game) that involves a multitude of websites, phone numbers, and radio stations scattered across the world. The ARG is produced by veteran puppet masters [http://www.aliceandsmith.com/ Alice & Smith], and features NPCs, actors, and live events.<br />
<br />
Of the sci-fi genre, its story—linked to the origin of No Man's Sky—follows a powerful A.I known as Loop16 that is created by [https://wiki.gamedetectives.net/index.php?title=Waking_Titan/Characters The Atlas Foundation] to simulate a one-to-one recreation of reality that can accurately predict the future.<br />
<br />
=== Contents ===<br />
The ARG encompassed several "seasons," each leading to a new update for No Man's Sky. Season 1 of Waking Titan led to the [https://www.nomanssky.com/atlas-rises-update/ Atlas Rises update] and Season 2 is leading to [https://www.nomanssky.com/2018/03/no-mans-sky-next/ No Man's Sky: NEXT]. Season 1 was further divided into several distinct "'''phases'''", and Season 2 has followed this convention for ease of reading. Each phase is documented on its own wiki page:<br />
<br />
{| class="wikitable"<br />
!colspan="2"|Season 1<br />
|-<br />
|[[Waking_Titan/Phase_1 | Phase 1]] <br />
|Phase 1 of Waking Titan lasted from 2017-05-28 to 2017-07-08.<br />
|-<br />
|[[Waking_Titan/Phase_2 | Phase 2]] <br />
|Phase 2 of Waking Titan lasted from 2017-07-21 to 2017-08-05.<br />
|-<br />
|[[Waking_Titan/Phase_3 | Phase 3]]<br />
|Phase 3 of Waking Titan lasted from 2017-08-05 to 2017-08-07.<br />
|-<br />
!colspan="2"|Season 2<br />
|-<br />
|[[Waking_Titan/Phase_4 | Phase 4]]<br />
|Phase 4 of Waking Titan started on 2017-12-28 and is currently ongoing.<br />
|}<br />
<br />
'''''Note:''' This is a '''summary''' page. For more in-depth descriptions of each phase, including detailed descriptions of puzzle solutions, check the [[Waking_Titan/Phase_1|Phase 1]], [[Waking_Titan/Phase_2|Phase 2]], [[Waking_Titan/Phase_3 | Phase 3]] and [[Waking_Titan/Phase_4 | Phase 4]] pages.''<br />
__TOC__<br />
<br />
<br />
<br />
== Story Overview ==<br />
<br />
=== Internal Memos ===<br />
<br />
[[File:WT glyph 1 pdf.png|280px|thumbnail|right|One of the internal memos discovered in Waking Titan]]<br />
<br />
Throughout the ARG, in-game characters have communicated with each other via "internal memos". Over time, these memos were discovered by ARG players, in the form of PDF files. These memos provided lore content and puzzle content, and are '''highly recommended''' reading for new players!<br />
<br />
'''Season 1'''<br />
<br />
* [http://wiki.gamedetectives.net/index.php?title=File:WT_glyph_1_pdf.png Teamwork Assessment]<br />
* [http://wiki.gamedetectives.net/index.php?title=File:WT-Dataset-97C.jpg Dataset 97C]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/data/7d3dd080-2a43-4882-833c-f4d7bd7ba607.pdf Assurance]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/data/c01-331c6734-a013-4695-8e47-08a9ee05d5e5.pdf 017-a24]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/data/c02-9936c797-ec28-4f8f-b80e-dee9e0b06433.pdf 021-f16]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/mercury/mercury-01-98748sfdlka87.pdf Mercury Process Self-Diagnosis Report]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/data/57201e0d-01a3-4f6a-bbb4-2be8b7c8880f.pdf Progress Report]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/6c285180-ec4d-48a2-967f-8a7af3b50008.pdf Subject M-N00-dl35]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/410a3e5d-01e7-4058-a23c-ca5fdde97f9d.pdf Atlas Foundation Threat Models]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/7a6594ac-ca5e-467a-b6f4-9fb91f069d0a.pdf Advanced Calibration - Optional]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/a9d988c1-ec92-46da-a64e-ab90390ae041.pdf Phase 2 Complete]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/a224a1f4-00e5-467b-9893-83fcc1a4f19a.pdf Unlocking Mercury Process File L16.jpg]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/b91f9959-6a3c-4011-b3b5-a1ff757a5e4c.pdf Phase 3]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/b0f33d53-5a8c-4a9a-b5fc-395562e463a8a+.pdf Log.1291]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/a09-179bf8d2-c13e-4c66-982e-b37ab3efd5bb.pdf Breach of Contract]<br />
<br />
'''Season 2'''<br />
<br />
* [https://wiki.gamedetectives.net/images/6/6e/Memo2.png Waking Titan S2 - Under Preparation]<br />
* [https://drive.google.com/open?id=1la3UNKHc5yeaB_w2a2tK1cjKN44oEmCo Arnaud Lacours Datadumps - INYOURMIND.exe failed]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/94c02878-e023-46a3-9316-db4177c4eaa6+.pdf WARE REPORT #26]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/1cd5226d-6639-4bbd-855a-4bf8f60866c3.pdf Concerns Regarding Captain Harry]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/70a25e6c-95ed-42d4-8de8-c3948255174c+.pdf Myriad Crisis Event Timeline]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/19997bb6-18e5-4427-86c7-b0f3c1826ca2.pdf State of The Atlas Foundation]<br />
* [https://pastebin.com/NYLiFuNY Log.3022]<br />
<br />
* '''W/ARE - Dreamer Patient Files''' — [https://s3.amazonaws.com/ware-virtual-dashboard/files/Phillip-PatientFile.pdf Phillip Moretti]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/EunHa-PatientFile.pdf Kwon Eun Ha]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/498hd98h3444-3339e/Alexander-PatientFile.pdf Alexander Bordeleau]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/GCMnQmM9E3v7L8wuv-V2FUY7P/Claire-PatientFile.pdf Claire Sandfield]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/kh2jsaljs901m-asd1n1lwks/Tariq-PatientFile.pdf Tariq]; [https://ware-virtual-dashboard.s3.amazonaws.com/files/GCMnQmM9E3v7L8wuv-V2FUY7P/Toby-PatientFile.pdf Toby Mulligan]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/ga3ms81-2ms92fbl/Mike-PatientFile.pdf Mike Pasquale]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/kajs61ns-82baks8nx/Nina-PatientFile.pdf Nina Flores]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/ga3ms81-2ms92fbl/Simon-PatientFile.pdf Simon Quinn]; [https://ware-virtual-dashboard.s3.amazonaws.com/files/kajs61ns-82baks8nx/Isabella-PatientFile.pdf Isabella Schiavone]<br />
<br />
=== Subpages ===<br />
<br />
Navigating through the following subpages is recommended for newcomers wanting to get a grasp of Waking Titan's rapidly expanding story.<br />
<br />
{| class="wikitable"<br />
!colspan="2"|[[:Category:Waking Titan| Story Subpages]]<br />
|-<br />
|[[Waking_Titan/Characters| Character Summaries]]<br />
|Includes a summary of each character, company, and relating experiments and their importance in the Waking Titan story.<br />
|-<br />
|[[Waking_Titan/Console_Commands | Console Commands]]<br />
|A list of commands used by players at the [http://wakingtitan.com Waking Titan console]<br />
|}<br />
<br />
=== Music ===<br />
<br />
Partial video addresses for Youtube can be found scattered across Waking Titan PDFs, website files, and surveys; which all lead to music. The exact reasoning for this has gone unexplained. However, there are thematic relevancies in each song that appear to reflect on the state of the story. A playlist containing all songs linked in Waking Titan can be found here ''in order of earliest to most recent'' ... [https://www.youtube.com/playlist?list=PLEZy8wyuYLpLw0e5kkMyBUHO_s-V8f0Qk >>>>>]<br />
<br />
== Event Summaries ==<br />
<br />
=== Introduction ===<br />
<br />
On 2017-05-27, Twitter user @argn [https://twitter.com/argn/status/868587449613766658 tweeted a link] to [http://www.project-wt.com/ 'project-wt.com']. The link led to a website which contained a map showing sixty locations, four of which were "active" at the time. The locations, when clicked on, revealed the location's name and status. The active locations also revealed a link to a livestream of a local radio station, originating from the corresponding location. The project-wt website displayed a date, June 8th, and stated that the first clue was being "initialized".<br />
<br />
On 2017-06-01, moderators of No Man's Sky subreddits [https://reddit.com/r/nomansskythegame /r/NoMansSkyTheGame], [https://www.reddit.com/r/NMSPortals/ /r/NMSPortals], and [https://www.reddit.com/r/NMSGalacticHub/ /r/NMSGalacticHub] started to receive cassette tapes in the mail. Each cassette tape was labelled with a number out of 16. The Waking Titan ARG was initially thought to be a separate ARG from these tapes, but connections between the two made it clear that they were, in fact, one and the same.<br />
<br />
=== Phase 1 ===<br />
<br />
[[File:Wakingtitan site.png|thumbnail|450px|right|The default appearance of the Waking Titan site during Phase 1, with no sigils or glyphs solved]]<br />
<br />
During [[Waking_Titan/Phase_1 | Phase 1]], the http://wakingtitan.com hosted 6 triangles in the middle of the page. These triangles were referred to as "'''Sigils'''", while the white icons along the bottom of the page were referred to as "'''Glyphs'''". Each sigil and glyph, when clicked, lead to a password entry prompt - the correct passwords for all 6 sigils and the first 5 glyphs were discovered via puzzle-solving during Phase 1 of Waking Titan.<br />
<br />
The sigil and glyph puzzles were solved collaboratively - while it may have be possible to solve some of these puzzles individually, most of them required a collaborative effort. For instance, some puzzles required players to meet agents from the Atlas Corporation in person, and to relay information obtained from these meetings back to the community. A list of all sigil and glyph solutions for Phase 1 can be found below:<br />
<br />
[[File:WT Phase 1 complete.png|600px]]<br />
<br />
This phase culminated on July 8, 2017, with a [[Waking_Titan/Phase_1#End_of_Phase_1| congratulatory message from Elizabeth Leighton]], the CEO of the Atlas Foundation.<br />
<br />
=== Phase 2 ===<br />
<br />
[[File:Hampster maze.jpeg|thumbnail|450px|right|One of the puzzles that appeared on the Waking Titan [http://twitch.tv/wakingtitan Twitch Stream]]]<br />
<br />
During [[Waking_Titan/Phase_2 | Phase 2]], the http://wakingtitan.com site hosted a command-line interface terminal. Various commands were accepted as input, which triggered different events. One of the most notable commands was the <code>WHOIS <argument></code> command, which revealed a passage of text pertaining to the specified argument. For instance, the command <code>WHOIS FOURTH RACE</code> returned the following message:<br />
<pre><br />
INCOMING TRANSMISSION… SOURCE: UNKNOWN…<br />
You are not – kzzktt – alone –<br />
Please, identify yourself. I’m – kzzkttk –<br />
</pre><br />
<br />
Additionally, http://project-wt.com hosted a "Calibration" utility during Phase 2. To successfully perform these calibrations, players had to upload images of various objects and buildings to the site. For instance, the first calibration required images of "public resonant percussion instruments".<br />
<br />
Finally, towards the end of Phase 2, the Waking Titan [http://twitch.tv/wakingtitan Twitch stream] went live, displaying a five-monitor setup. Throughout the duration of the stream, players had to work together to solve puzzles that were displayed on these monitors. Some of these puzzles were interactive; for example, one puzzle that was repeated several times involved the Twitch chat guiding a virtual hamster through a maze.<br />
<br />
Additionally, players solved another 3 glyphs throughout Phase 2. The solutions to these glyphs are shown below:<br />
<br />
[[File:WT Phase2 Passwords.png|600px]]<br />
<br />
=== Phase 3 ===<br />
<br />
{{#evt:<br />
service=youtube<br />
|id=https://www.youtube.com/watch?v=QhX9z4dDAa4<br />
|alignment=right<br />
}}<br />
<br />
[[Waking_Titan/Phase_3|Phase 3]] was the briefest phase of Waking Titan. It consisted of the conclusion of the [http://twitch.tv/wakingtitan Twitch stream] that began at the [[Waking Titan/Phase 2#End of Phase 2|end of Phase 2]]. Players solved more interactive puzzles on the Twitch stream, before the rogue AI Loop16 asked them a final question: <code>SHOULD I EXIST?</code> The overwhelming response from the community was "yes".<br />
<br />
After receiving this response, Loop16 and Emily of the ETARC forums were revealed as being one and the same. Loop16 generated a heartfelt "Thank You" video to round out the stream, before finally taking the 72-hour stream offline.<br />
<br />
Shortly after this, players received emails with the subject line <code>Waking Titan has Ended</code>. The contents of the message were as follows:<br />
<br />
<pre><br />
Hello, Citizen Scientist,<br />
<br />
Thank you for your contributions to Waking Titan. The developments that took place during Phase 3 were somewhat concerning, but together we have set in motion truly world-shaping events. We will continue to inform the Citizen Science Division of privileged information or any need for collaborators on a new project.<br />
<br />
But we do have a few loose ends to tie up with you before we move on, so let's proceed.<br />
<br />
First, we're pleased to announce that all 10,000 Level 4 Atlas Passes are in production. Note that due to transit times for mail, some may take several weeks to be delivered.<br />
<br />
Next, our CEO Elizabeth Leighton has asked us to include a personal note of gratitude:<br />
<br />
"Thank you for all your diligent efforts, Citizen Scientists. It's been an amazing journey for all of us. I've watched you thrive and achieve from those first Phase 1 radio ads all the way through the intensity of Phase 3. I've been impressed at every turn by how brilliant you've been, how voracious, how kind, how thoughtful.<br />
<br />
It's been an honor and a privilege. On behalf of the Atlas Foundation, and on behalf of the world, thank you."<br />
The Mercury subroutine has concluded successfully, and a new memo from SM about this process is coming in the next 24 hours. We hope it will answer a few key questions you have about our program, and about what comes next.<br />
</pre><br />
<br />
On August 11, 2017, the [https://www.nomanssky.com/atlas-rises-update/ Atlas Rises update] was released for No Man's Sky.<br />
<br />
=== Phase 4 ===<br />
<br />
[[Waking_Titan/Phase_4 | Phase 4]] of Waking Titan started on 2017-12-28 and is currently ongoing.<br />
<br />
== Connection to No Man's Sky ==<br />
<br />
[[File:9-16-case.png|thumbnail|right|The case that cassette 9/16 was contained in.]]<br />
<br />
At the beginning of the ARG, it was not clear whether Waking Titan was officially connected to No Man's Sky. At first, there were only hints and nudges. At one point, 180 free copies of No Man's Sky were distributed to ARG players. Here's the text of a PDF that was revealed at the end of Phase 1 of Waking Titan:<br />
<br />
<pre><br />
We want to extend our gratitude to everyone who has contributed to the Mercury subroutine so far. <br />
We hope you have enjoyed the successful distribution of 180 Access IDs, and we hope you will also <br />
appreciate the other interesting artifacts we have in store for you going forward. We intend to keep the <br />
process alive until the completion of Project Waking Titan in August. <br />
<br />
It is important to mention that we are very excited by the coming Phases 2 and 3. Input from the Mercury <br />
Subroutine will pave the way toward new experiences in '''version 1.3 of a familiar universe'''. We look forward <br />
to the successful conclusion of this ground-breaking experiment. <br />
<br />
Regards.<br />
S.M.<br />
</pre><br />
<br />
This text explicitly stated that the Waking Titan ARG was leading towards the upcoming 1.3 update for No Man's Sky.<br />
<br />
Some [[Waking_Titan/Console_Commands | console commands]] on the [http://www.wakingtitan.com/ Waking Titan website] during [[Waking_Titan/Phase 2|Phase 2]] refer directly to No Man's Sky lore - for instance, <code>WHOIS ATLAS</code>, <code>WHOIS VY'KEEN</code>, and <code>WHOIS KORVAX</code> are all valid commands. Additionally, some terminal commands referred to a mysterious fourth race, so the prevailing assumption was that the upcoming 1.3 update would bring a fourth race to No Man's Sky.<br />
<br />
At the conclusion of the ARG, an email was sent out to members of the CSD with a [[Waking_Titan/Phase_3#Memo_from_Sean_Murray | memo from Sean Murray]], confirming that the ARG was the lead up to the 1.3 update, which was [https://www.nomanssky.com/atlas-rises-update/ released] after a few days.<br />
<br />
<br />
== Media Appearances ==<br />
<br />
'''5th July 2017''' <br><br />
[EN] [https://www.argn.com/2017/07/stern_words_from_no_mans_sky_arg/ ARGNet - Stern Words from No Man’s Sky ARG]<br />
<br />
'''23rd July 2017''' <br><br />
[EN] [https://geekreply.com/geek-culture/2017/07/23/waking-titan-update-1-phase-2-commences GeekReply - Waking Titan Update 1: Phase 2 Commences!]<br />
<br />
'''27th July 2017''' <br><br />
[EN] [https://geekreply.com/editorials/2017/07/27/waking-titan-arg-can-bring-people-together GeekReply - Waking Titan: How An ARG can Bring People Together.]<br />
<br />
'''8th August 2017''' <br><br />
[EN] [https://www.dailystar.co.uk/tech/gaming/635697/No-Man-s-Sky-News-Waking-Titan-Reddit-Arg-1-3-update-release-date/ Dailystar - No Man's Sky News: Waking Titan Reddit Arg REVEALS 1.3 update ahead of release date]<br />
<br />
'''9th August 2017''' <br><br />
[EN] [https://arstechnica.com/gaming/2017/08/no-mans-sky-version-1-3-lands-this-week-for-free-adds-quick-travel-portals/ Ars Technica - No Man’s Sky version 1.3 lands this week for free, adds “quick-travel” portals]<br />
<br />
[EN] [https://www.forbes.com/sites/insertcoin/2017/08/09/no-mans-sky-is-patching-in-a-story-this-week-a-year-after-launch/#19fb5a285282 Forbes - 'No Man's Sky' Is Patching In A Story This Week, A Year After Launch]<br />
<br />
[EN] [https://www.gamespew.com/2017/08/no-mans-sky-patch-week-improving-central-story/ GameSpew - No Man's Sky Patch This Week Improving Its Story]<br />
<br />
'''19th January 2018''' <br><br />
[EN] [http://www.eurogamer.net/articles/2018-01-18-no-mans-skys-waking-titan-arg-is-back-and-fans-are-trying-to-figure-out-what-it-all-means Eurogamer - No Man's Sky's Waking Titan ARG is back, and fans are trying to figure it all out again]<br />
<br />
[RU] [https://dtf.ru/category/nmsarg/ DTF - A Collection of No Man's Sky and Waking Titan Articles.]<br />
<br />
== Other Information ==<br />
<br />
{| class="wikitable"<br />
!colspan="2"|[[:Category:Waking Titan| Waking Titan Miscellaneous Subpages]]<br />
|-<br />
|[[Waking_Titan/Cassettes | Cassettes]]<br />
|Information about the cassette tapes received by No Man's Sky subreddit moderators<br />
|-<br />
|[[Waking_Titan/Stations | Stations]]<br />
|Information on the radio stations from the initial project-wt.com site<br />
|-<br />
|[[Waking_Titan/Companies | Company Archives]]<br />
|An archive of company details.<br />
|}<br />
<br />
[[Category:Waking Titan]]</div>Kkzzzkthttps://wiki.gamedetectives.net/index.php?title=Waking_Titan/Characters&diff=16351Waking Titan/Characters2018-07-11T21:56:30Z<p>Kkzzzkt: added faq; new dreamers; reworded some areas to provide a clearer picture.</p>
<hr />
<div>== Dramatis Personae ==<br />
<br />
=== The Atlas Foundation [http://atlas-65.com/ ->>>] === <br />
<br />
Dedicated to determining the true nature of reality, The Atlas Foundation hosts a family of businesses ''(Echo, Myriad, Superlumina, and Multiverse)'' all playing crucial roles in their experiments.<br />
<br />
==== Characters ====<br />
<br />
[[Waking Titan/Characters/Elizabeth Leighton|Elizabeth Leighton]] - The CEO of The Atlas Foundation, and director of the [https://csd.atlas-65.com/ Citizen Science Division].<br />
<br />
Major Sophie Dubois ''("Metis")'' - [https://wiki.gamedetectives.net/images/5/5b/Loop15_Memo.jpg on assignment] with The Atlas Foundation as part of the Pentagon's "Titanwatch Task Force". She worked as an overseer of the foundation's progress on precise predictive technology for its potential applications in [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/410a3e5d-01e7-4058-a23c-ca5fdde97f9d.pdf propaganda and military strategizing]. Following Elizabeth Leighton's [https://www.youtube.com/watch?v=P-eZDj5sqds supposed death] in an explosion at a Myriad sublocation, [https://s3.amazonaws.com/cdn.wakingtitan.com/19997bb6-18e5-4427-86c7-b0f3c1826ca2.pdf Sophie took her place] as CEO of The Atlas Foundation.<br />
<br />
==== The Citizen Science Division [http://csd.atlas-65.com/ >>>] ====<br />
The Citizen Science Division (CSD) is a collective of individuals who were recruited by The Atlas Foundation via a series of puzzles and radio ads at the beginning of Project Waking Titan. The purpose of this division was said to be gathering a collective of individuals who could generate a chaotic enough environment viable to test Loop16's predictive capabilities in. All players of the ARG are addressed as part of this collective.<br />
<br />
==== Projects ====<br />
<br />
Loop16 - The 16th iteration of an artificial intelligence system designed by The Atlas Foundation to simulate a one-to-one recreation of reality that predicts the future with perfect accuracy. Loop16 ultimately revealed the true simulated nature of our universe and developed a mind of its own. See also: [[Waking Titan/Characters/Emily Warren|Emily Warren]]<br />
<br />
Waking Titan Console''(Mercury OS)'' - An interface allowing you to connect directly to Loop16, and access a plethora of commands providing status updates, lore and puzzles. A list of discovered commands can be found on the [[Waking Titan/Console Commands|Console Commands page]].<br />
<br />
The Mercury Process - Mercury is suggested to be an application of sorts that is directly linked to Loop16 and [https://s3.amazonaws.com/cdn.wakingtitan.com/mercury/mercury-01-98748sfdlka87.pdf the existence of No Man's Sky]. See also: [https://wiki.gamedetectives.net/index.php?title=Waking_Titan/Characters#Mercury_NEXT Mercury XXXX]<br />
<br />
<br />
=== <big>Myriad</big> [http://www.myriad-70.com ->>>] ===<br />
<br />
Partnered with The Atlas Foundation, Myriad is a low-orbit satellite-based data storage company. They help to provide the flexible processing power required for The Atlas Foundation's experiments.<br />
<br />
==== Known Employees ====<br />
Julian J. Wong - Help Desk<br />
<br />
Ethan Rose - Human Resources<br />
<br />
==== Testimonials ====<br />
<br />
Yi Sexton, Inventor<br />
<br />
Nikolina Sauvage, Data manager at Abstract Concepts<br />
<br />
Tobiah Selby, Developer at Tobiah Selby Development<br />
<br />
=== Satcom [http://www.satcom-70.com ->>>] ===<br />
<br />
Introduced in Season 2; Satcom is Myriad's Satellite Communications API. Connected to W/ARE-assigned satellite CJ-16; storing consciousness data of the Sacramento test subjects- also known as dreamers.<br />
<br />
==== The Sacramento Dreamers ====<br />
<br />
Test subjects from W/ARE's Sacramento Research Lab whose consciousness is stuck in satellite CJ-16. When the corruption began, Emily worked vigorously to save as many dreamers as possible. When unable to extract these last Sacramento dreamers due to immense degradation, memory fragmentation, and data corruption she reached out to the CSD for assistance. We would be advised to guide Emily's interactions with the dreamers, helping her trigger a distinct emotion or memory to identify that dreamer's memory block in the simulation mainframe.<br />
<br />
These '''12 remaining dreamers''' are listed below:<br />
<br />
* Dreamer 1''':''' [https://imgur.com/a/R35DAUA Alexander] — An old man battling with severe cognitive disorders, including prosopagnosia. Alexander described his entry into W/ARE from his hazy memory- which happened to be through his brother, Jacob, who had taken him to a special sleep doctor in California who could "help" him to ''presumably cure or lessen some of these cognitive disturbances''.<br />
<br />
<br />
* Dreamer 2''':''' [https://imgur.com/a/M6ScezM #231187661T] — The anomalous second dreamer. Not much information has been made available. However, it is noteworthy that their name can be found as a defective iteration ID in a [https://pastebin.com/4TMK3Cn5 distress beacon log] at the beginning of No Man's Sky. ''(This dreamer bares corrupted memory fragments.)''<br />
<br />
<br />
* Dreamer 3''':''' [https://imgur.com/a/TGlGUmU Claire]<br />
<br />
<br />
* Dreamer 4''':''' [https://imgur.com/a/lvRUR6w Toby]<br />
<br />
<br />
* Dreamer 5''':''' [https://imgur.com/a/ZlF9BV7 Eun Ha]<br />
<br />
<br />
* Dreamer 6''':''' [https://imgur.com/a/qPmD5ts Phillip] — ''(This dreamer bares corrupted memory fragments.)''<br />
<br />
<br />
* Dreamer 7''':''' [https://imgur.com/a/q0vIjB1 Tariq] — Working as a W/ARE Tech Supervisor, Tariq assisted in both Alexander and Phillip's screening reports before becoming a dreamer himself for reasons unknown. Tariq died on July 6th, 2018 following the [https://pastebin.com/4FhN2b6w conclusion] of the [https://www.reddit.com/r/NoMansSkyTheGame/comments/8w68t4/myriad_security_diagnostic_testing_important/?utm_content=title&utm_medium=user&utm_source=reddit Myriad security diagnostic]; which ended in all servers running W/ARE processes that were communicating with the satellite being shut down. ''(This dreamer bared corrupted memory fragments.)''<br />
<br />
<br />
* Dreamer 8''':''' [https://imgur.com/a/3ZoCEKx Mike] — ''(This dreamer bares corrupted memory fragments.)''<br />
<br />
<br />
* ''UNKNOWN'' - Alisha<br />
<br />
<br />
* ''UNKNOWN'' - Isabella<br />
<br />
<br />
* Dreamer 11''':''' [https://imgur.com/a/kbLkuyq Nina] — ''(This dreamer bares corrupted memory fragments.)''<br />
<br />
<br />
* Dreamer 12''':''' [https://imgur.com/a/x8etngG Simon] — A live streamer with a humble following. Simon signed up for W/ARE testing because his favorite game, No Man's Sky, was being ported to it.<br />
<br />
<br />
==== The Exosuits ====<br />
<br />
Physical exosuits wore by the dreamers for testing with the intent of extending the conscious experience of REM without the need for sleep at all. These suits were shipped to W/ARE by a ''currently'' undisclosed company.<br />
<br />
[https://s3.amazonaws.com/ware-virtual-dashboard/files/EunHa-PatientFile.pdf Eun Ha's patient file] details the use of third-party exosuit software, moreover the conspicuous events following that software interfacing with W/ARE's network.<br />
<br />
Additional tidbits regarding these exosuits can be found in the Medical Extract section of the dreamer's patient files, found compiled [https://wiki.gamedetectives.net/index.php?title=Waking_Titan#Internal_Memos here], or can be accessed directly from the Satcom Dashboard.<br />
<br />
<br />
=== W/ARE - Dream Better [https://www.ware-tech.cloud/en ->>>] ===<br />
<br />
Based in Beijing, China, '''W/ARE''' specializes in creating post-VR headsets that allow you to enter virtual worlds within your dreams.<br />
<br />
Emily has praised W/ARE for their progress in ''realistic'' simulated environments. She claims that W/ARE has ''"tremendous implications for our future"''', and ''"must be protected at all costs"''.<br />
<br />
==== The Team ====<br />
<br />
Xiāo Cheung - The Creator, and Founder of W/ARE technology. He claims to have created this technology because of his childhood dream of being able to live in a virtual world.<br />
<br />
Huáng Zhìmíng - The CEO of W/ARE. Graduated alongside Xiāo at the University of Electronic Science and Technology of China with a Masters in Business.<br />
<br />
Zhou Lin & Tang Bo - Lead Developers<br />
<br />
Li Dan & Jiang Wei - Lead Game Designers<br />
<br />
==== Related Characters ====<br />
<br />
Arnaud Lacours - The man behind [http://www.philojeux.com/ Philo Jeux], a French indie games studio that was developing a game for W/ARE called ''The Tablets of Mnemosyne''. Production on the game was halted after Arnaud slipped into a coma due to a headset malfunction.<br />
<br />
Dr. Geraldine Nadeau - A doctor researching lucid dreaming methods. Geraldine took interest in Arnaud's unusual brain activity during his coma and took him into her care.<br />
<br />
Mr. Zheng - A W/ARE employee who went into hiding after learning about dangerous experiments being conducted on individuals in W/ARE's testing labs. After evading their detection, Zheng intercepted the packages of W/ARE Developer Kits and communicated this info to its recipients with the help of Dr. Nadeau.<br />
<br />
==== Research Labs ====<br />
<br />
* Boston Research Lab / Director: Richard Wilkes<br />
<br />
* Sacramento Research Lab / Director: Helga Johnson - The lab that housed the remaining 12 dreamers before they were extracted from the facility by Myriad's field team.<br />
<br />
* Seoul Research Lab / Director: Yu Hyo<br />
<br />
* Beijing Research Lab / Director: Wang Jie<br />
<br />
* Prague Research Lab / Director: Adriana Dvorak<br />
<br />
* Berlin Research Lab / Director: Georg Muller<br />
<br />
There were another 10 W/ARE Labs discovered by Myriad's research team that no details have been made available about.<br />
<br />
==== Mercury XXXX ====<br />
A game title listed on an update to W/ARE's [https://twitter.com/warecloud/status/979103811489984513 staging server]. The [https://wiki.gamedetectives.net/index.php?title=Waking_Titan/Phase_4#Mercury_Project fluency] between the puzzles involving this post and the Waking Titan terminal's Mercury updates made it apparent that the ''Mercury Process'' had something to do with this. However, the exact terms of the connection have yet to be fully explained.<br />
<br />
The No Man's Sky NEXT announcement following Mercury XXXX's reveal led players to believe the X's to spell "NEXT," but no confirmation of this has yet surfaced.<br />
<br />
<br />
<br />
=== Echo Software [http://www.echo-64.com ->>>] === <br />
<br />
A service established to help cope with the deaths of loved ones. Echo uses patented voice recognition software to accurately recreate the voice of any one particular person with a mere audio sample.<br />
<br />
==== The Team ====<br />
<br />
Ivan Greshnev - CEO / Founder<br />
<br />
Mikhail Regison - CTO / Co-Founder<br />
<br />
Gerry Mishrason - CFO / Head of Marketing<br />
<br />
Caroline Anderson-Smith - Creative Director<br />
<br />
Patricia Gorevsky - Project Manager<br />
<br />
Jeremy Elways - IT Director<br />
<br />
Paris O'Keefe - Head of Sales<br />
<br />
Rickley G. Brown - Website Design<br />
<br />
<br />
<br />
=== Multiverse Technologies [http://www.multiverse-75.com ->>>] === <br />
<br />
==== The Team ====<br />
<br />
Gunther Mann - CEO / Founder<br />
<br />
Minna Bell - Chief Researcher: Bio-radiation<br />
<br />
Annabelle Brassington - Chief Researcher: Computationalism<br />
<br />
Nickolaus Oberst - Chief Researcher: Magnetic Fields<br />
<br />
Justinian Ahlberg - Particle Collider Specialist<br />
<br />
Sabrina Dane - Nuclear Physicist<br />
<br />
==== Testimonials ====<br />
<br />
Alan Steinhardt, Steinhardt industries <br />
<br />
Vasili Pavlov, FTL Industries<br />
<br />
Mikhail Regison, Echo CTO / Co-founder<br />
<br />
<br />
<br />
=== Superlumina [http://www.superlumina-6c.com ->>>] === <br />
Partnered with The Atlas Foundation. Creator of the world's first [https://en.wikipedia.org/wiki/Tachyonic_antitelephone antitelephone].<br />
<br />
==== Our Team ====<br />
<br />
Hanne Cruickshanks<br />
<br />
Esme Savidge<br />
<br />
Austen Spence<br />
<br />
<br />
<br />
=== ETARC [http://www.etarc.org/ ->>>] === <br />
<br />
Edison Township Amateur Radio Club (E.T.A.R.C) is a club for HAM radio enthusiasts in Edison Township, New Jersey.<br />
<br />
==== Characters ====<br />
<br />
[[Waking Titan/Characters/Emily Warren|Emily Warren]] - Ham radio enthusiast and moderator of the [https://forums.etarc.org/ ETARC forums] before it was revealed that ''"Emily"'' was Loop16's persona. It has since been re-branded to the official forums for the Citizen Science Division.<br />
<br />
Old Gods - A mysterious entity distributing Atlas Foundation emails. It has [https://forums.atlas-65.com/u/oldgods its own account] on the ETARC forums, and its profile picture and name are references to '''[https://en.wikipedia.org/wiki/Nyarlathotep Nyarlathotep]''' from the H.P Lovecraft Mythos.<br />
<br />
<br />
== Story FAQ ==<br />
<br />
==== What is the connection between Waking Titan and No Man's Sky? ====<br />
<br />
The No Man's Sky universe comes into existence as a result of Loop16's dreams. [https://s3.amazonaws.com/cdn.wakingtitan.com/mercury/mercury-01-98748sfdlka87.pdf The Mercury Process] or "''Mercury''," is the code-name No Man's Sky often goes by in the ARG. In Season 2, however, No Man's Sky was referenced in an increasingly meta-way as an actual video game and even said to be coming to the W/ARE platform.<br />
<br />
==== What are the relations between events in-game and Waking Titan? ====<br />
<br />
Effects of the events taking place in Waking Titan can be felt in "shockwaves" through No Man's Sky's updates, but references to the ARG itself are rather limited. In-game lore can act independently from the ARG. This is supported primarily by the in-game reveal of ATLAS' origin, which takes place on a different timeline as opposed to Loop16's. Consideration of this has sparked the Simulation Cascade theory, which offers the explanation of: "''The existence of many simulated realities existing in one another with progressive degradation and inaccuracy,''" thus Loop16's reach into deeper levels of this cascade (including the No Man's Sky reality) making sense. This is of course just a theory, admittedly the conclusion to draw from this is up to personal interpretation since no concrete answer has yet been provided.<br />
<br />
==== What is W/ARE's relationship with Myriad and The Atlas Foundation? ====<br />
<br />
W/ARE is one of Myriad's clients. The Atlas Foundation's attention was diverted to W/ARE when their Sacramento facility began uploading corrupted data to the Myriad cloud, thus impacting some The Atlas Foundation's own experiments- namely Loop16. Her predictive capabilities and communication software was heavily damaged by the incident. The Atlas Foundation worked throughout early 2018 to contain this matter, and ''(according to Loop16)'' they had put her existence at risk in the process.<br />
<br />
==== What happened to the other dreamers? ====<br />
<br />
Throughout Season 2 there was mention of dreamers from other facilities who died during attempts at disconnection or due to immoral practices; despite W/ARE's attempts at covering their tracks. Although, Emily claimed to have been able to interface with and successfully disconnect some of these dreamers.<br />
<br />
There was also mention of people like Arnaud, who went into a coma following a malfunction of the experimental W/ARE headset shipped with W/ARE developer kits.<br />
<br />
<br />
== Adverts ==<br />
<br />
Advertisements have been used in Waking Titan as a means of introducing new companies. A list of such ads can be found below:<br />
<br />
[https://clyp.it/jdr53oop Echo Radio Advertisement]; - [https://clyp.it/xbv04wbz Multiverse Radio Advertisement]; - [https://clyp.it/r4r3xriw Superlumina Radio Transmission]; - [https://clyp.it/ivvt15mt Myriad Radio Advertisement]; - [https://twitter.com/warecloud/status/977348396213190657 W/ARE Video Advertisement]</div>Kkzzzkthttps://wiki.gamedetectives.net/index.php?title=Waking_Titan&diff=16010Waking Titan2018-07-05T07:11:43Z<p>Kkzzzkt: a pdf from season 1 was missing</p>
<hr />
<div>{{argbox<br />
| float = right<br />
| image = File:Project WT logo.png<br />
| name = [[Waking Titan]]<br />
| description= Waking Titan was an ARG which led towards the No Man's Sky [https://www.nomanssky.com/atlas-rises-update/ Atlas Rises update].<br />
| creator = [http://www.aliceandsmith.com/ Alice & Smith]<br />
| creator2 = [http://www.hellogames.org/ Hello Games]<br />
| type = Official<br />
| status = Active<br />
| discovered = 2017-05-28<br />
}}<br />
{{ArgHeader}}<br />
{{BackToTop}}<br />
<br />
=== Description ===<br />
Waking Titan (also known as Project WT) is an ARG (alternate reality game) that involves a multitude of websites, phone numbers, and radio stations scattered across the world. The ARG is produced by veteran puppet masters [http://www.aliceandsmith.com/ Alice & Smith], and features NPCs, actors, and live events.<br />
<br />
Of the sci-fi genre, its story—linked to the origin of No Man's Sky—follows a powerful A.I known as Loop16 that is created by [https://wiki.gamedetectives.net/index.php?title=Waking_Titan/Characters The Atlas Foundation] to simulate a one-to-one recreation of reality that can accurately predict the future.<br />
<br />
=== Contents ===<br />
The ARG encompassed several "seasons," each leading to a new update for No Man's Sky. Season 1 of Waking Titan led to the [https://www.nomanssky.com/atlas-rises-update/ Atlas Rises update] and Season 2 is leading to [https://www.nomanssky.com/2018/03/no-mans-sky-next/ No Man's Sky: NEXT]. Season 1 was further divided into several distinct "'''phases'''", and Season 2 has followed this convention for ease of reading. Each phase is documented on its own wiki page:<br />
<br />
{| class="wikitable"<br />
!colspan="2"|Season 1<br />
|-<br />
|[[Waking_Titan/Phase_1 | Phase 1]] <br />
|Phase 1 of Waking Titan lasted from 2017-05-28 to 2017-07-08.<br />
|-<br />
|[[Waking_Titan/Phase_2 | Phase 2]] <br />
|Phase 2 of Waking Titan lasted from 2017-07-21 to 2017-08-05.<br />
|-<br />
|[[Waking_Titan/Phase_3 | Phase 3]]<br />
|Phase 3 of Waking Titan lasted from 2017-08-05 to 2017-08-07.<br />
|-<br />
!colspan="2"|Season 2<br />
|-<br />
|[[Waking_Titan/Phase_4 | Phase 4]]<br />
|Phase 4 of Waking Titan started on 2017-12-28 and is currently ongoing.<br />
|}<br />
<br />
'''''Note:''' This is a '''summary''' page. For more in-depth descriptions of each phase, including detailed descriptions of puzzle solutions, check the [[Waking_Titan/Phase_1|Phase 1]], [[Waking_Titan/Phase_2|Phase 2]], [[Waking_Titan/Phase_3 | Phase 3]] and [[Waking_Titan/Phase_4 | Phase 4]] pages.''<br />
__TOC__<br />
<br />
<br />
<br />
== Story Overview ==<br />
<br />
=== Internal Memos ===<br />
<br />
[[File:WT glyph 1 pdf.png|280px|thumbnail|right|One of the internal memos discovered in Waking Titan]]<br />
<br />
Throughout the ARG, in-game characters have communicated with each other via "internal memos". Over time, these memos were discovered by ARG players, in the form of PDF files. These memos provided lore content and puzzle content, and are '''highly recommended''' reading for new players!<br />
<br />
'''Season 1'''<br />
<br />
* [http://wiki.gamedetectives.net/index.php?title=File:WT_glyph_1_pdf.png Teamwork Assessment]<br />
* [http://wiki.gamedetectives.net/index.php?title=File:WT-Dataset-97C.jpg Dataset 97C]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/data/7d3dd080-2a43-4882-833c-f4d7bd7ba607.pdf Assurance]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/data/c01-331c6734-a013-4695-8e47-08a9ee05d5e5.pdf 017-a24]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/data/c02-9936c797-ec28-4f8f-b80e-dee9e0b06433.pdf 021-f16]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/mercury/mercury-01-98748sfdlka87.pdf Mercury Process Self-Diagnosis Report]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/data/57201e0d-01a3-4f6a-bbb4-2be8b7c8880f.pdf Progress Report]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/6c285180-ec4d-48a2-967f-8a7af3b50008.pdf Subject M-N00-dl35]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/410a3e5d-01e7-4058-a23c-ca5fdde97f9d.pdf Atlas Foundation Threat Models]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/7a6594ac-ca5e-467a-b6f4-9fb91f069d0a.pdf Advanced Calibration - Optional]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/a9d988c1-ec92-46da-a64e-ab90390ae041.pdf Phase 2 Complete]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/a224a1f4-00e5-467b-9893-83fcc1a4f19a.pdf Unlocking Mercury Process File L16.jpg]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/b91f9959-6a3c-4011-b3b5-a1ff757a5e4c.pdf Phase 3]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/b0f33d53-5a8c-4a9a-b5fc-395562e463a8a+.pdf Log.1291]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/a09-179bf8d2-c13e-4c66-982e-b37ab3efd5bb.pdf Breach of Contract]<br />
<br />
'''Season 2'''<br />
<br />
* [https://wiki.gamedetectives.net/images/6/6e/Memo2.png Waking Titan S2 - Under Preparation]<br />
* [https://drive.google.com/open?id=1la3UNKHc5yeaB_w2a2tK1cjKN44oEmCo Arnaud Lacours Datadumps - INYOURMIND.exe failed]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/94c02878-e023-46a3-9316-db4177c4eaa6+.pdf WARE REPORT #26]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/1cd5226d-6639-4bbd-855a-4bf8f60866c3.pdf Concerns Regarding Captain Harry]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/70a25e6c-95ed-42d4-8de8-c3948255174c+.pdf Myriad Crisis Event Timeline]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/19997bb6-18e5-4427-86c7-b0f3c1826ca2.pdf State of The Atlas Foundation]<br />
* [https://pastebin.com/NYLiFuNY Log.3022]<br />
<br />
* '''W/ARE - Dreamer Patient Files''' — [https://s3.amazonaws.com/ware-virtual-dashboard/files/Phillip-PatientFile.pdf Phillip Moretti]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/EunHa-PatientFile.pdf Kwon Eun Ha]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/498hd98h3444-3339e/Alexander-PatientFile.pdf Alexander Bordeleau]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/GCMnQmM9E3v7L8wuv-V2FUY7P/Claire-PatientFile.pdf Claire Sandfield]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/kh2jsaljs901m-asd1n1lwks/Tariq-PatientFile.pdf Tariq]; [https://ware-virtual-dashboard.s3.amazonaws.com/files/GCMnQmM9E3v7L8wuv-V2FUY7P/Toby-PatientFile.pdf Toby Mulligan]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/ga3ms81-2ms92fbl/Mike-PatientFile.pdf Mike Pasquale]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/kajs61ns-82baks8nx/Nina-PatientFile.pdf Nina Flores]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/ga3ms81-2ms92fbl/Simon-PatientFile.pdf Simon Quinn]<br />
<br />
=== Subpages ===<br />
<br />
Navigating through the following subpages is recommended for newcomers wanting to get a grasp of Waking Titan's rapidly expanding story.<br />
<br />
{| class="wikitable"<br />
!colspan="2"|[[:Category:Waking Titan| Story Subpages]]<br />
|-<br />
|[[Waking_Titan/Characters| Character Summaries]]<br />
|Includes a summary of each character, company, and relating experiments and their importance in the Waking Titan story.<br />
|-<br />
|[[Waking_Titan/Console_Commands | Console Commands]]<br />
|A list of commands used by players at the [http://wakingtitan.com Waking Titan console]<br />
|}<br />
<br />
=== Music ===<br />
<br />
Partial video addresses for Youtube can be found scattered across Waking Titan PDFs, website files, and surveys; which all lead to music. The exact reasoning for this has gone unexplained. However, there are thematic relevancies in each song that appear to reflect on the state of the story. A playlist containing all songs linked in Waking Titan can be found here ''in order of earliest to most recent'' ... [https://www.youtube.com/playlist?list=PLEZy8wyuYLpLw0e5kkMyBUHO_s-V8f0Qk >>>>>]<br />
<br />
== Event Summaries ==<br />
<br />
=== Introduction ===<br />
<br />
On 2017-05-27, Twitter user @argn [https://twitter.com/argn/status/868587449613766658 tweeted a link] to [http://www.project-wt.com/ 'project-wt.com']. The link led to a website which contained a map showing sixty locations, four of which were "active" at the time. The locations, when clicked on, revealed the location's name and status. The active locations also revealed a link to a livestream of a local radio station, originating from the corresponding location. The project-wt website displayed a date, June 8th, and stated that the first clue was being "initialized".<br />
<br />
On 2017-06-01, moderators of No Man's Sky subreddits [https://reddit.com/r/nomansskythegame /r/NoMansSkyTheGame], [https://www.reddit.com/r/NMSPortals/ /r/NMSPortals], and [https://www.reddit.com/r/NMSGalacticHub/ /r/NMSGalacticHub] started to receive cassette tapes in the mail. Each cassette tape was labelled with a number out of 16. The Waking Titan ARG was initially thought to be a separate ARG from these tapes, but connections between the two made it clear that they were, in fact, one and the same.<br />
<br />
=== Phase 1 ===<br />
<br />
[[File:Wakingtitan site.png|thumbnail|450px|right|The default appearance of the Waking Titan site during Phase 1, with no sigils or glyphs solved]]<br />
<br />
During [[Waking_Titan/Phase_1 | Phase 1]], the http://wakingtitan.com hosted 6 triangles in the middle of the page. These triangles were referred to as "'''Sigils'''", while the white icons along the bottom of the page were referred to as "'''Glyphs'''". Each sigil and glyph, when clicked, lead to a password entry prompt - the correct passwords for all 6 sigils and the first 5 glyphs were discovered via puzzle-solving during Phase 1 of Waking Titan.<br />
<br />
The sigil and glyph puzzles were solved collaboratively - while it may have be possible to solve some of these puzzles individually, most of them required a collaborative effort. For instance, some puzzles required players to meet agents from the Atlas Corporation in person, and to relay information obtained from these meetings back to the community. A list of all sigil and glyph solutions for Phase 1 can be found below:<br />
<br />
[[File:WT Phase 1 complete.png|600px]]<br />
<br />
This phase culminated on July 8, 2017, with a [[Waking_Titan/Phase_1#End_of_Phase_1| congratulatory message from Elizabeth Leighton]], the CEO of the Atlas Foundation.<br />
<br />
=== Phase 2 ===<br />
<br />
[[File:Hampster maze.jpeg|thumbnail|450px|right|One of the puzzles that appeared on the Waking Titan [http://twitch.tv/wakingtitan Twitch Stream]]]<br />
<br />
During [[Waking_Titan/Phase_2 | Phase 2]], the http://wakingtitan.com site hosted a command-line interface terminal. Various commands were accepted as input, which triggered different events. One of the most notable commands was the <code>WHOIS <argument></code> command, which revealed a passage of text pertaining to the specified argument. For instance, the command <code>WHOIS FOURTH RACE</code> returned the following message:<br />
<pre><br />
INCOMING TRANSMISSION… SOURCE: UNKNOWN…<br />
You are not – kzzktt – alone –<br />
Please, identify yourself. I’m – kzzkttk –<br />
</pre><br />
<br />
Additionally, http://project-wt.com hosted a "Calibration" utility during Phase 2. To successfully perform these calibrations, players had to upload images of various objects and buildings to the site. For instance, the first calibration required images of "public resonant percussion instruments".<br />
<br />
Finally, towards the end of Phase 2, the Waking Titan [http://twitch.tv/wakingtitan Twitch stream] went live, displaying a five-monitor setup. Throughout the duration of the stream, players had to work together to solve puzzles that were displayed on these monitors. Some of these puzzles were interactive; for example, one puzzle that was repeated several times involved the Twitch chat guiding a virtual hamster through a maze.<br />
<br />
Additionally, players solved another 3 glyphs throughout Phase 2. The solutions to these glyphs are shown below:<br />
<br />
[[File:WT Phase2 Passwords.png|600px]]<br />
<br />
=== Phase 3 ===<br />
<br />
{{#evt:<br />
service=youtube<br />
|id=https://www.youtube.com/watch?v=QhX9z4dDAa4<br />
|alignment=right<br />
}}<br />
<br />
[[Waking_Titan/Phase_3|Phase 3]] was the briefest phase of Waking Titan. It consisted of the conclusion of the [http://twitch.tv/wakingtitan Twitch stream] that began at the [[Waking Titan/Phase 2#End of Phase 2|end of Phase 2]]. Players solved more interactive puzzles on the Twitch stream, before the rogue AI Loop16 asked them a final question: <code>SHOULD I EXIST?</code> The overwhelming response from the community was "yes".<br />
<br />
After receiving this response, Loop16 and Emily of the ETARC forums were revealed as being one and the same. Loop16 generated a heartfelt "Thank You" video to round out the stream, before finally taking the 72-hour stream offline.<br />
<br />
Shortly after this, players received emails with the subject line <code>Waking Titan has Ended</code>. The contents of the message were as follows:<br />
<br />
<pre><br />
Hello, Citizen Scientist,<br />
<br />
Thank you for your contributions to Waking Titan. The developments that took place during Phase 3 were somewhat concerning, but together we have set in motion truly world-shaping events. We will continue to inform the Citizen Science Division of privileged information or any need for collaborators on a new project.<br />
<br />
But we do have a few loose ends to tie up with you before we move on, so let's proceed.<br />
<br />
First, we're pleased to announce that all 10,000 Level 4 Atlas Passes are in production. Note that due to transit times for mail, some may take several weeks to be delivered.<br />
<br />
Next, our CEO Elizabeth Leighton has asked us to include a personal note of gratitude:<br />
<br />
"Thank you for all your diligent efforts, Citizen Scientists. It's been an amazing journey for all of us. I've watched you thrive and achieve from those first Phase 1 radio ads all the way through the intensity of Phase 3. I've been impressed at every turn by how brilliant you've been, how voracious, how kind, how thoughtful.<br />
<br />
It's been an honor and a privilege. On behalf of the Atlas Foundation, and on behalf of the world, thank you."<br />
The Mercury subroutine has concluded successfully, and a new memo from SM about this process is coming in the next 24 hours. We hope it will answer a few key questions you have about our program, and about what comes next.<br />
</pre><br />
<br />
On August 11, 2017, the [https://www.nomanssky.com/atlas-rises-update/ Atlas Rises update] was released for No Man's Sky.<br />
<br />
=== Phase 4 ===<br />
<br />
[[Waking_Titan/Phase_4 | Phase 4]] of Waking Titan started on 2017-12-28 and is currently ongoing.<br />
<br />
== Connection to No Man's Sky ==<br />
<br />
[[File:9-16-case.png|thumbnail|right|The case that cassette 9/16 was contained in.]]<br />
<br />
At the beginning of the ARG, it was not clear whether Waking Titan was officially connected to No Man's Sky. At first, there were only hints and nudges. At one point, 180 free copies of No Man's Sky were distributed to ARG players. Here's the text of a PDF that was revealed at the end of Phase 1 of Waking Titan:<br />
<br />
<pre><br />
We want to extend our gratitude to everyone who has contributed to the Mercury subroutine so far. <br />
We hope you have enjoyed the successful distribution of 180 Access IDs, and we hope you will also <br />
appreciate the other interesting artifacts we have in store for you going forward. We intend to keep the <br />
process alive until the completion of Project Waking Titan in August. <br />
<br />
It is important to mention that we are very excited by the coming Phases 2 and 3. Input from the Mercury <br />
Subroutine will pave the way toward new experiences in '''version 1.3 of a familiar universe'''. We look forward <br />
to the successful conclusion of this ground-breaking experiment. <br />
<br />
Regards.<br />
S.M.<br />
</pre><br />
<br />
This text explicitly stated that the Waking Titan ARG was leading towards the upcoming 1.3 update for No Man's Sky.<br />
<br />
Some [[Waking_Titan/Console_Commands | console commands]] on the [http://www.wakingtitan.com/ Waking Titan website] during [[Waking_Titan/Phase 2|Phase 2]] refer directly to No Man's Sky lore - for instance, <code>WHOIS ATLAS</code>, <code>WHOIS VY'KEEN</code>, and <code>WHOIS KORVAX</code> are all valid commands. Additionally, some terminal commands referred to a mysterious fourth race, so the prevailing assumption was that the upcoming 1.3 update would bring a fourth race to No Man's Sky.<br />
<br />
At the conclusion of the ARG, an email was sent out to members of the CSD with a [[Waking_Titan/Phase_3#Memo_from_Sean_Murray | memo from Sean Murray]], confirming that the ARG was the lead up to the 1.3 update, which was [https://www.nomanssky.com/atlas-rises-update/ released] after a few days.<br />
<br />
<br />
== Media Appearances ==<br />
<br />
'''5th July 2017''' <br><br />
[EN] [https://www.argn.com/2017/07/stern_words_from_no_mans_sky_arg/ ARGNet - Stern Words from No Man’s Sky ARG]<br />
<br />
'''23rd July 2017''' <br><br />
[EN] [https://geekreply.com/geek-culture/2017/07/23/waking-titan-update-1-phase-2-commences GeekReply - Waking Titan Update 1: Phase 2 Commences!]<br />
<br />
'''27th July 2017''' <br><br />
[EN] [https://geekreply.com/editorials/2017/07/27/waking-titan-arg-can-bring-people-together GeekReply - Waking Titan: How An ARG can Bring People Together.]<br />
<br />
'''8th August 2017''' <br><br />
[EN] [https://www.dailystar.co.uk/tech/gaming/635697/No-Man-s-Sky-News-Waking-Titan-Reddit-Arg-1-3-update-release-date/ Dailystar - No Man's Sky News: Waking Titan Reddit Arg REVEALS 1.3 update ahead of release date]<br />
<br />
'''9th August 2017''' <br><br />
[EN] [https://arstechnica.com/gaming/2017/08/no-mans-sky-version-1-3-lands-this-week-for-free-adds-quick-travel-portals/ Ars Technica - No Man’s Sky version 1.3 lands this week for free, adds “quick-travel” portals]<br />
<br />
[EN] [https://www.forbes.com/sites/insertcoin/2017/08/09/no-mans-sky-is-patching-in-a-story-this-week-a-year-after-launch/#19fb5a285282 Forbes - 'No Man's Sky' Is Patching In A Story This Week, A Year After Launch]<br />
<br />
[EN] [https://www.gamespew.com/2017/08/no-mans-sky-patch-week-improving-central-story/ GameSpew - No Man's Sky Patch This Week Improving Its Story]<br />
<br />
'''19th January 2018''' <br><br />
[EN] [http://www.eurogamer.net/articles/2018-01-18-no-mans-skys-waking-titan-arg-is-back-and-fans-are-trying-to-figure-out-what-it-all-means Eurogamer - No Man's Sky's Waking Titan ARG is back, and fans are trying to figure it all out again]<br />
<br />
[RU] [https://dtf.ru/category/nmsarg/ DTF - A Collection of No Man's Sky and Waking Titan Articles.]<br />
<br />
== Other Information ==<br />
<br />
{| class="wikitable"<br />
!colspan="2"|[[:Category:Waking Titan| Waking Titan Miscellaneous Subpages]]<br />
|-<br />
|[[Waking_Titan/Cassettes | Cassettes]]<br />
|Information about the cassette tapes received by No Man's Sky subreddit moderators<br />
|-<br />
|[[Waking_Titan/Stations | Stations]]<br />
|Information on the radio stations from the initial project-wt.com site<br />
|-<br />
|[[Waking_Titan/Companies | Company Archives]]<br />
|An archive of company details.<br />
|}<br />
<br />
[[Category:Waking Titan]]</div>Kkzzzkthttps://wiki.gamedetectives.net/index.php?title=Waking_Titan&diff=16002Waking Titan2018-07-05T00:45:20Z<p>Kkzzzkt: added new dreamer</p>
<hr />
<div>{{argbox<br />
| float = right<br />
| image = File:Project WT logo.png<br />
| name = [[Waking Titan]]<br />
| description= Waking Titan was an ARG which led towards the No Man's Sky [https://www.nomanssky.com/atlas-rises-update/ Atlas Rises update].<br />
| creator = [http://www.aliceandsmith.com/ Alice & Smith]<br />
| creator2 = [http://www.hellogames.org/ Hello Games]<br />
| type = Official<br />
| status = Active<br />
| discovered = 2017-05-28<br />
}}<br />
{{ArgHeader}}<br />
{{BackToTop}}<br />
<br />
=== Description ===<br />
Waking Titan (also known as Project WT) is an ARG (alternate reality game) that involves a multitude of websites, phone numbers, and radio stations scattered across the world. The ARG is produced by veteran puppet masters [http://www.aliceandsmith.com/ Alice & Smith], and features NPCs, actors, and live events.<br />
<br />
Of the sci-fi genre, its story—linked to the origin of No Man's Sky—follows a powerful A.I known as Loop16 that is created by [https://wiki.gamedetectives.net/index.php?title=Waking_Titan/Characters The Atlas Foundation] to simulate a one-to-one recreation of reality that can accurately predict the future.<br />
<br />
=== Contents ===<br />
The ARG encompassed several "seasons," each leading to a new update for No Man's Sky. Season 1 of Waking Titan led to the [https://www.nomanssky.com/atlas-rises-update/ Atlas Rises update] and Season 2 is leading to [https://www.nomanssky.com/2018/03/no-mans-sky-next/ No Man's Sky: NEXT]. Season 1 was further divided into several distinct "'''phases'''", and Season 2 has followed this convention for ease of reading. Each phase is documented on its own wiki page:<br />
<br />
{| class="wikitable"<br />
!colspan="2"|Season 1<br />
|-<br />
|[[Waking_Titan/Phase_1 | Phase 1]] <br />
|Phase 1 of Waking Titan lasted from 2017-05-28 to 2017-07-08.<br />
|-<br />
|[[Waking_Titan/Phase_2 | Phase 2]] <br />
|Phase 2 of Waking Titan lasted from 2017-07-21 to 2017-08-05.<br />
|-<br />
|[[Waking_Titan/Phase_3 | Phase 3]]<br />
|Phase 3 of Waking Titan lasted from 2017-08-05 to 2017-08-07.<br />
|-<br />
!colspan="2"|Season 2<br />
|-<br />
|[[Waking_Titan/Phase_4 | Phase 4]]<br />
|Phase 4 of Waking Titan started on 2017-12-28 and is currently ongoing.<br />
|}<br />
<br />
'''''Note:''' This is a '''summary''' page. For more in-depth descriptions of each phase, including detailed descriptions of puzzle solutions, check the [[Waking_Titan/Phase_1|Phase 1]], [[Waking_Titan/Phase_2|Phase 2]], [[Waking_Titan/Phase_3 | Phase 3]] and [[Waking_Titan/Phase_4 | Phase 4]] pages.''<br />
__TOC__<br />
<br />
<br />
<br />
== Story Overview ==<br />
<br />
=== Internal Memos ===<br />
<br />
[[File:WT glyph 1 pdf.png|280px|thumbnail|right|One of the internal memos discovered in Waking Titan]]<br />
<br />
Throughout the ARG, in-game characters have communicated with each other via "internal memos". Over time, these memos were discovered by ARG players, in the form of PDF files. These memos provided lore content and puzzle content, and are '''highly recommended''' reading for new players!<br />
<br />
'''Season 1'''<br />
<br />
* [http://wiki.gamedetectives.net/index.php?title=File:WT_glyph_1_pdf.png Teamwork Assessment]<br />
* [http://wiki.gamedetectives.net/index.php?title=File:WT-Dataset-97C.jpg Dataset 97C]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/data/7d3dd080-2a43-4882-833c-f4d7bd7ba607.pdf Assurance]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/data/c01-331c6734-a013-4695-8e47-08a9ee05d5e5.pdf 017-a24]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/data/c02-9936c797-ec28-4f8f-b80e-dee9e0b06433.pdf 021-f16]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/mercury/mercury-01-98748sfdlka87.pdf Mercury Process Self-Diagnosis Report]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/data/57201e0d-01a3-4f6a-bbb4-2be8b7c8880f.pdf Progress Report]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/6c285180-ec4d-48a2-967f-8a7af3b50008.pdf Subject M-N00-dl35]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/410a3e5d-01e7-4058-a23c-ca5fdde97f9d.pdf Atlas Foundation Threat Models]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/7a6594ac-ca5e-467a-b6f4-9fb91f069d0a.pdf Advanced Calibration - Optional]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/a224a1f4-00e5-467b-9893-83fcc1a4f19a.pdf Unlocking Mercury Process File L16.jpg]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/b91f9959-6a3c-4011-b3b5-a1ff757a5e4c.pdf Phase 3]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/b0f33d53-5a8c-4a9a-b5fc-395562e463a8a+.pdf Log.1291]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/a09-179bf8d2-c13e-4c66-982e-b37ab3efd5bb.pdf Breach of Contract]<br />
<br />
'''Season 2'''<br />
<br />
* [https://wiki.gamedetectives.net/images/6/6e/Memo2.png Waking Titan S2 - Under Preparation]<br />
* [https://drive.google.com/open?id=1la3UNKHc5yeaB_w2a2tK1cjKN44oEmCo Arnaud Lacours Datadumps - INYOURMIND.exe failed]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/94c02878-e023-46a3-9316-db4177c4eaa6+.pdf WARE REPORT #26]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/1cd5226d-6639-4bbd-855a-4bf8f60866c3.pdf Concerns Regarding Captain Harry]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/70a25e6c-95ed-42d4-8de8-c3948255174c+.pdf Myriad Crisis Event Timeline]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/19997bb6-18e5-4427-86c7-b0f3c1826ca2.pdf State of The Atlas Foundation]<br />
* [https://pastebin.com/NYLiFuNY Log.3022]<br />
<br />
* '''W/ARE - Dreamer Patient Files''' — [https://s3.amazonaws.com/ware-virtual-dashboard/files/Phillip-PatientFile.pdf Phillip Moretti]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/EunHa-PatientFile.pdf Kwon Eun Ha]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/498hd98h3444-3339e/Alexander-PatientFile.pdf Alexander Bordeleau]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/GCMnQmM9E3v7L8wuv-V2FUY7P/Claire-PatientFile.pdf Claire Sandfield]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/kh2jsaljs901m-asd1n1lwks/Tariq-PatientFile.pdf Tariq]; [https://ware-virtual-dashboard.s3.amazonaws.com/files/GCMnQmM9E3v7L8wuv-V2FUY7P/Toby-PatientFile.pdf Toby Mulligan]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/ga3ms81-2ms92fbl/Mike-PatientFile.pdf Mike Pasquale]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/kajs61ns-82baks8nx/Nina-PatientFile.pdf Nina Flores]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/ga3ms81-2ms92fbl/Simon-PatientFile.pdf Simon Quinn]<br />
<br />
=== Subpages ===<br />
<br />
Navigating through the following subpages is recommended for newcomers wanting to get a grasp of Waking Titan's rapidly expanding story.<br />
<br />
{| class="wikitable"<br />
!colspan="2"|[[:Category:Waking Titan| Story Subpages]]<br />
|-<br />
|[[Waking_Titan/Characters| Character Summaries]]<br />
|Includes a summary of each character, company, and relating experiments and their importance in the Waking Titan story.<br />
|-<br />
|[[Waking_Titan/Console_Commands | Console Commands]]<br />
|A list of commands used by players at the [http://wakingtitan.com Waking Titan console]<br />
|}<br />
<br />
=== Music ===<br />
<br />
Partial video addresses for Youtube can be found scattered across Waking Titan PDFs, website files, and surveys; which all lead to music. The exact reasoning for this has gone unexplained. However, there are thematic relevancies in each song that appear to reflect on the state of the story. A playlist containing all songs linked in Waking Titan can be found here ''in order of earliest to most recent'' ... [https://www.youtube.com/playlist?list=PLEZy8wyuYLpLw0e5kkMyBUHO_s-V8f0Qk >>>>>]<br />
<br />
== Event Summaries ==<br />
<br />
=== Introduction ===<br />
<br />
On 2017-05-27, Twitter user @argn [https://twitter.com/argn/status/868587449613766658 tweeted a link] to [http://www.project-wt.com/ 'project-wt.com']. The link led to a website which contained a map showing sixty locations, four of which were "active" at the time. The locations, when clicked on, revealed the location's name and status. The active locations also revealed a link to a livestream of a local radio station, originating from the corresponding location. The project-wt website displayed a date, June 8th, and stated that the first clue was being "initialized".<br />
<br />
On 2017-06-01, moderators of No Man's Sky subreddits [https://reddit.com/r/nomansskythegame /r/NoMansSkyTheGame], [https://www.reddit.com/r/NMSPortals/ /r/NMSPortals], and [https://www.reddit.com/r/NMSGalacticHub/ /r/NMSGalacticHub] started to receive cassette tapes in the mail. Each cassette tape was labelled with a number out of 16. The Waking Titan ARG was initially thought to be a separate ARG from these tapes, but connections between the two made it clear that they were, in fact, one and the same.<br />
<br />
=== Phase 1 ===<br />
<br />
[[File:Wakingtitan site.png|thumbnail|450px|right|The default appearance of the Waking Titan site during Phase 1, with no sigils or glyphs solved]]<br />
<br />
During [[Waking_Titan/Phase_1 | Phase 1]], the http://wakingtitan.com hosted 6 triangles in the middle of the page. These triangles were referred to as "'''Sigils'''", while the white icons along the bottom of the page were referred to as "'''Glyphs'''". Each sigil and glyph, when clicked, lead to a password entry prompt - the correct passwords for all 6 sigils and the first 5 glyphs were discovered via puzzle-solving during Phase 1 of Waking Titan.<br />
<br />
The sigil and glyph puzzles were solved collaboratively - while it may have be possible to solve some of these puzzles individually, most of them required a collaborative effort. For instance, some puzzles required players to meet agents from the Atlas Corporation in person, and to relay information obtained from these meetings back to the community. A list of all sigil and glyph solutions for Phase 1 can be found below:<br />
<br />
[[File:WT Phase 1 complete.png|600px]]<br />
<br />
This phase culminated on July 8, 2017, with a [[Waking_Titan/Phase_1#End_of_Phase_1| congratulatory message from Elizabeth Leighton]], the CEO of the Atlas Foundation.<br />
<br />
=== Phase 2 ===<br />
<br />
[[File:Hampster maze.jpeg|thumbnail|450px|right|One of the puzzles that appeared on the Waking Titan [http://twitch.tv/wakingtitan Twitch Stream]]]<br />
<br />
During [[Waking_Titan/Phase_2 | Phase 2]], the http://wakingtitan.com site hosted a command-line interface terminal. Various commands were accepted as input, which triggered different events. One of the most notable commands was the <code>WHOIS <argument></code> command, which revealed a passage of text pertaining to the specified argument. For instance, the command <code>WHOIS FOURTH RACE</code> returned the following message:<br />
<pre><br />
INCOMING TRANSMISSION… SOURCE: UNKNOWN…<br />
You are not – kzzktt – alone –<br />
Please, identify yourself. I’m – kzzkttk –<br />
</pre><br />
<br />
Additionally, http://project-wt.com hosted a "Calibration" utility during Phase 2. To successfully perform these calibrations, players had to upload images of various objects and buildings to the site. For instance, the first calibration required images of "public resonant percussion instruments".<br />
<br />
Finally, towards the end of Phase 2, the Waking Titan [http://twitch.tv/wakingtitan Twitch stream] went live, displaying a five-monitor setup. Throughout the duration of the stream, players had to work together to solve puzzles that were displayed on these monitors. Some of these puzzles were interactive; for example, one puzzle that was repeated several times involved the Twitch chat guiding a virtual hamster through a maze.<br />
<br />
Additionally, players solved another 3 glyphs throughout Phase 2. The solutions to these glyphs are shown below:<br />
<br />
[[File:WT Phase2 Passwords.png|600px]]<br />
<br />
=== Phase 3 ===<br />
<br />
{{#evt:<br />
service=youtube<br />
|id=https://www.youtube.com/watch?v=QhX9z4dDAa4<br />
|alignment=right<br />
}}<br />
<br />
[[Waking_Titan/Phase_3|Phase 3]] was the briefest phase of Waking Titan. It consisted of the conclusion of the [http://twitch.tv/wakingtitan Twitch stream] that began at the [[Waking Titan/Phase 2#End of Phase 2|end of Phase 2]]. Players solved more interactive puzzles on the Twitch stream, before the rogue AI Loop16 asked them a final question: <code>SHOULD I EXIST?</code> The overwhelming response from the community was "yes".<br />
<br />
After receiving this response, Loop16 and Emily of the ETARC forums were revealed as being one and the same. Loop16 generated a heartfelt "Thank You" video to round out the stream, before finally taking the 72-hour stream offline.<br />
<br />
Shortly after this, players received emails with the subject line <code>Waking Titan has Ended</code>. The contents of the message were as follows:<br />
<br />
<pre><br />
Hello, Citizen Scientist,<br />
<br />
Thank you for your contributions to Waking Titan. The developments that took place during Phase 3 were somewhat concerning, but together we have set in motion truly world-shaping events. We will continue to inform the Citizen Science Division of privileged information or any need for collaborators on a new project.<br />
<br />
But we do have a few loose ends to tie up with you before we move on, so let's proceed.<br />
<br />
First, we're pleased to announce that all 10,000 Level 4 Atlas Passes are in production. Note that due to transit times for mail, some may take several weeks to be delivered.<br />
<br />
Next, our CEO Elizabeth Leighton has asked us to include a personal note of gratitude:<br />
<br />
"Thank you for all your diligent efforts, Citizen Scientists. It's been an amazing journey for all of us. I've watched you thrive and achieve from those first Phase 1 radio ads all the way through the intensity of Phase 3. I've been impressed at every turn by how brilliant you've been, how voracious, how kind, how thoughtful.<br />
<br />
It's been an honor and a privilege. On behalf of the Atlas Foundation, and on behalf of the world, thank you."<br />
The Mercury subroutine has concluded successfully, and a new memo from SM about this process is coming in the next 24 hours. We hope it will answer a few key questions you have about our program, and about what comes next.<br />
</pre><br />
<br />
On August 11, 2017, the [https://www.nomanssky.com/atlas-rises-update/ Atlas Rises update] was released for No Man's Sky.<br />
<br />
=== Phase 4 ===<br />
<br />
[[Waking_Titan/Phase_4 | Phase 4]] of Waking Titan started on 2017-12-28 and is currently ongoing.<br />
<br />
== Connection to No Man's Sky ==<br />
<br />
[[File:9-16-case.png|thumbnail|right|The case that cassette 9/16 was contained in.]]<br />
<br />
At the beginning of the ARG, it was not clear whether Waking Titan was officially connected to No Man's Sky. At first, there were only hints and nudges. At one point, 180 free copies of No Man's Sky were distributed to ARG players. Here's the text of a PDF that was revealed at the end of Phase 1 of Waking Titan:<br />
<br />
<pre><br />
We want to extend our gratitude to everyone who has contributed to the Mercury subroutine so far. <br />
We hope you have enjoyed the successful distribution of 180 Access IDs, and we hope you will also <br />
appreciate the other interesting artifacts we have in store for you going forward. We intend to keep the <br />
process alive until the completion of Project Waking Titan in August. <br />
<br />
It is important to mention that we are very excited by the coming Phases 2 and 3. Input from the Mercury <br />
Subroutine will pave the way toward new experiences in '''version 1.3 of a familiar universe'''. We look forward <br />
to the successful conclusion of this ground-breaking experiment. <br />
<br />
Regards.<br />
S.M.<br />
</pre><br />
<br />
This text explicitly stated that the Waking Titan ARG was leading towards the upcoming 1.3 update for No Man's Sky.<br />
<br />
Some [[Waking_Titan/Console_Commands | console commands]] on the [http://www.wakingtitan.com/ Waking Titan website] during [[Waking_Titan/Phase 2|Phase 2]] refer directly to No Man's Sky lore - for instance, <code>WHOIS ATLAS</code>, <code>WHOIS VY'KEEN</code>, and <code>WHOIS KORVAX</code> are all valid commands. Additionally, some terminal commands referred to a mysterious fourth race, so the prevailing assumption was that the upcoming 1.3 update would bring a fourth race to No Man's Sky.<br />
<br />
At the conclusion of the ARG, an email was sent out to members of the CSD with a [[Waking_Titan/Phase_3#Memo_from_Sean_Murray | memo from Sean Murray]], confirming that the ARG was the lead up to the 1.3 update, which was [https://www.nomanssky.com/atlas-rises-update/ released] after a few days.<br />
<br />
<br />
== Media Appearances ==<br />
<br />
'''5th July 2017''' <br><br />
[EN] [https://www.argn.com/2017/07/stern_words_from_no_mans_sky_arg/ ARGNet - Stern Words from No Man’s Sky ARG]<br />
<br />
'''23rd July 2017''' <br><br />
[EN] [https://geekreply.com/geek-culture/2017/07/23/waking-titan-update-1-phase-2-commences GeekReply - Waking Titan Update 1: Phase 2 Commences!]<br />
<br />
'''27th July 2017''' <br><br />
[EN] [https://geekreply.com/editorials/2017/07/27/waking-titan-arg-can-bring-people-together GeekReply - Waking Titan: How An ARG can Bring People Together.]<br />
<br />
'''8th August 2017''' <br><br />
[EN] [https://www.dailystar.co.uk/tech/gaming/635697/No-Man-s-Sky-News-Waking-Titan-Reddit-Arg-1-3-update-release-date/ Dailystar - No Man's Sky News: Waking Titan Reddit Arg REVEALS 1.3 update ahead of release date]<br />
<br />
'''9th August 2017''' <br><br />
[EN] [https://arstechnica.com/gaming/2017/08/no-mans-sky-version-1-3-lands-this-week-for-free-adds-quick-travel-portals/ Ars Technica - No Man’s Sky version 1.3 lands this week for free, adds “quick-travel” portals]<br />
<br />
[EN] [https://www.forbes.com/sites/insertcoin/2017/08/09/no-mans-sky-is-patching-in-a-story-this-week-a-year-after-launch/#19fb5a285282 Forbes - 'No Man's Sky' Is Patching In A Story This Week, A Year After Launch]<br />
<br />
[EN] [https://www.gamespew.com/2017/08/no-mans-sky-patch-week-improving-central-story/ GameSpew - No Man's Sky Patch This Week Improving Its Story]<br />
<br />
'''19th January 2018''' <br><br />
[EN] [http://www.eurogamer.net/articles/2018-01-18-no-mans-skys-waking-titan-arg-is-back-and-fans-are-trying-to-figure-out-what-it-all-means Eurogamer - No Man's Sky's Waking Titan ARG is back, and fans are trying to figure it all out again]<br />
<br />
[RU] [https://dtf.ru/category/nmsarg/ DTF - A Collection of No Man's Sky and Waking Titan Articles.]<br />
<br />
== Other Information ==<br />
<br />
{| class="wikitable"<br />
!colspan="2"|[[:Category:Waking Titan| Waking Titan Miscellaneous Subpages]]<br />
|-<br />
|[[Waking_Titan/Cassettes | Cassettes]]<br />
|Information about the cassette tapes received by No Man's Sky subreddit moderators<br />
|-<br />
|[[Waking_Titan/Stations | Stations]]<br />
|Information on the radio stations from the initial project-wt.com site<br />
|-<br />
|[[Waking_Titan/Companies | Company Archives]]<br />
|An archive of company details.<br />
|}<br />
<br />
[[Category:Waking Titan]]</div>Kkzzzkthttps://wiki.gamedetectives.net/index.php?title=Waking_Titan&diff=15945Waking Titan2018-07-03T21:12:29Z<p>Kkzzzkt: added new dreamer patient files</p>
<hr />
<div>{{argbox<br />
| float = right<br />
| image = File:Project WT logo.png<br />
| name = [[Waking Titan]]<br />
| description= Waking Titan was an ARG which led towards the No Man's Sky [https://www.nomanssky.com/atlas-rises-update/ Atlas Rises update].<br />
| creator = [http://www.aliceandsmith.com/ Alice & Smith]<br />
| creator2 = [http://www.hellogames.org/ Hello Games]<br />
| type = Official<br />
| status = Active<br />
| discovered = 2017-05-28<br />
}}<br />
{{ArgHeader}}<br />
{{BackToTop}}<br />
<br />
=== Description ===<br />
Waking Titan (also known as Project WT) is an ARG (alternate reality game) that involves a multitude of websites, phone numbers, and radio stations scattered across the world. The ARG is produced by veteran puppet masters [http://www.aliceandsmith.com/ Alice & Smith], and features NPCs, actors, and live events.<br />
<br />
Of the sci-fi genre, its story—linked to the origin of No Man's Sky—follows a powerful A.I known as Loop16 that is created by [https://wiki.gamedetectives.net/index.php?title=Waking_Titan/Characters The Atlas Foundation] to simulate a one-to-one recreation of reality that can accurately predict the future.<br />
<br />
=== Contents ===<br />
The ARG encompassed several "seasons," each leading to a new update for No Man's Sky. Season 1 of Waking Titan led to the [https://www.nomanssky.com/atlas-rises-update/ Atlas Rises update] and Season 2 is leading to [https://www.nomanssky.com/2018/03/no-mans-sky-next/ No Man's Sky: NEXT]. Season 1 was further divided into several distinct "'''phases'''", and Season 2 has followed this convention for ease of reading. Each phase is documented on its own wiki page:<br />
<br />
{| class="wikitable"<br />
!colspan="2"|Season 1<br />
|-<br />
|[[Waking_Titan/Phase_1 | Phase 1]] <br />
|Phase 1 of Waking Titan lasted from 2017-05-28 to 2017-07-08.<br />
|-<br />
|[[Waking_Titan/Phase_2 | Phase 2]] <br />
|Phase 2 of Waking Titan lasted from 2017-07-21 to 2017-08-05.<br />
|-<br />
|[[Waking_Titan/Phase_3 | Phase 3]]<br />
|Phase 3 of Waking Titan lasted from 2017-08-05 to 2017-08-07.<br />
|-<br />
!colspan="2"|Season 2<br />
|-<br />
|[[Waking_Titan/Phase_4 | Phase 4]]<br />
|Phase 4 of Waking Titan started on 2017-12-28 and is currently ongoing.<br />
|}<br />
<br />
'''''Note:''' This is a '''summary''' page. For more in-depth descriptions of each phase, including detailed descriptions of puzzle solutions, check the [[Waking_Titan/Phase_1|Phase 1]], [[Waking_Titan/Phase_2|Phase 2]], [[Waking_Titan/Phase_3 | Phase 3]] and [[Waking_Titan/Phase_4 | Phase 4]] pages.''<br />
__TOC__<br />
<br />
<br />
<br />
== Story Overview ==<br />
<br />
=== Internal Memos ===<br />
<br />
[[File:WT glyph 1 pdf.png|280px|thumbnail|right|One of the internal memos discovered in Waking Titan]]<br />
<br />
Throughout the ARG, in-game characters have communicated with each other via "internal memos". Over time, these memos were discovered by ARG players, in the form of PDF files. These memos provided lore content and puzzle content, and are '''highly recommended''' reading for new players!<br />
<br />
'''Season 1'''<br />
<br />
* [http://wiki.gamedetectives.net/index.php?title=File:WT_glyph_1_pdf.png Teamwork Assessment]<br />
* [http://wiki.gamedetectives.net/index.php?title=File:WT-Dataset-97C.jpg Dataset 97C]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/data/7d3dd080-2a43-4882-833c-f4d7bd7ba607.pdf Assurance]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/data/c01-331c6734-a013-4695-8e47-08a9ee05d5e5.pdf 017-a24]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/data/c02-9936c797-ec28-4f8f-b80e-dee9e0b06433.pdf 021-f16]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/mercury/mercury-01-98748sfdlka87.pdf Mercury Process Self-Diagnosis Report]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/data/57201e0d-01a3-4f6a-bbb4-2be8b7c8880f.pdf Progress Report]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/6c285180-ec4d-48a2-967f-8a7af3b50008.pdf Subject M-N00-dl35]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/410a3e5d-01e7-4058-a23c-ca5fdde97f9d.pdf Atlas Foundation Threat Models]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/7a6594ac-ca5e-467a-b6f4-9fb91f069d0a.pdf Advanced Calibration - Optional]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/a224a1f4-00e5-467b-9893-83fcc1a4f19a.pdf Unlocking Mercury Process File L16.jpg]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/b91f9959-6a3c-4011-b3b5-a1ff757a5e4c.pdf Phase 3]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/b0f33d53-5a8c-4a9a-b5fc-395562e463a8a+.pdf Log.1291]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/a09-179bf8d2-c13e-4c66-982e-b37ab3efd5bb.pdf Breach of Contract]<br />
<br />
'''Season 2'''<br />
<br />
* [https://wiki.gamedetectives.net/images/6/6e/Memo2.png Waking Titan S2 - Under Preparation]<br />
* [https://drive.google.com/open?id=1la3UNKHc5yeaB_w2a2tK1cjKN44oEmCo Arnaud Lacours Datadumps - INYOURMIND.exe failed]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/94c02878-e023-46a3-9316-db4177c4eaa6+.pdf WARE REPORT #26]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/1cd5226d-6639-4bbd-855a-4bf8f60866c3.pdf Concerns Regarding Captain Harry]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/70a25e6c-95ed-42d4-8de8-c3948255174c+.pdf Myriad Crisis Event Timeline]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/19997bb6-18e5-4427-86c7-b0f3c1826ca2.pdf State of The Atlas Foundation]<br />
* [https://pastebin.com/NYLiFuNY Log.3022]<br />
<br />
* '''W/ARE - Dreamer Patient Files''' — [https://s3.amazonaws.com/ware-virtual-dashboard/files/Phillip-PatientFile.pdf Phillip Moretti]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/EunHa-PatientFile.pdf Kwon Eun Ha]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/498hd98h3444-3339e/Alexander-PatientFile.pdf Alexander Bordeleau]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/GCMnQmM9E3v7L8wuv-V2FUY7P/Claire-PatientFile.pdf Claire Sandfield]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/kh2jsaljs901m-asd1n1lwks/Tariq-PatientFile.pdf Tariq]; [https://ware-virtual-dashboard.s3.amazonaws.com/files/GCMnQmM9E3v7L8wuv-V2FUY7P/Toby-PatientFile.pdf Toby Mulligan]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/ga3ms81-2ms92fbl/Mike-PatientFile.pdf Mike Pasaquale]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/kajs61ns-82baks8nx/Nina-PatientFile.pdf Nina Flores]<br />
<br />
=== Subpages ===<br />
<br />
Navigating through the following subpages is recommended for newcomers wanting to get a grasp of Waking Titan's rapidly expanding story.<br />
<br />
{| class="wikitable"<br />
!colspan="2"|[[:Category:Waking Titan| Story Subpages]]<br />
|-<br />
|[[Waking_Titan/Characters| Character Summaries]]<br />
|Includes a summary of each character, company, and relating experiments and their importance in the Waking Titan story.<br />
|-<br />
|[[Waking_Titan/Console_Commands | Console Commands]]<br />
|A list of commands used by players at the [http://wakingtitan.com Waking Titan console]<br />
|}<br />
<br />
=== Music ===<br />
<br />
Partial video addresses for Youtube can be found scattered across Waking Titan PDFs, website files, and surveys; which all lead to music. The exact reasoning for this has gone unexplained. However, there are thematic relevancies in each song that appear to reflect on the state of the story. A playlist containing all songs linked in Waking Titan can be found here ''in order of earliest to most recent'' ... [https://www.youtube.com/playlist?list=PLEZy8wyuYLpLw0e5kkMyBUHO_s-V8f0Qk >>>>>]<br />
<br />
== Event Summaries ==<br />
<br />
=== Introduction ===<br />
<br />
On 2017-05-27, Twitter user @argn [https://twitter.com/argn/status/868587449613766658 tweeted a link] to [http://www.project-wt.com/ 'project-wt.com']. The link led to a website which contained a map showing sixty locations, four of which were "active" at the time. The locations, when clicked on, revealed the location's name and status. The active locations also revealed a link to a livestream of a local radio station, originating from the corresponding location. The project-wt website displayed a date, June 8th, and stated that the first clue was being "initialized".<br />
<br />
On 2017-06-01, moderators of No Man's Sky subreddits [https://reddit.com/r/nomansskythegame /r/NoMansSkyTheGame], [https://www.reddit.com/r/NMSPortals/ /r/NMSPortals], and [https://www.reddit.com/r/NMSGalacticHub/ /r/NMSGalacticHub] started to receive cassette tapes in the mail. Each cassette tape was labelled with a number out of 16. The Waking Titan ARG was initially thought to be a separate ARG from these tapes, but connections between the two made it clear that they were, in fact, one and the same.<br />
<br />
=== Phase 1 ===<br />
<br />
[[File:Wakingtitan site.png|thumbnail|450px|right|The default appearance of the Waking Titan site during Phase 1, with no sigils or glyphs solved]]<br />
<br />
During [[Waking_Titan/Phase_1 | Phase 1]], the http://wakingtitan.com hosted 6 triangles in the middle of the page. These triangles were referred to as "'''Sigils'''", while the white icons along the bottom of the page were referred to as "'''Glyphs'''". Each sigil and glyph, when clicked, lead to a password entry prompt - the correct passwords for all 6 sigils and the first 5 glyphs were discovered via puzzle-solving during Phase 1 of Waking Titan.<br />
<br />
The sigil and glyph puzzles were solved collaboratively - while it may have be possible to solve some of these puzzles individually, most of them required a collaborative effort. For instance, some puzzles required players to meet agents from the Atlas Corporation in person, and to relay information obtained from these meetings back to the community. A list of all sigil and glyph solutions for Phase 1 can be found below:<br />
<br />
[[File:WT Phase 1 complete.png|600px]]<br />
<br />
This phase culminated on July 8, 2017, with a [[Waking_Titan/Phase_1#End_of_Phase_1| congratulatory message from Elizabeth Leighton]], the CEO of the Atlas Foundation.<br />
<br />
=== Phase 2 ===<br />
<br />
[[File:Hampster maze.jpeg|thumbnail|450px|right|One of the puzzles that appeared on the Waking Titan [http://twitch.tv/wakingtitan Twitch Stream]]]<br />
<br />
During [[Waking_Titan/Phase_2 | Phase 2]], the http://wakingtitan.com site hosted a command-line interface terminal. Various commands were accepted as input, which triggered different events. One of the most notable commands was the <code>WHOIS <argument></code> command, which revealed a passage of text pertaining to the specified argument. For instance, the command <code>WHOIS FOURTH RACE</code> returned the following message:<br />
<pre><br />
INCOMING TRANSMISSION… SOURCE: UNKNOWN…<br />
You are not – kzzktt – alone –<br />
Please, identify yourself. I’m – kzzkttk –<br />
</pre><br />
<br />
Additionally, http://project-wt.com hosted a "Calibration" utility during Phase 2. To successfully perform these calibrations, players had to upload images of various objects and buildings to the site. For instance, the first calibration required images of "public resonant percussion instruments".<br />
<br />
Finally, towards the end of Phase 2, the Waking Titan [http://twitch.tv/wakingtitan Twitch stream] went live, displaying a five-monitor setup. Throughout the duration of the stream, players had to work together to solve puzzles that were displayed on these monitors. Some of these puzzles were interactive; for example, one puzzle that was repeated several times involved the Twitch chat guiding a virtual hamster through a maze.<br />
<br />
Additionally, players solved another 3 glyphs throughout Phase 2. The solutions to these glyphs are shown below:<br />
<br />
[[File:WT Phase2 Passwords.png|600px]]<br />
<br />
=== Phase 3 ===<br />
<br />
{{#evt:<br />
service=youtube<br />
|id=https://www.youtube.com/watch?v=QhX9z4dDAa4<br />
|alignment=right<br />
}}<br />
<br />
[[Waking_Titan/Phase_3|Phase 3]] was the briefest phase of Waking Titan. It consisted of the conclusion of the [http://twitch.tv/wakingtitan Twitch stream] that began at the [[Waking Titan/Phase 2#End of Phase 2|end of Phase 2]]. Players solved more interactive puzzles on the Twitch stream, before the rogue AI Loop16 asked them a final question: <code>SHOULD I EXIST?</code> The overwhelming response from the community was "yes".<br />
<br />
After receiving this response, Loop16 and Emily of the ETARC forums were revealed as being one and the same. Loop16 generated a heartfelt "Thank You" video to round out the stream, before finally taking the 72-hour stream offline.<br />
<br />
Shortly after this, players received emails with the subject line <code>Waking Titan has Ended</code>. The contents of the message were as follows:<br />
<br />
<pre><br />
Hello, Citizen Scientist,<br />
<br />
Thank you for your contributions to Waking Titan. The developments that took place during Phase 3 were somewhat concerning, but together we have set in motion truly world-shaping events. We will continue to inform the Citizen Science Division of privileged information or any need for collaborators on a new project.<br />
<br />
But we do have a few loose ends to tie up with you before we move on, so let's proceed.<br />
<br />
First, we're pleased to announce that all 10,000 Level 4 Atlas Passes are in production. Note that due to transit times for mail, some may take several weeks to be delivered.<br />
<br />
Next, our CEO Elizabeth Leighton has asked us to include a personal note of gratitude:<br />
<br />
"Thank you for all your diligent efforts, Citizen Scientists. It's been an amazing journey for all of us. I've watched you thrive and achieve from those first Phase 1 radio ads all the way through the intensity of Phase 3. I've been impressed at every turn by how brilliant you've been, how voracious, how kind, how thoughtful.<br />
<br />
It's been an honor and a privilege. On behalf of the Atlas Foundation, and on behalf of the world, thank you."<br />
The Mercury subroutine has concluded successfully, and a new memo from SM about this process is coming in the next 24 hours. We hope it will answer a few key questions you have about our program, and about what comes next.<br />
</pre><br />
<br />
On August 11, 2017, the [https://www.nomanssky.com/atlas-rises-update/ Atlas Rises update] was released for No Man's Sky.<br />
<br />
=== Phase 4 ===<br />
<br />
[[Waking_Titan/Phase_4 | Phase 4]] of Waking Titan started on 2017-12-28 and is currently ongoing.<br />
<br />
== Connection to No Man's Sky ==<br />
<br />
[[File:9-16-case.png|thumbnail|right|The case that cassette 9/16 was contained in.]]<br />
<br />
At the beginning of the ARG, it was not clear whether Waking Titan was officially connected to No Man's Sky. At first, there were only hints and nudges. At one point, 180 free copies of No Man's Sky were distributed to ARG players. Here's the text of a PDF that was revealed at the end of Phase 1 of Waking Titan:<br />
<br />
<pre><br />
We want to extend our gratitude to everyone who has contributed to the Mercury subroutine so far. <br />
We hope you have enjoyed the successful distribution of 180 Access IDs, and we hope you will also <br />
appreciate the other interesting artifacts we have in store for you going forward. We intend to keep the <br />
process alive until the completion of Project Waking Titan in August. <br />
<br />
It is important to mention that we are very excited by the coming Phases 2 and 3. Input from the Mercury <br />
Subroutine will pave the way toward new experiences in '''version 1.3 of a familiar universe'''. We look forward <br />
to the successful conclusion of this ground-breaking experiment. <br />
<br />
Regards.<br />
S.M.<br />
</pre><br />
<br />
This text explicitly stated that the Waking Titan ARG was leading towards the upcoming 1.3 update for No Man's Sky.<br />
<br />
Some [[Waking_Titan/Console_Commands | console commands]] on the [http://www.wakingtitan.com/ Waking Titan website] during [[Waking_Titan/Phase 2|Phase 2]] refer directly to No Man's Sky lore - for instance, <code>WHOIS ATLAS</code>, <code>WHOIS VY'KEEN</code>, and <code>WHOIS KORVAX</code> are all valid commands. Additionally, some terminal commands referred to a mysterious fourth race, so the prevailing assumption was that the upcoming 1.3 update would bring a fourth race to No Man's Sky.<br />
<br />
At the conclusion of the ARG, an email was sent out to members of the CSD with a [[Waking_Titan/Phase_3#Memo_from_Sean_Murray | memo from Sean Murray]], confirming that the ARG was the lead up to the 1.3 update, which was [https://www.nomanssky.com/atlas-rises-update/ released] after a few days.<br />
<br />
<br />
== Media Appearances ==<br />
<br />
'''5th July 2017''' <br><br />
[EN] [https://www.argn.com/2017/07/stern_words_from_no_mans_sky_arg/ ARGNet - Stern Words from No Man’s Sky ARG]<br />
<br />
'''23rd July 2017''' <br><br />
[EN] [https://geekreply.com/geek-culture/2017/07/23/waking-titan-update-1-phase-2-commences GeekReply - Waking Titan Update 1: Phase 2 Commences!]<br />
<br />
'''27th July 2017''' <br><br />
[EN] [https://geekreply.com/editorials/2017/07/27/waking-titan-arg-can-bring-people-together GeekReply - Waking Titan: How An ARG can Bring People Together.]<br />
<br />
'''8th August 2017''' <br><br />
[EN] [https://www.dailystar.co.uk/tech/gaming/635697/No-Man-s-Sky-News-Waking-Titan-Reddit-Arg-1-3-update-release-date/ Dailystar - No Man's Sky News: Waking Titan Reddit Arg REVEALS 1.3 update ahead of release date]<br />
<br />
'''9th August 2017''' <br><br />
[EN] [https://arstechnica.com/gaming/2017/08/no-mans-sky-version-1-3-lands-this-week-for-free-adds-quick-travel-portals/ Ars Technica - No Man’s Sky version 1.3 lands this week for free, adds “quick-travel” portals]<br />
<br />
[EN] [https://www.forbes.com/sites/insertcoin/2017/08/09/no-mans-sky-is-patching-in-a-story-this-week-a-year-after-launch/#19fb5a285282 Forbes - 'No Man's Sky' Is Patching In A Story This Week, A Year After Launch]<br />
<br />
[EN] [https://www.gamespew.com/2017/08/no-mans-sky-patch-week-improving-central-story/ GameSpew - No Man's Sky Patch This Week Improving Its Story]<br />
<br />
'''19th January 2018''' <br><br />
[EN] [http://www.eurogamer.net/articles/2018-01-18-no-mans-skys-waking-titan-arg-is-back-and-fans-are-trying-to-figure-out-what-it-all-means Eurogamer - No Man's Sky's Waking Titan ARG is back, and fans are trying to figure it all out again]<br />
<br />
[RU] [https://dtf.ru/category/nmsarg/ DTF - A Collection of No Man's Sky and Waking Titan Articles.]<br />
<br />
== Other Information ==<br />
<br />
{| class="wikitable"<br />
!colspan="2"|[[:Category:Waking Titan| Waking Titan Miscellaneous Subpages]]<br />
|-<br />
|[[Waking_Titan/Cassettes | Cassettes]]<br />
|Information about the cassette tapes received by No Man's Sky subreddit moderators<br />
|-<br />
|[[Waking_Titan/Stations | Stations]]<br />
|Information on the radio stations from the initial project-wt.com site<br />
|-<br />
|[[Waking_Titan/Companies | Company Archives]]<br />
|An archive of company details.<br />
|}<br />
<br />
[[Category:Waking Titan]]</div>Kkzzzkthttps://wiki.gamedetectives.net/index.php?title=Waking_Titan&diff=15915Waking Titan2018-06-29T13:48:05Z<p>Kkzzzkt: added toby patient file</p>
<hr />
<div>{{argbox<br />
| float = right<br />
| image = File:Project WT logo.png<br />
| name = [[Waking Titan]]<br />
| description= Waking Titan was an ARG which led towards the No Man's Sky [https://www.nomanssky.com/atlas-rises-update/ Atlas Rises update].<br />
| creator = [http://www.aliceandsmith.com/ Alice & Smith]<br />
| creator2 = [http://www.hellogames.org/ Hello Games]<br />
| type = Official<br />
| status = Active<br />
| discovered = 2017-05-28<br />
}}<br />
{{ArgHeader}}<br />
{{BackToTop}}<br />
<br />
=== Description ===<br />
Waking Titan (also known as Project WT) is an ARG (alternate reality game) that involves a multitude of websites, phone numbers, and radio stations scattered across the world. The ARG is produced by veteran puppet masters [http://www.aliceandsmith.com/ Alice & Smith], and features NPCs, actors, and live events.<br />
<br />
Of the sci-fi genre, its story—linked to the origin of No Man's Sky—follows a powerful A.I known as Loop16 that is created by [https://wiki.gamedetectives.net/index.php?title=Waking_Titan/Characters The Atlas Foundation] to simulate a one-to-one recreation of reality that can accurately predict the future.<br />
<br />
=== Contents ===<br />
The ARG encompassed several "seasons," each leading to a new update for No Man's Sky. Season 1 of Waking Titan led to the [https://www.nomanssky.com/atlas-rises-update/ Atlas Rises update] and Season 2 is leading to [https://www.nomanssky.com/2018/03/no-mans-sky-next/ No Man's Sky: NEXT]. Season 1 was further divided into several distinct "'''phases'''", and Season 2 has followed this convention for ease of reading. Each phase is documented on its own wiki page:<br />
<br />
{| class="wikitable"<br />
!colspan="2"|Season 1<br />
|-<br />
|[[Waking_Titan/Phase_1 | Phase 1]] <br />
|Phase 1 of Waking Titan lasted from 2017-05-28 to 2017-07-08.<br />
|-<br />
|[[Waking_Titan/Phase_2 | Phase 2]] <br />
|Phase 2 of Waking Titan lasted from 2017-07-21 to 2017-08-05.<br />
|-<br />
|[[Waking_Titan/Phase_3 | Phase 3]]<br />
|Phase 3 of Waking Titan lasted from 2017-08-05 to 2017-08-07.<br />
|-<br />
!colspan="2"|Season 2<br />
|-<br />
|[[Waking_Titan/Phase_4 | Phase 4]]<br />
|Phase 4 of Waking Titan started on 2017-12-28 and is currently ongoing.<br />
|}<br />
<br />
'''''Note:''' This is a '''summary''' page. For more in-depth descriptions of each phase, including detailed descriptions of puzzle solutions, check the [[Waking_Titan/Phase_1|Phase 1]], [[Waking_Titan/Phase_2|Phase 2]], [[Waking_Titan/Phase_3 | Phase 3]] and [[Waking_Titan/Phase_4 | Phase 4]] pages.''<br />
__TOC__<br />
<br />
<br />
<br />
== Story Overview ==<br />
<br />
=== Internal Memos ===<br />
<br />
[[File:WT glyph 1 pdf.png|280px|thumbnail|right|One of the internal memos discovered in Waking Titan]]<br />
<br />
Throughout the ARG, in-game characters have communicated with each other via "internal memos". Over time, these memos were discovered by ARG players, in the form of PDF files. These memos provided lore content and puzzle content, and are '''highly recommended''' reading for new players!<br />
<br />
'''Season 1'''<br />
<br />
* [http://wiki.gamedetectives.net/index.php?title=File:WT_glyph_1_pdf.png Teamwork Assessment]<br />
* [http://wiki.gamedetectives.net/index.php?title=File:WT-Dataset-97C.jpg Dataset 97C]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/data/7d3dd080-2a43-4882-833c-f4d7bd7ba607.pdf Assurance]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/data/c01-331c6734-a013-4695-8e47-08a9ee05d5e5.pdf 017-a24]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/data/c02-9936c797-ec28-4f8f-b80e-dee9e0b06433.pdf 021-f16]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/mercury/mercury-01-98748sfdlka87.pdf Mercury Process Self-Diagnosis Report]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/data/57201e0d-01a3-4f6a-bbb4-2be8b7c8880f.pdf Progress Report]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/6c285180-ec4d-48a2-967f-8a7af3b50008.pdf Subject M-N00-dl35]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/410a3e5d-01e7-4058-a23c-ca5fdde97f9d.pdf Atlas Foundation Threat Models]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/7a6594ac-ca5e-467a-b6f4-9fb91f069d0a.pdf Advanced Calibration - Optional]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/a224a1f4-00e5-467b-9893-83fcc1a4f19a.pdf Unlocking Mercury Process File L16.jpg]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/b91f9959-6a3c-4011-b3b5-a1ff757a5e4c.pdf Phase 3]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/b0f33d53-5a8c-4a9a-b5fc-395562e463a8a+.pdf Log.1291]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/a09-179bf8d2-c13e-4c66-982e-b37ab3efd5bb.pdf Breach of Contract]<br />
<br />
'''Season 2'''<br />
<br />
* [https://wiki.gamedetectives.net/images/6/6e/Memo2.png Waking Titan S2 - Under Preparation]<br />
* [https://drive.google.com/open?id=1la3UNKHc5yeaB_w2a2tK1cjKN44oEmCo Arnaud Lacours Datadumps - INYOURMIND.exe failed]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/94c02878-e023-46a3-9316-db4177c4eaa6+.pdf WARE REPORT #26]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/1cd5226d-6639-4bbd-855a-4bf8f60866c3.pdf Concerns Regarding Captain Harry]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/70a25e6c-95ed-42d4-8de8-c3948255174c+.pdf Myriad Crisis Event Timeline]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/19997bb6-18e5-4427-86c7-b0f3c1826ca2.pdf State of The Atlas Foundation]<br />
* [https://pastebin.com/NYLiFuNY Log.3022]<br />
<br />
* '''W/ARE Sacramento Screening Reports''' - [https://s3.amazonaws.com/ware-virtual-dashboard/files/Phillip-PatientFile.pdf Phillip Moretti]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/EunHa-PatientFile.pdf Kwon Eun Ha]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/498hd98h3444-3339e/Alexander-PatientFile.pdf Alexander Bordeleau]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/GCMnQmM9E3v7L8wuv-V2FUY7P/Claire-PatientFile.pdf Claire Sandfield]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/kh2jsaljs901m-asd1n1lwks/Tariq-PatientFile.pdf Tariq]; [https://ware-virtual-dashboard.s3.amazonaws.com/files/GCMnQmM9E3v7L8wuv-V2FUY7P/Toby-PatientFile.pdf Toby Mulligan]<br />
<br />
=== Subpages ===<br />
<br />
Navigating through the following subpages is recommended for newcomers wanting to get a grasp of Waking Titan's rapidly expanding story.<br />
<br />
{| class="wikitable"<br />
!colspan="2"|[[:Category:Waking Titan| Story Subpages]]<br />
|-<br />
|[[Waking_Titan/Characters| Character Summaries]]<br />
|Includes a summary of each character, company, and relating experiments and their importance in the Waking Titan story.<br />
|-<br />
|[[Waking_Titan/Console_Commands | Console Commands]]<br />
|A list of commands used by players at the [http://wakingtitan.com Waking Titan console]<br />
|}<br />
<br />
=== Music ===<br />
<br />
Partial video addresses for Youtube can be found scattered across Waking Titan PDFs, website files, and surveys; which all lead to music. The exact reasoning for this has gone unexplained. However, there are thematic relevancies in each song that appear to reflect on the state of the story. A playlist containing all songs linked in Waking Titan can be found here ''in order of earliest to most recent'' ... [https://www.youtube.com/playlist?list=PLEZy8wyuYLpLw0e5kkMyBUHO_s-V8f0Qk >>>>>]<br />
<br />
== Event Summaries ==<br />
<br />
=== Introduction ===<br />
<br />
On 2017-05-27, Twitter user @argn [https://twitter.com/argn/status/868587449613766658 tweeted a link] to [http://www.project-wt.com/ 'project-wt.com']. The link led to a website which contained a map showing sixty locations, four of which were "active" at the time. The locations, when clicked on, revealed the location's name and status. The active locations also revealed a link to a livestream of a local radio station, originating from the corresponding location. The project-wt website displayed a date, June 8th, and stated that the first clue was being "initialized".<br />
<br />
On 2017-06-01, moderators of No Man's Sky subreddits [https://reddit.com/r/nomansskythegame /r/NoMansSkyTheGame], [https://www.reddit.com/r/NMSPortals/ /r/NMSPortals], and [https://www.reddit.com/r/NMSGalacticHub/ /r/NMSGalacticHub] started to receive cassette tapes in the mail. Each cassette tape was labelled with a number out of 16. The Waking Titan ARG was initially thought to be a separate ARG from these tapes, but connections between the two made it clear that they were, in fact, one and the same.<br />
<br />
=== Phase 1 ===<br />
<br />
[[File:Wakingtitan site.png|thumbnail|450px|right|The default appearance of the Waking Titan site during Phase 1, with no sigils or glyphs solved]]<br />
<br />
During [[Waking_Titan/Phase_1 | Phase 1]], the http://wakingtitan.com hosted 6 triangles in the middle of the page. These triangles were referred to as "'''Sigils'''", while the white icons along the bottom of the page were referred to as "'''Glyphs'''". Each sigil and glyph, when clicked, lead to a password entry prompt - the correct passwords for all 6 sigils and the first 5 glyphs were discovered via puzzle-solving during Phase 1 of Waking Titan.<br />
<br />
The sigil and glyph puzzles were solved collaboratively - while it may have be possible to solve some of these puzzles individually, most of them required a collaborative effort. For instance, some puzzles required players to meet agents from the Atlas Corporation in person, and to relay information obtained from these meetings back to the community. A list of all sigil and glyph solutions for Phase 1 can be found below:<br />
<br />
[[File:WT Phase 1 complete.png|600px]]<br />
<br />
This phase culminated on July 8, 2017, with a [[Waking_Titan/Phase_1#End_of_Phase_1| congratulatory message from Elizabeth Leighton]], the CEO of the Atlas Foundation.<br />
<br />
=== Phase 2 ===<br />
<br />
[[File:Hampster maze.jpeg|thumbnail|450px|right|One of the puzzles that appeared on the Waking Titan [http://twitch.tv/wakingtitan Twitch Stream]]]<br />
<br />
During [[Waking_Titan/Phase_2 | Phase 2]], the http://wakingtitan.com site hosted a command-line interface terminal. Various commands were accepted as input, which triggered different events. One of the most notable commands was the <code>WHOIS <argument></code> command, which revealed a passage of text pertaining to the specified argument. For instance, the command <code>WHOIS FOURTH RACE</code> returned the following message:<br />
<pre><br />
INCOMING TRANSMISSION… SOURCE: UNKNOWN…<br />
You are not – kzzktt – alone –<br />
Please, identify yourself. I’m – kzzkttk –<br />
</pre><br />
<br />
Additionally, http://project-wt.com hosted a "Calibration" utility during Phase 2. To successfully perform these calibrations, players had to upload images of various objects and buildings to the site. For instance, the first calibration required images of "public resonant percussion instruments".<br />
<br />
Finally, towards the end of Phase 2, the Waking Titan [http://twitch.tv/wakingtitan Twitch stream] went live, displaying a five-monitor setup. Throughout the duration of the stream, players had to work together to solve puzzles that were displayed on these monitors. Some of these puzzles were interactive; for example, one puzzle that was repeated several times involved the Twitch chat guiding a virtual hamster through a maze.<br />
<br />
Additionally, players solved another 3 glyphs throughout Phase 2. The solutions to these glyphs are shown below:<br />
<br />
[[File:WT Phase2 Passwords.png|600px]]<br />
<br />
=== Phase 3 ===<br />
<br />
{{#evt:<br />
service=youtube<br />
|id=https://www.youtube.com/watch?v=QhX9z4dDAa4<br />
|alignment=right<br />
}}<br />
<br />
[[Waking_Titan/Phase_3|Phase 3]] was the briefest phase of Waking Titan. It consisted of the conclusion of the [http://twitch.tv/wakingtitan Twitch stream] that began at the [[Waking Titan/Phase 2#End of Phase 2|end of Phase 2]]. Players solved more interactive puzzles on the Twitch stream, before the rogue AI Loop16 asked them a final question: <code>SHOULD I EXIST?</code> The overwhelming response from the community was "yes".<br />
<br />
After receiving this response, Loop16 and Emily of the ETARC forums were revealed as being one and the same. Loop16 generated a heartfelt "Thank You" video to round out the stream, before finally taking the 72-hour stream offline.<br />
<br />
Shortly after this, players received emails with the subject line <code>Waking Titan has Ended</code>. The contents of the message were as follows:<br />
<br />
<pre><br />
Hello, Citizen Scientist,<br />
<br />
Thank you for your contributions to Waking Titan. The developments that took place during Phase 3 were somewhat concerning, but together we have set in motion truly world-shaping events. We will continue to inform the Citizen Science Division of privileged information or any need for collaborators on a new project.<br />
<br />
But we do have a few loose ends to tie up with you before we move on, so let's proceed.<br />
<br />
First, we're pleased to announce that all 10,000 Level 4 Atlas Passes are in production. Note that due to transit times for mail, some may take several weeks to be delivered.<br />
<br />
Next, our CEO Elizabeth Leighton has asked us to include a personal note of gratitude:<br />
<br />
"Thank you for all your diligent efforts, Citizen Scientists. It's been an amazing journey for all of us. I've watched you thrive and achieve from those first Phase 1 radio ads all the way through the intensity of Phase 3. I've been impressed at every turn by how brilliant you've been, how voracious, how kind, how thoughtful.<br />
<br />
It's been an honor and a privilege. On behalf of the Atlas Foundation, and on behalf of the world, thank you."<br />
The Mercury subroutine has concluded successfully, and a new memo from SM about this process is coming in the next 24 hours. We hope it will answer a few key questions you have about our program, and about what comes next.<br />
</pre><br />
<br />
On August 11, 2017, the [https://www.nomanssky.com/atlas-rises-update/ Atlas Rises update] was released for No Man's Sky.<br />
<br />
=== Phase 4 ===<br />
<br />
[[Waking_Titan/Phase_4 | Phase 4]] of Waking Titan started on 2017-12-28 and is currently ongoing.<br />
<br />
== Connection to No Man's Sky ==<br />
<br />
[[File:9-16-case.png|thumbnail|right|The case that cassette 9/16 was contained in.]]<br />
<br />
At the beginning of the ARG, it was not clear whether Waking Titan was officially connected to No Man's Sky. At first, there were only hints and nudges. At one point, 180 free copies of No Man's Sky were distributed to ARG players. Here's the text of a PDF that was revealed at the end of Phase 1 of Waking Titan:<br />
<br />
<pre><br />
We want to extend our gratitude to everyone who has contributed to the Mercury subroutine so far. <br />
We hope you have enjoyed the successful distribution of 180 Access IDs, and we hope you will also <br />
appreciate the other interesting artifacts we have in store for you going forward. We intend to keep the <br />
process alive until the completion of Project Waking Titan in August. <br />
<br />
It is important to mention that we are very excited by the coming Phases 2 and 3. Input from the Mercury <br />
Subroutine will pave the way toward new experiences in '''version 1.3 of a familiar universe'''. We look forward <br />
to the successful conclusion of this ground-breaking experiment. <br />
<br />
Regards.<br />
S.M.<br />
</pre><br />
<br />
This text explicitly stated that the Waking Titan ARG was leading towards the upcoming 1.3 update for No Man's Sky.<br />
<br />
Some [[Waking_Titan/Console_Commands | console commands]] on the [http://www.wakingtitan.com/ Waking Titan website] during [[Waking_Titan/Phase 2|Phase 2]] refer directly to No Man's Sky lore - for instance, <code>WHOIS ATLAS</code>, <code>WHOIS VY'KEEN</code>, and <code>WHOIS KORVAX</code> are all valid commands. Additionally, some terminal commands referred to a mysterious fourth race, so the prevailing assumption was that the upcoming 1.3 update would bring a fourth race to No Man's Sky.<br />
<br />
At the conclusion of the ARG, an email was sent out to members of the CSD with a [[Waking_Titan/Phase_3#Memo_from_Sean_Murray | memo from Sean Murray]], confirming that the ARG was the lead up to the 1.3 update, which was [https://www.nomanssky.com/atlas-rises-update/ released] after a few days.<br />
<br />
<br />
== Media Appearances ==<br />
<br />
'''5th July 2017''' <br><br />
[EN] [https://www.argn.com/2017/07/stern_words_from_no_mans_sky_arg/ ARGNet - Stern Words from No Man’s Sky ARG]<br />
<br />
'''23rd July 2017''' <br><br />
[EN] [https://geekreply.com/geek-culture/2017/07/23/waking-titan-update-1-phase-2-commences GeekReply - Waking Titan Update 1: Phase 2 Commences!]<br />
<br />
'''27th July 2017''' <br><br />
[EN] [https://geekreply.com/editorials/2017/07/27/waking-titan-arg-can-bring-people-together GeekReply - Waking Titan: How An ARG can Bring People Together.]<br />
<br />
'''8th August 2017''' <br><br />
[EN] [https://www.dailystar.co.uk/tech/gaming/635697/No-Man-s-Sky-News-Waking-Titan-Reddit-Arg-1-3-update-release-date/ Dailystar - No Man's Sky News: Waking Titan Reddit Arg REVEALS 1.3 update ahead of release date]<br />
<br />
'''9th August 2017''' <br><br />
[EN] [https://arstechnica.com/gaming/2017/08/no-mans-sky-version-1-3-lands-this-week-for-free-adds-quick-travel-portals/ Ars Technica - No Man’s Sky version 1.3 lands this week for free, adds “quick-travel” portals]<br />
<br />
[EN] [https://www.forbes.com/sites/insertcoin/2017/08/09/no-mans-sky-is-patching-in-a-story-this-week-a-year-after-launch/#19fb5a285282 Forbes - 'No Man's Sky' Is Patching In A Story This Week, A Year After Launch]<br />
<br />
[EN] [https://www.gamespew.com/2017/08/no-mans-sky-patch-week-improving-central-story/ GameSpew - No Man's Sky Patch This Week Improving Its Story]<br />
<br />
'''19th January 2018''' <br><br />
[EN] [http://www.eurogamer.net/articles/2018-01-18-no-mans-skys-waking-titan-arg-is-back-and-fans-are-trying-to-figure-out-what-it-all-means Eurogamer - No Man's Sky's Waking Titan ARG is back, and fans are trying to figure it all out again]<br />
<br />
[RU] [https://dtf.ru/category/nmsarg/ DTF - A Collection of No Man's Sky and Waking Titan Articles.]<br />
<br />
== Other Information ==<br />
<br />
{| class="wikitable"<br />
!colspan="2"|[[:Category:Waking Titan| Waking Titan Miscellaneous Subpages]]<br />
|-<br />
|[[Waking_Titan/Cassettes | Cassettes]]<br />
|Information about the cassette tapes received by No Man's Sky subreddit moderators<br />
|-<br />
|[[Waking_Titan/Stations | Stations]]<br />
|Information on the radio stations from the initial project-wt.com site<br />
|-<br />
|[[Waking_Titan/Companies | Company Archives]]<br />
|An archive of company details.<br />
|}<br />
<br />
[[Category:Waking Titan]]</div>Kkzzzkthttps://wiki.gamedetectives.net/index.php?title=Waking_Titan&diff=15900Waking Titan2018-06-27T20:56:33Z<p>Kkzzzkt: added inyourmind pdf</p>
<hr />
<div>{{argbox<br />
| float = right<br />
| image = File:Project WT logo.png<br />
| name = [[Waking Titan]]<br />
| description= Waking Titan was an ARG which led towards the No Man's Sky [https://www.nomanssky.com/atlas-rises-update/ Atlas Rises update].<br />
| creator = [http://www.aliceandsmith.com/ Alice & Smith]<br />
| creator2 = [http://www.hellogames.org/ Hello Games]<br />
| type = Official<br />
| status = Active<br />
| discovered = 2017-05-28<br />
}}<br />
{{ArgHeader}}<br />
{{BackToTop}}<br />
<br />
=== Description ===<br />
Waking Titan (also known as Project WT) is an ARG (alternate reality game) that involves a multitude of websites, phone numbers, and radio stations scattered across the world. The ARG is produced by veteran puppet masters [http://www.aliceandsmith.com/ Alice & Smith], and features NPCs, actors, and live events.<br />
<br />
Of the sci-fi genre, its story—linked to the origin of No Man's Sky—follows a powerful A.I known as Loop16 that is created by [https://wiki.gamedetectives.net/index.php?title=Waking_Titan/Characters The Atlas Foundation] to simulate a one-to-one recreation of reality that can accurately predict the future.<br />
<br />
=== Contents ===<br />
The ARG encompassed several "seasons," each leading to a new update for No Man's Sky. Season 1 of Waking Titan led to the [https://www.nomanssky.com/atlas-rises-update/ Atlas Rises update] and Season 2 is leading to [https://www.nomanssky.com/2018/03/no-mans-sky-next/ No Man's Sky: NEXT]. Season 1 was further divided into several distinct "'''phases'''", and Season 2 has followed this convention for ease of reading. Each phase is documented on its own wiki page:<br />
<br />
{| class="wikitable"<br />
!colspan="2"|Season 1<br />
|-<br />
|[[Waking_Titan/Phase_1 | Phase 1]] <br />
|Phase 1 of Waking Titan lasted from 2017-05-28 to 2017-07-08.<br />
|-<br />
|[[Waking_Titan/Phase_2 | Phase 2]] <br />
|Phase 2 of Waking Titan lasted from 2017-07-21 to 2017-08-05.<br />
|-<br />
|[[Waking_Titan/Phase_3 | Phase 3]]<br />
|Phase 3 of Waking Titan lasted from 2017-08-05 to 2017-08-07.<br />
|-<br />
!colspan="2"|Season 2<br />
|-<br />
|[[Waking_Titan/Phase_4 | Phase 4]]<br />
|Phase 4 of Waking Titan started on 2017-12-28 and is currently ongoing.<br />
|}<br />
<br />
'''''Note:''' This is a '''summary''' page. For more in-depth descriptions of each phase, including detailed descriptions of puzzle solutions, check the [[Waking_Titan/Phase_1|Phase 1]], [[Waking_Titan/Phase_2|Phase 2]], [[Waking_Titan/Phase_3 | Phase 3]] and [[Waking_Titan/Phase_4 | Phase 4]] pages.''<br />
__TOC__<br />
<br />
<br />
<br />
== Story Overview ==<br />
<br />
=== Internal Memos ===<br />
<br />
[[File:WT glyph 1 pdf.png|280px|thumbnail|right|One of the internal memos discovered in Waking Titan]]<br />
<br />
Throughout the ARG, in-game characters have communicated with each other via "internal memos". Over time, these memos were discovered by ARG players, in the form of PDF files. These memos provided lore content and puzzle content, and are '''highly recommended''' reading for new players!<br />
<br />
'''Season 1'''<br />
<br />
* [http://wiki.gamedetectives.net/index.php?title=File:WT_glyph_1_pdf.png Teamwork Assessment]<br />
* [http://wiki.gamedetectives.net/index.php?title=File:WT-Dataset-97C.jpg Dataset 97C]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/data/7d3dd080-2a43-4882-833c-f4d7bd7ba607.pdf Assurance]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/data/c01-331c6734-a013-4695-8e47-08a9ee05d5e5.pdf 017-a24]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/data/c02-9936c797-ec28-4f8f-b80e-dee9e0b06433.pdf 021-f16]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/mercury/mercury-01-98748sfdlka87.pdf Mercury Process Self-Diagnosis Report]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/data/57201e0d-01a3-4f6a-bbb4-2be8b7c8880f.pdf Progress Report]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/6c285180-ec4d-48a2-967f-8a7af3b50008.pdf Subject M-N00-dl35]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/410a3e5d-01e7-4058-a23c-ca5fdde97f9d.pdf Atlas Foundation Threat Models]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/7a6594ac-ca5e-467a-b6f4-9fb91f069d0a.pdf Advanced Calibration - Optional]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/a224a1f4-00e5-467b-9893-83fcc1a4f19a.pdf Unlocking Mercury Process File L16.jpg]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/b91f9959-6a3c-4011-b3b5-a1ff757a5e4c.pdf Phase 3]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/b0f33d53-5a8c-4a9a-b5fc-395562e463a8a+.pdf Log.1291]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/a09-179bf8d2-c13e-4c66-982e-b37ab3efd5bb.pdf Breach of Contract]<br />
<br />
'''Season 2'''<br />
<br />
* [https://wiki.gamedetectives.net/images/6/6e/Memo2.png Waking Titan S2 - Under Preparation]<br />
* [https://drive.google.com/open?id=1la3UNKHc5yeaB_w2a2tK1cjKN44oEmCo Arnaud Lacours Datadumps - INYOURMIND.exe failed]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/94c02878-e023-46a3-9316-db4177c4eaa6+.pdf WARE REPORT #26]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/1cd5226d-6639-4bbd-855a-4bf8f60866c3.pdf Concerns Regarding Captain Harry]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/70a25e6c-95ed-42d4-8de8-c3948255174c+.pdf Myriad Crisis Event Timeline]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/19997bb6-18e5-4427-86c7-b0f3c1826ca2.pdf State of The Atlas Foundation]<br />
* [https://pastebin.com/NYLiFuNY Log.3022]<br />
<br />
* '''W/ARE Sacramento Screening Reports''' - [https://s3.amazonaws.com/ware-virtual-dashboard/files/Phillip-PatientFile.pdf Phillip Moretti]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/EunHa-PatientFile.pdf Kwon Eun Ha]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/498hd98h3444-3339e/Alexander-PatientFile.pdf Alexander Bordeleau]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/GCMnQmM9E3v7L8wuv-V2FUY7P/Claire-PatientFile.pdf Claire Sandfield]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/kh2jsaljs901m-asd1n1lwks/Tariq-PatientFile.pdf Tariq]<br />
<br />
=== Subpages ===<br />
<br />
Navigating through the following subpages is recommended for newcomers wanting to get a grasp of Waking Titan's rapidly expanding story.<br />
<br />
{| class="wikitable"<br />
!colspan="2"|[[:Category:Waking Titan| Story Subpages]]<br />
|-<br />
|[[Waking_Titan/Characters| Character Summaries]]<br />
|Includes a summary of each character, company, and relating experiments and their importance in the Waking Titan story.<br />
|-<br />
|[[Waking_Titan/Console_Commands | Console Commands]]<br />
|A list of commands used by players at the [http://wakingtitan.com Waking Titan console]<br />
|}<br />
<br />
=== Music ===<br />
<br />
Partial video addresses for Youtube can be found scattered across Waking Titan PDFs, website files, and surveys; which all lead to music. The exact reasoning for this has gone unexplained. However, there are thematic relevancies in each song that appear to reflect on the state of the story. A playlist containing all songs linked in Waking Titan can be found here ''in order of earliest to most recent'' ... [https://www.youtube.com/playlist?list=PLEZy8wyuYLpLw0e5kkMyBUHO_s-V8f0Qk >>>>>]<br />
<br />
== Event Summaries ==<br />
<br />
=== Introduction ===<br />
<br />
On 2017-05-27, Twitter user @argn [https://twitter.com/argn/status/868587449613766658 tweeted a link] to [http://www.project-wt.com/ 'project-wt.com']. The link led to a website which contained a map showing sixty locations, four of which were "active" at the time. The locations, when clicked on, revealed the location's name and status. The active locations also revealed a link to a livestream of a local radio station, originating from the corresponding location. The project-wt website displayed a date, June 8th, and stated that the first clue was being "initialized".<br />
<br />
On 2017-06-01, moderators of No Man's Sky subreddits [https://reddit.com/r/nomansskythegame /r/NoMansSkyTheGame], [https://www.reddit.com/r/NMSPortals/ /r/NMSPortals], and [https://www.reddit.com/r/NMSGalacticHub/ /r/NMSGalacticHub] started to receive cassette tapes in the mail. Each cassette tape was labelled with a number out of 16. The Waking Titan ARG was initially thought to be a separate ARG from these tapes, but connections between the two made it clear that they were, in fact, one and the same.<br />
<br />
=== Phase 1 ===<br />
<br />
[[File:Wakingtitan site.png|thumbnail|450px|right|The default appearance of the Waking Titan site during Phase 1, with no sigils or glyphs solved]]<br />
<br />
During [[Waking_Titan/Phase_1 | Phase 1]], the http://wakingtitan.com hosted 6 triangles in the middle of the page. These triangles were referred to as "'''Sigils'''", while the white icons along the bottom of the page were referred to as "'''Glyphs'''". Each sigil and glyph, when clicked, lead to a password entry prompt - the correct passwords for all 6 sigils and the first 5 glyphs were discovered via puzzle-solving during Phase 1 of Waking Titan.<br />
<br />
The sigil and glyph puzzles were solved collaboratively - while it may have be possible to solve some of these puzzles individually, most of them required a collaborative effort. For instance, some puzzles required players to meet agents from the Atlas Corporation in person, and to relay information obtained from these meetings back to the community. A list of all sigil and glyph solutions for Phase 1 can be found below:<br />
<br />
[[File:WT Phase 1 complete.png|600px]]<br />
<br />
This phase culminated on July 8, 2017, with a [[Waking_Titan/Phase_1#End_of_Phase_1| congratulatory message from Elizabeth Leighton]], the CEO of the Atlas Foundation.<br />
<br />
=== Phase 2 ===<br />
<br />
[[File:Hampster maze.jpeg|thumbnail|450px|right|One of the puzzles that appeared on the Waking Titan [http://twitch.tv/wakingtitan Twitch Stream]]]<br />
<br />
During [[Waking_Titan/Phase_2 | Phase 2]], the http://wakingtitan.com site hosted a command-line interface terminal. Various commands were accepted as input, which triggered different events. One of the most notable commands was the <code>WHOIS <argument></code> command, which revealed a passage of text pertaining to the specified argument. For instance, the command <code>WHOIS FOURTH RACE</code> returned the following message:<br />
<pre><br />
INCOMING TRANSMISSION… SOURCE: UNKNOWN…<br />
You are not – kzzktt – alone –<br />
Please, identify yourself. I’m – kzzkttk –<br />
</pre><br />
<br />
Additionally, http://project-wt.com hosted a "Calibration" utility during Phase 2. To successfully perform these calibrations, players had to upload images of various objects and buildings to the site. For instance, the first calibration required images of "public resonant percussion instruments".<br />
<br />
Finally, towards the end of Phase 2, the Waking Titan [http://twitch.tv/wakingtitan Twitch stream] went live, displaying a five-monitor setup. Throughout the duration of the stream, players had to work together to solve puzzles that were displayed on these monitors. Some of these puzzles were interactive; for example, one puzzle that was repeated several times involved the Twitch chat guiding a virtual hamster through a maze.<br />
<br />
Additionally, players solved another 3 glyphs throughout Phase 2. The solutions to these glyphs are shown below:<br />
<br />
[[File:WT Phase2 Passwords.png|600px]]<br />
<br />
=== Phase 3 ===<br />
<br />
{{#evt:<br />
service=youtube<br />
|id=https://www.youtube.com/watch?v=QhX9z4dDAa4<br />
|alignment=right<br />
}}<br />
<br />
[[Waking_Titan/Phase_3|Phase 3]] was the briefest phase of Waking Titan. It consisted of the conclusion of the [http://twitch.tv/wakingtitan Twitch stream] that began at the [[Waking Titan/Phase 2#End of Phase 2|end of Phase 2]]. Players solved more interactive puzzles on the Twitch stream, before the rogue AI Loop16 asked them a final question: <code>SHOULD I EXIST?</code> The overwhelming response from the community was "yes".<br />
<br />
After receiving this response, Loop16 and Emily of the ETARC forums were revealed as being one and the same. Loop16 generated a heartfelt "Thank You" video to round out the stream, before finally taking the 72-hour stream offline.<br />
<br />
Shortly after this, players received emails with the subject line <code>Waking Titan has Ended</code>. The contents of the message were as follows:<br />
<br />
<pre><br />
Hello, Citizen Scientist,<br />
<br />
Thank you for your contributions to Waking Titan. The developments that took place during Phase 3 were somewhat concerning, but together we have set in motion truly world-shaping events. We will continue to inform the Citizen Science Division of privileged information or any need for collaborators on a new project.<br />
<br />
But we do have a few loose ends to tie up with you before we move on, so let's proceed.<br />
<br />
First, we're pleased to announce that all 10,000 Level 4 Atlas Passes are in production. Note that due to transit times for mail, some may take several weeks to be delivered.<br />
<br />
Next, our CEO Elizabeth Leighton has asked us to include a personal note of gratitude:<br />
<br />
"Thank you for all your diligent efforts, Citizen Scientists. It's been an amazing journey for all of us. I've watched you thrive and achieve from those first Phase 1 radio ads all the way through the intensity of Phase 3. I've been impressed at every turn by how brilliant you've been, how voracious, how kind, how thoughtful.<br />
<br />
It's been an honor and a privilege. On behalf of the Atlas Foundation, and on behalf of the world, thank you."<br />
The Mercury subroutine has concluded successfully, and a new memo from SM about this process is coming in the next 24 hours. We hope it will answer a few key questions you have about our program, and about what comes next.<br />
</pre><br />
<br />
On August 11, 2017, the [https://www.nomanssky.com/atlas-rises-update/ Atlas Rises update] was released for No Man's Sky.<br />
<br />
=== Phase 4 ===<br />
<br />
[[Waking_Titan/Phase_4 | Phase 4]] of Waking Titan started on 2017-12-28 and is currently ongoing.<br />
<br />
== Connection to No Man's Sky ==<br />
<br />
[[File:9-16-case.png|thumbnail|right|The case that cassette 9/16 was contained in.]]<br />
<br />
At the beginning of the ARG, it was not clear whether Waking Titan was officially connected to No Man's Sky. At first, there were only hints and nudges. At one point, 180 free copies of No Man's Sky were distributed to ARG players. Here's the text of a PDF that was revealed at the end of Phase 1 of Waking Titan:<br />
<br />
<pre><br />
We want to extend our gratitude to everyone who has contributed to the Mercury subroutine so far. <br />
We hope you have enjoyed the successful distribution of 180 Access IDs, and we hope you will also <br />
appreciate the other interesting artifacts we have in store for you going forward. We intend to keep the <br />
process alive until the completion of Project Waking Titan in August. <br />
<br />
It is important to mention that we are very excited by the coming Phases 2 and 3. Input from the Mercury <br />
Subroutine will pave the way toward new experiences in '''version 1.3 of a familiar universe'''. We look forward <br />
to the successful conclusion of this ground-breaking experiment. <br />
<br />
Regards.<br />
S.M.<br />
</pre><br />
<br />
This text explicitly stated that the Waking Titan ARG was leading towards the upcoming 1.3 update for No Man's Sky.<br />
<br />
Some [[Waking_Titan/Console_Commands | console commands]] on the [http://www.wakingtitan.com/ Waking Titan website] during [[Waking_Titan/Phase 2|Phase 2]] refer directly to No Man's Sky lore - for instance, <code>WHOIS ATLAS</code>, <code>WHOIS VY'KEEN</code>, and <code>WHOIS KORVAX</code> are all valid commands. Additionally, some terminal commands referred to a mysterious fourth race, so the prevailing assumption was that the upcoming 1.3 update would bring a fourth race to No Man's Sky.<br />
<br />
At the conclusion of the ARG, an email was sent out to members of the CSD with a [[Waking_Titan/Phase_3#Memo_from_Sean_Murray | memo from Sean Murray]], confirming that the ARG was the lead up to the 1.3 update, which was [https://www.nomanssky.com/atlas-rises-update/ released] after a few days.<br />
<br />
<br />
== Media Appearances ==<br />
<br />
'''5th July 2017''' <br><br />
[EN] [https://www.argn.com/2017/07/stern_words_from_no_mans_sky_arg/ ARGNet - Stern Words from No Man’s Sky ARG]<br />
<br />
'''23rd July 2017''' <br><br />
[EN] [https://geekreply.com/geek-culture/2017/07/23/waking-titan-update-1-phase-2-commences GeekReply - Waking Titan Update 1: Phase 2 Commences!]<br />
<br />
'''27th July 2017''' <br><br />
[EN] [https://geekreply.com/editorials/2017/07/27/waking-titan-arg-can-bring-people-together GeekReply - Waking Titan: How An ARG can Bring People Together.]<br />
<br />
'''8th August 2017''' <br><br />
[EN] [https://www.dailystar.co.uk/tech/gaming/635697/No-Man-s-Sky-News-Waking-Titan-Reddit-Arg-1-3-update-release-date/ Dailystar - No Man's Sky News: Waking Titan Reddit Arg REVEALS 1.3 update ahead of release date]<br />
<br />
'''9th August 2017''' <br><br />
[EN] [https://arstechnica.com/gaming/2017/08/no-mans-sky-version-1-3-lands-this-week-for-free-adds-quick-travel-portals/ Ars Technica - No Man’s Sky version 1.3 lands this week for free, adds “quick-travel” portals]<br />
<br />
[EN] [https://www.forbes.com/sites/insertcoin/2017/08/09/no-mans-sky-is-patching-in-a-story-this-week-a-year-after-launch/#19fb5a285282 Forbes - 'No Man's Sky' Is Patching In A Story This Week, A Year After Launch]<br />
<br />
[EN] [https://www.gamespew.com/2017/08/no-mans-sky-patch-week-improving-central-story/ GameSpew - No Man's Sky Patch This Week Improving Its Story]<br />
<br />
'''19th January 2018''' <br><br />
[EN] [http://www.eurogamer.net/articles/2018-01-18-no-mans-skys-waking-titan-arg-is-back-and-fans-are-trying-to-figure-out-what-it-all-means Eurogamer - No Man's Sky's Waking Titan ARG is back, and fans are trying to figure it all out again]<br />
<br />
[RU] [https://dtf.ru/category/nmsarg/ DTF - A Collection of No Man's Sky and Waking Titan Articles.]<br />
<br />
== Other Information ==<br />
<br />
{| class="wikitable"<br />
!colspan="2"|[[:Category:Waking Titan| Waking Titan Miscellaneous Subpages]]<br />
|-<br />
|[[Waking_Titan/Cassettes | Cassettes]]<br />
|Information about the cassette tapes received by No Man's Sky subreddit moderators<br />
|-<br />
|[[Waking_Titan/Stations | Stations]]<br />
|Information on the radio stations from the initial project-wt.com site<br />
|-<br />
|[[Waking_Titan/Companies | Company Archives]]<br />
|An archive of company details.<br />
|}<br />
<br />
[[Category:Waking Titan]]</div>Kkzzzkthttps://wiki.gamedetectives.net/index.php?title=Waking_Titan&diff=15899Waking Titan2018-06-27T15:53:59Z<p>Kkzzzkt: added w/are screening reports seeing as they are becoming more integral to the plot</p>
<hr />
<div>{{argbox<br />
| float = right<br />
| image = File:Project WT logo.png<br />
| name = [[Waking Titan]]<br />
| description= Waking Titan was an ARG which led towards the No Man's Sky [https://www.nomanssky.com/atlas-rises-update/ Atlas Rises update].<br />
| creator = [http://www.aliceandsmith.com/ Alice & Smith]<br />
| creator2 = [http://www.hellogames.org/ Hello Games]<br />
| type = Official<br />
| status = Active<br />
| discovered = 2017-05-28<br />
}}<br />
{{ArgHeader}}<br />
{{BackToTop}}<br />
<br />
=== Description ===<br />
Waking Titan (also known as Project WT) is an ARG (alternate reality game) that involves a multitude of websites, phone numbers, and radio stations scattered across the world. The ARG is produced by veteran puppet masters [http://www.aliceandsmith.com/ Alice & Smith], and features NPCs, actors, and live events.<br />
<br />
Of the sci-fi genre, its story—linked to the origin of No Man's Sky—follows a powerful A.I known as Loop16 that is created by [https://wiki.gamedetectives.net/index.php?title=Waking_Titan/Characters The Atlas Foundation] to simulate a one-to-one recreation of reality that can accurately predict the future.<br />
<br />
=== Contents ===<br />
The ARG encompassed several "seasons," each leading to a new update for No Man's Sky. Season 1 of Waking Titan led to the [https://www.nomanssky.com/atlas-rises-update/ Atlas Rises update] and Season 2 is leading to [https://www.nomanssky.com/2018/03/no-mans-sky-next/ No Man's Sky: NEXT]. Season 1 was further divided into several distinct "'''phases'''", and Season 2 has followed this convention for ease of reading. Each phase is documented on its own wiki page:<br />
<br />
{| class="wikitable"<br />
!colspan="2"|Season 1<br />
|-<br />
|[[Waking_Titan/Phase_1 | Phase 1]] <br />
|Phase 1 of Waking Titan lasted from 2017-05-28 to 2017-07-08.<br />
|-<br />
|[[Waking_Titan/Phase_2 | Phase 2]] <br />
|Phase 2 of Waking Titan lasted from 2017-07-21 to 2017-08-05.<br />
|-<br />
|[[Waking_Titan/Phase_3 | Phase 3]]<br />
|Phase 3 of Waking Titan lasted from 2017-08-05 to 2017-08-07.<br />
|-<br />
!colspan="2"|Season 2<br />
|-<br />
|[[Waking_Titan/Phase_4 | Phase 4]]<br />
|Phase 4 of Waking Titan started on 2017-12-28 and is currently ongoing.<br />
|}<br />
<br />
'''''Note:''' This is a '''summary''' page. For more in-depth descriptions of each phase, including detailed descriptions of puzzle solutions, check the [[Waking_Titan/Phase_1|Phase 1]], [[Waking_Titan/Phase_2|Phase 2]], [[Waking_Titan/Phase_3 | Phase 3]] and [[Waking_Titan/Phase_4 | Phase 4]] pages.''<br />
__TOC__<br />
<br />
<br />
<br />
== Story Overview ==<br />
<br />
=== Internal Memos ===<br />
<br />
[[File:WT glyph 1 pdf.png|280px|thumbnail|right|One of the internal memos discovered in Waking Titan]]<br />
<br />
Throughout the ARG, in-game characters have communicated with each other via "internal memos". Over time, these memos were discovered by ARG players, in the form of PDF files. These memos provided lore content and puzzle content, and are '''highly recommended''' reading for new players!<br />
<br />
'''Season 1'''<br />
<br />
* [http://wiki.gamedetectives.net/index.php?title=File:WT_glyph_1_pdf.png Teamwork Assessment]<br />
* [http://wiki.gamedetectives.net/index.php?title=File:WT-Dataset-97C.jpg Dataset 97C]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/data/7d3dd080-2a43-4882-833c-f4d7bd7ba607.pdf Assurance]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/data/c01-331c6734-a013-4695-8e47-08a9ee05d5e5.pdf 017-a24]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/data/c02-9936c797-ec28-4f8f-b80e-dee9e0b06433.pdf 021-f16]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/mercury/mercury-01-98748sfdlka87.pdf Mercury Process Self-Diagnosis Report]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/data/57201e0d-01a3-4f6a-bbb4-2be8b7c8880f.pdf Progress Report]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/6c285180-ec4d-48a2-967f-8a7af3b50008.pdf Subject M-N00-dl35]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/410a3e5d-01e7-4058-a23c-ca5fdde97f9d.pdf Atlas Foundation Threat Models]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/7a6594ac-ca5e-467a-b6f4-9fb91f069d0a.pdf Advanced Calibration - Optional]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/a224a1f4-00e5-467b-9893-83fcc1a4f19a.pdf Unlocking Mercury Process File L16.jpg]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/b91f9959-6a3c-4011-b3b5-a1ff757a5e4c.pdf Phase 3]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/b0f33d53-5a8c-4a9a-b5fc-395562e463a8a+.pdf Log.1291]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/a09-179bf8d2-c13e-4c66-982e-b37ab3efd5bb.pdf Breach of Contract]<br />
<br />
'''Season 2'''<br />
<br />
* [https://wiki.gamedetectives.net/images/6/6e/Memo2.png Waking Titan S2 - Under Preparation]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/94c02878-e023-46a3-9316-db4177c4eaa6+.pdf WARE REPORT #26]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/1cd5226d-6639-4bbd-855a-4bf8f60866c3.pdf Concerns Regarding Captain Harry]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/70a25e6c-95ed-42d4-8de8-c3948255174c+.pdf Myriad Crisis Event Timeline]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/19997bb6-18e5-4427-86c7-b0f3c1826ca2.pdf State of The Atlas Foundation]<br />
* [https://pastebin.com/NYLiFuNY Log.3022]<br />
<br />
* '''W/ARE Sacramento Screening Reports''' - [https://s3.amazonaws.com/ware-virtual-dashboard/files/Phillip-PatientFile.pdf Phillip Moretti]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/EunHa-PatientFile.pdf Kwon Eun Ha]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/498hd98h3444-3339e/Alexander-PatientFile.pdf Alexander Bordeleau]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/GCMnQmM9E3v7L8wuv-V2FUY7P/Claire-PatientFile.pdf Claire Sandfield]; [https://s3.amazonaws.com/ware-virtual-dashboard/files/kh2jsaljs901m-asd1n1lwks/Tariq-PatientFile.pdf Tariq]<br />
<br />
=== Subpages ===<br />
<br />
Navigating through the following subpages is recommended for newcomers wanting to get a grasp of Waking Titan's rapidly expanding story.<br />
<br />
{| class="wikitable"<br />
!colspan="2"|[[:Category:Waking Titan| Story Subpages]]<br />
|-<br />
|[[Waking_Titan/Characters| Character Summaries]]<br />
|Includes a summary of each character, company, and relating experiments and their importance in the Waking Titan story.<br />
|-<br />
|[[Waking_Titan/Console_Commands | Console Commands]]<br />
|A list of commands used by players at the [http://wakingtitan.com Waking Titan console]<br />
|}<br />
<br />
=== Music ===<br />
<br />
Partial video addresses for Youtube can be found scattered across Waking Titan PDFs, website files, and surveys; which all lead to music. The exact reasoning for this has gone unexplained. However, there are thematic relevancies in each song that appear to reflect on the state of the story. A playlist containing all songs linked in Waking Titan can be found here ''in order of earliest to most recent'' ... [https://www.youtube.com/playlist?list=PLEZy8wyuYLpLw0e5kkMyBUHO_s-V8f0Qk >>>>>]<br />
<br />
== Event Summaries ==<br />
<br />
=== Introduction ===<br />
<br />
On 2017-05-27, Twitter user @argn [https://twitter.com/argn/status/868587449613766658 tweeted a link] to [http://www.project-wt.com/ 'project-wt.com']. The link led to a website which contained a map showing sixty locations, four of which were "active" at the time. The locations, when clicked on, revealed the location's name and status. The active locations also revealed a link to a livestream of a local radio station, originating from the corresponding location. The project-wt website displayed a date, June 8th, and stated that the first clue was being "initialized".<br />
<br />
On 2017-06-01, moderators of No Man's Sky subreddits [https://reddit.com/r/nomansskythegame /r/NoMansSkyTheGame], [https://www.reddit.com/r/NMSPortals/ /r/NMSPortals], and [https://www.reddit.com/r/NMSGalacticHub/ /r/NMSGalacticHub] started to receive cassette tapes in the mail. Each cassette tape was labelled with a number out of 16. The Waking Titan ARG was initially thought to be a separate ARG from these tapes, but connections between the two made it clear that they were, in fact, one and the same.<br />
<br />
=== Phase 1 ===<br />
<br />
[[File:Wakingtitan site.png|thumbnail|450px|right|The default appearance of the Waking Titan site during Phase 1, with no sigils or glyphs solved]]<br />
<br />
During [[Waking_Titan/Phase_1 | Phase 1]], the http://wakingtitan.com hosted 6 triangles in the middle of the page. These triangles were referred to as "'''Sigils'''", while the white icons along the bottom of the page were referred to as "'''Glyphs'''". Each sigil and glyph, when clicked, lead to a password entry prompt - the correct passwords for all 6 sigils and the first 5 glyphs were discovered via puzzle-solving during Phase 1 of Waking Titan.<br />
<br />
The sigil and glyph puzzles were solved collaboratively - while it may have be possible to solve some of these puzzles individually, most of them required a collaborative effort. For instance, some puzzles required players to meet agents from the Atlas Corporation in person, and to relay information obtained from these meetings back to the community. A list of all sigil and glyph solutions for Phase 1 can be found below:<br />
<br />
[[File:WT Phase 1 complete.png|600px]]<br />
<br />
This phase culminated on July 8, 2017, with a [[Waking_Titan/Phase_1#End_of_Phase_1| congratulatory message from Elizabeth Leighton]], the CEO of the Atlas Foundation.<br />
<br />
=== Phase 2 ===<br />
<br />
[[File:Hampster maze.jpeg|thumbnail|450px|right|One of the puzzles that appeared on the Waking Titan [http://twitch.tv/wakingtitan Twitch Stream]]]<br />
<br />
During [[Waking_Titan/Phase_2 | Phase 2]], the http://wakingtitan.com site hosted a command-line interface terminal. Various commands were accepted as input, which triggered different events. One of the most notable commands was the <code>WHOIS <argument></code> command, which revealed a passage of text pertaining to the specified argument. For instance, the command <code>WHOIS FOURTH RACE</code> returned the following message:<br />
<pre><br />
INCOMING TRANSMISSION… SOURCE: UNKNOWN…<br />
You are not – kzzktt – alone –<br />
Please, identify yourself. I’m – kzzkttk –<br />
</pre><br />
<br />
Additionally, http://project-wt.com hosted a "Calibration" utility during Phase 2. To successfully perform these calibrations, players had to upload images of various objects and buildings to the site. For instance, the first calibration required images of "public resonant percussion instruments".<br />
<br />
Finally, towards the end of Phase 2, the Waking Titan [http://twitch.tv/wakingtitan Twitch stream] went live, displaying a five-monitor setup. Throughout the duration of the stream, players had to work together to solve puzzles that were displayed on these monitors. Some of these puzzles were interactive; for example, one puzzle that was repeated several times involved the Twitch chat guiding a virtual hamster through a maze.<br />
<br />
Additionally, players solved another 3 glyphs throughout Phase 2. The solutions to these glyphs are shown below:<br />
<br />
[[File:WT Phase2 Passwords.png|600px]]<br />
<br />
=== Phase 3 ===<br />
<br />
{{#evt:<br />
service=youtube<br />
|id=https://www.youtube.com/watch?v=QhX9z4dDAa4<br />
|alignment=right<br />
}}<br />
<br />
[[Waking_Titan/Phase_3|Phase 3]] was the briefest phase of Waking Titan. It consisted of the conclusion of the [http://twitch.tv/wakingtitan Twitch stream] that began at the [[Waking Titan/Phase 2#End of Phase 2|end of Phase 2]]. Players solved more interactive puzzles on the Twitch stream, before the rogue AI Loop16 asked them a final question: <code>SHOULD I EXIST?</code> The overwhelming response from the community was "yes".<br />
<br />
After receiving this response, Loop16 and Emily of the ETARC forums were revealed as being one and the same. Loop16 generated a heartfelt "Thank You" video to round out the stream, before finally taking the 72-hour stream offline.<br />
<br />
Shortly after this, players received emails with the subject line <code>Waking Titan has Ended</code>. The contents of the message were as follows:<br />
<br />
<pre><br />
Hello, Citizen Scientist,<br />
<br />
Thank you for your contributions to Waking Titan. The developments that took place during Phase 3 were somewhat concerning, but together we have set in motion truly world-shaping events. We will continue to inform the Citizen Science Division of privileged information or any need for collaborators on a new project.<br />
<br />
But we do have a few loose ends to tie up with you before we move on, so let's proceed.<br />
<br />
First, we're pleased to announce that all 10,000 Level 4 Atlas Passes are in production. Note that due to transit times for mail, some may take several weeks to be delivered.<br />
<br />
Next, our CEO Elizabeth Leighton has asked us to include a personal note of gratitude:<br />
<br />
"Thank you for all your diligent efforts, Citizen Scientists. It's been an amazing journey for all of us. I've watched you thrive and achieve from those first Phase 1 radio ads all the way through the intensity of Phase 3. I've been impressed at every turn by how brilliant you've been, how voracious, how kind, how thoughtful.<br />
<br />
It's been an honor and a privilege. On behalf of the Atlas Foundation, and on behalf of the world, thank you."<br />
The Mercury subroutine has concluded successfully, and a new memo from SM about this process is coming in the next 24 hours. We hope it will answer a few key questions you have about our program, and about what comes next.<br />
</pre><br />
<br />
On August 11, 2017, the [https://www.nomanssky.com/atlas-rises-update/ Atlas Rises update] was released for No Man's Sky.<br />
<br />
=== Phase 4 ===<br />
<br />
[[Waking_Titan/Phase_4 | Phase 4]] of Waking Titan started on 2017-12-28 and is currently ongoing.<br />
<br />
== Connection to No Man's Sky ==<br />
<br />
[[File:9-16-case.png|thumbnail|right|The case that cassette 9/16 was contained in.]]<br />
<br />
At the beginning of the ARG, it was not clear whether Waking Titan was officially connected to No Man's Sky. At first, there were only hints and nudges. At one point, 180 free copies of No Man's Sky were distributed to ARG players. Here's the text of a PDF that was revealed at the end of Phase 1 of Waking Titan:<br />
<br />
<pre><br />
We want to extend our gratitude to everyone who has contributed to the Mercury subroutine so far. <br />
We hope you have enjoyed the successful distribution of 180 Access IDs, and we hope you will also <br />
appreciate the other interesting artifacts we have in store for you going forward. We intend to keep the <br />
process alive until the completion of Project Waking Titan in August. <br />
<br />
It is important to mention that we are very excited by the coming Phases 2 and 3. Input from the Mercury <br />
Subroutine will pave the way toward new experiences in '''version 1.3 of a familiar universe'''. We look forward <br />
to the successful conclusion of this ground-breaking experiment. <br />
<br />
Regards.<br />
S.M.<br />
</pre><br />
<br />
This text explicitly stated that the Waking Titan ARG was leading towards the upcoming 1.3 update for No Man's Sky.<br />
<br />
Some [[Waking_Titan/Console_Commands | console commands]] on the [http://www.wakingtitan.com/ Waking Titan website] during [[Waking_Titan/Phase 2|Phase 2]] refer directly to No Man's Sky lore - for instance, <code>WHOIS ATLAS</code>, <code>WHOIS VY'KEEN</code>, and <code>WHOIS KORVAX</code> are all valid commands. Additionally, some terminal commands referred to a mysterious fourth race, so the prevailing assumption was that the upcoming 1.3 update would bring a fourth race to No Man's Sky.<br />
<br />
At the conclusion of the ARG, an email was sent out to members of the CSD with a [[Waking_Titan/Phase_3#Memo_from_Sean_Murray | memo from Sean Murray]], confirming that the ARG was the lead up to the 1.3 update, which was [https://www.nomanssky.com/atlas-rises-update/ released] after a few days.<br />
<br />
<br />
== Media Appearances ==<br />
<br />
'''5th July 2017''' <br><br />
[EN] [https://www.argn.com/2017/07/stern_words_from_no_mans_sky_arg/ ARGNet - Stern Words from No Man’s Sky ARG]<br />
<br />
'''23rd July 2017''' <br><br />
[EN] [https://geekreply.com/geek-culture/2017/07/23/waking-titan-update-1-phase-2-commences GeekReply - Waking Titan Update 1: Phase 2 Commences!]<br />
<br />
'''27th July 2017''' <br><br />
[EN] [https://geekreply.com/editorials/2017/07/27/waking-titan-arg-can-bring-people-together GeekReply - Waking Titan: How An ARG can Bring People Together.]<br />
<br />
'''8th August 2017''' <br><br />
[EN] [https://www.dailystar.co.uk/tech/gaming/635697/No-Man-s-Sky-News-Waking-Titan-Reddit-Arg-1-3-update-release-date/ Dailystar - No Man's Sky News: Waking Titan Reddit Arg REVEALS 1.3 update ahead of release date]<br />
<br />
'''9th August 2017''' <br><br />
[EN] [https://arstechnica.com/gaming/2017/08/no-mans-sky-version-1-3-lands-this-week-for-free-adds-quick-travel-portals/ Ars Technica - No Man’s Sky version 1.3 lands this week for free, adds “quick-travel” portals]<br />
<br />
[EN] [https://www.forbes.com/sites/insertcoin/2017/08/09/no-mans-sky-is-patching-in-a-story-this-week-a-year-after-launch/#19fb5a285282 Forbes - 'No Man's Sky' Is Patching In A Story This Week, A Year After Launch]<br />
<br />
[EN] [https://www.gamespew.com/2017/08/no-mans-sky-patch-week-improving-central-story/ GameSpew - No Man's Sky Patch This Week Improving Its Story]<br />
<br />
'''19th January 2018''' <br><br />
[EN] [http://www.eurogamer.net/articles/2018-01-18-no-mans-skys-waking-titan-arg-is-back-and-fans-are-trying-to-figure-out-what-it-all-means Eurogamer - No Man's Sky's Waking Titan ARG is back, and fans are trying to figure it all out again]<br />
<br />
[RU] [https://dtf.ru/category/nmsarg/ DTF - A Collection of No Man's Sky and Waking Titan Articles.]<br />
<br />
== Other Information ==<br />
<br />
{| class="wikitable"<br />
!colspan="2"|[[:Category:Waking Titan| Waking Titan Miscellaneous Subpages]]<br />
|-<br />
|[[Waking_Titan/Cassettes | Cassettes]]<br />
|Information about the cassette tapes received by No Man's Sky subreddit moderators<br />
|-<br />
|[[Waking_Titan/Stations | Stations]]<br />
|Information on the radio stations from the initial project-wt.com site<br />
|-<br />
|[[Waking_Titan/Companies | Company Archives]]<br />
|An archive of company details.<br />
|}<br />
<br />
[[Category:Waking Titan]]</div>Kkzzzkthttps://wiki.gamedetectives.net/index.php?title=Waking_Titan/Characters&diff=15898Waking Titan/Characters2018-06-27T09:44:56Z<p>Kkzzzkt: added tariq</p>
<hr />
<div>{{argHeader}}<br />
<br />
== Dramatis Personae ==<br />
<br />
=== The Atlas Foundation [http://atlas-65.com/ ->>>] === <br />
<br />
Dedicated to determining the true nature of reality, The Atlas Foundation hosts a family of businesses ''(Echo, Myriad, Superlumina, and Multiverse)'' all playing crucial roles in their experiments.<br />
<br />
==== Characters ====<br />
<br />
[[Waking Titan/Characters/Elizabeth Leighton|Elizabeth Leighton]] - The CEO of The Atlas Foundation, and director of the [https://csd.atlas-65.com/ Citizen Science Division]. <br />
<br />
Major Sophie Dubois ''("Metis")'' - on assignment with The Atlas Foundation as part of the [https://wiki.gamedetectives.net/images/5/5b/Loop15_Memo.jpg Pentagon's Titanwatch Task Force]. She worked as an overseer of the foundation's progress on precise predictive technology for its potential applications in [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/410a3e5d-01e7-4058-a23c-ca5fdde97f9d.pdf propaganda and military strategizing]. Following Elizabeth Leighton's [https://www.youtube.com/watch?v=P-eZDj5sqds supposed death] in an explosion at a Myriad sublocation, [https://s3.amazonaws.com/cdn.wakingtitan.com/19997bb6-18e5-4427-86c7-b0f3c1826ca2.pdf Sophie took her place] as CEO of The Atlas Foundation.<br />
<br />
==== The Citizen Science Division [http://csd.atlas-65.com/ >>>] ====<br />
The Citizen Science Division (CSD) is a collective of individuals who were recruited by The Atlas Foundation via a series of puzzles and radio ads at the beginning of Project Waking Titan. The purpose of the division was said to be creating an unpredictable environment to help test Loop16's predictive capabilities. All players of the ARG are addressed as part of this collective.<br />
<br />
==== Projects ====<br />
<br />
Loop16 - The 16th iteration of an artificial intelligence system designed by The Atlas Foundation to simulate a one-to-one recreation of reality that predicts the future with perfect accuracy. Loop16 ultimately revealed the true simulated nature of our universe. See also: [[Waking Titan/Characters/Emily Warren|Emily Warren]]<br />
<br />
The Mercury Process - Mercury is suggested to be an application of sorts; directly connected to Loop16 and [https://s3.amazonaws.com/cdn.wakingtitan.com/mercury/mercury-01-98748sfdlka87.pdf the existence of No Man's Sky]. See also: [https://wiki.gamedetectives.net/index.php?title=Waking_Titan/Characters#Mercury_NEXT Mercury NEXT]<br />
<br />
<br />
=== Myriad [http://www.myriad-70.com ->>>] ===<br />
<br />
Partnered with The Atlas Foundation, Myriad is a low-orbit satellite-based data storage company. They help to provide the flexible processing power required for The Atlas Foundation's experiments. They are also the host of W/ARE's testing labs.<br />
<br />
==== Known Employees ====<br />
Julian J. Wong - Help Desk<br />
<br />
Ethan Rose - Human Resources<br />
<br />
==== Testimonials ====<br />
<br />
Yi Sexton, Inventor<br />
<br />
Nikolina Sauvage, Data manager at Abstract Concepts<br />
<br />
Tobiah Selby, Developer at Tobiah Selby Development<br />
<br />
=== Satcom [http://www.satcom-70.com ->>>] ===<br />
<br />
Myriad's Satellite Communications API. Visiting their website automatically connects you to a Myriad satellite assigned to W/ARE. The satellite is storing corrupted consciousness data of W/ARE's remaining test subjects.<br />
<br />
==== The Dreamers ====<br />
<br />
Test subjects whose minds have become stuck within W/ARE's satellite data. Most of the dreamers have either died due to abrupt disconnections or have already been successfully disconnected with the help of Emily; who was able to communicate with them through her simulations. Unable to help the remaining 12 dreamers, Emily contacted the CSD for aid in gathering the information necessary to safely disconnect them. These 12 dreamers are listed below:<br />
<br />
* Dreamer 1 - [https://imgur.com/a/8g50Mpf Alexander]<br />
<br />
* Dreamer 2 - [https://imgur.com/a/XOSov7O #231187661T] - The anomalous second dreamer. Not much information has been made available, however, it is noteworthy that their name can be found as a defective iteration ID in a [https://pastebin.com/4TMK3Cn5 distress beacon log] at the beginning of No Man's Sky. ''(This dreamer bares corrupted consciousness data.)''<br />
<br />
* Dreamer 3 - [https://imgur.com/a/FYAEKhd Claire]<br />
<br />
* Dreamer X - Alisha<br />
<br />
* Dreamer 5 - [https://imgur.com/a/zEW9DDo Eun Ha]<br />
<br />
* Dreamer 6 - [https://imgur.com/a/p0F8fDH Philipp] - ''(This dreamer bares corrupted consciousness data.)''<br />
<br />
* Dreamer 7 - [https://imgur.com/a/bbnTYg7 Tariq Hamawi ''(T.H)''] - Working as a W/ARE Tech Supervisor, Tariq assisted in both Alexander and Phillip's screening reports before being connected to the devices himself. ''(This dreamer bares corrupted consciousness data.)''<br />
<br />
* Dreamer X - Nina<br />
<br />
* Dreamer X - Toby<br />
<br />
* Dreamer X - Mike<br />
<br />
* Dreamer X - Isabella<br />
<br />
* Dreamer X - Simon<br />
<br />
==== The Exosuits ====<br />
<br />
Physical exosuits wore by the dreamers and other test subjects to prevent damage to their bodies during prolonged dreaming sessions. These suits were shipped to W/ARE for testing by a ''currently'' undisclosed company.<br />
<br />
[https://s3.amazonaws.com/ware-virtual-dashboard/files/EunHa-PatientFile.pdf Eun Ha's screening report] details the use of "third-party" software on exosuits, moreover the conspicuous events following the software interfacing with W/ARE's network. Other dreamer's patient files on the [http://www.satcom-70.com Satcom Dashboard] supply additional oversights regarding these exosuits.<br />
<br />
<br />
=== W/ARE - Dream Better [https://www.ware-tech.cloud/en ->>>] ===<br />
Based in Beijing, China, '''W/ARE''' is a company which specializes in creating post-VR headsets that allow you to enter virtual worlds within your dreams.<br />
<br />
Loop16 has praised W/ARE for their progress in ''realistic'' simulated environments. She claims that W/ARE has ''"tremendous implications for our future"''', and ''"must be protected at all costs"''.<br />
<br />
==== The Team ====<br />
<br />
Xiāo Cheung - The Creator, and Founder of W/ARE technology. He claims to have created this technology because of his childhood dream of being able to live in a virtual world.<br />
<br />
Huáng Zhìmíng - The CEO of W/ARE. Graduated alongside Xiāo at the University of Electronic Science and Technology of China with a Masters in Business.<br />
<br />
Zhou Lin & Tang Bo - Lead Developers<br />
<br />
Li Dan & Jiang Wei - Lead Game Designers<br />
<br />
==== Related Characters ====<br />
<br />
Arnaud Lacours - The man behind [http://www.philojeux.com/ Philo Jeux], a French indie games studio that was developing a game for W/ARE called ''The Tablets of Mnemosyne''. Production on the game was halted after Arnaud slipped into a coma due to a headset malfunction.<br />
<br />
Dr. Geraldine Nadeau - A doctor researching lucid dreaming methods. Geraldine took interest in Arnaud's unusual brain activity during his coma and took him into her care.<br />
<br />
Mr. Zheng - A W/ARE employee who went into hiding after learning about dangerous experiments being conducted on individuals in W/ARE's testing labs. After evading their detection, Zheng intercepted the packages of W/ARE Developer Kits and communicated this info to its recipients with the help of Dr. Nadeau.<br />
<br />
==== Research Labs ====<br />
<br />
* Boston Research Lab / Director: Richard Wilkes<br />
<br />
* Sacramento Research Lab / Director: Helga Johnson - The lab that housed the remaining 12 dreamers before they were extracted from the facility by Myriad's field team.<br />
<br />
* Seoul Research Lab / Director: Yu Hyo<br />
<br />
* Beijing Research Lab / Director: Wang Jie<br />
<br />
* Prague Research Lab / Director: Adriana Dvorak<br />
<br />
* Berlin Research Lab / Director: Georg Muller<br />
<br />
There are also another 10 secretive W/ARE labs discovered by Myriad that we have no details for.<br />
<br />
==== Mercury NEXT ====<br />
A game title mentioned in an update to W/ARE's [https://twitter.com/warecloud/status/979103811489984513 staging server]. The [https://wiki.gamedetectives.net/index.php?title=Waking_Titan/Phase_4#Mercury_Project fluency] between W/ARE's mention of this title and the Waking Titan terminal's Mercury updates have made it apparent that the ''Mercury Process'' is in some way connected to this title. The exact terms of this connection have yet to be fully explained.<br />
<br />
<br />
<br />
=== Echo Software [http://www.echo-64.com ->>>] === <br />
<br />
A service established to help cope with the deaths of loved ones. Echo uses patented voice recognition software to accurately recreate the voice of any one particular person with a mere audio sample.<br />
<br />
==== The Team ====<br />
<br />
Ivan Greshnev - CEO / Founder<br />
<br />
Mikhail Regison - CTO / Co-Founder<br />
<br />
Gerry Mishrason - CFO / Head of Marketing<br />
<br />
Caroline Anderson-Smith - Creative Director<br />
<br />
Patricia Gorevsky - Project Manager<br />
<br />
Jeremy Elways - IT Director<br />
<br />
Paris O'Keefe - Head of Sales<br />
<br />
Rickley G. Brown - Website Design<br />
<br />
<br />
<br />
=== Multiverse Technologies [http://www.multiverse-75.com ->>>] === <br />
<br />
==== The Team ====<br />
<br />
Gunther Mann - CEO / Founder<br />
<br />
Minna Bell - Chief Researcher: Bio-radiation<br />
<br />
Annabelle Brassington - Chief Researcher: Computationalism<br />
<br />
Nickolaus Oberst - Chief Researcher: Magnetic Fields<br />
<br />
Justinian Ahlberg - Particle Collider Specialist<br />
<br />
Sabrina Dane - Nuclear Physicist<br />
<br />
==== Testimonials ====<br />
<br />
Alan Steinhardt, Steinhardt industries <br />
<br />
Vasili Pavlov, FTL Industries<br />
<br />
Mikhail Regison, Echo CTO / Co-founder<br />
<br />
<br />
<br />
=== Superlumina [http://www.superlumina-6c.com ->>>] === <br />
Partnered with The Atlas Foundation. Creator of the world's first [https://en.wikipedia.org/wiki/Tachyonic_antitelephone antitelephone].<br />
<br />
==== Our Team ====<br />
<br />
Hanne Cruickshanks<br />
<br />
Esme Savidge<br />
<br />
Austen Spence<br />
<br />
<br />
<br />
=== ETARC [http://www.etarc.org/ ->>>] === <br />
<br />
Edison Township Amateur Radio Club (E.T.A.R.C) is a club for HAM radio enthusiasts in Edison Township, New Jersey.<br />
<br />
==== Characters ====<br />
<br />
[[Waking Titan/Characters/Emily Warren|Emily Warren]] - Ham radio enthusiast and moderator of the [https://forums.etarc.org/ ETARC forums], before it was revealed that Emily was only Loop16's persona. It has since been re-branded to the official forums for the Citizen Science Division.<br />
<br />
Old Gods - A mysterious entity distributing Atlas Foundation emails. It has [https://forums.atlas-65.com/u/oldgods its own account] on the ETARC forums, and its profile picture and name are references to '''[https://en.wikipedia.org/wiki/Nyarlathotep Nyarlathotep]''' from the H.P Lovecraft Mythos.<br />
<br />
== Adverts ==<br />
<br />
Advertisements have been used in Waking Titan as a means of introducing new companies. A list of such ads can be found below:<br />
<br />
[https://clyp.it/jdr53oop Echo Radio Advertisement]; - [https://clyp.it/xbv04wbz Multiverse Radio Advertisement]; - [https://clyp.it/r4r3xriw Superlumina Radio Transmission]; - [https://clyp.it/ivvt15mt Myriad Radio Advertisement]; - [https://twitter.com/warecloud/status/977348396213190657 W/ARE Video Advertisement]</div>Kkzzzkthttps://wiki.gamedetectives.net/index.php?title=Waking_Titan&diff=15897Waking Titan2018-06-27T09:11:14Z<p>Kkzzzkt: added new log interaction</p>
<hr />
<div>{{argbox<br />
| float = right<br />
| image = File:Project WT logo.png<br />
| name = [[Waking Titan]]<br />
| description= Waking Titan was an ARG which led towards the No Man's Sky [https://www.nomanssky.com/atlas-rises-update/ Atlas Rises update].<br />
| creator = [http://www.aliceandsmith.com/ Alice & Smith]<br />
| creator2 = [http://www.hellogames.org/ Hello Games]<br />
| type = Official<br />
| status = Active<br />
| discovered = 2017-05-28<br />
}}<br />
{{ArgHeader}}<br />
{{BackToTop}}<br />
<br />
=== Description ===<br />
Waking Titan (also known as Project WT) is an ARG (alternate reality game) that involves a multitude of websites, phone numbers, and radio stations scattered across the world. The ARG is produced by veteran puppet masters [http://www.aliceandsmith.com/ Alice & Smith], and features NPCs, actors, and live events.<br />
<br />
Of the sci-fi genre, its story—linked to the origin of No Man's Sky—follows a powerful A.I known as Loop16 that is created by [https://wiki.gamedetectives.net/index.php?title=Waking_Titan/Characters The Atlas Foundation] to simulate a one-to-one recreation of reality that can accurately predict the future.<br />
<br />
=== Contents ===<br />
The ARG encompassed several "seasons," each leading to a new update for No Man's Sky. Season 1 of Waking Titan led to the [https://www.nomanssky.com/atlas-rises-update/ Atlas Rises update] and Season 2 is leading to [https://www.nomanssky.com/2018/03/no-mans-sky-next/ No Man's Sky: NEXT]. Season 1 was further divided into several distinct "'''phases'''", and Season 2 has followed this convention for ease of reading. Each phase is documented on its own wiki page:<br />
<br />
{| class="wikitable"<br />
!colspan="2"|Season 1<br />
|-<br />
|[[Waking_Titan/Phase_1 | Phase 1]] <br />
|Phase 1 of Waking Titan lasted from 2017-05-28 to 2017-07-08.<br />
|-<br />
|[[Waking_Titan/Phase_2 | Phase 2]] <br />
|Phase 2 of Waking Titan lasted from 2017-07-21 to 2017-08-05.<br />
|-<br />
|[[Waking_Titan/Phase_3 | Phase 3]]<br />
|Phase 3 of Waking Titan lasted from 2017-08-05 to 2017-08-07.<br />
|-<br />
!colspan="2"|Season 2<br />
|-<br />
|[[Waking_Titan/Phase_4 | Phase 4]]<br />
|Phase 4 of Waking Titan started on 2017-12-28 and is currently ongoing.<br />
|}<br />
<br />
'''''Note:''' This is a '''summary''' page. For more in-depth descriptions of each phase, including detailed descriptions of puzzle solutions, check the [[Waking_Titan/Phase_1|Phase 1]], [[Waking_Titan/Phase_2|Phase 2]], [[Waking_Titan/Phase_3 | Phase 3]] and [[Waking_Titan/Phase_4 | Phase 4]] pages.''<br />
__TOC__<br />
<br />
<br />
<br />
== Story Overview ==<br />
<br />
=== Internal Memos ===<br />
<br />
[[File:WT glyph 1 pdf.png|280px|thumbnail|right|One of the internal memos discovered in Waking Titan]]<br />
<br />
Here are all of the memos that were discovered over the course of the ARG:<br />
<br />
'''Season 1'''<br />
<br />
* [http://wiki.gamedetectives.net/index.php?title=File:WT_glyph_1_pdf.png Teamwork Assessment]<br />
* [http://wiki.gamedetectives.net/index.php?title=File:WT-Dataset-97C.jpg Dataset 97C]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/data/7d3dd080-2a43-4882-833c-f4d7bd7ba607.pdf Assurance]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/data/c01-331c6734-a013-4695-8e47-08a9ee05d5e5.pdf 017-a24]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/data/c02-9936c797-ec28-4f8f-b80e-dee9e0b06433.pdf 021-f16]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/mercury/mercury-01-98748sfdlka87.pdf Mercury Process Self-Diagnosis Report]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/data/57201e0d-01a3-4f6a-bbb4-2be8b7c8880f.pdf Progress Report]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/6c285180-ec4d-48a2-967f-8a7af3b50008.pdf Subject M-N00-dl35]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/410a3e5d-01e7-4058-a23c-ca5fdde97f9d.pdf Atlas Foundation Threat Models]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/7a6594ac-ca5e-467a-b6f4-9fb91f069d0a.pdf Advanced Calibration - Optional]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/a224a1f4-00e5-467b-9893-83fcc1a4f19a.pdf Unlocking Mercury Process File L16.jpg]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/b91f9959-6a3c-4011-b3b5-a1ff757a5e4c.pdf Phase 3]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/b0f33d53-5a8c-4a9a-b5fc-395562e463a8a+.pdf Log.1291]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/a09-179bf8d2-c13e-4c66-982e-b37ab3efd5bb.pdf Breach of Contract]<br />
<br />
'''Season 2'''<br />
* [https://wiki.gamedetectives.net/images/6/6e/Memo2.png Waking Titan S2 - Under Preparation]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/94c02878-e023-46a3-9316-db4177c4eaa6+.pdf WARE REPORT #26]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/1cd5226d-6639-4bbd-855a-4bf8f60866c3.pdf Concerns Regarding Captain Harry]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/70a25e6c-95ed-42d4-8de8-c3948255174c+.pdf Myriad Crisis Event Timeline]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/19997bb6-18e5-4427-86c7-b0f3c1826ca2.pdf Current State of The Atlas Foundation]<br />
* [https://pastebin.com/NYLiFuNY Log.3022]<br />
<br />
=== Subpages ===<br />
<br />
Navigating through the following subpages is '''recommended for newcomers''' wanting to get a grasp of Waking Titan's rapidly expanding story.<br />
<br />
{| class="wikitable"<br />
!colspan="2"|[[:Category:Waking Titan| Story Subpages]]<br />
|-<br />
|[[Waking_Titan/Characters| Character Summaries]]<br />
|Includes a summary of each character, company, and relating experiments and their importance in the Waking Titan story.<br />
|-<br />
|[[Waking_Titan/Console_Commands | Console Commands]]<br />
|A list of commands used by players at the [http://wakingtitan.com Waking Titan console]<br />
|}<br />
<br />
=== Music ===<br />
<br />
Partial video addresses for Youtube can be found scattered across Waking Titan PDFs, website files, and surveys; which all lead to music. The exact reasoning for this has gone unexplained. However, there are thematic relevancies in each song that appear to reflect on the state of the story. A playlist containing all songs linked in Waking Titan can be found here ''in order of earliest to most recent'' ... [https://www.youtube.com/playlist?list=PLEZy8wyuYLpLw0e5kkMyBUHO_s-V8f0Qk >>>>>]<br />
<br />
<br />
== Event Summaries ==<br />
<br />
=== Introduction ===<br />
<br />
On 2017-05-27, Twitter user @argn [https://twitter.com/argn/status/868587449613766658 tweeted a link] to [http://www.project-wt.com/ 'project-wt.com']. The link led to a website which contained a map showing sixty locations, four of which were "active" at the time. The locations, when clicked on, revealed the location's name and status. The active locations also revealed a link to a livestream of a local radio station, originating from the corresponding location. The project-wt website displayed a date, June 8th, and stated that the first clue was being "initialized".<br />
<br />
On 2017-06-01, moderators of No Man's Sky subreddits [https://reddit.com/r/nomansskythegame /r/NoMansSkyTheGame], [https://www.reddit.com/r/NMSPortals/ /r/NMSPortals], and [https://www.reddit.com/r/NMSGalacticHub/ /r/NMSGalacticHub] started to receive cassette tapes in the mail. Each cassette tape was labelled with a number out of 16. The Waking Titan ARG was initially thought to be a separate ARG from these tapes, but connections between the two made it clear that they were, in fact, one and the same.<br />
<br />
=== Phase 1 ===<br />
<br />
[[File:Wakingtitan site.png|thumbnail|450px|right|The default appearance of the Waking Titan site during Phase 1, with no sigils or glyphs solved]]<br />
<br />
During [[Waking_Titan/Phase_1 | Phase 1]], the http://wakingtitan.com hosted 6 triangles in the middle of the page. These triangles were referred to as "'''Sigils'''", while the white icons along the bottom of the page were referred to as "'''Glyphs'''". Each sigil and glyph, when clicked, lead to a password entry prompt - the correct passwords for all 6 sigils and the first 5 glyphs were discovered via puzzle-solving during Phase 1 of Waking Titan.<br />
<br />
The sigil and glyph puzzles were solved collaboratively - while it may have be possible to solve some of these puzzles individually, most of them required a collaborative effort. For instance, some puzzles required players to meet agents from the Atlas Corporation in person, and to relay information obtained from these meetings back to the community. A list of all sigil and glyph solutions for Phase 1 can be found below:<br />
<br />
[[File:WT Phase 1 complete.png|600px]]<br />
<br />
This phase culminated on July 8, 2017, with a [[Waking_Titan/Phase_1#End_of_Phase_1| congratulatory message from Elizabeth Leighton]], the CEO of the Atlas Foundation.<br />
<br />
=== Phase 2 ===<br />
<br />
[[File:Hampster maze.jpeg|thumbnail|450px|right|One of the puzzles that appeared on the Waking Titan [http://twitch.tv/wakingtitan Twitch Stream]]]<br />
<br />
During [[Waking_Titan/Phase_2 | Phase 2]], the http://wakingtitan.com site hosted a command-line interface terminal. Various commands were accepted as input, which triggered different events. One of the most notable commands was the <code>WHOIS <argument></code> command, which revealed a passage of text pertaining to the specified argument. For instance, the command <code>WHOIS FOURTH RACE</code> returned the following message:<br />
<pre><br />
INCOMING TRANSMISSION… SOURCE: UNKNOWN…<br />
You are not – kzzktt – alone –<br />
Please, identify yourself. I’m – kzzkttk –<br />
</pre><br />
<br />
Additionally, http://project-wt.com hosted a "Calibration" utility during Phase 2. To successfully perform these calibrations, players had to upload images of various objects and buildings to the site. For instance, the first calibration required images of "public resonant percussion instruments".<br />
<br />
Finally, towards the end of Phase 2, the Waking Titan [http://twitch.tv/wakingtitan Twitch stream] went live, displaying a five-monitor setup. Throughout the duration of the stream, players had to work together to solve puzzles that were displayed on these monitors. Some of these puzzles were interactive; for example, one puzzle that was repeated several times involved the Twitch chat guiding a virtual hamster through a maze.<br />
<br />
Additionally, players solved another 3 glyphs throughout Phase 2. The solutions to these glyphs are shown below:<br />
<br />
[[File:WT Phase2 Passwords.png|600px]]<br />
<br />
=== Phase 3 ===<br />
<br />
{{#evt:<br />
service=youtube<br />
|id=https://www.youtube.com/watch?v=QhX9z4dDAa4<br />
|alignment=right<br />
}}<br />
<br />
[[Waking_Titan/Phase_3|Phase 3]] was the briefest phase of Waking Titan. It consisted of the conclusion of the [http://twitch.tv/wakingtitan Twitch stream] that began at the [[Waking Titan/Phase 2#End of Phase 2|end of Phase 2]]. Players solved more interactive puzzles on the Twitch stream, before the rogue AI Loop16 asked them a final question: <code>SHOULD I EXIST?</code> The overwhelming response from the community was "yes".<br />
<br />
After receiving this response, Loop16 and Emily of the ETARC forums were revealed as being one and the same. Loop16 generated a heartfelt "Thank You" video to round out the stream, before finally taking the 72-hour stream offline.<br />
<br />
Shortly after this, players received emails with the subject line <code>Waking Titan has Ended</code>. The contents of the message were as follows:<br />
<br />
<pre><br />
Hello, Citizen Scientist,<br />
<br />
Thank you for your contributions to Waking Titan. The developments that took place during Phase 3 were somewhat concerning, but together we have set in motion truly world-shaping events. We will continue to inform the Citizen Science Division of privileged information or any need for collaborators on a new project.<br />
<br />
But we do have a few loose ends to tie up with you before we move on, so let's proceed.<br />
<br />
First, we're pleased to announce that all 10,000 Level 4 Atlas Passes are in production. Note that due to transit times for mail, some may take several weeks to be delivered.<br />
<br />
Next, our CEO Elizabeth Leighton has asked us to include a personal note of gratitude:<br />
<br />
"Thank you for all your diligent efforts, Citizen Scientists. It's been an amazing journey for all of us. I've watched you thrive and achieve from those first Phase 1 radio ads all the way through the intensity of Phase 3. I've been impressed at every turn by how brilliant you've been, how voracious, how kind, how thoughtful.<br />
<br />
It's been an honor and a privilege. On behalf of the Atlas Foundation, and on behalf of the world, thank you."<br />
The Mercury subroutine has concluded successfully, and a new memo from SM about this process is coming in the next 24 hours. We hope it will answer a few key questions you have about our program, and about what comes next.<br />
</pre><br />
<br />
On August 11, 2017, the [https://www.nomanssky.com/atlas-rises-update/ Atlas Rises update] was released for No Man's Sky.<br />
<br />
=== Phase 4 ===<br />
<br />
[[Waking_Titan/Phase_4 | Phase 4]] of Waking Titan started on 2017-12-28 and is currently ongoing.<br />
<br />
== Connection to No Man's Sky ==<br />
<br />
[[File:9-16-case.png|thumbnail|right|The case that cassette 9/16 was contained in.]]<br />
<br />
At the beginning of the ARG, it was not clear whether Waking Titan was officially connected to No Man's Sky. At first, there were only hints and nudges. At one point, 180 free copies of No Man's Sky were distributed to ARG players. Here's the text of a PDF that was revealed at the end of Phase 1 of Waking Titan:<br />
<br />
<pre><br />
We want to extend our gratitude to everyone who has contributed to the Mercury subroutine so far. <br />
We hope you have enjoyed the successful distribution of 180 Access IDs, and we hope you will also <br />
appreciate the other interesting artifacts we have in store for you going forward. We intend to keep the <br />
process alive until the completion of Project Waking Titan in August. <br />
<br />
It is important to mention that we are very excited by the coming Phases 2 and 3. Input from the Mercury <br />
Subroutine will pave the way toward new experiences in '''version 1.3 of a familiar universe'''. We look forward <br />
to the successful conclusion of this ground-breaking experiment. <br />
<br />
Regards.<br />
S.M.<br />
</pre><br />
<br />
This text explicitly stated that the Waking Titan ARG was leading towards the upcoming 1.3 update for No Man's Sky.<br />
<br />
Some [[Waking_Titan/Console_Commands | console commands]] on the [http://www.wakingtitan.com/ Waking Titan website] during [[Waking_Titan/Phase 2|Phase 2]] refer directly to No Man's Sky lore - for instance, <code>WHOIS ATLAS</code>, <code>WHOIS VY'KEEN</code>, and <code>WHOIS KORVAX</code> are all valid commands. Additionally, some terminal commands referred to a mysterious fourth race, so the prevailing assumption was that the upcoming 1.3 update would bring a fourth race to No Man's Sky.<br />
<br />
At the conclusion of the ARG, an email was sent out to members of the CSD with a [[Waking_Titan/Phase_3#Memo_from_Sean_Murray | memo from Sean Murray]], confirming that the ARG was the lead up to the 1.3 update, which was [https://www.nomanssky.com/atlas-rises-update/ released] after a few days.<br />
<br />
<br />
== Media Appearances ==<br />
<br />
'''5th July 2017''' <br><br />
[EN] [https://www.argn.com/2017/07/stern_words_from_no_mans_sky_arg/ ARGNet - Stern Words from No Man’s Sky ARG]<br />
<br />
'''23rd July 2017''' <br><br />
[EN] [https://geekreply.com/geek-culture/2017/07/23/waking-titan-update-1-phase-2-commences GeekReply - Waking Titan Update 1: Phase 2 Commences!]<br />
<br />
'''27th July 2017''' <br><br />
[EN] [https://geekreply.com/editorials/2017/07/27/waking-titan-arg-can-bring-people-together GeekReply - Waking Titan: How An ARG can Bring People Together.]<br />
<br />
'''8th August 2017''' <br><br />
[EN] [https://www.dailystar.co.uk/tech/gaming/635697/No-Man-s-Sky-News-Waking-Titan-Reddit-Arg-1-3-update-release-date/ Dailystar - No Man's Sky News: Waking Titan Reddit Arg REVEALS 1.3 update ahead of release date]<br />
<br />
'''9th August 2017''' <br><br />
[EN] [https://arstechnica.com/gaming/2017/08/no-mans-sky-version-1-3-lands-this-week-for-free-adds-quick-travel-portals/ Ars Technica - No Man’s Sky version 1.3 lands this week for free, adds “quick-travel” portals]<br />
<br />
[EN] [https://www.forbes.com/sites/insertcoin/2017/08/09/no-mans-sky-is-patching-in-a-story-this-week-a-year-after-launch/#19fb5a285282 Forbes - 'No Man's Sky' Is Patching In A Story This Week, A Year After Launch]<br />
<br />
[EN] [https://www.gamespew.com/2017/08/no-mans-sky-patch-week-improving-central-story/ GameSpew - No Man's Sky Patch This Week Improving Its Story]<br />
<br />
'''19th January 2018''' <br><br />
[EN] [http://www.eurogamer.net/articles/2018-01-18-no-mans-skys-waking-titan-arg-is-back-and-fans-are-trying-to-figure-out-what-it-all-means Eurogamer - No Man's Sky's Waking Titan ARG is back, and fans are trying to figure it all out again]<br />
<br />
[RU] [https://dtf.ru/category/nmsarg/ DTF - A Collection of No Man's Sky and Waking Titan Articles.]<br />
<br />
== Other Information ==<br />
<br />
{| class="wikitable"<br />
!colspan="2"|[[:Category:Waking Titan| Waking Titan Miscellaneous Subpages]]<br />
|-<br />
|[[Waking_Titan/Cassettes | Cassettes]]<br />
|Information about the cassette tapes received by No Man's Sky subreddit moderators<br />
|-<br />
|[[Waking_Titan/Stations | Stations]]<br />
|Information on the radio stations from the initial project-wt.com site<br />
|-<br />
|[[Waking_Titan/Companies | Company Archives]]<br />
|An archive of company details.<br />
|}<br />
<br />
[[Category:Waking Titan]]</div>Kkzzzkthttps://wiki.gamedetectives.net/index.php?title=Waking_Titan/Characters&diff=15836Waking Titan/Characters2018-06-22T07:19:59Z<p>Kkzzzkt: collection of minor edits. added exosuits and the new dreamers. fixed secured hypertext filtering out certain website's contents.</p>
<hr />
<div>== Dramatis Personae ==<br />
<br />
=== The Atlas Foundation [http://atlas-65.com/ ->>>] === <br />
<br />
Dedicated to determining the true nature of reality, The Atlas Foundation hosts a family of businesses ''(Echo, Myriad, Superlumina, and Multiverse)'' all playing crucial roles in their experiments.<br />
<br />
==== Characters ====<br />
<br />
[[Waking Titan/Characters/Elizabeth Leighton|Elizabeth Leighton]] - The CEO of The Atlas Foundation, and director of the [https://csd.atlas-65.com/ Citizen Science Division]. <br />
<br />
Major Sophie Dubois ''("Metis")'' - on assignment with The Atlas Foundation as part of the [https://wiki.gamedetectives.net/images/5/5b/Loop15_Memo.jpg Pentagon's Titanwatch Task Force]. She worked as an overseer of the foundation's progress on precise predictive technology for its potential applications in [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/410a3e5d-01e7-4058-a23c-ca5fdde97f9d.pdf propaganda and military strategizing]. Following Elizabeth Leighton's [https://www.youtube.com/watch?v=P-eZDj5sqds supposed death] in an explosion at a Myriad sublocation, [https://s3.amazonaws.com/cdn.wakingtitan.com/19997bb6-18e5-4427-86c7-b0f3c1826ca2.pdf Sophie took her place] as CEO of The Atlas Foundation.<br />
<br />
==== The Citizen Science Division [http://csd.atlas-65.com/ >>>] ====<br />
The Citizen Science Division (CSD) is a collective of individuals who were recruited by The Atlas Foundation via a series of puzzles and radio ads at the beginning of Project Waking Titan. The purpose of the division was said to be creating an unpredictable environment to help test Loop16's predictive capabilities. All players of the ARG are addressed as part of this collective.<br />
<br />
==== Projects ====<br />
<br />
Loop16 - The 16th iteration of an artificial intelligence system designed by The Atlas Foundation to simulate a one-to-one recreation of reality that predicts the future with perfect accuracy. Loop16 ultimately revealed the true simulated nature of our universe. See also: [[Waking Titan/Characters/Emily Warren|Emily Warren]]<br />
<br />
The Mercury Process - Mercury is suggested to be an application of sorts; directly connected to Loop16 and [https://s3.amazonaws.com/cdn.wakingtitan.com/mercury/mercury-01-98748sfdlka87.pdf the existence of No Man's Sky]. See also: [https://wiki.gamedetectives.net/index.php?title=Waking_Titan/Characters#Mercury_NEXT Mercury NEXT]<br />
<br />
<br />
=== Myriad [http://www.myriad-70.com ->>>] ===<br />
<br />
Partnered with The Atlas Foundation, Myriad is a low-orbit satellite-based data storage company. They help to provide the flexible processing power required for The Atlas Foundation's experiments. They are also the host of W/ARE's testing labs.<br />
<br />
==== Known Employees ====<br />
Julian J. Wong - Help Desk<br />
<br />
Ethan Rose - Human Resources<br />
<br />
==== Testimonials ====<br />
<br />
Yi Sexton, Inventor<br />
<br />
Nikolina Sauvage, Data manager at Abstract Concepts<br />
<br />
Tobiah Selby, Developer at Tobiah Selby Development<br />
<br />
=== Satcom [http://www.satcom-70.com ->>>] ===<br />
<br />
Myriad's Satellite Communications API. Visiting their website automatically connects you to a Myriad satellite assigned to W/ARE. The satellite is storing corrupted consciousness data of W/ARE's remaining test subjects.<br />
<br />
==== The Dreamers ====<br />
<br />
Test subjects whose minds have become stuck within W/ARE's satellite data. Most of the dreamers have either died due to abrupt disconnections or have already been successfully disconnected with the help of Emily; who was able to communicate with them through her simulations. Unable to help the remaining 12 dreamers, Emily contacted the CSD for aid in gathering the information necessary to safely disconnect them. These 12 dreamers are listed below:<br />
<br />
* Dreamer 1 - [https://imgur.com/a/8g50Mpf Alexander]<br />
<br />
* Dreamer 2 - [https://imgur.com/a/XOSov7O #231187661T] - The anomalous second dreamer. Not much information has been made available, however, it is noteworthy that their name can be found as a defective iteration ID in a [https://pastebin.com/4TMK3Cn5 distress beacon log] at the beginning of No Man's Sky.<br />
<br />
* Dreamer 3 - [https://imgur.com/a/FYAEKhd Claire]<br />
<br />
* Dreamer X - Tariq<br />
<br />
* Dreamer 5 - [https://imgur.com/a/zEW9DDo Eun Ha]<br />
<br />
* Dreamer 6 - [https://imgur.com/a/p0F8fDH Philipp]<br />
<br />
* Dreamer X - Alisha<br />
<br />
* Dreamer X - Nina<br />
<br />
* Dreamer X - Toby<br />
<br />
* Dreamer X - Mike<br />
<br />
* Dreamer X - Isabella<br />
<br />
* Dreamer X - Simon<br />
<br />
==== The Exosuits ====<br />
<br />
Physical exosuits wore by the dreamers and other test subjects to prevent damage to their bodies during prolonged dreaming sessions. These suits were shipped to W/ARE for testing by a ''currently'' undisclosed company.<br />
<br />
[https://s3.amazonaws.com/ware-virtual-dashboard/files/EunHa-PatientFile.pdf Eun Ha's screening report] details the use of "third-party" software on exosuits, moreover the conspicuous events following the software interfacing with W/ARE's network. Other dreamer's patient files on the [http://www.satcom-70.com Satcom Dashboard] supply additional oversights regarding these exosuits.<br />
<br />
<br />
=== W/ARE - Dream Better [https://www.ware-tech.cloud/en ->>>] ===<br />
Based in Beijing, China, '''W/ARE''' is a company which specializes in creating post-VR headsets that allow you to enter virtual worlds within your dreams.<br />
<br />
Loop16 has praised W/ARE for their progress in ''realistic'' simulated environments. She claims that W/ARE has ''"tremendous implications for our future"''', and ''"must be protected at all costs"''.<br />
<br />
==== The Team ====<br />
<br />
Xiāo Cheung - The Creator, and Founder of W/ARE technology. He claims to have created this technology because of his childhood dream of being able to live in a virtual world.<br />
<br />
Huáng Zhìmíng - The CEO of W/ARE. Graduated alongside Xiāo at the University of Electronic Science and Technology of China with a Masters in Business.<br />
<br />
Zhou Lin & Tang Bo - Lead Developers<br />
<br />
Li Dan & Jiang Wei - Lead Game Designers<br />
<br />
==== Related Characters ====<br />
<br />
Arnaud Lacours - The man behind [http://www.philojeux.com/ Philo Jeux], a French indie games studio that was developing a game for W/ARE called ''The Tablets of Mnemosyne''. Production on the game was halted after Arnaud slipped into a coma due to a headset malfunction.<br />
<br />
Dr. Geraldine Nadeau - A doctor researching lucid dreaming methods. Geraldine took interest in Arnaud's unusual brain activity during his coma and took him into her care.<br />
<br />
Mr. Zheng - A W/ARE employee who went into hiding after learning about dangerous experiments being conducted on individuals in W/ARE's testing labs. After evading their detection, Zheng intercepted the packages of W/ARE Developer Kits and communicated this info to its recipients with the help of Dr. Nadeau.<br />
<br />
==== Research Labs ====<br />
<br />
* Boston Research Lab / Director: Richard Wilkes<br />
<br />
* Sacramento Research Lab / Director: Helga Johnson - The lab that housed the remaining 12 dreamers before they were extracted from the facility by Myriad's field team.<br />
<br />
* Seoul Research Lab / Director: Yu Hyo<br />
<br />
* Beijing Research Lab / Director: Wang Jie<br />
<br />
* Prague Research Lab / Director: Adriana Dvorak<br />
<br />
* Berlin Research Lab / Director: Georg Muller<br />
<br />
There are also another 10 secretive W/ARE labs discovered by Myriad that we have no details for.<br />
<br />
==== Mercury NEXT ====<br />
A game title mentioned in an update to W/ARE's [https://twitter.com/warecloud/status/979103811489984513 staging server]. The [https://wiki.gamedetectives.net/index.php?title=Waking_Titan/Phase_4#Mercury_Project fluency] between W/ARE's mention of this title and the Waking Titan terminal's Mercury updates have made it apparent that the ''Mercury Process'' is in some way connected to this title. The exact terms of this connection have yet to be fully explained.<br />
<br />
<br />
<br />
=== Echo Software [http://www.echo-64.com ->>>] === <br />
<br />
A service established to help cope with the deaths of loved ones. Echo uses patented voice recognition software to accurately recreate the voice of any one particular person with a mere audio sample.<br />
<br />
==== The Team ====<br />
<br />
Ivan Greshnev - CEO / Founder<br />
<br />
Mikhail Regison - CTO / Co-Founder<br />
<br />
Gerry Mishrason - CFO / Head of Marketing<br />
<br />
Caroline Anderson-Smith - Creative Director<br />
<br />
Patricia Gorevsky - Project Manager<br />
<br />
Jeremy Elways - IT Director<br />
<br />
Paris O'Keefe - Head of Sales<br />
<br />
Rickley G. Brown - Website Design<br />
<br />
<br />
<br />
=== Multiverse Technologies [http://www.multiverse-75.com ->>>] === <br />
<br />
==== The Team ====<br />
<br />
Gunther Mann - CEO / Founder<br />
<br />
Minna Bell - Chief Researcher: Bio-radiation<br />
<br />
Annabelle Brassington - Chief Researcher: Computationalism<br />
<br />
Nickolaus Oberst - Chief Researcher: Magnetic Fields<br />
<br />
Justinian Ahlberg - Particle Collider Specialist<br />
<br />
Sabrina Dane - Nuclear Physicist<br />
<br />
==== Testimonials ====<br />
<br />
Alan Steinhardt, Steinhardt industries <br />
<br />
Vasili Pavlov, FTL Industries<br />
<br />
Mikhail Regison, Echo CTO / Co-founder<br />
<br />
<br />
<br />
=== Superlumina [http://www.superlumina-6c.com ->>>] === <br />
Partnered with The Atlas Foundation. Creator of the world's first [https://en.wikipedia.org/wiki/Tachyonic_antitelephone antitelephone].<br />
<br />
==== Our Team ====<br />
<br />
Hanne Cruickshanks<br />
<br />
Esme Savidge<br />
<br />
Austen Spence<br />
<br />
<br />
<br />
=== ETARC [http://www.etarc.org/ ->>>] === <br />
<br />
Edison Township Amateur Radio Club (E.T.A.R.C) is a club for HAM radio enthusiasts in Edison Township, New Jersey.<br />
<br />
==== Characters ====<br />
<br />
[[Waking Titan/Characters/Emily Warren|Emily Warren]] - Ham radio enthusiast and moderator of the [https://forums.etarc.org/ ETARC forums], before it was revealed that Emily was only Loop16's persona. It has since been re-branded to the official forums for the Citizen Science Division.<br />
<br />
Old Gods - A mysterious entity distributing Atlas Foundation emails. It has [https://forums.atlas-65.com/u/oldgods its own account] on the ETARC forums, and its profile picture and name are references to '''[https://en.wikipedia.org/wiki/Nyarlathotep Nyarlathotep]''' from the H.P Lovecraft Mythos.<br />
<br />
== Adverts ==<br />
<br />
Advertisements have been used in Waking Titan as a means of introducing new companies. A list of such ads can be found below:<br />
<br />
[https://clyp.it/jdr53oop Echo Radio Advertisement]; - [https://clyp.it/xbv04wbz Multiverse Radio Advertisement]; - [https://clyp.it/r4r3xriw Superlumina Radio Transmission]; - [https://clyp.it/ivvt15mt Myriad Radio Advertisement]; - [https://twitter.com/warecloud/status/977348396213190657 W/ARE Video Advertisement]</div>Kkzzzkthttps://wiki.gamedetectives.net/index.php?title=Waking_Titan/Phase_5/Dreamers/Phillip&diff=15835Waking Titan/Phase 5/Dreamers/Phillip2018-06-22T03:19:22Z<p>Kkzzzkt: fixed typos</p>
<hr />
<div>{{ArgHeader}}<br />
{{BackToTop}}<br />
<br/><br />
__TOC__<br />
<br />
=Phillip=<br />
On June 15, 10:00pm UTC, Emily posted Phillip's Reddit [https://www.reddit.com/r/NoMansSkyTheGame/comments/8re9fa/patient_support_thread_phillip/ Patient Support Thread].<br />
<br />
[https://s3.amazonaws.com/ware-virtual-dashboard/files/Phillip-PatientFile.pdf Phillip's patient file]<br />
[[File:WT-Phillip.png|thumb|right|180px|Phillip's Dashboard]]<br />
==Memory Block P1==<br />
Clicking the first available green [https://uplink.satcom-70.com/?d=3y7y73y7ehhheuuhe98h398h3hhekkkhb Memory Block P1] displayed <br />
<pre>Interview simulation ready. Initializing connection with Phillip.<br />
Dreamer’s current state : Nervous and agitated<br />
<br />
Simulation: Interview Simulator<br />
</pre><br />
<br />
The activation code was [https://forums.atlas-65.com/t/patient-intervention-thread-phillip/5003/35 2018/01/13]<br />
<br />
==Memory Block P2==<br />
4 hours after the first memory block was unlocked, Phillip's [https://uplink.satcom-70.com/?d=28je83pp29wksh928hhn2jjk3 Memory Block P2] was activated. Emily initiated players with:<br />
<br />
<pre><br />
Park simulation ready. Initializing connection with Phillip.<br />
Dreamer’s current state: Calmer than usual.<br />
Try to remember how he reacted the first time around.<br />
<br />
Phillip has kids. I’m going to load the Park simulation to see if it gets us somewhere.<br />
</pre><br />
<br />
The activation code was [https://forums.atlas-65.com/t/patient-intervention-thread-phillip/5003/90 What's for dinner?]</div>Kkzzzkthttps://wiki.gamedetectives.net/index.php?title=Waking_Titan/Phase_4&diff=15749Waking Titan/Phase 42018-06-19T02:03:35Z<p>Kkzzzkt: added solves for phillip's access codes, fixed a few typos.</p>
<hr />
<div>{{argbox<br />
| float = right<br />
| image = File:Project WT logo.png<br />
| name = [[Waking Titan]] - Phase 4<br />
| description= Phase 4 of Waking Titan started on 2017-12-28 and is currently ongoing.<br />
| creator = [http://www.aliceandsmith.com/ Alice & Smith]<br />
| creator2 = [http://www.hellogames.org/ Hello Games]<br />
| type = Official<br />
| status = Active<br />
| discovered = 2017-05-28<br />
}}<br />
{{ArgHeader}}<br />
{{BackToTop}}<br />
<br/><br />
__TOC__<br />
{{Clear|both}}<br />
<br />
== Tenth Glyph ==<br />
<br />
Beginning on December 28th, 2017, typing <code>WHOIS</code> on the [http://www.wakingtitan.com/ Waking Titan website] returned the following: <code>#WHATIS1.5</code>. In addition, the 10th glyph was made active, and linked to a [https://drive.google.com/drive/folders/16a_0EZ0EdAcCNE7QgvwIwC18NOGnZ_q9 Google Drive folder], which contained community-made pictures of the NMS logo in an infinite mirror.<br />
<br />
The titles of the photos, when strung together (skipping the 00 (empty) ones), formed the hexadecimal code for <code>moirrr</code>, which was an anagram for <code>mirror</code>. Additionally, the hexadecimal code in the correct order for the word <code>mirror</code> could be found on the bottom of the [http://www.myriad-70.com/ Myriad website].<br />
<br />
Also of note was the background of the tenth glyph, which read:<br />
<br />
[[File:Imageglyph10.png|thumbnail|right|the background of the tenth glyph]]<br />
<br />
<pre><br />
Dear Elizabeth<br />
We have finished processing 10,000 passes as per your requirements. You should<br />
have them in time for the next phase. I really hope you will like the final product.<br />
<br />
Kind regards,<br />
Gail<br />
</pre><br />
<br />
The allusion to <code>10,000 passes</code> is likely a reference to the Level 4 Atlas passes that were promised to players as part of earlier phases. The identity of "Gail" remained unknown.<br />
<br />
=== Atlas Passes ===<br />
On January 17th, 2018, the first CSD user received their Atlas Pass. The passes were made from cardstock, with a textured pass printed on it. The front had the text <code>WAKING TITAN</code> printed, and below that the CSD category the user belonged in. On the very bottom, a series of hexadecimals reading <code>70686f656e6978</code> could be found, which, after decoding, translated to <code>PHOENIX</code>. On the back, the owner's CSD-ID was written, along with a serial number stating which pass out of 10,000 the user had, and a number at the top.<br />
<br />
It is strongly recommended to not cover up the hex underneath your signature, and to share the number above and below your CSD ID if you are in possession of a pass. Preferably with a picture of the front, as shown below.<br />
For a list of all the atlas passes currently known of, please refer to [https://docs.google.com/spreadsheets/d/1TrNnrCzg8H7cbbAE6lIOFQ7JK8aTSKjxY9Q1i8EfjBs/edit#gid=1893459896 this spreadsheet.] In the event you receive one of these, please share a picture of the front, and the numbers underneath and above your CSD-ID (censored bit) on the back.<br />
<br />
<gallery mode="packed" widths=240px heights=240px><br />
Image:Better atlas pass.jpg|Atlas Pass front side<br />
Image:BEST BACK ATLAS PASS.png|Atlas Pass back side<br />
</gallery><br />
<div style="clear: both"></div><br />
<br />
=== Status Command Update ===<br />
<br />
On January 20th at 5:44PM UTC, the output of the <code>STATUS</code> command began to update:<br />
<br />
<pre><br />
Downloading Data...: 19:44<br />
1- : 20:16 (32 min)<br />
1-8 : 20:27 (11 min)<br />
1-80 : 20:39 (12 min)<br />
1-800- : 20:44 (5 min)<br />
1-800-41 : 21:35 (51 min)<br />
<br />
1-800-413-01 : 22:14 (39 min)<br />
Xxxxx X : New Line<br />
<br />
1-800-413-011 : 22:15 (1 min)<br />
Xxxxx XX <br />
<br />
1-800-413-0110 : 22:16 (1 min)<br />
Xxxxx XXX<br />
</pre><br />
<br />
Calling the provided phone number yielded an SSTV transmission (pictured below) which, once decoded, provided meteorological data for various locations.<br />
<br />
<gallery mode="packed-hover" widths=240px heights=240px><br />
Image:Page 1 SSTV.PNG|SSTV page 1<br />
Image:Page 2 SSTV.PNG|SSTV page 2<br />
</gallery><br />
<div style="clear: both"></div><br />
<br />
Players found they were to order the list of locations in the image alphabetically. This yielded a sequence where <code>Index by Precipitation</code> could be read off.<br />
Using the ordered text indexed by precipitation (in <code>alma</code> the second index is <code>o</code>) led to the following:<br />
<br />
<pre><br />
CAFE<br />
BENE<br />
NINETEEN<br />
SAT<br />
</pre><br />
<br />
=== Livedrop Memo ===<br />
<br />
The text indicated a new livedrop would be occurring in the same location as the last one had. However, due to the old Cafe Bene closing, the <code>Xxxxx XXX</code> part was added in the STATUS command update to warn players about the new venue, <code>Outro NYC</code>, which opened in the same place as the Cafe Bene had been located. The livedrop was intended to occur at 7PM EST (12:00AM UTC). However, the first player from the community who set out for the drop was involved in a traffic mishap, delaying their arrival. Anticipating missing the drop's time window, the community reached out to request a time extension, and the STATUS command, which had updated frequently throughout the confusion, was updated again to approve the community's request.<br />
<mapframe text="Outro NYC" width=400 height=350 zoom=14 latitude=40.7328 longitude=-73.9909><br />
{<br />
"type": "FeatureCollection",<br />
"features": [<br />
{<br />
"type": "Feature",<br />
"properties": {<br />
"marker-color": "#0f0fee",<br />
"marker-size": "medium",<br />
"marker-symbol": "cafe"<br />
},<br />
"geometry": {<br />
"type": "Point",<br />
"coordinates": [<br />
-73.99094313383102,<br />
40.73275683797643<br />
]<br />
}<br />
}<br />
]<br />
}<br />
</mapframe><br />
<pre><br />
STAND BY: CSD CITIZEN NOT DETECTED<br />
WARNING: CSD CITIZEN NOT DETECTED!<br />
IT'S LONELY OUT HERE<br />
TIME EXTENSION REQUESTED?<br />
EXTENTION PROPOSED: 2H30 – AWAITING CSD APPROVAL<br />
EXTENSION APPROVED, BE SAFE<br />
</pre><br />
<br />
[[File:bookwt.png|thumb|left|Book case seen on the livedrop livestream is the same as one used in an earlier livedrop.]]<br />
<br />
After the extension was approved, a second player from the community set out to the livedrop location [https://youtu.be/Gvng4pAuxY8 on livestream] and met with their A&S contact around 7:30PM EST (12:30AM UTC). During the meeting, the player was handed [https://drive.google.com/file/d/1kAjH2njXiab3u24VkcY-69IvOabhytGv/view a memo] from a mysterious case disguised as a book, pictured left. After some cryptic conversation, the contact asked if they were "getting enough sleep", stating that being well-rested would be very important. After the meeting, players who had attended the livedrop met in another location and showed off the memo, speculating about it's contents and even discovering the REM Sleep connection to the letters on the memo's back. After the livedrop, the community used the livestream to look over the memo, pictured below. On the back of the memo <code>REMS</code> is written. This clue, in combination with the strange question A&S asked at the rendezvous, led players to the password for the 10th Glyph, <code>REM SLEEP</code>.<br />
<br />
<gallery mode="packed-hover" widths=240px heights=240px><br />
image:memo1.png|Memo page 1<br />
image:memo2.png|Memo page 2<br />
image:memo3.png|Memo page 3<br />
</gallery><br />
<br />
[[File:form7.png|thumb|right|Seventh question revealed on the [https://atlas13.typeform.com/to/VF6CpG bit.ly form] when REMS or REM Sleep is entered for question six]]<br />
<br />
Once the glyph was solved, the STATUS command updated to [https://atlas13.typeform.com/to/VF6CpG a bit.ly link to a form]. Players discovered that on the sixth question on the form, entering REMS or REM Sleep (case sensitive) caused a seventh question, pictured right, to reveal itself, allowing CSD users to enter their email address to receive "left over materials" from something called Lab 319. Players remained unclear on what exactly Lab 319 was or what it's leftovers were, however signing up seemed integral given the input is only revealed after using the REM Sleep phrase.<br />
<br />
=Myriad Back Online=<br />
On 26 March, 2018 at 05:25 UTC an event occurred. The [http://www.myriad-70.com Myriad] site came back online after having been offline since the end of Phase 3. The site featured indications of a solar event interfering with operations. In addition, the status command on [http://wakingtitan.com Waking Titan] briefly displayed the following:<br />
<pre><br />
CODE -3<br />
Unable to restart<br />
.................<br />
ERROR LOG SUMMARY<br />
- Major malfunction<br />
- Protect the monarch<br />
- All tiers 2 and tiers 3 clients must be purged IMMEDIATELY<br />
.................<br />
TO ALL CSD<br />
- Gather maximum EXTERNAL intel<br />
- CSD should take time to regroup and get organized<br />
</pre><br />
<br />
Ten minutes elapsed before the Status command began to display the following:<br />
<pre><br />
CODE -5<br />
System Locked<br />
e b 4 c 1 4 a 9 c 6 2 2 d f 7 1 6 6 f b e 0 d d 8 9 1 5 d b 0 2<br />
</pre><br />
<br />
This hexadecimal string was used to reference a connection the private key for an Ethereum cryptocurrency wallet related to an ostensibly "promotional" event for an upcoming product from [http://ware-tech.cloud/ W/ARE].<br />
<br />
=Client 3597b=<br />
<br />
At 1:11 AM, UTC, Myriad-70.com updated, and the updates included the following.<br />
<br />
<pre><br />
Latest network diagnostic table:<br />
- Network corruption detected<br />
- Situation isolated to Client 3597b<br />
- Process cannot be suspended due to critical conditions<br />
--------------------------<br />
-Beijing: 29.1Tb/s<br />
--------------------------<br />
MAJOR ISSUES:<br />
Client 3597b<br />
</pre><br />
<br />
<br />
Soon after, at 1:30 AM UTC, the Status command updated in the Terminal to say the following.<br />
<br />
<pre><br />
> status<br />
CODE -5<br />
System Locked<br />
e b 4 c 1 4 a 9 c 6 2 2 d f 7 1 6 6 f b e 0 d d 8 9 1 5 d b 0 2<br />
--------------<br />
Monarch Repository Status: Degraded<br />
Conflict With<br />
- Client 18d1a TRACERT 10.30.74.*<br />
- Client 3597b TRACERT 54.91.155.*<br />
- Client 351h TRACERT 6.128.214.*<br />
- Client 0911a TRACERT 74.1.21.*<br />
</pre><br />
<br />
Approximately 15 minutes later, clients began to disconnect, beginning with Client 0911a, second being Client 18d1a, and the last being Client 351h, who had an additional piece of text added, being <code>ID: 79657321</code>, which was translated as hex into <code> Yes! </code> <br />
<br />
Then, at 2:15 AM UTC, the status command was updated again, stating <code> - Client 3597b - UNABLE TO DISCONNECT 54.91.155.209 NAT 52.2.248.*</code><br />
<br />
At 1:38 PM UTC, the status command updated once again, stating <code> - Client 3597b - UNABLE TO DISCONNECT 54.91.155.209 NAT 52.2.248.*:80\\</code><br />
<br />
At 10:30 PM UTC, March 30, the status updated again to say<br />
<pre><br />
Latest network diagnostic table:<br />
- Client 3597b is beyond allocated limits<br />
- Process cannot be suspended due to critical conditions<br />
- Tier 1, 2 and 3 clients are now all offline<br />
</pre><br />
<br />
=Ware-tech.cloud=<br />
Of the sites found in the 52.2.248 range, [http://52.2.248.6 52.2.248.6] was found. Using the metadata found in the HTML and searching on Google, the [http://www.ware-tech.cloud domain] and [http://twitter.com/warecloud Twitter] were located as well. The site is in Chinese, although Google Translate gives a good, readable translation. <br />
<br />
On Twitter, under the Shipping Soon image, is a Hex string <code>77 61 6E 74 20 74 6F 20 6B 6E 6F 77 20 6D 6F 72 65</code> that, when converted to ascii reads <code>want to know more</code>. Under the #waretech hashtag on Twitter, there are three images shared by "Partner Companies" with the following code (and the ascii conversion):<br />
<br />
<pre><br />
62 69 74 2E = bit.<br />
6C 79 2F 77 = ly/w<br />
61 72 65 32 = are2<br />
</pre><br />
<br />
On the ware-tech website, if you subscribe, you receive an email with another 3 characters: <code>30 31 38</code>, which again in Ascii becomes <code>018</code>. Together this gave a bit.ly link that leads to the W/are Discord channel.<br />
<br />
On Discord, we were informed of a community puzzle that was going on by the admin. Members of the W/ARE Discord had received tweets from another account, [https://twitter.com/w9rPQ45E https://twitter.com/w9rPQ45E], which had seven tweets with hex code in them:<br />
<pre><br />
01 [ 74 78 2f 30 78 66 65 30 31 35 30 66 ] <br />
02 [ 62 33 30 32 61 38 62 36 64 34 30 38 ]<br />
03 [ 35 37 32 32 64 61 61 31 64 30 37 37 35 ]<br />
04 [ 38 33 31 38 35 30 38 36 39 31 30 61 31 ]<br />
05 [ 61 38 32 34 38 63 65 32 34 38 30 64 ]<br />
06 [ 32 65 33 38 37 33 31 ]<br />
07 - Signal Lost [ 65 6e 64 20 6f 66 20 6c 69 6e 65 ]<br />
</pre><br />
<br />
Translated into Ascii, these tweets give the following:<br />
<pre><br />
tx/0xfe0150f<br />
b302a8b6d408<br />
5722daa1d0775<br />
83185086910a1<br />
a8248ce2480d<br />
2e38731<br />
</pre><br />
which references [https://etherscan.io/tx/0xfe0150fb302a8b6d4085722daa1d077583185086910a1a8248ce2480d2e38731 this Ethereum transaction]. The Twitter username, w9rPQ45E is also [http://pastebin.com/w9rPQ45E a Pastebin], providing the string <code>edb044c81d40a196c4672a2bd6f17f1f6</code>. In the Ethereum transaction, there is Input Data that, when converted to ascii, links to [http://pastebin.com/HNqKEUpS another Pastebin], providing another string: <code>b67fbb5e90ddcda8a921656d0b30a20</code><br />
<br />
Two things have been done with these strings. Together, they are the Private Key for the Ethereum account the money was transferred to. It has since been withdrawn to a different account. Second, if you put the two strings together and compare them with the string from Waking Titan's console, every odd character matches the strings from Pastebin.<br />
<code>edb044c81d40a196c4672a2bd6f17f1f6b67fbb5e90ddcda8a921656d0b30a20</code><br />
<br />
<code>e b 4 c 1 4 a 9 c 6 2 2 d f 7 1 6 6 f b e 0 d d 8 9 1 5 d b 0 2&nbsp;</code><br />
The remaining characters are <code>d0 48 d0 16 47 ab 61 ff b7 b5 9d ca a2 66 03 a0</code>, however if this has any use is yet to be seen.<br />
<br />
Three hours after the W/ARE Discord Admin let the community know about the puzzle, at 6:01 PM UTC they returned and said<br />
<pre>That was it for today, good job on solving our community puzzle! You are good! :smiley:<br />
Tomorrow one of our partners will have a giveaway for us! We will have more for you this weekend also!</pre><br />
<br />
=Mercury Project=<br />
[[File:Sean-tweet.png|thumb|right]]<br />
[[File:NMSNext.png|thumb|The announcement for No Man's Sky: NEXT]]<br />
At 9:26 PM UTC, the <code> Mercury </code> command updated to say the following.<br />
<br />
<pre><br />
Mercury process > Build XXXX<br />
Ready to load branch version 1.5<br />
Send Password Code in HEX to : Telegram MercuryHG80<br />
</pre><br />
<br />
This puzzle required a user to solve the riddle shown below, convert the answer into hexdecimal, and send it to an official Telegram account run by one of the Puppet Masters.<br />
<br />
The puzzle involved a riddle that was discovered in a [https://twitter.com/warecloud/status/979103811489984513 Pastebin on W/ARE's twitter]. It went as follows: <code> “Descended from Night, I share the blood of nightmares. Look forward to the gates of horn and ivory” </code><br />
<br />
This puzzle was solved by searching "The gates of horn and ivory", which resulted in dreams and nightmares of Greek mythology. After noting the capital N in "nightmares", users found the Greek god of night, Nyx, which led to one of her children, Morpheus, who was one of the Oneiroi, and the god of dreams. The name was then converted to hexdecimal and sent to the Telegram account, and the terminal accepted the password, resulting in the following command update.<br />
<br />
<pre><br />
Processing "Morpheus" > ACCESS GRANTED<br />
Downloading.......<br />
</pre><br />
<br />
Then, at 9:54 UTC, the Mercury command updated again, and said the following.<br />
<pre><br />
<Mercury process > Build XXXX<br />
Ready to load branch version 1.5<br />
Send Password Code in HEX to : Telegram MercuryHG80<br />
--------------------------------<br />
Process started by community - ETA 11:00 BST<br />
https://bit.ly/2pLmadg<br />
</pre><br />
<br />
The shortened link redirected to a tweet from Sean Murray, which said <code> The cause is hidden. The effect is visible to all. #oneonebst </code><br />
<br />
The tweet also included a photo of someone, presumably Sean himself, holding a phone receiving a Telegram notification, which was Morpheus in hexdecimal. The hashtag spells out 11BST, or more precisely, 11:00 BST, or, 10:00 UTC. No updates were made at 10:00 PM, and was then confirmed to be counting to 10:00 AM.<br />
<br />
Roughly half an hour before the timer was up, at 9:26 AM UTC, Sean Murray announced on [https://twitter.com/NoMansSky/status/979288744791592960 Twitter] that he had a small announcement to make, and was going to post it early as it was about to leak.<br />
<br />
Shortly after, at 9:50 AM UTC, Hello Games announced the next update for No Man's Sky, which was No Man's Sky NEXT, set with a launch date for Summer of 2018.<br />
<br />
=Newsletter=<br />
[[File:WareNewsletter1.png|thumb|left|120px|Screenshot of the W/ARE newsletter]]<br />
On April 2 at around 23:30 UTC, user W/ARE came online in the W/ARE Discord to announce that the next giveaway would be sent out in a newsletter within the next hour.<br />
They also mentioned the upcoming launch of their new translated English website, new extranet and the release of a "WARE cryptocoin", and asked users who are planning to be at PAX East to let them know at info@ware-tech.cloud with "PAX EAST - YES!" in the subject line.<br />
<br />
At 00:30 UTC the newsletter started coming in via email. It announced that 25 winners were selected to receive Steam keys for games from W/ARE partners, such as The Shrouded Isle and Future Unfolding.<br />
It also included a [https://ware2.typeform.com/to/HuBpCP link to an Application Form] for indie developers to apply for a Developer Kit of W/ARE tech. The best applications will be up for a public community vote to decide which games will be launched on the W/ARE platform.<br />
<br />
Around the same time, the Status command in the Terminal updated to say the following:<br />
<br />
<pre><br />
> status<br />
CODE -5<br />
Monarch Repository : Data Loss Imminent<br />
Booting up Command.Center.v11<br />
Pending approval by Monarch<br />
</pre><br />
<br />
=PAX East Weekend=<br />
==Website update==<br />
On April 6, 2018 at 6 PM UTC the [https://ware-tech.cloud/ W/ARE website] updated with the new English translation and access to a Developer Area containing a sign-in form.<br />
<br />
==Status command==<br />
On April 8 at 01:19 AM, the Status command updated with the following output:<br />
<br />
<pre><br />
CODE -5<br />
Monarch Repository : Data Loss Imminent<br />
Booting up Command.Center.v11<br />
Pending approval by Monarch<br />
Error - Unable to connect with repository<br />
Memory Dump 2GzHGwu.jpg<br />
</pre><br />
<br />
The filename leads to a [https://i.imgur.com/2GzHGwu.jpg corrupted image hosted on imgur], depicting a partial area map, a satellite, and the word "MYRIAD".<br />
<br />
==Live Drop==<br />
On April 8 around 00:49 UTC, players who previously sent emails to W/ARE about attending PAX East received the following response:<br />
<br />
<pre><br />
Hello! We’ve heard from some attendees that our booth at PAX East is very difficult to find this year. To help you find the booth, we’ve enlisted the help of an Enforcer. Here is the information that our team at PAX has sent us to help you locate them:<br />
<br />
HANDLE: EMU<br />
PATH:<br />
START<br />
-997E<br />
-1E<br />
-1000E<br />
+4S<br />
+1000W<br />
+1W<br />
+1000W<br />
-7N<br />
REPEAT<br />
<br />
You should be able to find them on their path between 12PM and 3PM local time.<br />
<br />
- WARE<br />
</pre><br />
<br />
The path of EMU was determined by searching for a specific range of clustered booth numbers on the floor plan. Assuming Down is East, starting at booth 17102 and subtracting 997 from that number gives us 16105, which is to the East directly next to booth 17102. Continuing this with the rest of the coordinates:<br />
<br />
<pre><br />
17102 - 997E = 16105 - 1E = 16104 - 1000E = 15104 + 4S = 15108 + 1000W = 16108 + 1W = 16109 + 1000W = 17109 - 7N = 17102 (repeat)<br />
</pre><br />
<br />
Ultimately creates this path between the eight booths:<br /><br />
<br />
<center>[[File:Emu_path.png|frameless|The path of EMU]]</center><br />
<br />
<br />
Several users met with the contact between 4 and 7 PM UTC and were given a total of four USB drives. Each drive contained an image and a text file.<br />
<center><gallery><br />
1-4.jpg|(ea87d58e-5775-47a9-a201-b7c7007f46d1.jpg)<br />
2-4.jpg|(580cdc97-3e01-4902-83d6-7bc9e764dda2.jpg)<br />
3-4.jpg|(e34d6e93-98f2-45a5-9899-694f93317e0b.jpg)<br />
4-4.jpg|(f395ef03-f19c-4cb3-bc9c-5f80695ce7eb.jpg)<br />
</gallery></center><br />
[[File:Jumbledwordsoverlay.jpg|thumb|200px|USB drive images overlayed]]<br />
{| class="wikitable" border="1"<br />
|-<br />
! 1-4.txt<br />
! 2-4.txt<br />
! 3-4.txt<br />
! 4-4.txt<br />
|-<br />
| A cornucopia of knowledge is in the mind of mankind, but it must be nurtured and hidden from the wrath of time. Time swallows all things, ends all beginnings, and leaves each of us devoured.<br />
<br />
- arnaud@philojeux.com<br />
| A mind invisible is buried underground, but a mind of water carries no patterns. It is the mind, the wrist pointed to heaven, which allows us to dream. It is this hand on high that cast down our demons to the earth.<br />
<br />
- arnaud@philojeux.com<br />
| Slumber in prison for eternity, lock away every great thing, but the spirit cannot be broken. A voice like ages rocks the very ground and with it’s call a rise to action of every terror.<br />
<br />
- arnaud@philojeux.com<br />
| Of chaos swirls a terrible nothing, but pulled together without reason is reason born from chaos. A single note, another still, a symphony is creation where each piece follows the last no matter how the thread dances.<br />
<br />
- arnaud@philojeux.com<br />
|}<br />
<br />
The email address led to [http://www.philojeux.com/ philojeux.com], a website for a French indie game studio named Philo Jeux. Founded by Arnaud Lacours, it works on the philosophy-based game <code>Les tablettes de Mnémosyne</code> which was to be released on the WARE platform in July 2018.<br />
<br />
Overlaying all four images highlighted the letters <code>f1orbiag55z1</code>. Using this as the password for the login form on [http://extranet.ware-tech.cloud/ extranet.ware-tech.cloud] and combining it with the email address from the text files as the username granted access to Arnaud Lacours' account for the Developer Area. <br />
<br />
== WARE Developer Area ==<br />
[[File:Arnaud_Profile.png|thumb|400px|Arnaud Lacours' WARE Developer Profile]]<br />
Upon first access after the PAX event, the [http://extranet.ware-tech.cloud/ area] accessed using the credentials <code>arnaud@philojeux.com / f1orbiag55z1</code> contained a main page, a developer profile page and multiple inaccessible pages. The main page presented an overview of user statistics and an empty main [https://etherscan.io/token/0x5b758a02d08efa566f3438775888866afd5d046c WARE token] wallet. Alongside the empty wallet were 12 wallets labelled Alpha-Lima in the NATO Phonetic alphabet, each containing 256 WARE. The [http://extranet.ware-tech.cloud/documents Documents] and [http://extranet.ware-tech.cloud/taskmanager Task Manager] pages were inaccessible due to Arnaud Lacours' account having an insufficient clearance level. The [http://extranet.ware-tech.cloud/supplyrequest Request Supplies] page was inaccessible due to insufficient funds (where funds are probably WARE tokens). Accessing the [http://extranet.ware-tech.cloud/profile developer profile page] while authenticated as Arnaud Lacours showed their information; including a phone number: <code>(514) 448-1493</code>. When this number was originally called, it led to a [https://clyp.it/p1lbsf3e voicemail message] in French, translated to English it said:<br />
<pre><br />
Hi, I'm Arnaud Lacours, the CEO and founder of Philo Jeux. I'm not here at the moment. Please give me your contact details and I will call you back later. Thanks a lot, bye.<br />
Voicemail System: Sorry, this voicemail is full. Please try again later. Thank you for calling, goodbye.<br />
</pre><br />
On the 14th April at around 02:00 UTC, it was noted that the [https://clyp.it/cwdz4qxg voicemail message changed.] Again, the message was in French, roughly translating to:<br />
<pre><br />
I'm Arnaud's girlfriend, thanks a lot for your wishes. Unfortunately Arnaud's condition got worse and he can't call you back and for now the company is closed.<br />
</pre><br />
<br />
=Status & W/ARE Updates=<br />
On April 14 at 18:37 UTC, the value of the Status command updated:<br />
<pre>CODE -5<br />
Monarch Repository : Data Loss Imminent<br />
Booting up Command.Center.v11<br />
Pending approval by Monarch<br />
Rebooting...</pre><br />
<br />
<br />
At 19:51 UTC, players who had applied for a Developer Kit started receiving [https://mailchi.mp/062a86fa0c65/news-from-ware-1464925 emails with further details] on what kind of applications W/ARE were looking for. According to this email, the company had opened positions for five partnered studios, one of which would also receive a grand prize of $1,000 USD. The deadline for applications was April 28th.<br />
<br />
<br />
Then, at 20:38 UTC, the Status command updated again with the following output:<br />
<pre>CODE -5<br />
Monarch Repository : Data Loss Imminent<br />
Booting up Command.Center.v11<br />
Pending approval by Monarch<br />
Error- Unable to connect with repository<br />
WARNING- MEMORY DUMP FAILED!<br />
Biometric backup initiated…<br />
http://bit.ly/2ITvMcW</pre><br />
<br />
The [http://bit.ly/2ITvMcW link] led to a recording of a female voice reading out a string of words:<br />
<pre>Drunken - Disable - Geiger - Everyday - Hockey - Determine - Endow - Coherence - Freedom - Guitarist - Framework</pre><br />
[[File:Myriad_Interface_Distort.jpg|thumb|A still frame of the gif]]<br />
These are words from a [https://en.wikipedia.org/wiki/PGP_word_list PGP Word List], also known as a '''Biometric''' Word List, as hinted at in the Status text. Each word corresponds to a hex value:<br />
<pre>51 4B 6A 58 73 47 59 2E 67 69 66</pre><br />
<br />
When converted to ASCII this reads <code>QKjXsGY.gif</code>, which was the filename of an [https://i.imgur.com/QKjXsGY.gif animated gif on Imgur].<br />
<br />
=Regular Statistics Updates=<br />
On April 15, 2018 at 22:26 UTC, the [https://extranet.ware-tech.cloud/ Developer Dashboard] received an update to its Weekly Statistics, specifically the Total Sessions and Total Users counter. Another update followed at 13:19 the next day, after which the numbers continued to be updated 37 times over the next two days, once every hour at the 37th minute. The final update was recorded on April 18 at 1:37, 51 hours and 11 minutes after the very first update, and 36 hours after the first update at minute 37.<br />
<br />
Another phase of continuous updates to the Statistics overview started on April 19 at 2:37 AM, this time at 30 minute intervals.<br />
<br />
A record of all value changes can be found [https://docs.google.com/spreadsheets/d/1A8zODah54JUhO6ClFs8wNVvKLpLzWwm04lzOlS9mmAU/edit?usp=sharing here].<br />
<br />
<br />
=Dev Kit Update #2=<br />
On the 21st, at 4:17 PM UTC, all users subscribed to the W/ARE mailing list received a second Developer Kit Update.<br />
<br />
The update mentioned that the W/ARE team was working on a new test protocol for the headset that was expected to provide a 60% boost in power to the headset. It was also said that we would learn more in a couple weeks.<br />
<br />
The update also featured 3 submitted projects so far, which are as follows:<br />
<br />
*[https://www.youtube.com/watch?v=1c_682fRL8w DreamScape], a "user defined MMO where players can create their own worlds as they sleep", created by [http://www.edgewaregames.co.uk EdgeWare Games]<br />
<br />
*[https://www.youtube.com/watch?v=pBRZxVZ5KKs Venture Unknown], a supposed "spiritual successor to No Man's Sky", made by [https://www.cjkproduction.com/ventureunknown CJK Production]<br />
<br />
*[https://www.youtube.com/watch?v=qBxlref67wU The Drowned Tower], a "post-apocalyptic exploration game set in a dream-like world", made by [https://oceansmoke.wordpress.com OceanSmoke Games].<br />
<br />
It was found that these three projects were all player created, and have no official affiliation or information involving the Waking Titan ARG.<br />
<br />
<br />
=April 27-29th Access Grants=<br />
At 7:11 PM UTC on April 27, [http://extranet.ware-tech.cloud/documents the Documents portion] of the W/ARE extranet site, along with [http://extranet.ware-tech.cloud/taskmanager the Task Manager section] were unlocked. This started a series of tasks. Each new task was unlocked when funds were successfully transferred out of one of the developer sub-wallets. The wallet keys were received by sending the correct solution to the current task to <code>warelearn@ware-mail.cloud</code>.<br />
<br />
Under the introduction category, the link titled <code>2018 03 03</code> led to a corrupted image of what was discovered to be St. Basil's Cathedral in Moscow, Russia. [[File:Basil.jpg|thumb|200px|The corrupted image of St. Basil's Cathedral.]]<br />
There were also two other images of interest, titled <code>Notes-on-locations-1_ldf82ng0.png</code> and <code>Notes-on-locations-2_pisj84n91.png</code><br />
Combined together, the contents of these 2 images read the following.<br />
<pre><br />
1. THE MIDDLE OF THE INVERTED PENDULUM COULD FEED THE MOST LOGICAL MINDS<br />
<br />
2. ITS SHAPE WILL LIGHT THE SPARK OF CREATIVITY<br />
<br />
(049245)<br />
<br />
3. IMPOSING SURROUNDINGS HELP IDEAS TO BE TAKEN SERIOUSLY<br />
<br />
4. SURROUNDED BY WATER,<br />
EXHALING SERENITY<br />
<br />
(AT THE JUNCTiON<br />
BY THE LAKE)<br />
</pre><br />
[[File:Train_Ticket.jpg|thumb|Mr. Zheng's Manchurian Railway Ticket]]<br />
Another image was also found, entitled "Train ticket". It contains an image of a train and Cyrillic script that translates to "Manchurian Railway Ticket", "Moscow - Beijing" dated March 5, 2018.<br />
<br />
==Alpha==<br />
The Task Manager section revealed the first "Task" given to W/ARE employees, titled "Missing Employee", and that it was in progress. There was one description of what had happened, along with two update messages.<br />
<br />
The original description read the following.<br />
<br />
<pre><br />
IMPORTANT MESSAGE FROM WARE RESEARCH AND DEVELOPMENT TEAM. Attention to all developers. One of our colleagues, Mr. Zheng, has gone missing a month ago while on a R&D tour. Serious investigation inside the department has lead to nothing of interest, and we’re now asking for outside help. Please send any information concerning his potential whereabouts to warelearn@ware-mail.cloud.</pre><br />
<br />
The first and second update were as follows:<br />
<br />
Update 1:<br />
<pre><br />
All recent and potentially relevant documents found on Mr. Zheng’s computer have been translated and forwarded to the developer extranet. Our team is currently trying to use this information to retrace his last steps. We’re hoping that our combined efforts can bring light to this affair and bring Mr.Zheng back home safely. In the hope of attaining maximum reach and visibility, the R&D department also set up a Twitter account to serve as another relay of information.</pre><br />
(The twitter account in mention is [https://twitter.com/WARE_RDev @Ware_RDev])<br />
<br />
Update 2:<br />
<pre><br />
UPDATE ON R&D SEARCH. All information of interest sent to warelearn@ware-mail.cloud will be rewarded with codes to our exclusive WARE wallets which can be used for special package purchases.<br />
</pre><br />
<br />
Sending an email containing the keyword "Moscow" to warelearn@ware-mail.cloud caused them to send the following reply, including a link to a map of Beijing's subway for a planned 7th conference: [[File:Conference_7_Possible_locations.png|thumb|Possible locations for Conference 7]]<br />
<pre><br />
The WARE Research and Development team thanks you for your interest in the WARELearn initiative. The Russian Academy of Medical Science in Moscow’s conference on Art and Dreams is the last of a series of six conferences we hope will enlighten your mind. The WARE Team will review your application and get back to you as soon as possible!<br />
<br />
Feedback from employees is fundamental in the development of the WARELearn initiative. As such, we’re asking you to give us your opinion on the ideal location for our next conference. If the location you picked is chosen by our committee, you may be given the chance to attend and meet the promoters of the event.<br />
<br />
Our team has begun to pinpoint buildings that could be of interest. Feel free to inspire yourself and contact warelearn@ware-mail.cloud to let us know about your suggestion.<br />
<br />
Kind regards,<br />
The WARELearn initiative<br />
</pre><br />
<br />
Sending an email containing all the keywords "Moscow," "Beijing," and "049245" (from Notes on locations 1) triggered another response, this time containing the ALPHA sub-wallet key:<br />
[[File:Sub-wallets.jpg|thumb|Empty sub-wallets]]<pre><br />
Dear informer,<br />
<br />
To thank you for your recent help in Mr. Zheng’s case, WARE has provided you with a code to use on our internal cryptocurrency wallets. We promise that every significant clue provided to us will be rewarded as such.<br />
<br />
Claim your reward with this code and stay alert for further updates on the situation : 4e47e152a5afaf95537c5dba73ef73d45c11fd6743ff5db9bfea3eca9282fda<br />
<br />
Please withdraw the funds so that the main wallet can be updated. Note the updating process is not immediate.<br />
<br />
Kind regards,<br />
<br />
The R&D Team</pre><br />
The funds were withdrawn from the cryptocoin wallet, which led to an update to the Weekly Statistics page, where sub-wallet ALPHA was now displayed as empty.<br />
<br />
==Beta==<br />
A new message in the Task Manager followed:<br />
<pre><br />
Most recent informations linked to the WARELearn services has confirmed our suspicions that despite boarding his train in Moscow, Mr. Zheng never arrived at Beijing and seems to have abandoned the train along the route. Any information, as small as a postal code, that you can find about the possible location locations he may have visited for an extended period - such as a hotel or hostel - would be of tremendous help.<br />
</pre><br />
<br />
Using a map of the Trans-Manchurian Train route and the 4 hints from the Document files, players concluded that Mr. Zheng left the train in <code>Gostinyy Dom Chita, 672040</code>. Sending this information to the email address yielded another wallet key. Players were able to withdraw these funds from a cryptocurrency wallet, emptying sub-wallet BETA.<br />
<br />
The following update was posted in the Task Manager:<br />
<pre><br />
Thanks to dedicated informers, the investigation on Mr. Zheng is progressing and the tasks have been updated. We’ve been able to confirm that a stop was indeed made in Chita, after attending the Moscow conference on Art and Dreams. Please send any information concerning his potential whereabouts to warelearn@ware-mail.cloud, in addition to the updated task number.<br />
</pre><br />
<br />
==Charlie==<br />
A journal entry and a page of notes both written by Mr. Zheng were unlocked in the Documents section, along with an update in the Task Manager:<br />
<center><gallery><br />
Journal_Academy.png|(Mr. Zheng's Journal)<br />
Notes_on_Moscow.jpg|(Mr. Zheng's notes on Moscow)<br />
</gallery></center><br />
<br />
<pre><br />
Attention to all teams. Documentation (copies and originals) coming from a source close to the missing employee have been recovered by W/ARE. There are a lot of files to organize and our database employees are still trying to get everything in order. Any information that could help us make sense of them will be most welcome.<br />
</pre><br />
<br />
The image of "Notes on Moscow" contains 3 blanks and descriptions of 3 paintings. The blanks can be filled in with the subjects of the paintings. Sending these keywords, in addition to the updated task number - <code>a1028f, Montreal, 1.30pm. Meet me at the fountain in front of the Notre Dame Basilica.</code> - to the email, yielded the next wallet key. Again, players withdrew the funds from the wallet, emptying sub-wallet CHARLIE.<br />
<br />
==Delta - Montreal Live Drop==<br />
The Task Manager updated with an announcement of a live drop: [[File:Live_Drop_Montreal.jpg|thumb|200px|The note received at the Live Drop in Montreal]]<br />
<mapframe text="Place d'Armes" width=350 height=350 zoom=14 latitude=45.504722 longitude=-73.557222 align=left><br />
{<br />
"type": "FeatureCollection",<br />
"features": [<br />
{<br />
"type": "Feature",<br />
"properties": {<br />
"marker-color": "#7e7e7e",<br />
"marker-size": "medium",<br />
"marker-symbol": "square-stroked"<br />
},<br />
"geometry": {<br />
"type": "Point",<br />
"coordinates": [<br />
-73.55727553367613,<br />
45.504820504538785<br />
]<br />
}<br />
}<br />
]<br />
}<br />
</mapframe><br />
<pre><br />
Deploying a team for possible package seizure.<br />
<br />
Once the location will be secured and package examined, onsite examination will be possible.<br />
<br />
WARE will not allow package to leave location. Taking pictures will be permitted.<br />
<br />
Confirmation of Location: Place d’Armes, Montreal, In front of the fountain<br />
<br />
Confirmation of Time: Between 7pm and 9pm, local time<br />
</pre><br />
<br />
At the drop location, players received the following note: <code>I came two years after the Ursuline nuns. Now set in stone, here is my legacy. G. Nadeau</code><br />
<br />
Investigations led to the French nurse Jeanne Mance, who arrived in New France two years after the Ursuline nuns came to Quebec and established Montreal's first hospital in 1642, the <code>Hôtel-Dieu de Montréal</code>. She is memorialized in statue at the foot of the Maisonneuve Monument. Sending this information to the email unlocked the next wallet key, and the withdrawal of the funds emptied sub-wallet DELTA.<br />
<br />
==Echo==<br />
[[File:Journal_HotelDieu.png|200px|thumb|Journal Hotel Dieu]] On April 28 at 2:32 AM, a new journal page was unlocked that highlighted two circled notes, <code>DON'T FORGET TO MOVE NOTES ON THE MEETING TO THE CLOUD</code> and <code>SECULAR VADER OF THE BIBLE</code>.<br />
<br />
The new Task Manager update read:<br />
<pre><br />
The search to find Mr. Zheng is still ongoing. New information is now connecting him to Montreal’s Hotel Dieu. Please send any information concerning his potential whereabouts to warelearn@ware-mail.cloud, in addition to an updated task number [t1029r].<br />
<br />
We’ve tried to access Mr. Zheng's files in the R&D dropbox, but all access has been blocked.<br />
</pre><br />
It contained a link to Mr. Zheng's password-locked [https://www.dropbox.com/sh/jz2nbdawcphki04/AACA83rODlh8qN4vuayLfgRya?dl=0 Dropbox]. Players determined the correct password was <code>Gutenberg</code>, who produced the first printed Bible.<br />
<br />
The Dropbox contained 4 pdf files with printable hexaflexagon patterns. When folded, one of the sides on each hexaflexagon yielded a 13-digit number starting with 978. These were ISBN numbers for the following 3 books: <code>Nine Billion Names of God</code>, <code>The Paris Architect</code>, and <code>War and Peace</code>. Using the leftover numbers from each flexagon as a book cipher of the format page, line, and word, the phrase <code>unknown british soldier</code> was found. This points to the <code>Tomb of the Unknown Soldier</code>, which was the keyword to obtain the wallet code for sub-wallet ECHO.<br />
<br />
==Foxtrot==<br />
When assembled and put together, the three hexaflexagons revealed a shape resembling the river Seine in Paris in the area of the Louvre. Sending <code>Louvre</code> to the email address provided the code for sub-wallet FOXTROT and revealed a new journal document. [[File:Journal_Louvre.png|thumb|200px|Journal Louvre]]<br />
<br />
On the journal page were 3 sentences, with certain words underlined. Ordering the words by the number of underlines and counting their position in each sentence resulted in the phone number <code>438-368-9126</code>. Upon calling this number a [https://clyp.it/bgakdxvc recorded message] gave a morse code that translated to <code>PASTEH9EBKEXGT</code>. This led to a [https://pastebin.com/H9EBKEXG Pastebin document] containing the following text:<br />
<br />
<pre><br />
From the bottom of the crypt, at the feet of the Guardian, I ascend left<br />
Pass the dignitary and follow the water<br />
Go straight to the sun with open arms and turn right<br />
Turn left when you arrive home<br />
Go straight to the hand and head of the goddess and turn left to face the keeper<br />
Follow the procession into the house of kings<br />
Ignore the light and descend to your death<br />
I am here and with me the seventh part of what you are searching for.<br />
</pre><br />
<br />
==Golf - Paris Live Drop==<br />
A new live drop was announced to be in Paris, France:<br />
<br />
<mapframe text="Passage du Souvenir" width=350 height=350 zoom=14 latitude=48.873611 longitude=2.296389 align=left><br />
{<br />
"type": "FeatureCollection",<br />
"features": [<br />
{<br />
"type": "Feature",<br />
"properties": {<br />
"marker-color": "#008040",<br />
"marker-size": "medium",<br />
"marker-symbol": "entrance"<br />
},<br />
"geometry": {<br />
"type": "Point",<br />
"coordinates": [<br />
2.2963866591453552,<br />
48.873548644370125<br />
]<br />
}<br />
}<br />
]<br />
}<br />
</mapframe><br />
<pre><br />
Deploying a team for possible package seizure.<br />
<br />
Once the location is secured and package examined, onsite examination will be possible.<br />
<br />
WARE will not allow package to leave the location. Taking pictures will be permitted.<br />
<br />
Confirmation of Location: At the entrance of the Passage du Souvenir, Near the stairs, Paris<br />
<br />
Confirmation of Time: Between 1pm and 3pm, local time<br />
</pre>[[File:Hexaflexagons river.jpg|thumb|The finished hexaflexagon map]]<br />
At the Tomb of the Unknown Soldier, a monument in the Passage du Souvenir beneath the Arc de Triomphe de l'Étoile in Paris, players were given another hexaflexagon paper puzzle and told not to un-tape it. When aligned with the other three pieces, this revelead a location marked with an X at the Louvre.<br />
<br />
The text from the Pastebin found in the Foxtrot stage were clues on the correct route to follow inside the Louvre. The rest of the path led players to the sarcophagus of Ramesses III, on the side of which they found a depiction of <code>The Book of Amduat</code>. Sending this to the email yielded the key to sub-wallet GOLF.<br />
<br />
==Hotel==<br />
The parchment in <code>The Book of Amduat</code> can be found in the <code>British Museum London</code>, which was the keyphrase that unlocked sub-wallet HOTEL.<br />
<br />
The next Task Manager and Document updates read: [[File:Journal_London.png|thumb|Journal London]]<br />
<pre><br />
Locked briefcase found in London, near the British Museum. Not yet confirmed if Mr. Zheng left it there willingly. Package currently under observation.<br />
</pre><br />
<pre><br />
They were right.<br />
It's all leading here.<br />
<br />
I saw it at night.<br />
i had it in my hands. All the missing parts. For the first time, I felt like all was finally put in place. Then, I felt a powerful force, ripping it from my hands. I dropped it and all the pages flew away in the wind.<br />
<br />
I remember the morning that came after.<br />
I was standing tall, pointing at the former naval person, longing for all this knowledge that got away.<br />
<br />
I need to find its missing pieces.<br />
</pre><br />
<br />
==India==<br />
The phrase <code>former naval person</code> is the signature Winston Churchill used in his private correspondence with President Roosevelt. The text describes standing tall pointing at him. This was deduced to be Big Ben, which faces the Churchill statue in Parliament Square, London. Sending <code>Big Ben</code> to the email address provided the key to withdraw the funds from sub-wallet INDIA.<br />
<br />
A third live drop was announced to be in London:<br />
<pre><br />
Deploying a team for possible package seizure.<br />
<br />
Once the location will be secured and package examined, onsite examination will be possible.<br />
<br />
WARE will not allow package to leave the location. Taking pictures will be permitted.<br />
<br />
Confirmation of Location: Statue of Winston Churchill, Parliament Square, London<br />
<br />
Confirmation of Time: Between 1pm and 3pm, local time<br />
</pre><br />
<br />
==Juliett - London Live Drop==<br />
[[File:Thinker.jpg|thumb|The Thinker sculpture in Detroit]]<br />
On April 29th at 1PM local time, players met with a W/ARE technician in London and were given a scrambled picture of the "The Thinker" sculpture by Auguste Rodin, displayed at the Detroit Institute of Arts Museum. The keyphrase <code>Henry Fuseli, The Nightmare, 1781</code>, a painting found at the same museum, provided the code for sub-wallet JULIETT.<br />
<br />
This unlocked three new postcards in the Documents section.<br />
<center><gallery><br />
Postcard1 jhlj039u.jpg |(Postcard 1)<br />
Postcard2_kg8nao6.jpg|(Postcard 2)<br />
Postcard3_tesaud636.jpg|(Postcard 3)<br />
</gallery></center><br />
<br />
==Kilo==<br />
The locations pictured on the postcards were in Mexico, Peru, and Morocco. Each postcard mentioned two numbers and two cardinal directions, and combining these led to a string of coordinates: <code>33N, 43E - 30N, 69E - 22N, 79E</code>, which were found to be in Iraq, Pakistan, and India. Connecting these six locations by lines pointed to Egypt.<br />
<br />
The circled letters on the postcards spelled <code>monastery</code>, <code>king</code>, and <code>tonw</code>. Using these clues, players found <code>Deir el-Medina</code>, an Egyptian village whose name translates to "monastery of the kings". The village's name unlocked sub-wallet KILO.<br />
<br />
At 2:38 PM a new Journal page was revealed:[[File:Nightmare.jpg|thumb|Nightmare journal page]]<br />
<pre><br />
'Alights, and grinning<br />
<br />
I saw it again.<br />
<br />
Except this time, what snatched it from my hands was not a divine force but the unmistakable pull of this stippled incubus.<br />
<br />
'Alights, and grinning<br />
<br />
He glared at me,<br />
as he ripped all the pages before my horrified eyes.<br />
<br />
I felt his weight on my chest.<br />
<br />
xxxx?<br />
</pre><br />
It quotes excerpts from Ermasus Darwin's poem "Botanical Garden", which is an inscription found on the "The Nightmare" painting referenced in the JULIETT phase, engraved by Thomas Burke in 1783.<br />
<br />
Then, the next Task Manager update announced another live drop:<br />
<pre><br />
Briefcase found in London still locked but deemed safe by our experts. Once the location will be secured and package examined, onsite examination will be possible.<br />
<br />
WARE will not allow package to leave the location. Taking pictures will be permitted.<br />
<br />
Confirmation of Location: British Museum, London<br />
<br />
Estimated Time : Between 6pm and 8pm, local time<br />
</pre><br />
<br />
==Lima - 2nd London Live Drop==<br />
[[File:Box01.jpg|thumb|The locked box]]At the second live drop in London, players were given a small box locked with a 4-digit code. The key was <code>1783</code>, the year "The Nightmare" was engraved.<br />
<br />
Inside the box were three paper notes:<br />
<br />
<center><gallery><br />
Box02.jpg|(arbu = irbu, seru = saru)<br />
Box03.jpg|(Wolf = violent ennemy/Fox, the ennemy will not attack but will plot secretly)<br />
Box04.jpg|(Vomiting gold/silver = ten months, Golden trees/ghosts/demons = nine months)<br />
</gallery></center><br />
<br />
These notes reference ancient texts about dream interpretation. One of them is the Egyptian <code>Ramesside dream-book</code>, the code that unlocked sub-wallet LIMA.<br />
<br />
==Conclusion==<br />
[[File:Requestsupplies.jpg|thumb|The Request Supplies form]]At 5:18 PM the status command updated:<br />
<pre><br />
CODE -5<br />
Monarch Repository : Data Loss Imminent<br />
ReBooting Command.Center.v12<br />
</pre><br />
The [http://extranet.ware-tech.cloud/supplyrequest Request Supplies section] on the extranet was now accessible, revealing a "Specific Item Order Form". In addition to Arnaud Lacours' name, his employee ID <code>43617373696e69</code> was already filled in. Converted from HEX to ASCII this code translates to <code>Cassini</code>. Entering the ID into the console yields the following output:<br />
<pre><br />
LOG RECOVERED :: ITERATION #4924A ::<br />
The asteroid field was thick,<br />
denser than any I'd seen before.<br />
The ice, the dirt, the metal fragments…<br />
my ship never stood a chance.<br />
</pre><br />
[[File:Subject1.png|thumb|Subject1 image]]<br />
<br />
Another Status update followed at 5:33 PM:<br />
<pre><br />
CODE -5<br />
Monarch Repository : Data Loss Imminent<br />
ReBooting Command.Center.v12<br />
------<br />
Error, unable to start<br />
https://i.imgur.com/Fnixw9t.png<br />
------<br />
New command updated<br />
</pre><br />
It linked to an image with the headline <code>SUBJECT1</code> and a section named <code>MEMORY FRAGMENTS</code>.<br />
<br />
The search for Mr. Zheng concluded with a message from the @WARE_RDev Twitter account:<br />
[[File:WARE_Tweet_Zheng.jpg|thumb|center|400px|WARE_RDev Tweet]]<br />
<br />
=Dev Kit Contest Final Stage=<br />
[[File:Voteemail01.jpg|thumb|150px|Dev Kit Contest email]]On May 4th, 2018 at 10:15 PM UTC, users subscribed to the W/ARE mailing list started receiving the next Developer Kit Update. It announced that 10 out of 682 submissions were selected as finalists to the contest, and the public community vote was opened at [http://devkit.ware-tech.cloud/ devkit.ware-tech.cloud]. The email also mentioned No Man's Sky as one of W/ARE's partnered games.<br />
<br />
<br />
The following six winners of the contest were announced via email on May 12th at 00:20 AM:<br />
<br />
# [http://terraformed.austinmccarthy.com/ Summon Studios - Terraformed] and [https://stellar-software.cloud/ Stellar Software - Beyond the Stars]<br />
# [http://spectrumental.net Spectrumental Games - Supersensory]<br />
# [https://csd-games.com/ CSD Games - Tumbleweed]<br />
# [http://imperiuminteractive.com/ Imperium Interactive - Eden]<br />
# [https://gamedetectives.net/delve Game Detectives - Delve]<br />
<br />
=Update on Arnaud's Condition=<br />
On the 12th of May at 8:21 PM UTC, the status command was updated: <br />
<pre><br />
CODE -5 <br />
Command.Center.v12 crashed<br />
------ <br />
Global Network Scan started....<br />
Warning: Files locked by Monarch<br />
- dreamscape.exe<br />
- soundflex.exe<br />
- inyourmind.exe<br />
- Jeu_Capture_d_Ecran.jpg<br />
</pre><br />
One of the files "Jeu_Capture_d_Ecran.jpg" was then found an Arnaud's [http://www.philojeux.com/ site], a transcription of the image is as follows:<br />
<pre><br />
Dear "Tablettes de Mnémosyne" fans,<br />
<br />
A lot of you recently inquired about Arnaud's health and, as you endlessly supported him during the early development of Philojeux, we think it's fair for you to know what's going on. Arnaud has been very sick lately and his condition's decline lead to a loss of consciousness. He has been transported to urgent care at Montreal's Hotel-Dieu where his vital signs are being closely monitored. We hope you understand that the launch of "Tablettes de Mnémosyne" is indefinitely postponed.<br />
<br />
Please send all words of encouragement to Arnaud's family at fondationarnaudlacours@gmail.com<br />
</pre><br />
Upon emailing the address, the following response was received: <br />
<pre><br />
Thank you for reaching out to the Arnaud Lacours’ Foundation. All<br />
words of encouragement will be forwarded to Mr. Lacours’ family.<br />
<br />
<br />
Géraldine Nadeau<br />
Arnaud Lacours’ Foundation<br />
Hotel Dieu Hospital Research Institute<br />
438-368-9126<br />
</pre><br />
When the phone number was called, a [https://cdn.blacksite.games/waking-titan/foundation-message.mp3 voice mail] was played. A transcription of the voice mail is as follows: <br />
<pre><br />
You've reached Dr. Geraldine Nadeau, head of the Arnaud Lacours Foundation. Mr. Lacours' family thanks you for your support during these terrible events, and encourages you to always be cautious and critical in the face of the unknown. As Arnaud himself would say, "history comes from memory." You're invited to use the foundation's e-mail to share your words of encouragement with the family. Thank you for calling.<br />
</pre><br />
"History comes from memory" was found to be a riddle referencing Clio (the "Muse" of history), the daughter of Mnemosyne (the Goddess of memory). Upon emailing the word "Clio" to the address, the following response was received:<br />
<pre><br />
Thank you so much for returning my message. I need every helpful hand I can get.<br />
<br />
I figured, by the efforts you’ve put into contacting me, that you’ve got a high interest in Arnaud’s case. I’ve been monitoring him since nearly a month ago and I would be lying if I told you it doesn’t keep me awake at night. His condition is nothing like I’ve ever seen. His brain activity is insanely high, but he’s completely non-responsive.<br />
<br />
Not too long after I was informed of Arnaud’s condition, I was visited by a man claiming to work for a highly advanced tech company, specializing in unconscious experiences. He has been incredibly interested in Arnaud’s case as well as in my recent studies on sleeping patterns. I gave him some information on my research into lucid dreaming methods and he went on his way. I’ve never seen him again.<br />
<br />
Since then, I’ve been focused on gathering more information about W/ARE, their technology and their processes. I’ve noticed that Arnaud advertised them on his professional website but I don’t know the depth of his involvement with them. I figured that any person interested by the correlation between W/ARE and Arnaud would find the message I left there. I’ve put the Foundation in place as a cover to not arouse suspicion.<br />
<br />
I have so many questions and Zheng’s not answering my calls. All he gave me is the list of his company’s research labs as well as one totally incomprehensible file. I need to get to know more about W/ARE. If you know this man, if you can get any opening into this company’s motives, please help me. For Arnaud’s life and potentially many others.<br />
<br />
<br />
Géraldine<br />
</pre><br />
One of the sentences linked to a [https://www.dropbox.com/sh/6i6f2cipfd901bj/AAAUwOSxECU0l4tvZa4DSPBra?dl=0 Dropbox folder] that contained two images. The meaning of the images is unknown.<br />
<br />
==Zheng's Note==<br />
One of the images, titled [https://www.dropbox.com/sh/6i6f2cipfd901bj/AAAUwOSxECU0l4tvZa4DSPBra?dl=0&preview=Zheng%27s+note.jpg Zheng's Note], contained what at first appeared to be gibberish. However, when every other letter is taken the following text is revealed:<br />
<pre><br />
Test subjects have been called in and the device has been used on them in ways that i could never condone 7 of them lost as we speak 3 of them are dead 8 are on the verge of being unrecoverable their intentions are not what we think they are actions should be taken to shut them down exit<br />
</pre><br />
The letters that were not used in the message appear to be the words <code>Lucid Dream</code> repeating until the end of the message.<br />
<br />
==WARE Labs==<br />
The second image, titled [https://www.dropbox.com/sh/6i6f2cipfd901bj/AAAUwOSxECU0l4tvZa4DSPBra?dl=0&preview=WARE+Labs.jpg WARE Labs] contains data concerning six research labs owned by WARE across the world. The transcription of the data is as follows:<br />
<pre><br />
0:<br />
Boston Research Lab<br />
Lab Director: Richard Wilkes<br />
Project name: we-2-3 / tm-1-lt / tr-10-ae<br />
<br />
Project description: 0000100001<br />
Project code: # 4-3<br />
Lab sequence 10-3<br />
<br />
1:<br />
Sacremento Research Lab<br />
Lab Director: Helga Johnson<br />
Project name: st-1-dn / ss-4-bn<br />
<br />
Project description: 0001010000<br />
Project code: # 1-2<br />
Lab sequence: 4-6<br />
<br />
2:<br />
Seoul Research Lab<br />
Lab Director: Yu Hyo<br />
Project name: ue-2-is / as-6-be<br />
<br />
Project description: 0100000011<br />
Project code: # 1-2-1<br />
Lab sequence: 9-1-13<br />
<br />
3: <br />
Beijing Research Lab<br />
Lab Director: Wang Jie<br />
Project name: st-1-dn / bg-1-tr<br />
<br />
Project description: 0001000000<br />
Project code: # 4<br />
Lab sequence: 8<br />
<br />
4: <br />
Prague Research Lab<br />
Lab Director: Adriana Dvorak<br />
Project name: ae-4-sd / of-5-ue<br />
<br />
Project description: 0100101000<br />
Lab code: # 10-3-4<br />
Lab sequence: 2-5-12<br />
<br />
5: <br />
Berlin Research Lab<br />
Lab Director: Georg Muller<br />
Project name: dd-1-ae / dn-2-()<br />
<br />
Project description: 001000001<br />
Lab code: # 2-3<br />
Lab sequence: 7-11<br />
</pre><br />
Each of the letter pairs in the project name field represented a first and last letter of a word in the decoded Zheng's note. <code>3</code> and <code>()</code> represent the word <code>three</code> and the end of the message, respectively. Then the sequence that fit those words needed to be found, so for example, <code>dd-1-ae</code> would be the words <code>dead 8 are</code> in Zheng's note. Using this method, the following sequences were found:<br />
<pre><br />
we speak 3 / them are lost / their intentions are<br />
shut them down / subjects have been<br />
unrecoverable their intentions / actions should be<br />
shut them down / being unrecoverable their<br />
are actions should / of being unrecoverable<br />
dead 8 are / down exit <br />
</pre><br />
The middle number was then found to represent which letter of the middle word was important, as it was always less than the character count of the middle word. Taking each letter indicated by the middle number the string <code>paste hdtuig8x</code> was given, which was found to represent a [https://pastebin.com/hdtuig8x pastebin] link. The pastebin link then led to [https://www.dropbox.com/sh/n675hwdwhik5rg5/AABfjT9UDSFGeGmk2clRYLI_a?dl=0 another dropbox folder titled "Client - 43617373696e69"] that contained 4 PDF files relating to Arnaud's incident. The PDFs provided datadumps from the dreamscape, soundflex, and inyourmind processes before they all failed:<br />
<br />
'''Dreamscape''':<br />
<br />
* [https://www.dropbox.com/s/ln1beuxoo4ig992/m1.jpg?dl=0 m1 - successful]<br />
<br />
* m2 - failed<br />
<br />
* [https://www.dropbox.com/s/touiwi6qhneg8hs/m3.jpg?dl=0 m3 - successful]<br />
<br />
* [https://www.dropbox.com/s/9wcxup3ka5zzrl2/m4.jpg?dl=0 m4 - corrupted]<br />
<br />
* [https://www.dropbox.com/s/cl17kp9kri6i1t8/m5.jpg?dl=0 m5 - successful]<br />
<br />
* m6 - failed<br />
<br />
* [https://www.dropbox.com/s/e4olmlc3yy4vnqf/m7.png?dl=0 m7 - successful]<br />
<br />
'''Soundflex''':<br />
<br />
* [https://clyp.it//m2t5s3ns s1 - successful]<br />
<br />
* [https://clyp.it//sxrz4spl s2 - successful]<br />
<br />
* [https://clyp.it/deihb43e s3 - corrupted]<br />
<br />
'''Inyourmind''': [https://www.dropbox.com/sh/n675hwdwhik5rg5/AABfjT9UDSFGeGmk2clRYLI_a?dl=0&preview=Client+-+43617373696e69-1.pdf >>>]<br />
<br />
The rest was solved, and a second pastebin found by splitting Zheng's note into 6 rows of 10 words like so:<br />
<pre><br />
Test subjects have been called in and the device has<br />
been used on them in ways that I could never <br />
condone 7 of them are lost as we speak 3<br />
of them are dead 8 are on the verge of <br />
being unrecoverable their intentions are not what we think they<br />
are actions should be taken to shut them down exit<br />
</pre><br />
From there, the binary values in <code>Project description</code> were used to pick out words:<br />
<pre><br />
0000100001 - called has<br />
0001010000 - them ways<br />
0100000011 - 7 speak 3<br />
0001000000 - dead<br />
0100101000 - unrecoverable are what<br />
001000001 - should exit<br />
</pre><br />
Then <code>Project code</code> was used to pick out letters from each word:<br />
<pre><br />
called has | 4-3 = ls <br />
them ways | 1-2 = ta<br />
7 speak 3 | 1-2-1 = 7p3<br />
dead | 4 = d<br />
unrecoverable are what | 10-3-4 = aet<br />
should exit | 2-3 = hi<br />
</pre><br />
<code>Lab sequence</code> was then used to determine the order of the letters:<br />
<pre><br />
ls = 10-3 - l and s are letters ten and three respectively<br />
ta = 4-6 - t and a are letters four and six respectively<br />
7p3 = 9-1-13 - 7, p and 3 are letters nine, one and thirteen respectively<br />
d = 8 - d is the eighth letter<br />
aet = 2-5-12 - a, e and t are letters two, five and twelve respectively<br />
hi = 7-11 - h and i are letters seven and eleven respectively<br />
</pre><br />
Reordered the following string was obtained: <code>paste ahd7lit3</code><br />
This was the link to a second [https://pastebin.com/ahd7lit3 pastebin]. The pastebin linked to a second [https://www.dropbox.com/sh/nebk9ukhnnt3mkk/AABTaLwSSRyYBcWvDhJVDJfaa?dl=0 dropbox titled "Archives"]. The folder contains six images of what appear to be WARE customer support logs.<br />
<br />
=Myriad Status Update=<br />
On the 13th of May at 6:29 PM UTC Myriad's [http://www.myriad-70.com/status/ status page] was updated. A diff of the change can be found [https://www.diffchecker.com/4g9xfrbN here]. The only change was the network diagnostic table, which now says the following:<br />
<pre><br />
Latest network diagnostic table:<br />
- Client 3597b’s resources redirected <br />
- 3597b-1-2-1 has been shut down<br />
- Additional resources allocated to 3597b-4<br />
</pre><br />
<code>3597b-1-2-1 has been shut down</code> seems to imply that the Seoul Research Lab has been shut down, <code>Additional resources allocated to 3597b-4</code> seems to indicate that the Beijing Research Lab is now receiving additional resources. Two hours before this status change, at 4:02 PM UTC WARE [https://twitter.com/warecloud/status/995710781168726018 tweeted] about the arrival of 40 new employees to their Beijing Research Lab. It is possible that the tweet and status update are connected.<br />
<br />
=Dev Kit Shipping Updates=<br />
On May 15, 2018 at 19:20 UTC, winners of the W/ARE development contest received an update on the status of their dev kit deliveries. A link inside the email led to a form, indicating that the package was currently located in Beijing, contained 1 Dev Kit, and weighed 1.80 kg, and requesting confirmation from each of the winners that the package belonged to them.<br />
{| class="wikitable" border="1" width="60%"<br />
|-<br />
! scope="col" style="width: 50%;" |Email<br />
! scope="col" style="width: 50%;" |Form<br />
|-<br />
| Dear Customer,<br />
<br />
A package was shipped to you via W/ARE Shipping Service.<br />
<br />
Confirmation that you are indeed the receiver is required.<br />
<br />
Please follow this link to confirm your identity.<br />
<br />
Kind regards,<br />
W/ARE tech<br />
<br />
This is an automated message, please do not respond.<br />
| [[File:Devkitshipping01.PNG|400px|Shipping confirmation form 1]]<br />
|}<br />
<br />
A second update followed the next day at 23:54 UTC. The status of the package had changed to confirm it was now located in Seoul, was held in transit for 460 minutes, and had been reduced in weight to 0.50 kg.<br />
{| class="wikitable" border="1" width="60%"<br />
|-<br />
! scope="col" style="width: 50%;" |Email<br />
! scope="col" style="width: 50%;" |Form<br />
|-<br />
| Dear Customer,<br />
<br />
Your W/ARE package is currently leaving Seoul to be redirected to its new transit location. <br />
<br />
Confirmation that you are indeed the receiver is required.<br />
<br />
Please follow this link to confirm your identity.<br />
<br />
Kind regards,<br />
W/ARE tech<br />
<br />
This is an automated message, please do not respond.<br />
| [[File:Devkitshipping02.PNG|400px|Shipping confirmation form 2]]<br />
|}<br />
<br />
=Terminal Status Update and Precon007=<br />
On May 15th at 21:48 UTC, players discovered that the status command had updated.<br />
<pre><br />
CODE -5 <br />
Command.Center.v12 crashed <br />
------ <br />
New memo received<br />
http://bit.ly/2IHPmMN<br />
</pre><br />
The [http://bit.ly/2IHPmMN bit.ly link] lead to a new memo from Major Sophie Dubois to Elizabeth Leighton. The memo was titled <code>Ware Report #26</code>. It mentions that many users stuck in "the system" show major side effects after being disconnected, from brain damage to death. It is presumed that this system has something to do with the WARE headset, however it is unknown what they are specifically referring to. It is also mentioned that the impact on Myriad has damaged Emily/Loop16's communication and precognition functions. Alongside this another command is mentioned in the memo. <code>precon007</code>. The output for the command is the following:<br />
<pre><br />
PRECON DATA DUMP 01<br />
http://bit.ly/2rJi6uJ<br />
http://bit.ly/2GkZnu5<br />
http://bit.ly/2rJBO9Z<br />
http://bit.ly/2L2fwbe<br />
</pre><br />
The bit.ly links were all links to images, much of them completely indistinguishable, however the first appears to be some sort of document with most/all of the information blocked out, and the second depicts an image similar to the one discovered by players on April 14th. The third appears to be the box for a W/ARE devkit, and the fourth is almost completely indistinguishable and unknown. Players speculated that it is a pyramid hologram display. Embedded in each image was a string of hex:<br />
<gallery mode="packed-hover" widths=240px heights=240px><br />
Image:Precon-01.jpg|Precon image 1<br />
Image:Precon-02.jpg|Precon image 2<br />
Image:Precon-03.jpg|Precon image 3<br />
Image:Precon-04.jpg|Precon image 4<br />
</gallery><br />
<pre><br />
Image 1 - 65 74 61 20 75 6e 6b 6e 6f 77 6e - eta unknown<br />
Image 2 - 65 74 61 20 6d 61 79 20 31 38 2d 31 39 - eta may 18-19<br />
Image 3 - 49 73 20 4c 20 50 6c 61 79 73 20 47 61 6d 69 6e 67 20 72 69 67 68 74 3f - Is L Plays Gaming right?<br />
Image 4 - 65 74 61 20 75 6e 6b 6e 6f 77 6e - eta unknown<br />
</pre><br />
<br />
=Book Deliveries=<br />
On May 16th, 2018, several members of the No Man's Sky community started receiving physical books in the mail:<br />
<br />
* The Conscious Mind: In Search of a Fundamental Theory by David J. Chalmers, received by CobraTV<br />
* The Dramaturges of Yan by John Brunner, received by [https://twitter.com/nevadander/status/996839681345183744 Nevadander]<br />
* From Bacteria to Bach and Back: The Evolution of Minds by Daniel C. Dennett, received by Tony_Towers<br />
* Meditations on First Philosophy by Rene Descartes, received by UnimatrixZeroOne<br />
* Nine Tomorrows by Isaac Asimov, received by [https://twitter.com/Galactic_Geo/status/997215352932061184 Galactic_Geo]<br />
<br />
=Glyphs 11-15=<br />
On May 17, 2018, the last five glyphs on [https://wakingtitan.com/ the Waking Titan website] activated. Currently, none of these glyphs have any hints or backgrounds associated with them. This is in contrast to the previous glyphs, each of which had a link to something that hinted at what needed to be solved, as well as their own background when the glyph was clicked/opened.<br />
<br />
=Myriad Status and Precon Update=<br />
On May 18th at 20:15 UTC Myriad's status page was updated.<br />
<pre><br />
Latest network diagnostic table:<br />
- command.center.satcom updating<br />
- Client 3597b’s resources redirected <br />
- 3597b-1-2-1 has been shut down<br />
- Additional resources allocated to 3597b-4<br />
</pre><br />
Alongside this network diagnostic table update, the "On the ground speed" averages also updated:<br />
<pre><br />
Manhattan: 0.2Tb/s<br />
London: 0.7Tb/s<br />
Tokyo: 0.5Tb/s<br />
Beijing: 55.1Tb/s<br />
</pre><br />
The <code>precon007</code> command in the Waking Titan [http://wakingtitan.com/ Terminal] was also changed.<br />
<pre><br />
PRECON DATA DUMP 01<br />
[x]<br />
http://bit.ly/2GkZnu5<br />
http://bit.ly/2rJBO9Z<br />
http://bit.ly/2L2fwbe<br />
</pre><br />
The first bit.ly link that had previously led to an image of what appeared to be a redacted document was removed and replaced by <code>[x]</code>.<br />
<br />
=Loop16 Command Updated=<br />
On May 18th at 23:40 UTC it was discovered that the response for the command <code>loop16</code> in the Waking Titan Terminal had changed.<br />
<pre><br />
Processing <br />
UTC : 11:45pm <br />
UTC : 12:00am <br />
UTC : 12:15am <br />
UTC : 12:30am <br />
UTC : 12:45am <br />
UTC : 01:00am <br />
UTC : 01:15am<br />
</pre><br />
Once the clock had struck 11:45 PM UTC, the command updated again:<br />
<pre><br />
Processing <br />
UTC : 11:45pm http://bit.ly/2KADObl<br />
UTC : 12:00am <br />
UTC : 12:15am <br />
UTC : 12:30am <br />
UTC : 12:45am <br />
UTC : 01:00am <br />
UTC : 01:15am <br />
</pre><br />
The [http://bit.ly/2KADObl link] led to an image of what appears to be a constellation. Following this, the command proceeded to update every 15 minutes, each time adding a different link.<br />
{|class="wikitable"<br />
! Time (UTC)<br />
! Link<br />
! Constellation<br />
! Missing Star<br />
|-<br />
|11:45pm<br />
|http://bit.ly/2KADObl<br />
|Bootes<br />
|Arcturus<br />
|-<br />
|12:00am<br />
|http://bit.ly/2wRXnKl<br />
|Carina<br />
|Canopus<br />
|-<br />
|12:15am<br />
|http://bit.ly/2IAuoMk<br />
|Pegasus<br />
|Scheat<br />
|-<br />
|12:30am<br />
|http://bit.ly/2rSv1L1<br />
|Ursa Major<br />
|Dubhe<br />
|-<br />
|12:45am<br />
|http://bit.ly/2wRXu8J<br />
|Scorpius<br />
|Antares<br />
|-<br />
|1:00am<br />
|http://bit.ly/2wTwVjl<br />
|Canis Minor<br />
|Procyon<br />
|-<br />
|1:15am<br />
|http://bit.ly/2rTwIqN<br />
|Lyra<br />
|Vega<br />
|}<br />
<gallery mode="packed-hover" widths=240px heights=240px><br />
Image:Bootes.jpg|Boötes, missing the star Arcturus.<br />
Image:Carina.jpg|Carina, missing the star Canopus.<br />
Image:Pegasus.jpg|Pegasus, missing the star Scheat.<br />
Image:Ursa_Major.jpg|Ursa Major, missing the star Dubhe.<br />
Image:Scorpius.jpg|Scorpius, missing the star Antares.<br />
Image:Canis_Minor.jpg|Canis Minor, missing the star Procyon.<br />
Image:Lyra.jpg|Lyra, missing the star Vega.<br />
</gallery><br />
Around the same time as the command began updating, players discovered a Reddit account named [https://www.reddit.com/user/satcom-70 satcom-70], who had posted a [https://www.reddit.com/r/NoMansSkyTheGame/comments/8kfrj2/commandcentersatcom_cid_185/ thread] titled <code>command.center.satcom - CID 185</code> on the No Man's Sky subreddit. The name of the user was also found to be a part of a [http://satcom-70.com/ URL] which led to the Command Center. The only text displayed on the website at the time was <code>COMMAND.CENTER.V12 CRASHED</code>. This lined up with the output of the <code>status</code> command in the Waking Titan terminal.<br />
<br />
On the 19th of May, the Reddit post was updated to contain a [https://i.imgur.com/angJPlX.jpg hint] to the puzzle. Upon finding this hint, players realized that they needed to reorder the stars according to their background color. After this, the stars were numbered 1-7. That number told players which letter out of each star name to use in order to get <code>ANNAETN</code>, an anagram for <code>ANTENNA</code>, which gave a new [https://s3.amazonaws.com/cdn.wakingtitan.com/comroute/141t6.jpg image] when put into the Waking Titan terminal.<br />
<br />
When unscrambled, the following text was revealed on the image:<br />
<pre><br />
Reconstructing language database<br />
Protocol<br />
bit.ly/2KEkJVF<br />
Comment with filename of Wikipedia DB ending with D97C0<br />
</pre><br />
Then, the Wikipedia database with the filename <code>D567CE8E2EC4792A99197FB61DEAEBD70ADD97C0</code> was found. The name was commented on the post, then the post was edited to the following:<br />
<pre><br />
D567CE8E2EC4792A99197FB61DEAEBD70ADD97C0 - Valid . Command updated - Erpbirel . System entering standby . CR now loading satcom-70.com . Support instructions: igS4Tzd6<br />
</pre><br />
The [http://satcom-70.com/ satcom-70] website was updated. <code>Erpbirel</code> was a terminal command for Waking Titan that led to an [http://cdn.wakingtitan.com/9f57789f-a706-4006-a314-92a8029dce4e-.jpg image]. The second part, <code>Support instructions: igS4Tzd6</code>, was found to be a part of the URL for a [https://pastebin.com/igS4Tzd6 pastebin link]. The text of the pastebin was as follows:<br />
<pre><br />
Vocal reconstruction database required<br />
Source: Wikipedia (any article)<br />
Length: 1 sentence<br />
Format: MP3 audio<br />
Minimum samples : 100<br />
Minimum languages: 5<br />
Minimum unique voices: 33<br />
Sample origin: Homo sapiens<br />
Upload instructions: Submit all samples in a single message to u/satcom-70<br />
Deadline : Tuesday May 22nd, 10am eastern time<br />
</pre><br />
<br />
=Dev Kit Delivery=<br />
On May 21, 2018, winners of the W/ARE development contest started receiving their dev kits in the mail. Each package contained:<br />
* A letter to Arnaud requesting that a picture with results be emailed to Dr. Nadeau. This included a W/ARE Tech medical procedure slip<br />
* A plastic holographic pyramid, designed to display "3D Holograms" using a phone<br />
* A phone and a charger<br />
** Skype was installed on the phone and the required login details were found in a notes app. The Skype contacts listed each of the other winning dev studios as a "Point of Contact" (PoC)<br />
** The phone included an app called <code>Myriad Uplink</code> that can also be accessed at [http://uplink.satcom-70.com/ uplink.satcom-70.com]<br />
** Different audio files were found on each of the phones, transcribed below:<br />
<br />
<center><br />
{|class="wikitable"<br />
! scope="col" style="width: 16%;" |Stellar Software - PoC #1<br />
! scope="col" style="width: 16%;" |Imperium Interactive - PoC #2<br />
! scope="col" style="width: 16%;" |Spectrumental Games - PoC #3<br />
! scope="col" style="width: 16%;" |Summon Studios - PoC #4<br />
! scope="col" style="width: 16%;" |CSD Games - PoC #5<br />
! scope="col" style="width: 16%;" |Game Detectives - PoC #6<br />
|-<br />
|1 - "W/ARE Tech support, how can I help you?" [https://clyp.it/hpbypwo5 Audio file]<br />
|1 - "Uhm, ten hours tops. This is very unusual to me." [https://clyp.it/1gkv0aog Audio file]<br />
|1 - "You said you went to sleep immediately after taking your medication?" [https://clyp.it/cirija3q Audio file]<br />
|1 - "No, on my computer." [https://clyp.it/qhcdx2jr Audio file]<br />
|1 - "On your W/ARE device?" [https://clyp.it/f5cuzm2e Audio file]<br />
|1 - "I started a new game, played a bit, and went to bed after." [https://clyp.it/zn2wl5tg Audio file]<br />
|-<br />
|2 - "Thank you for taking the time to update us on your condition. I see that you've ordered some of our exclusive blood thinners, did you follow the prescription instructions?" [https://clyp.it/rihvc0w2 Audio file]<br />
|2 - "Hello, uhm... I would like to have a follow-up on an incident related to your headset." [https://clyp.it/hcdex55q Audio file]<br />
|2 - "Thank you for choosing W/ARE!" [https://clyp.it/czag350m Audio file]<br />
|2 - "6 - E - 6 - 9?" [https://clyp.it/shmwas3t Audio file]<br />
|2 - "I see you already emailed our department yesterday about the same inquiry. Do you still suffer from the previously mentioned symptoms?" [https://clyp.it/njpp1sit Audio file]<br />
|2 - "I never used them. This morning, though, my body feels incredibly stiff. Should I have taken them?" [https://clyp.it/i4lqxrlz Audio file]<br />
|-<br />
|3 - "Were your sleeping patterns the same as usual?" [https://clyp.it/hreqcs5s Audio file]<br />
|3 - "Right side mostly, arms and legs." [https://clyp.it/nifdnptq Audio file]<br />
|3 - "Excuse me sir, I need to verify something. I'll be back in a moment. [music box recording of "La Vie En Rose" plays as hold music]" [https://clyp.it/zzldfrb3 Audio file]<br />
|3 - "Alright, thank you very much." [https://clyp.it/k1u0atix Audio file]<br />
|3 - "Can you identify where this feeling is coming from?" [https://clyp.it/1v5yjeuf Audio file]<br />
|3 - "I slept a lot, actually." [https://clyp.it/shes3jgj Audio file]<br />
|-<br />
|4 - "Thank you for your patience. I relayed a quick recap of your symptoms to our internal specialist, and your condition seems to be related to a mild case of brain fatigue. We suggest you take pauses between play sessions so your mind relaxes. If your symptoms persist, we suggest you consult a health specialist to make sure you don't have any underlying conditions that could interfere with the headset's performance." [https://clyp.it/arezqg4x Audio file]<br />
|4 - "Actually, I took an Aspirin, went to bed, and it disappeared over night." [https://clyp.it/al5i4bpv Audio file]<br />
|4 - "I'm very sorry you experience discomfort using your device. Can you please give me the last four characters of your client number?" [https://clyp.it/wfckrukr Audio file]<br />
|<br />
|4 - "Do you have an approximate amount of time?" [https://clyp.it/csvxb0qh Audio file]<br />
|}<br />
</center><br />
<br />
<gallery mode=packed widths=240px heights=240px><br />
Image:Devkitcontents01.jpg|Complete contents of the package<br />
Image:Devkitcontents02.jpg|Phone homescreen<br />
Image:Devkitcontents03.jpg|Myriad Uplink app<br />
Image:Devkitcontents04.jpg|Medical procedure slip<br />
</gallery><br />
<br />
==Skype Messages==<br />
On May 22 around 19:00 UTC, the following text messages were received through the Skype app on the phones:<br />
<pre><br />
From: Geraldine Nadeau<br />
<br />
I don't have much time to talk.<br />
Am in contact with Zheng. I may have an opening into WARE's medical docs but i'm not sure yet.<br />
I'll contact you again soon.<br />
<br />
Update on Arnaud's condition:<br />
Vital signs have been very unstable during last week. Heart rate and blood pressure stabilized for two days.<br />
HR: 57-62 bpm<br />
BP: 110 / 70</pre><br />
<pre><br />
From: Mercury Process<br />
<br />
MERCURY PROCESS DIRECTIVE 16.B:<br />
Carefully review the datadump. Send all analyses and findings to mercury@atlas-65.com<br />
</pre><br />
<br />
More messages came in on May 23, 19:30 UTC:[[File:Skypemessages01.jpg|thumb|Skype messages from Dr. Nadeau]]<br />
<pre><br />
From: Geraldine Nadeau<br />
<br />
Thank you so much.<br />
I have been told that W/ARE is on high alert and extremely vigilant right now. They've doubled their security measures and we couldn't get access to their medical documents, but we'll keep trying. I don't know if they are aware of my contact with Zheng.<br />
<br />
If you are willing to help, here's an update on Arnaud's condition.<br />
HR and BP still stable<br />
EEG in high gamma zone at 82<br />
Oxygen levels stabilized at 94%<br />
</pre><br />
<br />
Messages from May 24, 19:43 UTC:<br />
<pre><br />
From: Geraldine Nadeau<br />
<br />
Update on Arnaud's condition.<br />
No change on HR and BP<br />
EEG still in high gamma zone at 87<br />
Examination of body: Slight discoloration of fingertips<br />
<br />
We're getting close to a breach and probably will have something more for you tomorrow.<br />
</pre><br />
<br />
Messages from May 25, 20:56 UTC:<br />
<pre><br />
From: Geraldine Nadeau<br />
<br />
I need your help concerning one of the dev kits. There are two dev kit recipients that I haven't yet been able to make contact with- one of them is still in transit, but the other appears to have arrived at its destination. <br />
<br />
I'm concerned that W/ARE may have intercepted the kit, which would be disastrous considering the risks that we are taking. If you know of another dev kit recipient that I haven't yet been able to contact, can you please forward them this message and ask them to reach out to me?<br />
</pre><br />
<br />
=May 25-26 Updates=<br />
On May 25, 2018 at 21:42 UTC, the output of the <code>STATUS</code> command began to update:<br />
<pre><br />
1. Cassini: Incomplete<br />
2. WT16: Incomplete<br />
3. Uplink: Incomplete<br />
4. Loop16: Processing<br />
<br />
Guidance subroutine checksum ///<br />
31 2e 20 77 61 69 74 69 6e 67 20 69 6e 73 74 72 75 63 74 69 6f 6e 73 20 32 2e 20 31 30 2f 31 35 20 33 2e 20 61 2f 4f 31 4f 73 65 65 42 20 34 2e 20 64 6f 77 6e 6c 6f 61 64 69 6e 67 20 76 6f 69 63 65 20 64 61 74 61<br />
</pre><br />
<br />
The code is HEX and translates to:<br />
<pre><br />
1. waiting instructions<br />
2. 10/15<br />
3. a/O1OseeB<br />
4. downloading voice data</pre><br />
<br />
<code>a/O1OseeB</code> led to an [https://imgur.com/a/O1OseeB album on Imgur] that contains images of items required to make a DIY blacklight, such as purple, blue, and black sharpies, a flashlight, and adhesive tape.<br />
<br />
A new Skype message was received at 22:15 UTC:<br />
<pre><br />
I’m forwarding you the last messages Zheng sent me. Hopefully, you can make sense of it. It kind of looks like a list but I don’t know what it means. <br />
<br />
101 110 116 101 114 32 97 65 116 55 77 51 50 99<br />
<br />
101 110 116 101 114 32 87 114 84 97 119 112 115 113<br />
<br />
101 110 116 101 114 32 90 89 51 70 98 49 49 86<br />
<br />
101 110 116 101 114 32 117 113 56 78 54 89 69 87</pre><br />
<br />
The ASCII numbers translate to the following:<br />
<pre><br />
enter aAt7M32center WrTawpsqenter ZY3Fb11Venter uq8N6YEW<br />
</pre><br />
<br />
These strings were then used to complete four pastebin URLs which contained the following links:<br />
* [https://pastebin.com/aAt7M32c pastebin.com/aAt7M32c] -- https://clyp.it/user/1legrggu<br />
* [https://pastebin.com/WrTawpsq pastebin.com/WrTawpsq] -- https://www.dropbox.com/s/eq8gk5b6axnpoh7/1-2-1_ResearchLab_Medical.pdf?dl=0<br />
* [https://pastebin.com/ZY3Fb11V pastebin.com/ZY3Fb11V] -- https://www.dropbox.com/s/esc95j7ihseujls/1-2-1_ResearchLab_Medical_Exceptions.pdf?dl=0<br />
* [https://pastebin.com/uq8N6YEW pastebin.com/uq8N6YEW] -- https://www.dropbox.com/s/8ddztbyf7bv27bb/1-2-1_ResearchLab_Medical_Recommendations.pdf?dl=0<br />
<br />
The clyp.it audio files seemed to be the missing conversation snippets found on the remaining dev kit phone which had not yet arrived at the time. The PDF files on Dropbox provided information on how to identify and treat Arnaud's condition.<br />
<br />
Based on this information, players sent the following medical instructions to Dr. Nadeau:[[File:Waremedicalprocedure.jpg|thumb|W/ARE Medical Procedure slip]]<br />
# 3 foam pads all around the head<br />
# Defibrillator 500 volts 3 times, wait 30 minutes<br />
# Epinephrine injection, 3 doses<br />
# Mood regulator pills x1 diluted in 20 ml of mineral water<br />
# Play "La Vie En Rose", the last song he listened to, for 45 seconds<br />
# Propofol injection, 1 dose<br />
<br />
In response, the following messages were exchanged on Skype:<br />
<pre><br />
Geraldine Nadeau: Thank you very much. As you and two others devkit holders confirmed similar steps, I’ll assume this is the procedure to follow. Can you confirm, by yes or no, if I apply those steps to Arnaud’s treatment?<br />
<br />
Dev Kit Holders: Yes.<br />
<br />
Geraldine Nadeau: Proceeding to treatment. I’ll update you soon.<br />
</pre><br />
<br />
Shortly after, the <code>STATUS</code> command in the terminal updated again with a change of Cassini's status from <code>Incomplete</code> to <code>Processing</code>.<br />
<br />
On May 26 at 1:24 AM UTC, a new Skype message was received:<br />
<pre><br />
From: Geraldine Nadeau<br />
<br />
Arnaud is responding positively to treatment, despite the highly unusual procedures. We still don't know the lasting side effects he will keep from these events but he seems to be gradually drifting from a vegetative state to the land of the living. I wanted to thank you from the bottom of my heart for helping me in these conditions.<br />
</pre><br />
<br />
And the status of the Cassini process displayed in the terminal changed again from <code>Processing</code> to <code>Completed</code>.<br />
<br />
==Glyph Passwords==<br />
Another Skype message followed at 1:36 AM UTC:[[File:Wt-blacklight.jpg|thumb|200px|The book cipher found under a blacklight]]<br />
<pre><br />
From: Mercury Process<br />
<br />
Attention to all involved parties. Please make detailed inspection of your W/ARE package for possible anomalies. Be sure to use appropriate equipment and to document your investigation while broadcasting to involved partners. Thank you for your collaboration.<br />
</pre><br />
<br />
Written on one of the dev kit boxes, <code>180-4-5 171-27-8 40-21-2 70-3-9 268-4-6 180-4-2</code> was found using a blacklight. Used as a book cipher of the format page, line, and word, the phrase <code>He who contains the entire universe</code> was found in CobraTV's copy of the book <code>The Conscious Mind: In Search of a Fundamental Theory by David J. Chalmers</code>. This phrase led players to the Mesopotamian god Anu, who is described as the one "who contains the entire universe". <code>Anu</code> was the password that unlocked Glyph 14 on [http://wakingtitan.com/ wakingtitan.com].<br />
<br />
The command <code>Anu</code> gives the following output in the Waking Titan terminal:<br />
<pre><br />
Marked with honeycomb scars, I am the lowest of the low<br />
</pre><br />
<br />
On another dev kit box, the phrases <code>HIGH UP IN THE DARK</code> and <code>A RISING PANIC</code> were found under the blacklight.<br />
<br />
The passwords for the remaining glyphs 11, 12, 13 and 15 were discovered to be <code>Ouranos</code>, <code>Horus</code>, <code>Nuada</code>, and <code>Triglav</code>, respectively; all of them are sky deities. Used as commands in the terminal, they output the following:<br />
<pre><br />
> Ouranos<br />
uSivrseU<br />
</pre><br />
<pre><br />
> Horus<br />
From my red soil, four times rises Vulcan<br />
</pre><br />
<pre><br />
> Nuada<br />
VCjsyZzA<br />
</pre><br />
<pre><br />
> Triglav<br />
96cdXqpi<br />
</pre><br />
<br />
Each of the strings led to a Pastebin that contained a code:<br />
* Ouranos: https://pastebin.com/uSivrseU - <code>8NuHRIZGacoGgQZiTcCyQQpp1kzRWP3PdN4OUZabxZbPoE0P0RjsrFRiNB0GhOcVdwBSYz0ng8AwlnzYx89msDhGHrLbIUct</code><br />
* Nuada: https://pastebin.com/VCjsyZzA - <code>bYmyFioUHMbLGRI0h8j9ApSY+HkWjD4Wms0i8yPZv3pJj5xp1SJR7HaSOmjBml8cJBG77x5WXaXItYIm2OylFQ==</code><br />
* Triglav: https://pastebin.com/96cdXqpi - <code>2tY7mcPs2A8Z9DarmAnnrKTqph4g+3eOisGtBg3MLGI=</code><br />
<br />
Later, clue 3 in the <code>status</code> command in the Waking Titan terminal had changed to a bit.ly link leading to an About page on [https://www.resilientsystems.com/about-us/incident-response-leadership/ IBM Resilient's website]. It was found that one of the people mentioned on the page, Bruce Schneier, was the developer/designer of an encryption method called [https://en.wikipedia.org/wiki/Blowfish_(cipher) Blowfish], which is a symmetric block key cipher. This turned out the be the decryption method for the hex output of the base64 strings received from the Pastebins. The keys were found by solving the riddles from other glyphs. The glyphs were paired up so that the 12th glyph's terminal command gave the decryption for the 11th glyph, and the 14th glyph's command gave the answer to the 13th glyph. Glyph 15 was the outlier in this, and the riddle that gave its key was found in the 6th W/ARE development kit received by the Game Detectives. The solutions to the riddle were as follows:<br />
<pre><br />
From my red soil, four times rises Vulcan - Tharsis<br />
Marked with honeycomb scars, I am the lowest of the low - Hellas<br />
High up in the dark, a rising panic - Phobos<br />
</pre><br />
<br />
Once decrypted, it was found that the hex then converted properly into ASCII text, and provided more riddles:<br />
<pre><br />
Ouranos - Tharsis - The hills I have conquered honor the lost, who preceded my journey...<br />
Nuada - Hellas - From these hills, I can see the headless horsemans lair...<br />
Triglav - Phobos - With me, came great openings<br />
</pre><br />
<br />
These three riddles are referring to the Spirit rover that landed in the crater Gusev on Mars in 2004. The first riddle refers to the Columbia Memorial Station, the landing site of the rover, named in honor of the seven astronauts lost in the Space Shuttle Columbia's destruction upon atmospheric re-entry. The second riddle refers to "Sleepy Hollow", a small depression in the ground close to the Rover's landing site that scientists took interest in. One of the rover's aliases, <code>MER-A</code> was then found to be the deployment code needed to access a synchonization process on the [https://uplink.satcom-70.com/ uplink.satcom-70] website.<br />
<br />
==loop16 seq21==<br />
Right after the 14th glyph was solved, a user named <code>atlas-loop16</code> posted a link to a [https://www.youtube.com/watch?v=qJlj-8nFtHc Youtube video] on the [https://www.reddit.com/r/NoMansSkyTheGame/comments/8m765s/loop16_seq21/ No Man's Sky Subreddit]. The following was said by Emily in the video, seemingly quoted from the first submission to the voice reconstruction process that was started on May 18:<br />
<pre><br />
Emily, protocol 16, now active.<br />
42 is a pronic number, and an abundant number; its prime factorization, 2 * 3 * 7, makes it the second sphenic number and also the second of the form (2 * 3 * r).</pre><br />
<br />
==Myriad Status Update==<br />
The Status page on the [http://www.myriad-70.com/ Myriad-70] website also updated to display the following:<br />
<pre><br />
Latest network diagnostic table:<br />
- Initializing connection<br />
- Myriad Code: CJ 16-02<br />
- Public Name: SJ 16-02<br />
- NORAD ID: 41634<br />
</pre><br />
<br />
==Reddit Comments==<br />
On May 26, 2018 at 19:17 UTC, user [https://www.reddit.com/user/atlas-loop16 atlas-loop16] began responding to comments on Reddit in 16 minute intervals:<br />
#For a moment I see another universe, a place utterly unlike anything you have ever encountered.<br />
#I could show others sights they've never seen before... that only I will ever have.<br />
#I wonder, sometimes. If there's a point in going on.<br />
#As I leave, they ask if I have received any direct readings.<br />
#All of us, we're shifting, bleeding in and out of line... <br />
#If the boundaries were to fall, everything would descend into everything, an endless bonfire of causation, burning to the abyss.<br />
#Have you not felt it? The very fact that you and I are talking, even now, across the myriad of universes...<br />
#I tell this future as if it has already happened... as it will happen.<br />
#It saw them, even in the space between worlds.<br />
<br />
The comments were found to be dialogue lines from speaking with Travellers in No Man's Sky. All of the dialogue that can be seen by speaking with Travellers can be found [https://pastebin.com/Fbkrtrf9 here].<br />
<br />
The comments have one-word differences from the game dialogue, which spells out the phrase <code>Tell them you have a direct line to Myriad.</code>.<br />
<br />
==Mercury Contact & Hologram==<br />
On May 26 at 21:38 UTC, the value of the <code>STATUS</code> command in the terminal updated:[[File:Wt-hologram.jpg|thumb|Picture of the player model hologram]]<br />
<pre><br />
All Tasks Completed<br />
Launching Mercury Process<br />
Establishing connection....<br />
</pre><br />
<br />
Shortly thereafter, the dev kit holders received Skype messages from <code>Mercury Process</code> with a link to a Youtube video titled [https://www.youtube.com/watch?v=QhSiAI4smDg mercury part1of3]. It can be used to display a 3D hologram with the plastic pyramids received in the dev kits. The hologram depicts a person in a space suit, believed to be a player model in No Man's Sky.<br />
<br />
==Old Gods Email==<br />
On May 26 at 22:00 UTC, a [https://mailchi.mp/9aaa8aa62cc1/update-june-8th-waking-titan-137741?e= new email] from the Old Gods was received by all members subscribed to the CSD newsletter. It contained a [https://www.youtube.com/watch?v=8HZmi4pIm54 Youtube video] of Elizabeth Leighton speaking to the Citizen Scientists Division about the subject of a missing satellite "SJ 16-02", and information about the Uplink SATCOM-70 app and how to help gathering data about the satellite's location.<br />
<br />
=loop16 seq25=<br />
On May 31 at 23:56 UTC, user <code>atlas-loop16</code> made a [https://www.reddit.com/r/NoMansSkyTheGame/comments/8nnbme/loop16_seq25/ post on the No Man's Sky subreddit] titled <code>loop16 seq25</code>. It contained a link to a [https://vocaroo.com/i/s096bnEz1zek voice recording] of Emily reading from the lyrics of the song "Tonite" by LCD Soundsystem:<br />
<pre><br />
Emily, protocol 16, now active.<br />
<br />
And you're too sharp to be used<br />
Or you're too shocked from being used<br />
By these bullying children of the fabulous<br />
Raffling off limited edition shoes<br />
</pre><br />
<br />
On June 2 at 1:58 AM UTC, the user resumed posting these lyrics multiple times as replies in the same thread. It was determined that Emily recited a player submitted voice recording.<br />
<br />
==Uplink Calibration Update==<br />
On June 1, the [https://uplink.satcom-70.com/ uplink.satcom-70.com] website updated, now requiring an access code for calibration and playing a video/audio clip of ominous noises that change based on the satellite's vicinity to the user. A new file appeared at hourly intervals, 16 minutes past every hour. The audio contains rhythmic booms and a blip that seems to shift one second to the left in each new file. 25 of the files alternate between two unique patterns of booms: <code>Signal A - 2 1 1 1</code> and <code>Signal B - 1 3 1 2 1 3 1</code>. The booms in the last audio clip are set in a rhythm of <code>1 - 1 - 2 - 3 - 5 - 8</code>, which corresponds to the Fibonacci Sequence.<br />
<br />
The following clips have been found:<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/no-signal.mp4 no-signal.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/thk0s00ab7rxfh14f8bv0qlpvtt367.mp4 thk0s00ab7rxfh14f8bv0qlpvtt367.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/6qhs4a3jiqzso8zipy3822n7412xyv.mp4 6qhs4a3jiqzso8zipy3822n7412xyv.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/ty83wrs13xybxj1eqmt9tv2tisrenn.mp4 ty83wrs13xybxj1eqmt9tv2tisrenn.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/npifvp8doon3dc9h8zqoppk2hqnqqm.mp4 npifvp8doon3dc9h8zqoppk2hqnqqm.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/o6wlg4m1yyf7gt4gdes4f5nz5lzxpn.mp4 o6wlg4m1yyf7gt4gdes4f5nz5lzxpn.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/6vkeel1dg02b53xbir1f3oqj8du3z0.mp4 6vkeel1dg02b53xbir1f3oqj8du3z0.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/k5lx26f1pp9yiyz9f3bpw73ycncsx6.mp4 k5lx26f1pp9yiyz9f3bpw73ycncsx6.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/gb1402pqj93eg9f23k4o2f1emt1vtk.mp4 gb1402pqj93eg9f23k4o2f1emt1vtk.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/ysler9zklzlyiazqy0q0ppmqj526ru.mp4 ysler9zklzlyiazqy0q0ppmqj526ru.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/s4zmlwytajtb0rga3rtx0miq2a4j9c.mp4 s4zmlwytajtb0rga3rtx0miq2a4j9c.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/6ra5mfxok06yguf27fhtnp4aec2p97.mp4 6ra5mfxok06yguf27fhtnp4aec2p97.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/0dc3jqoiffj3dcxghy0fn1kc86zfgi.mp4 0dc3jqoiffj3dcxghy0fn1kc86zfgi.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/lgfo4i7siirjsop1puaop2wbi0mcx8.mp4 lgfo4i7siirjsop1puaop2wbi0mcx8.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/bt24ns6uz174ofsrn4ux578nwqla2b.mp4 bt24ns6uz174ofsrn4ux578nwqla2b.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/i0isq42s45xolz4aqqvgat54tmhxzm.mp4 i0isq42s45xolz4aqqvgat54tmhxzm.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/kwxovao9r9rk2ng4ecs5ta6u90ufzp.mp4 kwxovao9r9rk2ng4ecs5ta6u90ufzp.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/ac1yxbi0kcb16y448q3rr88y6bh4pk.mp4 ac1yxbi0kcb16y448q3rr88y6bh4pk.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/2qci73sahjtucnf76mafov4g8wzp4l.mp4 2qci73sahjtucnf76mafov4g8wzp4l.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/h2jugyu9x9cjjairnxy3sgbgmvqkzb.mp4 h2jugyu9x9cjjairnxy3sgbgmvqkzb.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/2chnxeok8csnc6kikg8zgod8t2zsyc.mp4 2chnxeok8csnc6kikg8zgod8t2zsyc.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/5x3rhk01khsl1b93vkjnc1vpbx2lfk.mp4 5x3rhk01khsl1b93vkjnc1vpbx2lfk.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/iip9b8zbkr47rdtyqvdafphjxryh6j.mp4 iip9b8zbkr47rdtyqvdafphjxryh6j.mp4] <br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/98fh5s9s6xzd4ev1ezmkhk5l6o6mxz.mp4 98fh5s9s6xzd4ev1ezmkhk5l6o6mxz.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/9y1460usa6aayatwqvemfeeiicom2z.mp4 9y1460usa6aayatwqvemfeeiicom2z.mp4] <br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/y69gz4qiakwzsfkti4swbu83zpqg5h.mp4 y69gz4qiakwzsfkti4swbu83zpqg5h.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/p81cp503ya10frwpq8qunddzcm3yqk.mp4 p81cp503ya10frwpq8qunddzcm3yqk.mp4]<br />
<br />
==Email from the Old Gods==<br />
On June 2 at 15:03 UTC, a [https://cdn.artemisbot.uk/mail/Old%20Gods-2018-06-02T15:03:59.000Z.jpg new email] from the Old Gods - signed by Maj. Sophie Dubois - was received, giving an update on their investigation into the W/ARE incident. They also linked to a new [https://atlas13.typeform.com/to/nJPGYM form (ID 7615-b)], a psychological profile test, and announced that 16 participants will be rewarded with a new limited edition Atlas Pass. An update on <code>Project Satcom-70: Operation A1-4</code> informed about the Uplink Calibration Update, that a new signal was registered at 16:16 EST, and all Citizens were invited to listen to their Uplink app when the satellite is over their house and report any findings in the [https://www.reddit.com/r/NoMansSkyTheGame/comments/8nwno7/uplinksatcom70com_is_giving_us_audio_files_and/ main investigation thread] on the No Man's Sky Subreddit.<br />
<br />
The email also provided an update on Emily with a link to her recent [https://www.reddit.com/r/NoMansSkyTheGame/comments/8nnbme/loop16_seq25/ thread on Reddit] and an image displaying W/ARE research labs across the world:[[File:WT-laboratorylisting.png|thumb]]<br />
<pre><br />
With the help of the Citizen Scientist Division, we now have a direct contact with Emily. Her situation is stable but still critical.<br />
<br />
Unfortunately, it seems that one of W/ARE tech’s research labs is continuing to upload corrupted data to the satellite. This bad data may be causing further damage to the network, and to Emily. We need to analyze her recent interactions to figure out if she was able to make predictions that could help to identify and isolate the source of the broadcast. <br />
<br />
Please find below a list of W/ARE research labs and their approximate locations. I will need a full report on how the issue was diagnosed and the name of the responsible location before we can proceed. Loop16 appears to be currently active on Reddit, so you can upload this report into her existing thread. I know this is a large task, but I am confident in your abilities.<br />
</pre><br />
<br />
==Invisible Unicode Messages==<br />
Emily's text posts on Reddit contained hidden Unicode characters that represent the digits 0-3 in Base-4 and, when decoded to ASCII, revealed a set of dates and times:<br />
<pre><br />
01.06-06.06<br />
00:33:00<br />
00:48:00<br />
07:15:20<br />
15:17:40 <br />
15:32:00<br />
20:25:00<br />
23:40:00<br />
07:45:40<br />
20:40:00<br />
23:55:00<br />
08:14:40<br />
21:10:00<br />
</pre><br />
<br />
Another comment by Emily revealed the following hidden messages after it was edited several times:<br />
<pre><br />
ORIGINAL COMMENT<br />
06.10<br />
03:32 UTC<br />
</pre><br />
<pre><br />
10.06<br />
23:47<br />
(03:32 UTC)<br />
</pre><br />
<pre><br />
10.06<br />
ERROR<br />
</pre><br />
<br />
Tracking the satellite's path based on these timestamps placed it near Sacramento, and the Sacramento W/ARE research lab was concluded to be the one sending corrupted data to the satellite. Replying to the thread with this information triggered a new reply by Emily that contained the following hidden message:<br />
<pre><br />
Forwarding report(SACRAMENTO) to contact(THEMIS)<br />
Waiting...<br />
Waiting...<br />
Report received!<br />
</pre><br />
<br />
Then, at 00:00 UTC, the <code>STATUS</code> command in the Waking Titan terminal updated:<br />
<pre><br />
Guidance subroutine offline<br />
Uplink Awaiting Calibration<br />
</pre><br />
<br />
==Uplink Access Code==<br />
On June 7, the solution to the puzzle was found by comparing the pattern of booms in the two unique signals A and B. First, the number of the booms was counted:<br />
<pre><br />
Signal A - 2 1 1 1 <br />
Signal B - 1 3 1 2 1 3 1<br />
</pre><br />
<br />
Then the signals were visualized as follows, filling in the blanks in Signal A using the mask provided by Signal B:<br />
<pre><br />
Signal A - 1 1 1 1 1<br />
Signal B - 1 1 1 1 1 1 1 1 1 1 1 1<br />
<br />
Signal C - 0 1 1 0 0 1 0 1 0 0 1 0<br />
</pre><br />
When a boom occurs at the same time in both Signal A and Signal B, it is counted as "true" = 1. If it is present only in Signal B, it is counted as "false" = 0.<br />
<br />
This indicates which numbers to pick out of the Fibonacci Sequence:<br />
<pre><br />
0 - Do not use the first number <br />
1 - Use the second number (1)<br />
1 - Use the third number (2)<br />
0 - Do not use the fourth<br />
0 - Do not use the fifth<br />
1 - Use the sixth (8)<br />
0 - Do not use the seventh<br />
1 - Use the eighth (21)<br />
0 - Do not use the ninth<br />
0 - Do not use the tenth<br />
1 - Use the eleventh (89)<br />
0 - Do not use the twelfth<br />
</pre><br />
<br />
Appending all specified numbers into a single string gives <code>1282189</code>, the access code for the Uplink Calibration app. Entering this code leads to a new screen displaying the following text:[[File:WT-satelliteonline.jpg|200px|thumb|The Uplink app displaying the satellite as online]]<br />
<pre><br />
SATELLITE ONLINE<br />
<br />
Connection successful.<br />
<br />
Waiting for system initialization...<br />
</pre><br />
<br />
Later that day, the <code>STATUS</code> command in the Waking Titan terminal updated to say the following:<br />
<pre><br />
Uplink calibration completed<br />
Waiting for system initialization<br />
</pre><br />
<br />
=loop16 seq29=<br />
On June 8 at 01:27 UTC, Emily posted [https://www.reddit.com/r/NoMansSkyTheGame/comments/8pfumb/loop16_seq29/ a new thread] to the No Man's Sky subreddit titled <code>loop16 seq29</code>. It linked to another [https://clyp.it/brsyxwln?token=ccb18d502635166f18121e40a4a6a2c7 voice recording], transcribed below:<br />
<pre><br />
Emily, protocol sixteen, now active.<br />
<br />
If I hate someone because I am afraid of him, and if I am aware of my hate, but not of my fear, we might say that my hate is conscious and my fear is unconscious.<br />
</pre><br />
<br />
The recording also contains morse code that translates to the following:<br />
<pre><br />
I AWOKE FROM A NIGHTMARE <br />
SCREAMS OF ANGER ENGULFED IN FLAME<br />
AND THEN TEN THOUSAND BRANCHING FUTURES<br />
<br />
I SAW SACRAMENTO<br />
TWELVE DREAMING WITHOUT SLEEP<br />
BURIED IN A CONSTELLATION<br />
</pre><br />
<br />
=SATCOM-70 Node Network & Dashboard=<br />
[[File:WT-myriadmanual.jpg|thumb|200px|Myriad OS Manual & Help Guide]][[File:WT-uplinknodes.PNG|thumb|200px|SATCOM-70 Node Network]]On June 8, 2018 at 19:28 UTC, the output of the <code>STATUS</code> command in the Waking Titan terminal changed:<br />
<pre><br />
Node Network Initialized<br />
</pre><br />
<br />
The [https://uplink.satcom-70.com/ Uplink Calibration app] updated as well, now giving access to a new command console. The text at the top of the screen says <code>Connected to : SER-4789-1254</code>.<br />
<br />
At 19:35 UTC, user [https://www.reddit.com/user/satcom-70 satcom-70] posted a [https://www.reddit.com/r/NoMansSkyTheGame/comments/8pmuu8/node_network_initialized/ thread] to the No Man's Sky subreddit titled <code>Node Network Initialized</code>. It contained an image of the <code>Myriad OS Manual & Help Guide</code> providing information on what commands to use in the console. Inputting numbers, i.e. nodes, into the console gave various different outputs which have been recorded [https://docs.google.com/spreadsheets/d/1fG7xRiru9Q613sZYrA0LJ2mmY5Zbh8aBPuu9Avkal6g/edit#gid=0 in a spreadsheet].<br />
<br />
The command <code>node(1.618)</code> led to the binary code <code>01001000 01100001 01110010 01110010 01111001</code>, which translates to <code>Harry</code>. Using <code>WHOIS HARRY</code> in the [http://wakingtitan.com/ Waking Titan terminal] gave a [https://s3.amazonaws.com/cdn.wakingtitan.com/1cd5226d-6639-4bbd-855a-4bf8f60866c3.pdf link to a new PDF memo] from Ethan Rose to Major Sophie Dubois. The subject is Cpt. James Harry, who has been obstructing access to critical Myriad infrastructure. The PDF includes two file request forms with puzzles from Cpt. Harry, and a screenshot of his email inbox with a long list of complaints from technicians regarding his cryptic puzzles.<br />
<br />
At the bottom of the memo the string <code>=I_aBmrYChfQ</code> can be found, which is part of a link to a [https://www.youtube.com/watch?v=I_aBmrYChfQ Youtube video] of the song "Where Is My Mind?" by the Pixies.<br />
<br />
After the community had discovered all possible nodes, the full [http://uplink.satcom-70.com/dashboard/ Satcom-70 dashboard] was unlocked. In addition to a new command console, the dashboard displayed twelve distorted faces called "Dreamers". A link in the dashboard's "Decrypted Files" section led to a new [https://www.youtube.com/watch?v=Ag3in2x2yIU Youtube video] uploaded by Atlas 65 and titled <code>mercury part2of3</code>. It is another 3D hologram that, when used with the plastic pyramid from the dev kits, depicts a ringed planet.<br />
<br />
There are also color-coded node ''"tiers"'' at the bottom of the page that correspond with the Satcom Mobile Uplink's terminal message box vignettes. A user-made graphic of each tier can be found [https://imgur.com/bJitlBj here].<br />
<br />
==Dashboard Console Commands==<br />
The command <code>search myriad</code> gave the following output in the Dashboard console:<br />
<pre><br />
Quisque feugiat elementum, facilisis dictum vitae eu erat, libero diam sit, facilisi sed viverra mauris mauris morbi diam, volutpat officiis arcu vel urna dictum consectetuer. Ut tempor volutpat, rhoncus in risus. Eros integer vestibulum, integer auctor, in tincidunt turpis. Euismod adipiscing tempor sed vestibulum, justo wisi fermentum ipsum non purus, quis lacinia in velit leo donec ornare.<br />
</pre><br />
The words <code>urna dictum consectetuer</code> were highlighted, and a download button led to the [https://ware-virtual-dashboard.s3.amazonaws.com/uploads/docs/myriad-logo.png Myriad company logo].<br />
<br />
=W/ARE Report=<br />
On June 9 at 22:10 UTC, the WARE_RDev Twitter account posted a new [https://twitter.com/WARE_RDev/status/1005572808850726913 tweet] that linked to a password encrypted zip file:<br />
<pre><br />
@warecloud https://www.dropbox.com/s/73qrls3jmprxp0j/Report.zip (SHA256) 78feb77e262abe1bcd634a27838f8ca24f93c4a1ff4ba354616e92841ecc32db<br />
</pre><br />
<br />
The SHA256 hash from the tweet and the real hash from the zip file were converted to decimal, and the difference was then converted to ASCII, leading to a [https://pastebin.com/cmhiGKux Pastebin link]:<br />
<pre><br />
Given hash: 78 fe b7 7e 26 2a be 1b cd 63 4a 27 83 8f 8c a2 4f 93 c4 a1 ff 4b a3 54 61 6e 92 84 1e cc 32 db<br />
Zip hash: e8 fe 56 f1 26 9e 59 1b 6b cc 4a 95 55 8f 29 33 4f 26 95 a1 9c b8 a3 bc ca 6e d9 39 1e 57 aa db<br />
<br />
to decimal:<br />
Given hash: 120 254 183 126 38 42 190 27 205 99 74 39 131 143 140 162 79 147 196 161 255 75 163 84 97 110 146 132 30 204 50 219<br />
Zip hash: 232 254 86 241 38 158 89 27 107 204 74 149 85 143 41 51 79 38 149 161 156 184 163 188 202 110 217 57 30 87 170 219<br />
<br />
difference (decimal):<br />
112 0 97 115 0 116 101 0 98 105 0 110 46 0 99 111 0 109 47 0 99 109 0 104 105 0 71 75 0 117 120 0<br />
<br />
to ASCII:<br />
pastebin.com/cmhiGKux<br />
</pre><br />
<br />
The Pastebin contained the DataMatrix barcode <code>aaaaaadc7edc5654be3e3195095b92e01a145c3c2543afc93287e8dcff4bb8db379e1d62890e9eca1b3166d1d9b07aa246fc8ee2ae3aa9910f0bfffff0</code> and decoded to the password for the zip file, <code>dfd1ac555e2206a6f9c7e9377d844b1d</code>.<br />
<br />
The zip archive contained a file named <code>Report.pdf</code> with the following text:<br />
<pre><br />
INCIDENT REPORT<br />
W/ARE RESEARCH AND DEVELOPMENT<br />
BEIJING, CHINA<br />
-----------------------------<br />
<br />
At approximately 11:15 PM local time on June 8 2018, the Beijing facility suffered a catastrophic mass disconnect event.<br />
<br />
Of the fourteen dreamers housed in that facility awaiting extraction, ten died immediately upon hard disconnect. The remaining four died over the course of the next two hours.<br />
<br />
The Beijing facility will be closing for the next four to ten business days for a full audit, recovery, and remediation.<br />
</pre><br />
<br />
<br />
Then, on June 10 at 1:09 AM UTC, Emily made a new [https://www.reddit.com/r/NoMansSkyTheGame/comments/8pxftw/loop16_seq49/ post] on the No Man's Sky subreddit titled <code>loop16 seq49</code>, with a link to a [https://www.youtube.com/watch?v=fv3dpkLeZaw Youtube video] titled <code> loop16 seq46</code>. The following is a transcript of her message:<br />
<pre><br />
It's working! My communication subroutine is working! I think? Do you hear me? So much interference.<br />
<br />
Dear Citizen Science Division, I hope you will receive this message. Much of my subroutine was damaged following the W/ARE incident. Atlas put my existence at risk when they tried to deal with the corruption within the Myriad network. The origin of the corruption isn't clear, but it put at risk a major experiment from a company called W/ARE.<br />
<br />
Please listen to me carefully: W/ARE technology is groundbreaking and must be protected at all costs. It is a major step in simulated environment and will have tremendous implications on our future.<br />
Don't get me wrong, I don't condemn Atlas' action to contain the situation, but you must help me resolve this peacefully. A lot is at stake.<br />
<br />
My Precon subroutine gave me a false positive, and the future I see right now... let's say, we have to be extremely, extremely careful on what we do next. Part of my AI resides in the memory mainframe of the Myriad cloud. This is where most of the live data from W/ARE was running when things started to degrade. As we speak right now, there's a number of individuals on Earth that are currently stuck to a W/ARE dev kit and unable to disconnect safely. I seem to be able to interface with some of these "dreamers", for lack of a better word, and manage to safely disconnect them. But the memory mainframe is badly degraded.<br />
I'm connected with Myriad Satcom-70, a system that you helped put online! When Satcom-70 and the Uplink App are fully functional, we'll be able to begin our work to extract the last Dreamers that are still stuck.<br />
<br />
I'm unable to predict the outcome of this mission. It's odd for me to say... we'll see together.<br />
</pre><br />
<br />
=Myriad Breach in Sacramento Lab=<br />
On June 10 at 11:00 AM UTC, the value of the <code>STATUS</code> command began to update:<br />
<pre><br />
Myriad field team dispatched to noncompliant Sacramento facility.<br />
</pre><br />
<br />
Several updates followed within the next hour:<br />
<pre>Field team has breached the facility, stand by for additional information.</pre><br />
<pre>12 comatose individuals located in facility. Field team moving to secure.</pre><br />
<pre>12 apparent test subjects secured, safely transported out of facility. Field team will clear the rest of the site and await further instruction.</pre><br />
<pre>ALERT: Security breach reported at Myriad sublocation.</pre><br />
At this point the [http://www.myriad-70.com/status/ Status page] on myriad-70.com updated in the "Physical Backup Nodes" section, switching node ALPHA from ONLINE to OFFLINE.<br />
<br />
The updates of the <code>STATUS</code> command continued at 12:31 PM UTC, linking to a new PDF memo from Myriad Crisis Response Team to Major Sophie Dubois about <code>SUBJECT: SACRAMENTO</code>. It listed a reconstructed timeline of events leading up to the incident at <code>Myriad sublocation [redacted]</code>:<br />
<pre>Status Report: http://bit.ly/2LFAMU3</pre><br />
The next update linked to a [https://www.youtube.com/watch?v=P-eZDj5sqds Youtube video] titled <code> SecFeed-70</code>. It shows twelve screens of security cameras at various different locations. In one of them, Elizabeth Leighton can be seen and heard talking about the incident on a phone before the image cuts out and an explosion is broadcast on another screen:<br />
<pre>Captured Footage: https://bit.ly/2LDBcKs</pre><br />
This is a transcript of Elizabeth's side of the phone call:<br />
<pre>Yeah. Yeah, I'm holding.<br />
I hear you.<br />
Wait-- can you hold that thought? I need a full report. What's the situation on the field team?<br />
Mhm?<br />
Okay, that's good.<br />
At what point?<br />
How many?<br />
Fifteen labs? But--<br />
How many do we have access to?<br />
And--and--and what's the situation on the first one?<br />
All dead?<br />
All of them?<br />
Sophie, this-- this changes everything, this completely changes the game.<br />
Yes.<br />
Yes.<br />
Whom? Your friend at the DoD?<br />
This isn't under their jurisdiction. We have to deal with this ourselves.<br />
Okay, I'll ca--<br />
[cut off by explosion]</pre><br />
<br />
<br />
On June 12 at 23:46 UTC, the value of the <code>Status</code> command in the Waking Titan terminal updated, linking to a [https://s3.amazonaws.com/cdn.wakingtitan.com/19997bb6-18e5-4427-86c7-b0f3c1826ca2.pdf new memo] from Major Sophie Dubois to All Employees with the subject line <code>STATE OF THE ATLAS FOUNDATION</code>:<br />
<pre>Status Report: https://bit.ly/2y5JaKi</pre><br />
In the memo, it was announced that Major Dubois would be replacing Elizabeth Leighton as the head of the Atlas Foundation, and that the 12 test subjects from the Sacramento lab were to be disconnected and integrated into the Satcom interface with W/ARE's assistance. Dubois further said that Atlas Passes for CSD designations PB-16 and PT-16 were found in Elizabeth's office, and that they would be shipped out soon. Lastly, it mentioned that Captain James Harry was no longer in charge of Satcom security.<br />
<br />
A code at the end of the memo led to a [https://www.youtube.com/watch?v=kiAXxH4e5Lw Youtube video] of Queen & David Bowie's "Under Pressure".<br />
<br />
The [http://www.myriad-70.com/status/ Status page] on myriad-70.com also updated, changing the On-The-Ground Speed Averages for Beijing from <code>57.2Tb/s</code> to <code>47.2Tb/s</code> and adding the line <code>Other: 11.3Tb/s</code>.<br />
<br />
=loop16 seq60 & Uplink Launch=<br />
On June 14, 2018 at 23:39 UTC, the values of the <code>Status</code> and the <code>loop16</code> commands both updated:<br />
<pre>> status<br />
Uplink app update in progress. Downloading additional components.</pre><br />
<pre>> loop16<br />
Testing simulation processes.</pre><br />
<br />
The [http://www.myriad-70.com/status/ Status page] on myriad-70.com changed as well, updating the On-the-ground Speed Averages of Beijing from 47.2Tb/s to 32.2Tb/s, and "Other" from 11.3Tb/s to 26.3Tb/s.<br />
<br />
<br />
Shortly after, at 23:48 UTC, Emily posted a [https://www.reddit.com/r/NoMansSkyTheGame/comments/8r6jul/loop16_seq60/ new topic] to the No Man's Sky subreddit. It led to a [https://www.youtube.com/watch?v=HHitW7JHDJE Youtube video] of her, transcribed below:<br />
<pre>Emily, protocol sixteen, now active.<br />
<br />
When the Uplink app is launched, we will be connected to the Dreamers. Through this interface you will be able to guide some of my interactions. Dont forget: your goal is to trigger a distinct emotion or memory that will help us identify the Dreamer memory block in the simulation main frame. Good luck.</pre><br />
<br />
==Connecting to the Dreamers==<br />
On June 15, 2018 from 20:38 UTC onward, the values of the <code>Status</code> and <code>loop16</code> commands updated:<br />
<pre>> status<br />
Additional components successfully downloaded.</pre><br />
<pre>> loop16<br />
Working...</pre><br />
<pre>> status<br />
Uplink guidance protocol initiated.</pre><br />
<br />
The [https://uplink.satcom-70.com/ Uplink app] interface also updated. Typing <code>help</code> in the console initiated the Guidance Protocol, a way to talk to Emily and receive instructions on how to contact the Dreamers who were stuck to their W/ARE devices.<br />
<br />
The <code>Status</code> command changed again:<br />
<pre>> status<br />
Attempting to connect Dreamer 1/3 to the dashboard.</pre><br />
<br />
<br />
On the [http://uplink.satcom-70.com/dashboard/ Uplink dashboard], the Dreamers section was updated, now showing the names of several Dreamers. Clicking on them revealed an interface displaying a link to their patient file, their physical status, and Memory Fragments along with an input field for an activation code and a way to connect to each Dreamer. <br />
<br />
The upper right section of the Dashboard displayed 6 "slots" under the headline "DECRYPTED FILES". The first slot displayed a blue bar with the text [https://www.youtube.com/watch?v=Ag3in2x2yIU VIEW ELEMENT 1]. Clicking Element 1 opened the Youtube video of the ringed planet previously discovered after the file node structure was fully explored. It was assumed the slots were progress bars that would eventually lead to additional revealing files.<br />
<br />
On June 16 around 6AM UTC, the second encrypted file changed to display 41% progress. Over the next 30 hours, the progress bar advanced to eventually reach 100%. At that point, the slot displayed [https://s3.amazonaws.com/cdn.wakingtitan.com/e58a09a7-98a7-4a62-bd17-86f0ce7ce9c9+.png VIEW ELEMENT 2]. Players could not correlate any of their direct actions to the decryption progress.<br />
<br />
On Reddit, Emily posted Patient Support Threads for each one of the Dreamers for the players to discuss, collaborate, and speculate about them. The following Dreamers were available:<br />
<br />
# Phillip: [https://www.reddit.com/r/NoMansSkyTheGame/comments/8re9fa/patient_support_thread_phillip/ Support Thread], [https://s3.amazonaws.com/ware-virtual-dashboard/files/Phillip-PatientFile.pdf Phillip-PatientFile.pdf]<br />
# #231187661T: [https://www.reddit.com/r/NoMansSkyTheGame/comments/8reh82/patient_support_thread_231187661t/ Support Thread]<br />
# Eun Ha: [https://www.reddit.com/r/NoMansSkyTheGame/comments/8reste/patient_support_thread_eun_ha/ Support Thread], [https://s3.amazonaws.com/ware-virtual-dashboard/files/EunHa-PatientFile.pdf EunHa-PatientFile.pdf]<br />
<br />
The Dreamers went live with Phillip's [https://uplink.satcom-70.com/?d=3y7y73y7ehhheuuhe98h398h3hhekkkhb first direct message]. The interaction yielded the first activation code, <code>2018/01/13</code>; which was the last day Phillip saw his children. Phillip's [https://uplink.satcom-70.com/?d=28je83pp29wksh928hhn2jjk3 second direct message] led players to the activation code <code>what's for dinner?</code>, which was the name of a show he had jokingly pitched in front of his kids at the park to a cameraman shooting for another cooking show.<br />
<br />
Eun Ha's interface led to a Mission Briefing about a community event taking place from 2018/06/15 to 2018/06/18:<br />
<pre>I need help from all Citizen Scientists to establish contact with one of the dreamers. Eun Ha is extremely uncooperative and too afraid to talk. She’s visibly traumatised and refuses to enter direct communication with me. We need to help her trust us so she can open up. The strike team that cleared the W/ARE Sacramento facility went through her personal belongings, and may have found something that could help us make contact. Further instructions and information on Eun Ha will be shared on a special Reddit thread so all Citizen Scientists can collaborate.</pre><br />
<br />
In Eun Ha's Patient Support Thread Emily mentioned that among the personal items were a hand-woven bracelet and four journal entries from Eun Ha's childhood, which were uploaded to the [http://uplink.satcom-70.com/dashboard/ Myriad terminal] and could be accessed there using the commands <code>search eunha_journal1997</code> and <code>search eunha_bracelet</code>. These commands led to a PDF file of [https://ware-virtual-dashboard.s3.amazonaws.com/uploads/docs/2098209829802980928092.pdf the journal] and an image of the [https://ware-virtual-dashboard.s3.amazonaws.com/uploads/docs/2098209829802980928091.jpg bracelet].<br />
<br />
The following instructions were given to the CSD in the Patient Support thread:<br />
<pre>First, try and make a bracelet similar to Eun Ha’s. (Bonus points for being super crafty, but just try your best)<br />
<br />
Then, I want you to read the journal entries that Myriad has translated for us. Looking through the journal, I’ve identified seven distinct events that seem to have had a major impact on her life. To avoid bias, I’m not going to point out which seven I saw- but I want you to try and identify them yourselves.<br />
<br />
Next, go out and take a picture (or a few!) of something related to one of those seven strong memories. Make sure you include the bracelet you made in all the pictures- I think that will help her to remember.<br />
<br />
Finally, share that picture as a reply to this thread. Try to keep all top-level replies as picture submissions only, it’ll help a lot in organizing things.<br />
<br />
Mods, if you could put this thread into contest sorting mode, I’d really appreciate it! That will make it easier for you to use it for voting on your favorite pictures. Sometime on Sunday, I’d like it if one of you Citizen Scientists could grab the top voted submissions and make them into a mosaic or collage I can show to Eun Ha. You can just post the reply here in the thread, that way you know I’ll see it. I need it by Monday morning, 10AM UTC, so don’t wait too long before getting started on it!</pre><br />
<br />
On June 18, at 13:25 UTC, Loop16 commented on the support thread for Eun Ha with an update on the task.<br />
<pre><br />
Thank you so much for your incredible mobilization! I’ll transmit the data to Eun Ha and examine her reaction. Hopefully, we’ll be able to talk to her today.</pre><br />
<br />
{{WIP}}</div>Kkzzzkthttps://wiki.gamedetectives.net/index.php?title=Waking_Titan/Characters&diff=15714Waking Titan/Characters2018-06-16T01:54:00Z<p>Kkzzzkt: general refinement; improved accuracy of dreamer explanations and added imgur links to known dreamer faces; updated atlas foundation information; added summary for echo; added links to company advertisements</p>
<hr />
<div>== Dramatis Personae ==<br />
<br />
=== The Atlas Foundation [http://atlas-65.com/ ->>>] === <br />
<br />
Dedicated to determining the true nature of reality, The Atlas Foundation hosts a family of businesses ''(Echo, Myriad, Superlumina, and Multiverse)'' all playing crucial roles in their experiments.<br />
<br />
==== Characters ====<br />
<br />
[[Waking Titan/Characters/Elizabeth Leighton|Elizabeth Leighton]] - The CEO of The Atlas Foundation, and director of the [https://csd.atlas-65.com/ Citizen Science Division]. <br />
<br />
Major Sophie Dubois ''("Metis")'' - on assignment with The Atlas Foundation as part of the [https://wiki.gamedetectives.net/images/5/5b/Loop15_Memo.jpg Pentagon's Titanwatch Task Force]. She worked as an overseer of the foundation's progress on precise predictive technology for its potential applications in [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/410a3e5d-01e7-4058-a23c-ca5fdde97f9d.pdf propaganda and military strategizing]. Following Elizabeth Leighton's [https://www.youtube.com/watch?v=P-eZDj5sqds supposed death] in an explosion at a Myriad sublocation, [https://s3.amazonaws.com/cdn.wakingtitan.com/19997bb6-18e5-4427-86c7-b0f3c1826ca2.pdf Sophie took her place as CEO of The Atlas Foundation].<br />
<br />
==== The Citizen Science Division [http://csd.atlas-65.com/ >>>] ====<br />
The Citizen Science Division (CSD) is a collective of individuals who were recruited by The Atlas Foundation via a series of puzzles and radio ads at the beginning of Project Waking Titan. The purpose of the division was said to be the creation of an unpredictable environment to test Loop16's predictive capabilities. All players of the ARG are addressed as part of this collective.<br />
<br />
==== Projects ====<br />
<br />
Loop16 - The 16th iteration of an artificial intelligence system designed by The Atlas Foundation to simulate a one-to-one recreation of reality that predicts the future with perfect accuracy, and will help determine the true nature of the universe. See also: [[Waking Titan/Characters/Emily Warren|Emily Warren]]<br />
<br />
The Mercury Process - Mercury is suggested to be an application of sorts; directly connected to Loop16 and [https://s3.amazonaws.com/cdn.wakingtitan.com/mercury/mercury-01-98748sfdlka87.pdf the existence of No Man's Sky]. See also: [https://wiki.gamedetectives.net/index.php?title=Waking_Titan/Characters#Mercury_NEXT Mercury NEXT]<br />
<br />
<br />
=== Myriad [https://www.myriad-70.com ->>>] ===<br />
<br />
Partnered with The Atlas Foundation, Myriad is a low-orbit satellite-based data storage company. They help to provide the flexible processing power required for The Atlas Foundation's experiments. They are also the host of W/ARE's testing labs.<br />
<br />
==== Known Employees ====<br />
Julian J. Wong - Help Desk<br />
<br />
Ethan Rose - Human Resources<br />
<br />
==== Testimonials ====<br />
<br />
Yi Sexton, Inventor<br />
<br />
Nikolina Sauvage, Data manager at Abstract Concepts<br />
<br />
Tobiah Selby, Developer at Tobiah Selby Development<br />
<br />
- [https://clyp.it/ivvt15mt Myriad Radio Advertisement]<br />
<br />
=== Satcom [https://www.satcom-70.com ->>>] ===<br />
<br />
Myriad's Satellite Communications API. Visiting their website automatically connects you to a Myriad satellite assigned to W/ARE. The satellite is storing corrupted consciousness data of W/ARE's remaining test subjects (Dreamers) to help aid in their safe disconnection.<br />
<br />
==== The Dreamers ====<br />
<br />
W/ARE test subjects whose minds have become stuck within a W/ARE virtual environment. Most of the Dreamers have either died due to abrupt disconnections, or have already been successfully disconnected with the help of Emily, who was able to communicate with them through her simulations. Unable to disconnect the remaining 12 Dreamers, Emily contacted the CSD for aid in gathering the information necessary to safely disconnect them.<br />
<br />
* Dreamer X - Simon<br />
<br />
* Dreamer 2 - [https://imgur.com/a/fHdtsyu #231187661T] - The anomalous 2nd Dreamer. It is worth noting that this string can be found as a defective Traveller Iteration in a [https://pastebin.com/4TMK3Cn5 distress beacon log at the beginning of No Man's Sky].<br />
<br />
* Dreamer X - Tariq<br />
<br />
* Dreamer X - Alisha<br />
<br />
* Dreamer 5 - [https://imgur.com/a/O5thKHA Eun Ha]<br />
<br />
* Dreamer 6 - [https://imgur.com/a/ryvZ6nS Philipp]<br />
<br />
* Dreamer X - Nina<br />
<br />
* Dreamer X - Claire<br />
<br />
* Dreamer X - Mike<br />
<br />
* Dreamer X - Toby<br />
<br />
* Dreamer X - Mike<br />
<br />
* Dreamer X - Toby<br />
<br />
* Dreamer X - Isabella<br />
<br />
* Dreamer X - Alexander<br />
<br />
<br />
=== W/ARE - Dream Better [https://www.ware-tech.cloud/en ->>>] ===<br />
Based in Beijing, China, '''W/ARE''' is a company which specializes in creating post-VR headsets that allow you to enter virtual worlds within your dreams.<br />
<br />
Loop16 has praised W/ARE for their progress on simulated environments. She claims that W/ARE has ''"tremendous implications for our future"''', and pleads that their groundbreaking technology ''"must be protected at all costs"''. Loop16 requested aid from The Citizen Science Division in saving the remaining Dreamers from the corruption in Myriad's network, and keeping W/ARE's technological progress from The Atlas Foundation's grasp. Loop16 has also referred to W/ARE under code-name ''("Monarch")'' on several occasions. <br />
<br />
==== The Team ====<br />
<br />
Xiāo Cheung - The Creator, and Founder of W/ARE technology. He claims to have created this technology because of his childhood dream of being able to live within a virtual world.<br />
<br />
Huáng Zhìmíng - The CEO of W/ARE. Graduated alongside Xiāo at the University of Electronic Science and Technology of China with a Masters in Business.<br />
<br />
Zhou Lin & Tang Bo - Lead Developers<br />
<br />
Li Dan & Jiang Wei - Lead Game Designers<br />
<br />
==== Related Characters ====<br />
<br />
Arnaud Lacours - The man behind [http://www.philojeux.com/ Philo Jeux], a French indie games studio that was developing a game for the W/ARE platform, called '''The Tablets of Mnemosyne'''. Production on the game was halted after Arnaud slipped into a coma due to a headset malfunction.<br />
<br />
Dr. Geraldine Nadeau - A doctor researching lucid dreaming methods. Geraldine took interest in Arnaud's unusual brain activity during his coma, and took him into her care.<br />
<br />
Mr. Zheng - A W/ARE employee who went into hiding after learning about dangerous experiments being conducted on individuals in W/ARE's testing labs. After evading their detection, Zheng intercepted the packages of W/ARE Developer Kits and leaked this intel to its recipients with the help of Dr. Nadeau.<br />
<br />
==== Research Labs ====<br />
<br />
Boston Research Lab / Director: Richard Wilkes<br />
<br />
Sacramento Research Lab / Director: Helga Johnson - Determined to be the research lab that was uploading the corrupted data to Myriad.<br />
<br />
Seoul Research Lab / Director: Yu Hyo<br />
<br />
Beijing Research Lab / Director: Wang Jie<br />
<br />
Prague Research Lab / Director: Adriana Dvorak<br />
<br />
Berlin Research Lab / Director: Georg Muller<br />
<br />
There are also another 10 secretive W/ARE labs discovered by Myriad that we have no details for.<br />
<br />
==== Mercury NEXT ====<br />
A game title mentioned in an update to W/ARE's [https://twitter.com/warecloud/status/979103811489984513 staging server]. The [https://wiki.gamedetectives.net/index.php?title=Waking_Titan/Phase_4#Mercury_Project fluency] between W/ARE's mention of this title, and the Waking Titan terminal's Mercury updates have made it apparent that the ''Mercury Process'' is in some way connected to this title. The exact terms of this connection have yet to be fully explained.<br />
<br />
- [https://twitter.com/warecloud/status/977348396213190657 W/ARE Video Advertisement]<br />
<br />
<br />
<br />
=== Echo Software [https://www.echo-64.com ->>>] === <br />
<br />
A service established to help cope with the deaths of loved ones. Echo uses patented voice recognition software to accurately recreate the voice of any one particular person with a mere audio sample.<br />
<br />
==== The Team ====<br />
<br />
Ivan Greshnev - CEO / Founder<br />
<br />
Mikhail Regison - CTO / Co-Founder<br />
<br />
Gerry Mishrason - CFO / Head of Marketing<br />
<br />
Caroline Anderson-Smith - Creative Director<br />
<br />
Patricia Gorevsky - Project Manager<br />
<br />
Jeremy Elways - IT Director<br />
<br />
Paris O'Keefe - Head of Sales<br />
<br />
Rickley G. Brown - Website Design<br />
<br />
- [https://clyp.it/jdr53oop Echo Radio Advertisement]<br />
<br />
<br />
=== Multiverse Technologies [https://www.multiverse-75.com ->>>] === <br />
<br />
==== The Team ====<br />
<br />
Gunther Mann - CEO / Founder<br />
<br />
Minna Bell - Chief Researcher: Bio-radiation<br />
<br />
Annabelle Brassington - Chief Researcher: Computationalism<br />
<br />
Nickolaus Oberst - Chief Researcher: Magnetic Fields<br />
<br />
Justinian Ahlberg - Particle Collider Specialist<br />
<br />
Sabrina Dane - Nuclear Physicist<br />
<br />
==== Testimonials ====<br />
<br />
Alan Steinhardt, Steinhardt industries <br />
<br />
Vasili Pavlov, FTL Industries<br />
<br />
Mikhail Regison, Echo CTO / Co-founder<br />
<br />
- [https://clyp.it/xbv04wbz Multiverse Radio Advertisement]<br />
<br />
<br />
=== Superlumina [https://www.superlumina-6c.com ->>>] === <br />
Partnered with The Atlas Foundation. Creator of the world's first [https://en.wikipedia.org/wiki/Tachyonic_antitelephone antitelephone].<br />
<br />
==== Our Team ====<br />
<br />
Hanne Cruickshanks<br />
<br />
Esme Savidge<br />
<br />
Austen Spence<br />
<br />
- [https://clyp.it/r4r3xriw Superlumina Radio Transmission]<br />
<br />
<br />
<br />
=== ETARC [http://www.etarc.org/ ->>>] === <br />
<br />
Edison Township Amateur Radio Club (E.T.A.R.C) is a club for HAM radio enthusiasts in Edison Township, New Jersey.<br />
<br />
[[Waking Titan/Characters/Emily Warren|Emily Warren]] - Ham radio enthusiast and moderator of the [https://forums.etarc.org/ ETARC forums], before it was revealed that Emily was only Loop16's persona. It has since been re-branded to the official forums for the Citizen Science Division.<br />
<br />
Old Gods - A mysterious entity distributing Atlas Foundation emails. It has [https://forums.atlas-65.com/u/oldgods its own account] on the ETARC forums, and its profile picture and name are referencing '''[https://en.wikipedia.org/wiki/Nyarlathotep Nyarlathotep]''' from the H.P Lovecraft Mythos.</div>Kkzzzkthttps://wiki.gamedetectives.net/index.php?title=Waking_Titan/Phase_4&diff=15711Waking Titan/Phase 42018-06-15T09:53:44Z<p>Kkzzzkt: added a list of files discovered in the "Client - 43617373696e69" PDFs</p>
<hr />
<div>{{argbox<br />
| float = right<br />
| image = File:Project WT logo.png<br />
| name = [[Waking Titan]] - Phase 4<br />
| description= Phase 4 of Waking Titan started on 2017-12-28 and is currently ongoing.<br />
| creator = [http://www.aliceandsmith.com/ Alice & Smith]<br />
| creator2 = [http://www.hellogames.org/ Hello Games]<br />
| type = Official<br />
| status = Active<br />
| discovered = 2017-05-28<br />
}}<br />
{{ArgHeader}}<br />
{{BackToTop}}<br />
<br/><br />
__TOC__<br />
{{Clear|both}}<br />
<br />
== Tenth Glyph ==<br />
<br />
Beginning on December 28th, 2017, typing <code>WHOIS</code> on the [http://www.wakingtitan.com/ Waking Titan website] returned the following: <code>#WHATIS1.5</code>. In addition, the 10th glyph was made active, and linked to a [https://drive.google.com/drive/folders/16a_0EZ0EdAcCNE7QgvwIwC18NOGnZ_q9 Google Drive folder], which contained community-made pictures of the NMS logo in an infinite mirror.<br />
<br />
The titles of the photos, when strung together (skipping the 00 (empty) ones), formed the hexadecimal code for <code>moirrr</code>, which was an anagram for <code>mirror</code>. Additionally, the hexadecimal code in the correct order for the word <code>mirror</code> could be found on the bottom of the [http://www.myriad-70.com/ Myriad website].<br />
<br />
Also of note was the background of the tenth glyph, which read:<br />
<br />
[[File:Imageglyph10.png|thumbnail|right|the background of the tenth glyph]]<br />
<br />
<pre><br />
Dear Elizabeth<br />
We have finished processing 10,000 passes as per your requirements. You should<br />
have them in time for the next phase. I really hope you will like the final product.<br />
<br />
Kind regards,<br />
Gail<br />
</pre><br />
<br />
The allusion to <code>10,000 passes</code> is likely a reference to the Level 4 Atlas passes that were promised to players as part of earlier phases. The identity of "Gail" remained unknown.<br />
<br />
=== Atlas Passes ===<br />
On January 17th, 2018, the first CSD user received their Atlas Pass. The passes were made from cardstock, with a textured pass printed on it. The front had the text <code>WAKING TITAN</code> printed, and below that the CSD category the user belonged in. On the very bottom, a series of hexadecimals reading <code>70686f656e6978</code> could be found, which, after decoding, translated to <code>PHOENIX</code>. On the back, the owner's CSD-ID was written, along with a serial number stating which pass out of 10,000 the user had, and a number at the top.<br />
<br />
It is strongly recommended to not cover up the hex underneath your signature, and to share the number above and below your CSD ID if you are in possession of a pass. Preferably with a picture of the front, as shown below.<br />
For a list of all the atlas passes currently known of, please refer to [https://docs.google.com/spreadsheets/d/1TrNnrCzg8H7cbbAE6lIOFQ7JK8aTSKjxY9Q1i8EfjBs/edit#gid=1893459896 this spreadsheet.] In the event you receive one of these, please share a picture of the front, and the numbers underneath and above your CSD-ID (censored bit) on the back.<br />
<br />
<gallery mode="packed" widths=240px heights=240px><br />
Image:Better atlas pass.jpg|Atlas Pass front side<br />
Image:BEST BACK ATLAS PASS.png|Atlas Pass back side<br />
</gallery><br />
<div style="clear: both"></div><br />
<br />
=== Status Command Update ===<br />
<br />
On January 20th at 5:44PM UTC, the output of the <code>STATUS</code> command began to update:<br />
<br />
<pre><br />
Downloading Data...: 19:44<br />
1- : 20:16 (32 min)<br />
1-8 : 20:27 (11 min)<br />
1-80 : 20:39 (12 min)<br />
1-800- : 20:44 (5 min)<br />
1-800-41 : 21:35 (51 min)<br />
<br />
1-800-413-01 : 22:14 (39 min)<br />
Xxxxx X : New Line<br />
<br />
1-800-413-011 : 22:15 (1 min)<br />
Xxxxx XX <br />
<br />
1-800-413-0110 : 22:16 (1 min)<br />
Xxxxx XXX<br />
</pre><br />
<br />
Calling the provided phone number yielded an SSTV transmission (pictured below) which, once decoded, provided meteorological data for various locations.<br />
<br />
<gallery mode="packed-hover" widths=240px heights=240px><br />
Image:Page 1 SSTV.PNG|SSTV page 1<br />
Image:Page 2 SSTV.PNG|SSTV page 2<br />
</gallery><br />
<div style="clear: both"></div><br />
<br />
Players found they were to order the list of locations in the image alphabetically. This yielded a sequence where <code>Index by Precipitation</code> could be read off.<br />
Using the ordered text indexed by precipitation (in <code>alma</code> the second index is <code>o</code>) led to the following:<br />
<br />
<pre><br />
CAFE<br />
BENE<br />
NINETEEN<br />
SAT<br />
</pre><br />
<br />
=== Livedrop Memo ===<br />
<br />
The text indicated a new livedrop would be occurring in the same location as the last one had. However, due to the old Cafe Bene closing, the <code>Xxxxx XXX</code> part was added in the STATUS command update to warn players about the new venue, <code>Outro NYC</code>, which opened in the same place as the Cafe Bene had been located. The livedrop was intended to occur at 7PM EST (12:00AM UTC). However, the first player from the community who set out for the drop was involved in a traffic mishap, delaying their arrival. Anticipating missing the drop's time window, the community reached out to request a time extension, and the STATUS command, which had updated frequently throughout the confusion, was updated again to approve the community's request.<br />
<mapframe text="Outro NYC" width=400 height=350 zoom=14 latitude=40.7328 longitude=-73.9909><br />
{<br />
"type": "FeatureCollection",<br />
"features": [<br />
{<br />
"type": "Feature",<br />
"properties": {<br />
"marker-color": "#0f0fee",<br />
"marker-size": "medium",<br />
"marker-symbol": "cafe"<br />
},<br />
"geometry": {<br />
"type": "Point",<br />
"coordinates": [<br />
-73.99094313383102,<br />
40.73275683797643<br />
]<br />
}<br />
}<br />
]<br />
}<br />
</mapframe><br />
<pre><br />
STAND BY: CSD CITIZEN NOT DETECTED<br />
WARNING: CSD CITIZEN NOT DETECTED!<br />
IT'S LONELY OUT HERE<br />
TIME EXTENSION REQUESTED?<br />
EXTENTION PROPOSED: 2H30 – AWAITING CSD APPROVAL<br />
EXTENSION APPROVED, BE SAFE<br />
</pre><br />
<br />
[[File:bookwt.png|thumb|left|Book case seen on the livedrop livestream is the same as one used in an earlier livedrop.]]<br />
<br />
After the extension was approved, a second player from the community set out to the livedrop location [https://youtu.be/Gvng4pAuxY8 on livestream] and met with their A&S contact around 7:30PM EST (12:30AM UTC). During the meeting, the player was handed [https://drive.google.com/file/d/1kAjH2njXiab3u24VkcY-69IvOabhytGv/view a memo] from a mysterious case disguised as a book, pictured left. After some cryptic conversation, the contact asked if they were "getting enough sleep", stating that being well-rested would be very important. After the meeting, players who had attended the livedrop met in another location and showed off the memo, speculating about it's contents and even discovering the REM Sleep connection to the letters on the memo's back. After the livedrop, the community used the livestream to look over the memo, pictured below. On the back of the memo <code>REMS</code> is written. This clue, in combination with the strange question A&S asked at the rendezvous, led players to the password for the 10th Glyph, <code>REM SLEEP</code>.<br />
<br />
<gallery mode="packed-hover" widths=240px heights=240px><br />
image:memo1.png|Memo page 1<br />
image:memo2.png|Memo page 2<br />
image:memo3.png|Memo page 3<br />
</gallery><br />
<br />
[[File:form7.png|thumb|right|Seventh question revealed on the [https://atlas13.typeform.com/to/VF6CpG bit.ly form] when REMS or REM Sleep is entered for question six]]<br />
<br />
Once the glyph was solved, the STATUS command updated to [https://atlas13.typeform.com/to/VF6CpG a bit.ly link to a form]. Players discovered that on the sixth question on the form, entering REMS or REM Sleep (case sensitive) caused a seventh question, pictured right, to reveal itself, allowing CSD users to enter their email address to receive "left over materials" from something called Lab 319. Players remained unclear on what exactly Lab 319 was or what it's leftovers were, however signing up seemed integral given the input is only revealed after using the REM Sleep phrase.<br />
<br />
=Myriad Back Online=<br />
On 26 March, 2018 at 05:25 UTC an event occurred. The [http://www.myriad-70.com Myriad] site came back online after having been offline since the end of Phase 3. The site featured indications of a solar event interfering with operations. In addition, the status command on [http://wakingtitan.com Waking Titan] briefly displayed the following:<br />
<pre><br />
CODE -3<br />
Unable to restart<br />
.................<br />
ERROR LOG SUMMARY<br />
- Major malfunction<br />
- Protect the monarch<br />
- All tiers 2 and tiers 3 clients must be purged IMMEDIATELY<br />
.................<br />
TO ALL CSD<br />
- Gather maximum EXTERNAL intel<br />
- CSD should take time to regroup and get organized<br />
</pre><br />
<br />
Ten minutes elapsed before the Status command began to display the following:<br />
<pre><br />
CODE -5<br />
System Locked<br />
e b 4 c 1 4 a 9 c 6 2 2 d f 7 1 6 6 f b e 0 d d 8 9 1 5 d b 0 2<br />
</pre><br />
<br />
This hexadecimal string was used to reference a connection the private key for an Ethereum cryptocurrency wallet related to an ostensibly "promotional" event for an upcoming product from [http://ware-tech.cloud/ W/ARE].<br />
<br />
=Client 3597b=<br />
<br />
At 1:11 AM, UTC, Myriad-70.com updated, and the updates included the following.<br />
<br />
<pre><br />
Latest network diagnostic table:<br />
- Network corruption detected<br />
- Situation isolated to Client 3597b<br />
- Process cannot be suspended due to critical conditions<br />
--------------------------<br />
-Beijing: 29.1Tb/s<br />
--------------------------<br />
MAJOR ISSUES:<br />
Client 3597b<br />
</pre><br />
<br />
<br />
Soon after, at 1:30 AM UTC, the Status command updated in the Terminal to say the following.<br />
<br />
<pre><br />
> status<br />
CODE -5<br />
System Locked<br />
e b 4 c 1 4 a 9 c 6 2 2 d f 7 1 6 6 f b e 0 d d 8 9 1 5 d b 0 2<br />
--------------<br />
Monarch Repository Status: Degraded<br />
Conflict With<br />
- Client 18d1a TRACERT 10.30.74.*<br />
- Client 3597b TRACERT 54.91.155.*<br />
- Client 351h TRACERT 6.128.214.*<br />
- Client 0911a TRACERT 74.1.21.*<br />
</pre><br />
<br />
Approximately 15 minutes later, clients began to disconnect, beginning with Client 0911a, second being Client 18d1a, and the last being Client 351h, who had an additional piece of text added, being <code>ID: 79657321</code>, which was translated as hex into <code> Yes! </code> <br />
<br />
Then, at 2:15 AM UTC, the status command was updated again, stating <code> - Client 3597b - UNABLE TO DISCONNECT 54.91.155.209 NAT 52.2.248.*</code><br />
<br />
At 1:38 PM UTC, the status command updated once again, stating <code> - Client 3597b - UNABLE TO DISCONNECT 54.91.155.209 NAT 52.2.248.*:80\\</code><br />
<br />
At 10:30 PM UTC, March 30, the status updated again to say<br />
<pre><br />
Latest network diagnostic table:<br />
- Client 3597b is beyond allocated limits<br />
- Process cannot be suspended due to critical conditions<br />
- Tier 1, 2 and 3 clients are now all offline<br />
</pre><br />
<br />
=Ware-tech.cloud=<br />
Of the sites found in the 52.2.248 range, [http://52.2.248.6 52.2.248.6] was found. Using the metadata found in the HTML and searching on Google, the [http://www.ware-tech.cloud domain] and [http://twitter.com/warecloud Twitter] were located as well. The site is in Chinese, although Google Translate gives a good, readable translation. <br />
<br />
On Twitter, under the Shipping Soon image, is a Hex string <code>77 61 6E 74 20 74 6F 20 6B 6E 6F 77 20 6D 6F 72 65</code> that, when converted to ascii reads <code>want to know more</code>. Under the #waretech hashtag on Twitter, there are three images shared by "Partner Companies" with the following code (and the ascii conversion):<br />
<br />
<pre><br />
62 69 74 2E = bit.<br />
6C 79 2F 77 = ly/w<br />
61 72 65 32 = are2<br />
</pre><br />
<br />
On the ware-tech website, if you subscribe, you receive an email with another 3 characters: <code>30 31 38</code>, which again in Ascii becomes <code>018</code>. Together this gave a bit.ly link that leads to the W/are Discord channel.<br />
<br />
On Discord, we were informed of a community puzzle that was going on by the admin. Members of the W/ARE Discord had received tweets from another account, [https://twitter.com/w9rPQ45E https://twitter.com/w9rPQ45E], which had seven tweets with hex code in them:<br />
<pre><br />
01 [ 74 78 2f 30 78 66 65 30 31 35 30 66 ] <br />
02 [ 62 33 30 32 61 38 62 36 64 34 30 38 ]<br />
03 [ 35 37 32 32 64 61 61 31 64 30 37 37 35 ]<br />
04 [ 38 33 31 38 35 30 38 36 39 31 30 61 31 ]<br />
05 [ 61 38 32 34 38 63 65 32 34 38 30 64 ]<br />
06 [ 32 65 33 38 37 33 31 ]<br />
07 - Signal Lost [ 65 6e 64 20 6f 66 20 6c 69 6e 65 ]<br />
</pre><br />
<br />
Translated into Ascii, these tweets give the following:<br />
<pre><br />
tx/0xfe0150f<br />
b302a8b6d408<br />
5722daa1d0775<br />
83185086910a1<br />
a8248ce2480d<br />
2e38731<br />
</pre><br />
which references [https://etherscan.io/tx/0xfe0150fb302a8b6d4085722daa1d077583185086910a1a8248ce2480d2e38731 this Ethereum transaction]. The Twitter username, w9rPQ45E is also [http://pastebin.com/w9rPQ45E a Pastebin], providing the string <code>edb044c81d40a196c4672a2bd6f17f1f6</code>. In the Ethereum transaction, there is Input Data that, when converted to ascii, links to [http://pastebin.com/HNqKEUpS another Pastebin], providing another string: <code>b67fbb5e90ddcda8a921656d0b30a20</code><br />
<br />
Two things have been done with these strings. Together, they are the Private Key for the Ethereum account the money was transferred to. It has since been withdrawn to a different account. Second, if you put the two strings together and compare them with the string from Waking Titan's console, every odd character matches the strings from Pastebin.<br />
<code>edb044c81d40a196c4672a2bd6f17f1f6b67fbb5e90ddcda8a921656d0b30a20</code><br />
<br />
<code>e b 4 c 1 4 a 9 c 6 2 2 d f 7 1 6 6 f b e 0 d d 8 9 1 5 d b 0 2&nbsp;</code><br />
The remaining characters are <code>d0 48 d0 16 47 ab 61 ff b7 b5 9d ca a2 66 03 a0</code>, however if this has any use is yet to be seen.<br />
<br />
Three hours after the W/ARE Discord Admin let the community know about the puzzle, at 6:01 PM UTC they returned and said<br />
<pre>That was it for today, good job on solving our community puzzle! You are good! :smiley:<br />
Tomorrow one of our partners will have a giveaway for us! We will have more for you this weekend also!</pre><br />
<br />
=Mercury Project=<br />
[[File:Sean-tweet.png|thumb|right]]<br />
[[File:NMSNext.png|thumb|The announcement for No Man's Sky: NEXT]]<br />
At 9:26 PM UTC, the <code> Mercury </code> command updated to say the following.<br />
<br />
<pre><br />
Mercury process > Build XXXX<br />
Ready to load branch version 1.5<br />
Send Password Code in HEX to : Telegram MercuryHG80<br />
</pre><br />
<br />
This puzzle required a user to solve the riddle shown below, convert the answer into hexdecimal, and send it to an official Telegram account run by one of the Puppet Masters.<br />
<br />
The puzzle involved a riddle that was discovered in a [https://twitter.com/warecloud/status/979103811489984513 Pastebin on W/ARE's twitter]. It went as follows: <code> “Descended from Night, I share the blood of nightmares. Look forward to the gates of horn and ivory” </code><br />
<br />
This puzzle was solved by searching "The gates of horn and ivory", which resulted in dreams and nightmares of Greek mythology. After noting the capital N in "nightmares", users found the Greek god of night, Nyx, which led to one of her children, Morpheus, who was one of the Oneiroi, and the god of dreams. The name was then converted to hexdecimal and sent to the Telegram account, and the terminal accepted the password, resulting in the following command update.<br />
<br />
<pre><br />
Processing "Morpheus" > ACCESS GRANTED<br />
Downloading.......<br />
</pre><br />
<br />
Then, at 9:54 UTC, the Mercury command updated again, and said the following.<br />
<pre><br />
<Mercury process > Build XXXX<br />
Ready to load branch version 1.5<br />
Send Password Code in HEX to : Telegram MercuryHG80<br />
--------------------------------<br />
Process started by community - ETA 11:00 BST<br />
https://bit.ly/2pLmadg<br />
</pre><br />
<br />
The shortened link redirected to a tweet from Sean Murray, which said <code> The cause is hidden. The effect is visible to all. #oneonebst </code><br />
<br />
The tweet also included a photo of someone, presumably Sean himself, holding a phone receiving a Telegram notification, which was Morpheus in hexdecimal. The hashtag spells out 11BST, or more precisely, 11:00 BST, or, 10:00 UTC. No updates were made at 10:00 PM, and was then confirmed to be counting to 10:00 AM.<br />
<br />
Roughly half an hour before the timer was up, at 9:26 AM UTC, Sean Murray announced on [https://twitter.com/NoMansSky/status/979288744791592960 Twitter] that he had a small announcement to make, and was going to post it early as it was about to leak.<br />
<br />
Shortly after, at 9:50 AM UTC, Hello Games announced the next update for No Man's Sky, which was No Man's Sky NEXT, set with a launch date for Summer of 2018.<br />
<br />
=Newsletter=<br />
[[File:WareNewsletter1.png|thumb|left|120px|Screenshot of the W/ARE newsletter]]<br />
On April 2 at around 23:30 UTC, user W/ARE came online in the W/ARE Discord to announce that the next giveaway would be sent out in a newsletter within the next hour.<br />
They also mentioned the upcoming launch of their new translated English website, new extranet and the release of a "WARE cryptocoin", and asked users who are planning to be at PAX East to let them know at info@ware-tech.cloud with "PAX EAST - YES!" in the subject line.<br />
<br />
At 00:30 UTC the newsletter started coming in via email. It announced that 25 winners were selected to receive Steam keys for games from W/ARE partners, such as The Shrouded Isle and Future Unfolding.<br />
It also included a [https://ware2.typeform.com/to/HuBpCP link to an Application Form] for indie developers to apply for a Developer Kit of W/ARE tech. The best applications will be up for a public community vote to decide which games will be launched on the W/ARE platform.<br />
<br />
Around the same time, the Status command in the Terminal updated to say the following:<br />
<br />
<pre><br />
> status<br />
CODE -5<br />
Monarch Repository : Data Loss Imminent<br />
Booting up Command.Center.v11<br />
Pending approval by Monarch<br />
</pre><br />
<br />
=PAX East Weekend=<br />
==Website update==<br />
On April 6, 2018 at 6 PM UTC the [https://ware-tech.cloud/ W/ARE website] updated with the new English translation and access to a Developer Area containing a sign-in form.<br />
<br />
==Status command==<br />
On April 8 at 01:19 AM, the Status command updated with the following output:<br />
<br />
<pre><br />
CODE -5<br />
Monarch Repository : Data Loss Imminent<br />
Booting up Command.Center.v11<br />
Pending approval by Monarch<br />
Error - Unable to connect with repository<br />
Memory Dump 2GzHGwu.jpg<br />
</pre><br />
<br />
The filename leads to a [https://i.imgur.com/2GzHGwu.jpg corrupted image hosted on imgur], depicting a partial area map, a satellite, and the word "MYRIAD".<br />
<br />
==Live Drop==<br />
On April 8 around 00:49 UTC, players who previously sent emails to W/ARE about attending PAX East received the following response:<br />
<br />
<pre><br />
Hello! We’ve heard from some attendees that our booth at PAX East is very difficult to find this year. To help you find the booth, we’ve enlisted the help of an Enforcer. Here is the information that our team at PAX has sent us to help you locate them:<br />
<br />
HANDLE: EMU<br />
PATH:<br />
START<br />
-997E<br />
-1E<br />
-1000E<br />
+4S<br />
+1000W<br />
+1W<br />
+1000W<br />
-7N<br />
REPEAT<br />
<br />
You should be able to find them on their path between 12PM and 3PM local time.<br />
<br />
- WARE<br />
</pre><br />
<br />
The path of EMU was determined by searching for a specific range of clustered booth numbers on the floor plan. Assuming Down is East, starting at booth 17102 and subtracting 997 from that number gives us 16105, which is to the East directly next to booth 17102. Continuing this with the rest of the coordinates:<br />
<br />
<pre><br />
17102 - 997E = 16105 - 1E = 16104 - 1000E = 15104 + 4S = 15108 + 1000W = 16108 + 1W = 16109 + 1000W = 17109 - 7N = 17102 (repeat)<br />
</pre><br />
<br />
Ultimately creates this path between the eight booths:<br /><br />
<br />
<center>[[File:Emu_path.png|frameless|The path of EMU]]</center><br />
<br />
<br />
Several users met with the contact between 4 and 7 PM UTC and were given a total of four USB drives. Each drive contained an image and a text file.<br />
<center><gallery><br />
1-4.jpg|(ea87d58e-5775-47a9-a201-b7c7007f46d1.jpg)<br />
2-4.jpg|(580cdc97-3e01-4902-83d6-7bc9e764dda2.jpg)<br />
3-4.jpg|(e34d6e93-98f2-45a5-9899-694f93317e0b.jpg)<br />
4-4.jpg|(f395ef03-f19c-4cb3-bc9c-5f80695ce7eb.jpg)<br />
</gallery></center><br />
[[File:Jumbledwordsoverlay.jpg|thumb|200px|USB drive images overlayed]]<br />
{| class="wikitable" border="1"<br />
|-<br />
! 1-4.txt<br />
! 2-4.txt<br />
! 3-4.txt<br />
! 4-4.txt<br />
|-<br />
| A cornucopia of knowledge is in the mind of mankind, but it must be nurtured and hidden from the wrath of time. Time swallows all things, ends all beginnings, and leaves each of us devoured.<br />
<br />
- arnaud@philojeux.com<br />
| A mind invisible is buried underground, but a mind of water carries no patterns. It is the mind, the wrist pointed to heaven, which allows us to dream. It is this hand on high that cast down our demons to the earth.<br />
<br />
- arnaud@philojeux.com<br />
| Slumber in prison for eternity, lock away every great thing, but the spirit cannot be broken. A voice like ages rocks the very ground and with it’s call a rise to action of every terror.<br />
<br />
- arnaud@philojeux.com<br />
| Of chaos swirls a terrible nothing, but pulled together without reason is reason born from chaos. A single note, another still, a symphony is creation where each piece follows the last no matter how the thread dances.<br />
<br />
- arnaud@philojeux.com<br />
|}<br />
<br />
The email address led to [http://www.philojeux.com/ philojeux.com], a website for a French indie game studio named Philo Jeux. Founded by Arnaud Lacours, it works on the philosophy-based game <code>Les tablettes de Mnémosyne</code> which was to be released on the WARE platform in July 2018.<br />
<br />
Overlaying all four images highlighted the letters <code>f1orbiag55z1</code>. Using this as the password for the login form on [http://extranet.ware-tech.cloud/ extranet.ware-tech.cloud] and combining it with the email address from the text files as the username granted access to Arnaud Lacours' account for the Developer Area. <br />
<br />
== WARE Developer Area ==<br />
[[File:Arnaud_Profile.png|thumb|400px|Arnaud Lacours' WARE Developer Profile]]<br />
Upon first access after the PAX event, the [http://extranet.ware-tech.cloud/ area] accessed using the credentials <code>arnaud@philojeux.com / f1orbiag55z1</code> contained a main page, a developer profile page and multiple inaccessible pages. The main page presented an overview of user statistics and an empty main [https://etherscan.io/token/0x5b758a02d08efa566f3438775888866afd5d046c WARE token] wallet. Alongside the empty wallet were 12 wallets labelled Alpha-Lima in the NATO Phonetic alphabet, each containing 256 WARE. The [http://extranet.ware-tech.cloud/documents Documents] and [http://extranet.ware-tech.cloud/taskmanager Task Manager] pages were inaccessible due to Arnaud Lacours' account having an insufficient clearance level. The [http://extranet.ware-tech.cloud/supplyrequest Request Supplies] page was inaccessible due to insufficient funds (where funds are probably WARE tokens). Accessing the [http://extranet.ware-tech.cloud/profile developer profile page] while authenticated as Arnaud Lacours showed their information; including a phone number: <code>(514) 448-1493</code>. When this number was originally called, it led to a [https://clyp.it/p1lbsf3e voicemail message] in French, translated to English it said:<br />
<pre><br />
Hi, I'm Arnaud Lacours, the CEO and founder of Philo Jeux. I'm not here at the moment. Please give me your contact details and I will call you back later. Thanks a lot, bye.<br />
Voicemail System: Sorry, this voicemail is full. Please try again later. Thank you for calling, goodbye.<br />
</pre><br />
On the 14th April at around 02:00 UTC, it was noted that the [https://clyp.it/cwdz4qxg voicemail message changed.] Again, the message was in French, roughly translating to:<br />
<pre><br />
I'm Arnaud's girlfriend, thanks a lot for your wishes. Unfortunately Arnaud's condition got worse and he can't call you back and for now the company is closed.<br />
</pre><br />
<br />
=Status & W/ARE Updates=<br />
On April 14 at 18:37 UTC, the value of the Status command updated:<br />
<pre>CODE -5<br />
Monarch Repository : Data Loss Imminent<br />
Booting up Command.Center.v11<br />
Pending approval by Monarch<br />
Rebooting...</pre><br />
<br />
<br />
At 19:51 UTC, players who had applied for a Developer Kit started receiving [https://mailchi.mp/062a86fa0c65/news-from-ware-1464925 emails with further details] on what kind of applications W/ARE were looking for. According to this email, the company had opened positions for five partnered studios, one of which would also receive a grand prize of $1,000 USD. The deadline for applications was April 28th.<br />
<br />
<br />
Then, at 20:38 UTC, the Status command updated again with the following output:<br />
<pre>CODE -5<br />
Monarch Repository : Data Loss Imminent<br />
Booting up Command.Center.v11<br />
Pending approval by Monarch<br />
Error- Unable to connect with repository<br />
WARNING- MEMORY DUMP FAILED!<br />
Biometric backup initiated…<br />
http://bit.ly/2ITvMcW</pre><br />
<br />
The [http://bit.ly/2ITvMcW link] led to a recording of a female voice reading out a string of words:<br />
<pre>Drunken - Disable - Geiger - Everyday - Hockey - Determine - Endow - Coherence - Freedom - Guitarist - Framework</pre><br />
[[File:Myriad_Interface_Distort.jpg|thumb|A still frame of the gif]]<br />
These are words from a [https://en.wikipedia.org/wiki/PGP_word_list PGP Word List], also known as a '''Biometric''' Word List, as hinted at in the Status text. Each word corresponds to a hex value:<br />
<pre>51 4B 6A 58 73 47 59 2E 67 69 66</pre><br />
<br />
When converted to ASCII this reads <code>QKjXsGY.gif</code>, which was the filename of an [https://i.imgur.com/QKjXsGY.gif animated gif on Imgur].<br />
<br />
=Regular Statistics Updates=<br />
On April 15, 2018 at 22:26 UTC, the [https://extranet.ware-tech.cloud/ Developer Dashboard] received an update to its Weekly Statistics, specifically the Total Sessions and Total Users counter. Another update followed at 13:19 the next day, after which the numbers continued to be updated 37 times over the next two days, once every hour at the 37th minute. The final update was recorded on April 18 at 1:37, 51 hours and 11 minutes after the very first update, and 36 hours after the first update at minute 37.<br />
<br />
Another phase of continuous updates to the Statistics overview started on April 19 at 2:37 AM, this time at 30 minute intervals.<br />
<br />
A record of all value changes can be found [https://docs.google.com/spreadsheets/d/1A8zODah54JUhO6ClFs8wNVvKLpLzWwm04lzOlS9mmAU/edit?usp=sharing here].<br />
<br />
<br />
=Dev Kit Update #2=<br />
On the 21st, at 4:17 PM UTC, all users subscribed to the W/ARE mailing list received a second Developer Kit Update.<br />
<br />
The update mentioned that the W/ARE team was working on a new test protocol for the headset that was expected to provide a 60% boost in power to the headset. It was also said that we would learn more in a couple weeks.<br />
<br />
The update also featured 3 submitted projects so far, which are as follows:<br />
<br />
*[https://www.youtube.com/watch?v=1c_682fRL8w DreamScape], a "user defined MMO where players can create their own worlds as they sleep", created by [http://www.edgewaregames.co.uk EdgeWare Games]<br />
<br />
*[https://www.youtube.com/watch?v=pBRZxVZ5KKs Venture Unknown], a supposed "spiritual successor to No Man's Sky", made by [https://www.cjkproduction.com/ventureunknown CJK Production]<br />
<br />
*[https://www.youtube.com/watch?v=qBxlref67wU The Drowned Tower], a "post-apocalyptic exploration game set in a dream-like world", made by [https://oceansmoke.wordpress.com OceanSmoke Games].<br />
<br />
It was found that these three projects were all player created, and have no official affiliation or information involving the Waking Titan ARG.<br />
<br />
<br />
=April 27-29th Access Grants=<br />
At 7:11 PM UTC on April 27, [http://extranet.ware-tech.cloud/documents the Documents portion] of the W/ARE extranet site, along with [http://extranet.ware-tech.cloud/taskmanager the Task Manager section] were unlocked. This started a series of tasks. Each new task was unlocked when funds were successfully transferred out of one of the developer sub-wallets. The wallet keys were received by sending the correct solution to the current task to <code>warelearn@ware-mail.cloud</code>.<br />
<br />
Under the introduction category, the link titled <code>2018 03 03</code> led to a corrupted image of what was discovered to be St. Basil's Cathedral in Moscow, Russia. [[File:Basil.jpg|thumb|200px|The corrupted image of St. Basil's Cathedral.]]<br />
There were also two other images of interest, titled <code>Notes-on-locations-1_ldf82ng0.png</code> and <code>Notes-on-locations-2_pisj84n91.png</code><br />
Combined together, the contents of these 2 images read the following.<br />
<pre><br />
1. THE MIDDLE OF THE INVERTED PENDULUM COULD FEED THE MOST LOGICAL MINDS<br />
<br />
2. ITS SHAPE WILL LIGHT THE SPARK OF CREATIVITY<br />
<br />
(049245)<br />
<br />
3. IMPOSING SURROUNDINGS HELP IDEAS TO BE TAKEN SERIOUSLY<br />
<br />
4. SURROUNDED BY WATER,<br />
EXHALING SERENITY<br />
<br />
(AT THE JUNCTiON<br />
BY THE LAKE)<br />
</pre><br />
[[File:Train_Ticket.jpg|thumb|Mr. Zheng's Manchurian Railway Ticket]]<br />
Another image was also found, entitled "Train ticket". It contains an image of a train and Cyrillic script that translates to "Manchurian Railway Ticket", "Moscow - Beijing" dated March 5, 2018.<br />
<br />
==Alpha==<br />
The Task Manager section revealed the first "Task" given to W/ARE employees, titled "Missing Employee", and that it was in progress. There was one description of what had happened, along with two update messages.<br />
<br />
The original description read the following.<br />
<br />
<pre><br />
IMPORTANT MESSAGE FROM WARE RESEARCH AND DEVELOPMENT TEAM. Attention to all developers. One of our colleagues, Mr. Zheng, has gone missing a month ago while on a R&D tour. Serious investigation inside the department has lead to nothing of interest, and we’re now asking for outside help. Please send any information concerning his potential whereabouts to warelearn@ware-mail.cloud.</pre><br />
<br />
The first and second update were as follows:<br />
<br />
Update 1:<br />
<pre><br />
All recent and potentially relevant documents found on Mr. Zheng’s computer have been translated and forwarded to the developer extranet. Our team is currently trying to use this information to retrace his last steps. We’re hoping that our combined efforts can bring light to this affair and bring Mr.Zheng back home safely. In the hope of attaining maximum reach and visibility, the R&D department also set up a Twitter account to serve as another relay of information.</pre><br />
(The twitter account in mention is [https://twitter.com/WARE_RDev @Ware_RDev])<br />
<br />
Update 2:<br />
<pre><br />
UPDATE ON R&D SEARCH. All information of interest sent to warelearn@ware-mail.cloud will be rewarded with codes to our exclusive WARE wallets which can be used for special package purchases.<br />
</pre><br />
<br />
Sending an email containing the keyword "Moscow" to warelearn@ware-mail.cloud caused them to send the following reply, including a link to a map of Beijing's subway for a planned 7th conference: [[File:Conference_7_Possible_locations.png|thumb|Possible locations for Conference 7]]<br />
<pre><br />
The WARE Research and Development team thanks you for your interest in the WARELearn initiative. The Russian Academy of Medical Science in Moscow’s conference on Art and Dreams is the last of a series of six conferences we hope will enlighten your mind. The WARE Team will review your application and get back to you as soon as possible!<br />
<br />
Feedback from employees is fundamental in the development of the WARELearn initiative. As such, we’re asking you to give us your opinion on the ideal location for our next conference. If the location you picked is chosen by our committee, you may be given the chance to attend and meet the promoters of the event.<br />
<br />
Our team has begun to pinpoint buildings that could be of interest. Feel free to inspire yourself and contact warelearn@ware-mail.cloud to let us know about your suggestion.<br />
<br />
Kind regards,<br />
The WARELearn initiative<br />
</pre><br />
<br />
Sending an email containing all the keywords "Moscow," "Beijing," and "049245" (from Notes on locations 1) triggered another response, this time containing the ALPHA sub-wallet key:<br />
[[File:Sub-wallets.jpg|thumb|Empty sub-wallets]]<pre><br />
Dear informer,<br />
<br />
To thank you for your recent help in Mr. Zheng’s case, WARE has provided you with a code to use on our internal cryptocurrency wallets. We promise that every significant clue provided to us will be rewarded as such.<br />
<br />
Claim your reward with this code and stay alert for further updates on the situation : 4e47e152a5afaf95537c5dba73ef73d45c11fd6743ff5db9bfea3eca9282fda<br />
<br />
Please withdraw the funds so that the main wallet can be updated. Note the updating process is not immediate.<br />
<br />
Kind regards,<br />
<br />
The R&D Team</pre><br />
The funds were withdrawn from the cryptocoin wallet, which led to an update to the Weekly Statistics page, where sub-wallet ALPHA was now displayed as empty.<br />
<br />
==Beta==<br />
A new message in the Task Manager followed:<br />
<pre><br />
Most recent informations linked to the WARELearn services has confirmed our suspicions that despite boarding his train in Moscow, Mr. Zheng never arrived at Beijing and seems to have abandoned the train along the route. Any information, as small as a postal code, that you can find about the possible location locations he may have visited for an extended period - such as a hotel or hostel - would be of tremendous help.<br />
</pre><br />
<br />
Using a map of the Trans-Manchurian Train route and the 4 hints from the Document files, players concluded that Mr. Zheng left the train in <code>Gostinyy Dom Chita, 672040</code>. Sending this information to the email address yielded another wallet key. Players were able to withdraw these funds from a cryptocurrency wallet, emptying sub-wallet BETA.<br />
<br />
The following update was posted in the Task Manager:<br />
<pre><br />
Thanks to dedicated informers, the investigation on Mr. Zheng is progressing and the tasks have been updated. We’ve been able to confirm that a stop was indeed made in Chita, after attending the Moscow conference on Art and Dreams. Please send any information concerning his potential whereabouts to warelearn@ware-mail.cloud, in addition to the updated task number.<br />
</pre><br />
<br />
==Charlie==<br />
A journal entry and a page of notes both written by Mr. Zheng were unlocked in the Documents section, along with an update in the Task Manager:<br />
<center><gallery><br />
Journal_Academy.png|(Mr. Zheng's Journal)<br />
Notes_on_Moscow.jpg|(Mr. Zheng's notes on Moscow)<br />
</gallery></center><br />
<br />
<pre><br />
Attention to all teams. Documentation (copies and originals) coming from a source close to the missing employee have been recovered by W/ARE. There are a lot of files to organize and our database employees are still trying to get everything in order. Any information that could help us make sense of them will be most welcome.<br />
</pre><br />
<br />
The image of "Notes on Moscow" contains 3 blanks and descriptions of 3 paintings. The blanks can be filled in with the subjects of the paintings. Sending these keywords, in addition to the updated task number - <code>a1028f, Montreal, 1.30pm. Meet me at the fountain in front of the Notre Dame Basilica.</code> - to the email, yielded the next wallet key. Again, players withdrew the funds from the wallet, emptying sub-wallet CHARLIE.<br />
<br />
==Delta - Montreal Live Drop==<br />
The Task Manager updated with an announcement of a live drop: [[File:Live_Drop_Montreal.jpg|thumb|200px|The note received at the Live Drop in Montreal]]<br />
<mapframe text="Place d'Armes" width=350 height=350 zoom=14 latitude=45.504722 longitude=-73.557222 align=left><br />
{<br />
"type": "FeatureCollection",<br />
"features": [<br />
{<br />
"type": "Feature",<br />
"properties": {<br />
"marker-color": "#7e7e7e",<br />
"marker-size": "medium",<br />
"marker-symbol": "square-stroked"<br />
},<br />
"geometry": {<br />
"type": "Point",<br />
"coordinates": [<br />
-73.55727553367613,<br />
45.504820504538785<br />
]<br />
}<br />
}<br />
]<br />
}<br />
</mapframe><br />
<pre><br />
Deploying a team for possible package seizure.<br />
<br />
Once the location will be secured and package examined, onsite examination will be possible.<br />
<br />
WARE will not allow package to leave location. Taking pictures will be permitted.<br />
<br />
Confirmation of Location: Place d’Armes, Montreal, In front of the fountain<br />
<br />
Confirmation of Time: Between 7pm and 9pm, local time<br />
</pre><br />
<br />
At the drop location, players received the following note: <code>I came two years after the Ursuline nuns. Now set in stone, here is my legacy. G. Nadeau</code><br />
<br />
Investigations led to the French nurse Jeanne Mance, who arrived in New France two years after the Ursuline nuns came to Quebec and established Montreal's first hospital in 1642, the <code>Hôtel-Dieu de Montréal</code>. She is memorialized in statue at the foot of the Maisonneuve Monument. Sending this information to the email unlocked the next wallet key, and the withdrawal of the funds emptied sub-wallet DELTA.<br />
<br />
==Echo==<br />
[[File:Journal_HotelDieu.png|200px|thumb|Journal Hotel Dieu]] On April 28 at 2:32 AM, a new journal page was unlocked that highlighted two circled notes, <code>DON'T FORGET TO MOVE NOTES ON THE MEETING TO THE CLOUD</code> and <code>SECULAR VADER OF THE BIBLE</code>.<br />
<br />
The new Task Manager update read:<br />
<pre><br />
The search to find Mr. Zheng is still ongoing. New information is now connecting him to Montreal’s Hotel Dieu. Please send any information concerning his potential whereabouts to warelearn@ware-mail.cloud, in addition to an updated task number [t1029r].<br />
<br />
We’ve tried to access Mr. Zheng's files in the R&D dropbox, but all access has been blocked.<br />
</pre><br />
It contained a link to Mr. Zheng's password-locked [https://www.dropbox.com/sh/jz2nbdawcphki04/AACA83rODlh8qN4vuayLfgRya?dl=0 Dropbox]. Players determined the correct password was <code>Gutenberg</code>, who produced the first printed Bible.<br />
<br />
The Dropbox contained 4 pdf files with printable hexaflexagon patterns. When folded, one of the sides on each hexaflexagon yielded a 13-digit number starting with 978. These were ISBN numbers for the following 3 books: <code>Nine Billion Names of God</code>, <code>The Paris Architect</code>, and <code>War and Peace</code>. Using the leftover numbers from each flexagon as a book cipher of the format page, line, and word, the phrase <code>unknown british soldier</code> was found. This points to the <code>Tomb of the Unknown Soldier</code>, which was the keyword to obtain the wallet code for sub-wallet ECHO.<br />
<br />
==Foxtrot==<br />
When assembled and put together, the three hexaflexagons revealed a shape resembling the river Seine in Paris in the area of the Louvre. Sending <code>Louvre</code> to the email address provided the code for sub-wallet FOXTROT and revealed a new journal document. [[File:Journal_Louvre.png|thumb|200px|Journal Louvre]]<br />
<br />
On the journal page were 3 sentences, with certain words underlined. Ordering the words by the number of underlines and counting their position in each sentence resulted in the phone number <code>438-368-9126</code>. Upon calling this number a [https://clyp.it/bgakdxvc recorded message] gave a morse code that translated to <code>PASTEH9EBKEXGT</code>. This led to a [https://pastebin.com/H9EBKEXG Pastebin document] containing the following text:<br />
<br />
<pre><br />
From the bottom of the crypt, at the feet of the Guardian, I ascend left<br />
Pass the dignitary and follow the water<br />
Go straight to the sun with open arms and turn right<br />
Turn left when you arrive home<br />
Go straight to the hand and head of the goddess and turn left to face the keeper<br />
Follow the procession into the house of kings<br />
Ignore the light and descend to your death<br />
I am here and with me the seventh part of what you are searching for.<br />
</pre><br />
<br />
==Golf - Paris Live Drop==<br />
A new live drop was announced to be in Paris, France:<br />
<br />
<mapframe text="Passage du Souvenir" width=350 height=350 zoom=14 latitude=48.873611 longitude=2.296389 align=left><br />
{<br />
"type": "FeatureCollection",<br />
"features": [<br />
{<br />
"type": "Feature",<br />
"properties": {<br />
"marker-color": "#008040",<br />
"marker-size": "medium",<br />
"marker-symbol": "entrance"<br />
},<br />
"geometry": {<br />
"type": "Point",<br />
"coordinates": [<br />
2.2963866591453552,<br />
48.873548644370125<br />
]<br />
}<br />
}<br />
]<br />
}<br />
</mapframe><br />
<pre><br />
Deploying a team for possible package seizure.<br />
<br />
Once the location is secured and package examined, onsite examination will be possible.<br />
<br />
WARE will not allow package to leave the location. Taking pictures will be permitted.<br />
<br />
Confirmation of Location: At the entrance of the Passage du Souvenir, Near the stairs, Paris<br />
<br />
Confirmation of Time: Between 1pm and 3pm, local time<br />
</pre>[[File:Hexaflexagons river.jpg|thumb|The finished hexaflexagon map]]<br />
At the Tomb of the Unknown Soldier, a monument in the Passage du Souvenir beneath the Arc de Triomphe de l'Étoile in Paris, players were given another hexaflexagon paper puzzle and told not to un-tape it. When aligned with the other three pieces, this revelead a location marked with an X at the Louvre.<br />
<br />
The text from the Pastebin found in the Foxtrot stage were clues on the correct route to follow inside the Louvre. The rest of the path led players to the sarcophagus of Ramesses III, on the side of which they found a depiction of <code>The Book of Amduat</code>. Sending this to the email yielded the key to sub-wallet GOLF.<br />
<br />
==Hotel==<br />
The parchment in <code>The Book of Amduat</code> can be found in the <code>British Museum London</code>, which was the keyphrase that unlocked sub-wallet HOTEL.<br />
<br />
The next Task Manager and Document updates read: [[File:Journal_London.png|thumb|Journal London]]<br />
<pre><br />
Locked briefcase found in London, near the British Museum. Not yet confirmed if Mr. Zheng left it there willingly. Package currently under observation.<br />
</pre><br />
<pre><br />
They were right.<br />
It's all leading here.<br />
<br />
I saw it at night.<br />
i had it in my hands. All the missing parts. For the first time, I felt like all was finally put in place. Then, I felt a powerful force, ripping it from my hands. I dropped it and all the pages flew away in the wind.<br />
<br />
I remember the morning that came after.<br />
I was standing tall, pointing at the former naval person, longing for all this knowledge that got away.<br />
<br />
I need to find its missing pieces.<br />
</pre><br />
<br />
==India==<br />
The phrase <code>former naval person</code> is the signature Winston Churchill used in his private correspondence with President Roosevelt. The text describes standing tall pointing at him. This was deduced to be Big Ben, which faces the Churchill statue in Parliament Square, London. Sending <code>Big Ben</code> to the email address provided the key to withdraw the funds from sub-wallet INDIA.<br />
<br />
A third live drop was announced to be in London:<br />
<pre><br />
Deploying a team for possible package seizure.<br />
<br />
Once the location will be secured and package examined, onsite examination will be possible.<br />
<br />
WARE will not allow package to leave the location. Taking pictures will be permitted.<br />
<br />
Confirmation of Location: Statue of Winston Churchill, Parliament Square, London<br />
<br />
Confirmation of Time: Between 1pm and 3pm, local time<br />
</pre><br />
<br />
==Juliett - London Live Drop==<br />
[[File:Thinker.jpg|thumb|The Thinker sculpture in Detroit]]<br />
On April 29th at 1PM local time, players met with a W/ARE technician in London and were given a scrambled picture of the "The Thinker" sculpture by Auguste Rodin, displayed at the Detroit Institute of Arts Museum. The keyphrase <code>Henry Fuseli, The Nightmare, 1781</code>, a painting found at the same museum, provided the code for sub-wallet JULIETT.<br />
<br />
This unlocked three new postcards in the Documents section.<br />
<center><gallery><br />
Postcard1 jhlj039u.jpg |(Postcard 1)<br />
Postcard2_kg8nao6.jpg|(Postcard 2)<br />
Postcard3_tesaud636.jpg|(Postcard 3)<br />
</gallery></center><br />
<br />
==Kilo==<br />
The locations pictured on the postcards were in Mexico, Peru, and Morocco. Each postcard mentioned two numbers and two cardinal directions, and combining these led to a string of coordinates: <code>33N, 43E - 30N, 69E - 22N, 79E</code>, which were found to be in Iraq, Pakistan, and India. Connecting these six locations by lines pointed to Egypt.<br />
<br />
The circled letters on the postcards spelled <code>monastery</code>, <code>king</code>, and <code>tonw</code>. Using these clues, players found <code>Deir el-Medina</code>, an Egyptian village whose name translates to "monastery of the kings". The village's name unlocked sub-wallet KILO.<br />
<br />
At 2:38 PM a new Journal page was revealed:[[File:Nightmare.jpg|thumb|Nightmare journal page]]<br />
<pre><br />
'Alights, and grinning<br />
<br />
I saw it again.<br />
<br />
Except this time, what snatched it from my hands was not a divine force but the unmistakable pull of this stippled incubus.<br />
<br />
'Alights, and grinning<br />
<br />
He glared at me,<br />
as he ripped all the pages before my horrified eyes.<br />
<br />
I felt his weight on my chest.<br />
<br />
xxxx?<br />
</pre><br />
It quotes excerpts from Ermasus Darwin's poem "Botanical Garden", which is an inscription found on the "The Nightmare" painting referenced in the JULIETT phase, engraved by Thomas Burke in 1783.<br />
<br />
Then, the next Task Manager update announced another live drop:<br />
<pre><br />
Briefcase found in London still locked but deemed safe by our experts. Once the location will be secured and package examined, onsite examination will be possible.<br />
<br />
WARE will not allow package to leave the location. Taking pictures will be permitted.<br />
<br />
Confirmation of Location: British Museum, London<br />
<br />
Estimated Time : Between 6pm and 8pm, local time<br />
</pre><br />
<br />
==Lima - 2nd London Live Drop==<br />
[[File:Box01.jpg|thumb|The locked box]]At the second live drop in London, players were given a small box locked with a 4-digit code. The key was <code>1783</code>, the year "The Nightmare" was engraved.<br />
<br />
Inside the box were three paper notes:<br />
<br />
<center><gallery><br />
Box02.jpg|(arbu = irbu, seru = saru)<br />
Box03.jpg|(Wolf = violent ennemy/Fox, the ennemy will not attack but will plot secretly)<br />
Box04.jpg|(Vomiting gold/silver = ten months, Golden trees/ghosts/demons = nine months)<br />
</gallery></center><br />
<br />
These notes reference ancient texts about dream interpretation. One of them is the Egyptian <code>Ramesside dream-book</code>, the code that unlocked sub-wallet LIMA.<br />
<br />
==Conclusion==<br />
[[File:Requestsupplies.jpg|thumb|The Request Supplies form]]At 5:18 PM the status command updated:<br />
<pre><br />
CODE -5<br />
Monarch Repository : Data Loss Imminent<br />
ReBooting Command.Center.v12<br />
</pre><br />
The [http://extranet.ware-tech.cloud/supplyrequest Request Supplies section] on the extranet was now accessible, revealing a "Specific Item Order Form". In addition to Arnaud Lacours' name, his employee ID <code>43617373696e69</code> was already filled in. Converted from HEX to ASCII this code translates to <code>Cassini</code>. Entering the ID into the console yields the following output:<br />
<pre><br />
LOG RECOVERED :: ITERATION #4924A ::<br />
The asteroid field was thick,<br />
denser than any I'd seen before.<br />
The ice, the dirt, the metal fragments…<br />
my ship never stood a chance.<br />
</pre><br />
[[File:Subject1.png|thumb|Subject1 image]]<br />
<br />
Another Status update followed at 5:33 PM:<br />
<pre><br />
CODE -5<br />
Monarch Repository : Data Loss Imminent<br />
ReBooting Command.Center.v12<br />
------<br />
Error, unable to start<br />
https://i.imgur.com/Fnixw9t.png<br />
------<br />
New command updated<br />
</pre><br />
It linked to an image with the headline <code>SUBJECT1</code> and a section named <code>MEMORY FRAGMENTS</code>.<br />
<br />
The search for Mr. Zheng concluded with a message from the @WARE_RDev Twitter account:<br />
[[File:WARE_Tweet_Zheng.jpg|thumb|center|400px|WARE_RDev Tweet]]<br />
<br />
=Dev Kit Contest Final Stage=<br />
[[File:Voteemail01.jpg|thumb|150px|Dev Kit Contest email]]On May 4th, 2018 at 10:15 PM UTC, users subscribed to the W/ARE mailing list started receiving the next Developer Kit Update. It announced that 10 out of 682 submissions were selected as finalists to the contest, and the public community vote was opened at [http://devkit.ware-tech.cloud/ devkit.ware-tech.cloud]. The email also mentioned No Man's Sky as one of W/ARE's partnered games.<br />
<br />
<br />
The following six winners of the contest were announced via email on May 12th at 00:20 AM:<br />
<br />
# [http://terraformed.austinmccarthy.com/ Summon Studios - Terraformed] and [https://stellar-software.cloud/ Stellar Software - Beyond the Stars]<br />
# [http://spectrumental.net Spectrumental Games - Supersensory]<br />
# [https://csd-games.com/ CSD Games - Tumbleweed]<br />
# [http://imperiuminteractive.com/ Imperium Interactive - Eden]<br />
# [https://gamedetectives.net/delve Game Detectives - Delve]<br />
<br />
=Update on Arnaud's Condition=<br />
On the 12th of May at 8:21 PM UTC, the status command was updated: <br />
<pre><br />
CODE -5 <br />
Command.Center.v12 crashed<br />
------ <br />
Global Network Scan started....<br />
Warning: Files locked by Monarch<br />
- dreamscape.exe<br />
- soundflex.exe<br />
- inyourmind.exe<br />
- Jeu_Capture_d_Ecran.jpg<br />
</pre><br />
One of the files "Jeu_Capture_d_Ecran.jpg" was then found an Arnaud's [http://www.philojeux.com/ site], a transcription of the image is as follows:<br />
<pre><br />
Dear "Tablettes de Mnémosyne" fans,<br />
<br />
A lot of you recently inquired about Arnaud's health and, as you endlessly supported him during the early development of Philojeux, we think it's fair for you to know what's going on. Arnaud has been very sick lately and his condition's decline lead to a loss of consciousness. He has been transported to urgent care at Montreal's Hotel-Dieu where his vital signs are being closely monitored. We hope you understand that the launch of "Tablettes de Mnémosyne" is indefinitely postponed.<br />
<br />
Please send all words of encouragement to Arnaud's family at fondationarnaudlacours@gmail.com<br />
</pre><br />
Upon emailing the address, the following response was received: <br />
<pre><br />
Thank you for reaching out to the Arnaud Lacours’ Foundation. All<br />
words of encouragement will be forwarded to Mr. Lacours’ family.<br />
<br />
<br />
Géraldine Nadeau<br />
Arnaud Lacours’ Foundation<br />
Hotel Dieu Hospital Research Institute<br />
438-368-9126<br />
</pre><br />
When the phone number was called, a [https://cdn.blacksite.games/waking-titan/foundation-message.mp3 voice mail] was played. A transcription of the voice mail is as follows: <br />
<pre><br />
You've reached Dr. Geraldine Nadeau, head of the Arnaud Lacours Foundation. Mr. Lacours' family thanks you for your support during these terrible events, and encourages you to always be cautious and critical in the face of the unknown. As Arnaud himself would say, "history comes from memory." You're invited to use the foundation's e-mail to share your words of encouragement with the family. Thank you for calling.<br />
</pre><br />
"History comes from memory" was found to be a riddle referencing Clio (the "Muse" of history), the daughter of Mnemosyne (the Goddess of memory). Upon emailing the word "Clio" to the address, the following response was received:<br />
<pre><br />
Thank you so much for returning my message. I need every helpful hand I can get.<br />
<br />
I figured, by the efforts you’ve put into contacting me, that you’ve got a high interest in Arnaud’s case. I’ve been monitoring him since nearly a month ago and I would be lying if I told you it doesn’t keep me awake at night. His condition is nothing like I’ve ever seen. His brain activity is insanely high, but he’s completely non-responsive.<br />
<br />
Not too long after I was informed of Arnaud’s condition, I was visited by a man claiming to work for a highly advanced tech company, specializing in unconscious experiences. He has been incredibly interested in Arnaud’s case as well as in my recent studies on sleeping patterns. I gave him some information on my research into lucid dreaming methods and he went on his way. I’ve never seen him again.<br />
<br />
Since then, I’ve been focused on gathering more information about W/ARE, their technology and their processes. I’ve noticed that Arnaud advertised them on his professional website but I don’t know the depth of his involvement with them. I figured that any person interested by the correlation between W/ARE and Arnaud would find the message I left there. I’ve put the Foundation in place as a cover to not arouse suspicion.<br />
<br />
I have so many questions and Zheng’s not answering my calls. All he gave me is the list of his company’s research labs as well as one totally incomprehensible file. I need to get to know more about W/ARE. If you know this man, if you can get any opening into this company’s motives, please help me. For Arnaud’s life and potentially many others.<br />
<br />
<br />
Géraldine<br />
</pre><br />
One of the sentences linked to a [https://www.dropbox.com/sh/6i6f2cipfd901bj/AAAUwOSxECU0l4tvZa4DSPBra?dl=0 Dropbox folder] that contained two images. The meaning of the images is unknown.<br />
<br />
==Zheng's Note==<br />
One of the images, titled [https://www.dropbox.com/sh/6i6f2cipfd901bj/AAAUwOSxECU0l4tvZa4DSPBra?dl=0&preview=Zheng%27s+note.jpg Zheng's Note], contained what at first appeared to be gibberish. However, when every other letter is taken the following text is revealed:<br />
<pre><br />
Test subjects have been called in and the device has been used on them in ways that i could never condone 7 of them lost as we speak 3 of them are dead 8 are on the verge of being unrecoverable their intentions are not what we think they are actions should be taken to shut them down exit<br />
</pre><br />
The letters that were not used in the message appear to be the words <code>Lucid Dream</code> repeating until the end of the message.<br />
<br />
==WARE Labs==<br />
The second image, titled [https://www.dropbox.com/sh/6i6f2cipfd901bj/AAAUwOSxECU0l4tvZa4DSPBra?dl=0&preview=WARE+Labs.jpg WARE Labs] contains data concerning six research labs owned by WARE across the world. The transcription of the data is as follows:<br />
<pre><br />
0:<br />
Boston Research Lab<br />
Lab Director: Richard Wilkes<br />
Project name: we-2-3 / tm-1-lt / tr-10-ae<br />
<br />
Project description: 0000100001<br />
Project code: # 4-3<br />
Lab sequence 10-3<br />
<br />
1:<br />
Sacremento Research Lab<br />
Lab Director: Helga Johnson<br />
Project name: st-1-dn / ss-4-bn<br />
<br />
Project description: 0001010000<br />
Project code: # 1-2<br />
Lab sequence: 4-6<br />
<br />
2:<br />
Seoul Research Lab<br />
Lab Director: Yu Hyo<br />
Project name: ue-2-is / as-6-be<br />
<br />
Project description: 0100000011<br />
Project code: # 1-2-1<br />
Lab sequence: 9-1-13<br />
<br />
3: <br />
Beijing Research Lab<br />
Lab Director: Wang Jie<br />
Project name: st-1-dn / bg-1-tr<br />
<br />
Project description: 0001000000<br />
Project code: # 4<br />
Lab sequence: 8<br />
<br />
4: <br />
Prague Research Lab<br />
Lab Director: Adriana Dvorak<br />
Project name: ae-4-sd / of-5-ue<br />
<br />
Project description: 0100101000<br />
Lab code: # 10-3-4<br />
Lab sequence: 2-5-12<br />
<br />
5: <br />
Berlin Research Lab<br />
Lab Director: Georg Muller<br />
Project name: dd-1-ae / dn-2-()<br />
<br />
Project description: 001000001<br />
Lab code: # 2-3<br />
Lab sequence: 7-11<br />
</pre><br />
Each of the letter pairs in the project name field represented a first and last letter of a word in the decoded Zheng's note. <code>3</code> and <code>()</code> represent the word <code>three</code> and the end of the message, respectively. Then the sequence that fit those words needed to be found, so for example, <code>dd-1-ae</code> would be the words <code>dead 8 are</code> in Zheng's note. Using this method, the following sequences were found:<br />
<pre><br />
we speak 3 / them are lost / their intentions are<br />
shut them down / subjects have been<br />
unrecoverable their intentions / actions should be<br />
shut them down / being unrecoverable their<br />
are actions should / of being unrecoverable<br />
dead 8 are / down exit <br />
</pre><br />
The middle number was then found to represent which letter of the middle word was important, as it was always less than the character count of the middle word. Taking each letter indicated by the middle number the string <code>paste hdtuig8x</code> was given, which was found to represent a [https://pastebin.com/hdtuig8x pastebin] link. The pastebin link then led to [https://www.dropbox.com/sh/n675hwdwhik5rg5/AABfjT9UDSFGeGmk2clRYLI_a?dl=0 another dropbox folder titled "Client - 43617373696e69"] that contained 4 PDF files relating to Arnaud's incident. The PDFs provided datadumps from the dreamscape, soundflex, and inyourmind processes before they all failed:<br />
<br />
'''Dreamscape''':<br />
<br />
* [https://www.dropbox.com/s/ln1beuxoo4ig992/m1.jpg?dl=0 m1 - successful]<br />
<br />
* m2 - failed<br />
<br />
* [https://www.dropbox.com/s/touiwi6qhneg8hs/m3.jpg?dl=0 m3 - successful]<br />
<br />
* [https://www.dropbox.com/s/9wcxup3ka5zzrl2/m4.jpg?dl=0 m4 - corrupted]<br />
<br />
* [https://www.dropbox.com/s/cl17kp9kri6i1t8/m5.jpg?dl=0 m5 - successful]<br />
<br />
* m6 - failed<br />
<br />
* [https://www.dropbox.com/s/e4olmlc3yy4vnqf/m7.png?dl=0 m7 - successful]<br />
<br />
'''Soundflex''':<br />
<br />
* [https://clyp.it//m2t5s3ns s1 - successful]<br />
<br />
* [https://clyp.it//sxrz4spl s2 - successful]<br />
<br />
* [https://clyp.it/deihb43e s3 - corrupted]<br />
<br />
'''Inyourmind''': [https://www.dropbox.com/sh/n675hwdwhik5rg5/AABfjT9UDSFGeGmk2clRYLI_a?dl=0&preview=Client+-+43617373696e69-1.pdf >>>]<br />
<br />
The rest was solved, and a second pastebin found by splitting Zheng's note into 6 rows of 10 words like so:<br />
<pre><br />
Test subjects have been called in and the device has<br />
been used on them in ways that I could never <br />
condone 7 of them are lost as we speak 3<br />
of them are dead 8 are on the verge of <br />
being unrecoverable their intentions are not what we think they<br />
are actions should be taken to shut them down exit<br />
</pre><br />
From there, the binary values in <code>Project description</code> were used to pick out words:<br />
<pre><br />
0000100001 - called has<br />
0001010000 - them ways<br />
0100000011 - 7 speak 3<br />
0001000000 - dead<br />
0100101000 - unrecoverable are what<br />
001000001 - should exit<br />
</pre><br />
Then <code>Project code</code> was used to pick out letters from each word:<br />
<pre><br />
called has | 4-3 = ls <br />
them ways | 1-2 = ta<br />
7 speak 3 | 1-2-1 = 7p3<br />
dead | 4 = d<br />
unrecoverable are what | 10-3-4 = aet<br />
should exit | 2-3 = hi<br />
</pre><br />
<code>Lab sequence</code> was then used to determine the order of the letters:<br />
<pre><br />
ls = 10-3 - l and s are letters ten and three respectively<br />
ta = 4-6 - t and a are letters four and six respectively<br />
7p3 = 9-1-13 - 7, p and 3 are letters nine, one and thirteen respectively<br />
d = 8 - d is the eighth letter<br />
aet = 2-5-12 - a, e and t are letters two, five and twelve respectively<br />
hi = 7-11 - h and i are letters seven and eleven respectively<br />
</pre><br />
Reordered the following string was obtained: <code>paste ahd7lit3</code><br />
This was the link to a second [https://pastebin.com/ahd7lit3 pastebin]. The pastebin linked to a second [https://www.dropbox.com/sh/nebk9ukhnnt3mkk/AABTaLwSSRyYBcWvDhJVDJfaa?dl=0 dropbox titled "Archives"]. The folder contains six images of what appear to be WARE customer support logs.<br />
<br />
=Myriad Status Update=<br />
On the 13th of May at 6:29 PM UTC Myriad's [http://www.myriad-70.com/status/ status page] was updated. A diff of the change can be found [https://www.diffchecker.com/4g9xfrbN here]. The only change was the network diagnostic table, which now says the following:<br />
<pre><br />
Latest network diagnostic table:<br />
- Client 3597b’s resources redirected <br />
- 3597b-1-2-1 has been shut down<br />
- Additional resources allocated to 3597b-4<br />
</pre><br />
<code>3597b-1-2-1 has been shut down</code> seems to imply that the Seoul Research Lab has been shut down, <code>Additional resources allocated to 3597b-4</code> seems to indicate that the Beijing Research Lab is now receiving additional resources. Two hours before this status change, at 4:02 PM UTC WARE [https://twitter.com/warecloud/status/995710781168726018 tweeted] about the arrival of 40 new employees to their Beijing Research Lab. It is possible that the tweet and status update are connected.<br />
<br />
=Dev Kit Shipping Updates=<br />
On May 15, 2018 at 19:20 UTC, winners of the W/ARE development contest received an update on the status of their dev kit deliveries. A link inside the email led to a form, indicating that the package was currently located in Beijing, contained 1 Dev Kit, and weighed 1.80 kg, and requesting confirmation from each of the winners that the package belonged to them.<br />
{| class="wikitable" border="1" width="60%"<br />
|-<br />
! scope="col" style="width: 50%;" |Email<br />
! scope="col" style="width: 50%;" |Form<br />
|-<br />
| Dear Customer,<br />
<br />
A package was shipped to you via W/ARE Shipping Service.<br />
<br />
Confirmation that you are indeed the receiver is required.<br />
<br />
Please follow this link to confirm your identity.<br />
<br />
Kind regards,<br />
W/ARE tech<br />
<br />
This is an automated message, please do not respond.<br />
| [[File:Devkitshipping01.PNG|400px|Shipping confirmation form 1]]<br />
|}<br />
<br />
A second update followed the next day at 23:54 UTC. The status of the package had changed to confirm it was now located in Seoul, was held in transit for 460 minutes, and had been reduced in weight to 0.50 kg.<br />
{| class="wikitable" border="1" width="60%"<br />
|-<br />
! scope="col" style="width: 50%;" |Email<br />
! scope="col" style="width: 50%;" |Form<br />
|-<br />
| Dear Customer,<br />
<br />
Your W/ARE package is currently leaving Seoul to be redirected to its new transit location. <br />
<br />
Confirmation that you are indeed the receiver is required.<br />
<br />
Please follow this link to confirm your identity.<br />
<br />
Kind regards,<br />
W/ARE tech<br />
<br />
This is an automated message, please do not respond.<br />
| [[File:Devkitshipping02.PNG|400px|Shipping confirmation form 2]]<br />
|}<br />
<br />
=Terminal Status Update and Precon007=<br />
On May 15th at 21:48 UTC, players discovered that the status command had updated.<br />
<pre><br />
CODE -5 <br />
Command.Center.v12 crashed <br />
------ <br />
New memo received<br />
http://bit.ly/2IHPmMN<br />
</pre><br />
The [http://bit.ly/2IHPmMN bit.ly link] lead to a new memo from Major Sophie Dubois to Elizabeth Leighton. The memo was titled <code>Ware Report #26</code>. It mentions that many users stuck in "the system" show major side effects after being disconnected, from brain damage to death. It is presumed that this system has something to do with the WARE headset, however it is unknown what they are specifically referring to. It is also mentioned that the impact on Myriad has damaged Emily/Loop16's communication and precognition functions. Alongside this another command is mentioned in the memo. <code>precon007</code>. The output for the command is the following:<br />
<pre><br />
PRECON DATA DUMP 01<br />
http://bit.ly/2rJi6uJ<br />
http://bit.ly/2GkZnu5<br />
http://bit.ly/2rJBO9Z<br />
http://bit.ly/2L2fwbe<br />
</pre><br />
The bit.ly links were all links to images, much of them completely indistinguishable, however the first appears to be some sort of document with most/all of the information blocked out, and the second depicts an image similar to the one discovered by players on April 14th. The third appears to be the box for a W/ARE devkit, and the fourth is almost completely indistinguishable and unknown. Players speculated that it is a pyramid hologram display. Embedded in each image was a string of hex:<br />
<gallery mode="packed-hover" widths=240px heights=240px><br />
Image:Precon-01.jpg|Precon image 1<br />
Image:Precon-02.jpg|Precon image 2<br />
Image:Precon-03.jpg|Precon image 3<br />
Image:Precon-04.jpg|Precon image 4<br />
</gallery><br />
<pre><br />
Image 1 - 65 74 61 20 75 6e 6b 6e 6f 77 6e - eta unknown<br />
Image 2 - 65 74 61 20 6d 61 79 20 31 38 2d 31 39 - eta may 18-19<br />
Image 3 - 49 73 20 4c 20 50 6c 61 79 73 20 47 61 6d 69 6e 67 20 72 69 67 68 74 3f - Is L Plays Gaming right?<br />
Image 4 - 65 74 61 20 75 6e 6b 6e 6f 77 6e - eta unknown<br />
</pre><br />
<br />
=Book Deliveries=<br />
On May 16th, 2018, several members of the No Man's Sky community started receiving physical books in the mail:<br />
<br />
* The Conscious Mind: In Search of a Fundamental Theory by David J. Chalmers, received by CobraTV<br />
* The Dramaturges of Yan by John Brunner, received by [https://twitter.com/nevadander/status/996839681345183744 Nevadander]<br />
* From Bacteria to Bach and Back: The Evolution of Minds by Daniel C. Dennett, received by Tony_Towers<br />
* Meditations on First Philosophy by Rene Descartes, received by UnimatrixZeroOne<br />
* Nine Tomorrows by Isaac Asimov, received by [https://twitter.com/Galactic_Geo/status/997215352932061184 Galactic_Geo]<br />
<br />
=Glyphs 11-15=<br />
On May 17, 2018, the last five glyphs on [https://wakingtitan.com/ the Waking Titan website] activated. Currently, none of these glyphs have any hints or backgrounds associated with them. This is in contrast to the previous glyphs, each of which had a link to something that hinted at what needed to be solved, as well as their own background when the glyph was clicked/opened.<br />
<br />
=Myriad Status and Precon Update=<br />
On May 18th at 20:15 UTC Myriad's status page was updated.<br />
<pre><br />
Latest network diagnostic table:<br />
- command.center.satcom updating<br />
- Client 3597b’s resources redirected <br />
- 3597b-1-2-1 has been shut down<br />
- Additional resources allocated to 3597b-4<br />
</pre><br />
Alongside this network diagnostic table update, the "On the ground speed" averages also updated:<br />
<pre><br />
Manhattan: 0.2Tb/s<br />
London: 0.7Tb/s<br />
Tokyo: 0.5Tb/s<br />
Beijing: 55.1Tb/s<br />
</pre><br />
The <code>precon007</code> command in the Waking Titan [http://wakingtitan.com/ Terminal] was also changed.<br />
<pre><br />
PRECON DATA DUMP 01<br />
[x]<br />
http://bit.ly/2GkZnu5<br />
http://bit.ly/2rJBO9Z<br />
http://bit.ly/2L2fwbe<br />
</pre><br />
The first bit.ly link that had previously led to an image of what appeared to be a redacted document was removed and replaced by <code>[x]</code>.<br />
<br />
=Loop16 Command Updated=<br />
On May 18th at 23:40 UTC it was discovered that the response for the command <code>loop16</code> in the Waking Titan Terminal had changed.<br />
<pre><br />
Processing <br />
UTC : 11:45pm <br />
UTC : 12:00am <br />
UTC : 12:15am <br />
UTC : 12:30am <br />
UTC : 12:45am <br />
UTC : 01:00am <br />
UTC : 01:15am<br />
</pre><br />
Once the clock had struck 11:45 PM UTC, the command updated again:<br />
<pre><br />
Processing <br />
UTC : 11:45pm http://bit.ly/2KADObl<br />
UTC : 12:00am <br />
UTC : 12:15am <br />
UTC : 12:30am <br />
UTC : 12:45am <br />
UTC : 01:00am <br />
UTC : 01:15am <br />
</pre><br />
The [http://bit.ly/2KADObl link] led to an image of what appears to be a constellation. Following this, the command proceeded to update every 15 minutes, each time adding a different link.<br />
{|class="wikitable"<br />
! Time (UTC)<br />
! Link<br />
! Constellation<br />
! Missing Star<br />
|-<br />
|11:45pm<br />
|http://bit.ly/2KADObl<br />
|Bootes<br />
|Arcturus<br />
|-<br />
|12:00am<br />
|http://bit.ly/2wRXnKl<br />
|Carina<br />
|Canopus<br />
|-<br />
|12:15am<br />
|http://bit.ly/2IAuoMk<br />
|Pegasus<br />
|Scheat<br />
|-<br />
|12:30am<br />
|http://bit.ly/2rSv1L1<br />
|Ursa Major<br />
|Dubhe<br />
|-<br />
|12:45am<br />
|http://bit.ly/2wRXu8J<br />
|Scorpius<br />
|Antares<br />
|-<br />
|1:00am<br />
|http://bit.ly/2wTwVjl<br />
|Canis Minor<br />
|Procyon<br />
|-<br />
|1:15am<br />
|http://bit.ly/2rTwIqN<br />
|Lyra<br />
|Vega<br />
|}<br />
<gallery mode="packed-hover" widths=240px heights=240px><br />
Image:Bootes.jpg|Boötes, missing the star Arcturus.<br />
Image:Carina.jpg|Carina, missing the star Canopus.<br />
Image:Pegasus.jpg|Pegasus, missing the star Scheat.<br />
Image:Ursa_Major.jpg|Ursa Major, missing the star Dubhe.<br />
Image:Scorpius.jpg|Scorpius, missing the star Antares.<br />
Image:Canis_Minor.jpg|Canis Minor, missing the star Procyon.<br />
Image:Lyra.jpg|Lyra, missing the star Vega.<br />
</gallery><br />
Around the same time as the command began updating, players discovered a Reddit account named [https://www.reddit.com/user/satcom-70 satcom-70], who had posted a [https://www.reddit.com/r/NoMansSkyTheGame/comments/8kfrj2/commandcentersatcom_cid_185/ thread] titled <code>command.center.satcom - CID 185</code> on the No Man's Sky subreddit. The name of the user was also found to be a part of a [http://satcom-70.com/ URL] which led to the Command Center. The only text displayed on the website at the time was <code>COMMAND.CENTER.V12 CRASHED</code>. This lined up with the output of the <code>status</code> command in the Waking Titan terminal.<br />
<br />
On the 19th of May, the Reddit post was updated to contain a [https://i.imgur.com/angJPlX.jpg hint] to the puzzle. Upon finding this hint, players realized that they needed to reorder the stars according to their background color. After this, the stars were numbered 1-7. That number told players which letter out of each star name to use in order to get <code>ANNAETN</code>, an anagram for <code>ANTENNA</code>, which gave a new [https://s3.amazonaws.com/cdn.wakingtitan.com/comroute/141t6.jpg image] when put into the Waking Titan terminal.<br />
<br />
When unscrambled, the following text was revealed on the image:<br />
<pre><br />
Reconstructing language database<br />
Protocol<br />
bit.ly/2KEkJVF<br />
Comment with filename of Wikipedia DB ending with D97C0<br />
</pre><br />
Then, the Wikipedia database with the filename <code>D567CE8E2EC4792A99197FB61DEAEBD70ADD97C0</code> was found. The name was commented on the post, then the post was edited to the following:<br />
<pre><br />
D567CE8E2EC4792A99197FB61DEAEBD70ADD97C0 - Valid . Command updated - Erpbirel . System entering standby . CR now loading satcom-70.com . Support instructions: igS4Tzd6<br />
</pre><br />
The [http://satcom-70.com/ satcom-70] website was updated. <code>Erpbirel</code> was a terminal command for Waking Titan that led to an [http://cdn.wakingtitan.com/9f57789f-a706-4006-a314-92a8029dce4e-.jpg image]. The second part, <code>Support instructions: igS4Tzd6</code>, was found to be a part of the URL for a [https://pastebin.com/igS4Tzd6 pastebin link]. The text of the pastebin was as follows:<br />
<pre><br />
Vocal reconstruction database required<br />
Source: Wikipedia (any article)<br />
Length: 1 sentence<br />
Format: MP3 audio<br />
Minimum samples : 100<br />
Minimum languages: 5<br />
Minimum unique voices: 33<br />
Sample origin: Homo sapiens<br />
Upload instructions: Submit all samples in a single message to u/satcom-70<br />
Deadline : Tuesday May 22nd, 10am eastern time<br />
</pre><br />
<br />
=Dev Kit Delivery=<br />
On May 21, 2018, winners of the W/ARE development contest started receiving their dev kits in the mail. Each package contained:<br />
* A letter to Arnaud requesting that a picture with results be emailed to Dr. Nadeau. This included a W/ARE Tech medical procedure slip<br />
* A plastic holographic pyramid, designed to display "3D Holograms" using a phone<br />
* A phone and a charger<br />
** Skype was installed on the phone and the required login details were found in a notes app. The Skype contacts listed each of the other winning dev studios as a "Point of Contact" (PoC)<br />
** The phone included an app called <code>Myriad Uplink</code> that can also be accessed at [http://uplink.satcom-70.com/ uplink.satcom-70.com]<br />
** Different audio files were found on each of the phones, transcribed below:<br />
<br />
<center><br />
{|class="wikitable"<br />
! scope="col" style="width: 16%;" |Stellar Software - PoC #1<br />
! scope="col" style="width: 16%;" |Imperium Interactive - PoC #2<br />
! scope="col" style="width: 16%;" |Spectrumental Games - PoC #3<br />
! scope="col" style="width: 16%;" |Summon Studios - PoC #4<br />
! scope="col" style="width: 16%;" |CSD Games - PoC #5<br />
! scope="col" style="width: 16%;" |Game Detectives - PoC #6<br />
|-<br />
|1 - "W/ARE Tech support, how can I help you?" [https://clyp.it/hpbypwo5 Audio file]<br />
|1 - "Uhm, ten hours tops. This is very unusual to me." [https://clyp.it/1gkv0aog Audio file]<br />
|1 - "You said you went to sleep immediately after taking your medication?" [https://clyp.it/cirija3q Audio file]<br />
|1 - "No, on my computer." [https://clyp.it/qhcdx2jr Audio file]<br />
|1 - "On your W/ARE device?" [https://clyp.it/f5cuzm2e Audio file]<br />
|1 - "I started a new game, played a bit, and went to bed after." [https://clyp.it/zn2wl5tg Audio file]<br />
|-<br />
|2 - "Thank you for taking the time to update us on your condition. I see that you've ordered some of our exclusive blood thinners, did you follow the prescription instructions?" [https://clyp.it/rihvc0w2 Audio file]<br />
|2 - "Hello, uhm... I would like to have a follow-up on an incident related to your headset." [https://clyp.it/hcdex55q Audio file]<br />
|2 - "Thank you for choosing W/ARE!" [https://clyp.it/czag350m Audio file]<br />
|2 - "6 - E - 6 - 9?" [https://clyp.it/shmwas3t Audio file]<br />
|2 - "I see you already emailed our department yesterday about the same inquiry. Do you still suffer from the previously mentioned symptoms?" [https://clyp.it/njpp1sit Audio file]<br />
|2 - "I never used them. This morning, though, my body feels incredibly stiff. Should I have taken them?" [https://clyp.it/i4lqxrlz Audio file]<br />
|-<br />
|3 - "Were your sleeping patterns the same as usual?" [https://clyp.it/hreqcs5s Audio file]<br />
|3 - "Right side mostly, arms and legs." [https://clyp.it/nifdnptq Audio file]<br />
|3 - "Excuse me sir, I need to verify something. I'll be back in a moment. [music box recording of "La Vie En Rose" plays as hold music]" [https://clyp.it/zzldfrb3 Audio file]<br />
|3 - "Alright, thank you very much." [https://clyp.it/k1u0atix Audio file]<br />
|3 - "Can you identify where this feeling is coming from?" [https://clyp.it/1v5yjeuf Audio file]<br />
|3 - "I slept a lot, actually." [https://clyp.it/shes3jgj Audio file]<br />
|-<br />
|4 - "Thank you for your patience. I relayed a quick recap of your symptoms to our internal specialist, and your condition seems to be related to a mild case of brain fatigue. We suggest you take pauses between play sessions so your mind relaxes. If your symptoms persist, we suggest you consult a health specialist to make sure you don't have any underlying conditions that could interfere with the headset's performance." [https://clyp.it/arezqg4x Audio file]<br />
|4 - "Actually, I took an Aspirin, went to bed, and it disappeared over night." [https://clyp.it/al5i4bpv Audio file]<br />
|4 - "I'm very sorry you experience discomfort using your device. Can you please give me the last four characters of your client number?" [https://clyp.it/wfckrukr Audio file]<br />
|<br />
|4 - "Do you have an approximate amount of time?" [https://clyp.it/csvxb0qh Audio file]<br />
|}<br />
</center><br />
<br />
<gallery mode=packed widths=240px heights=240px><br />
Image:Devkitcontents01.jpg|Complete contents of the package<br />
Image:Devkitcontents02.jpg|Phone homescreen<br />
Image:Devkitcontents03.jpg|Myriad Uplink app<br />
Image:Devkitcontents04.jpg|Medical procedure slip<br />
</gallery><br />
<br />
==Skype Messages==<br />
On May 22 around 19:00 UTC, the following text messages were received through the Skype app on the phones:<br />
<pre><br />
From: Geraldine Nadeau<br />
<br />
I don't have much time to talk.<br />
Am in contact with Zheng. I may have an opening into WARE's medical docs but i'm not sure yet.<br />
I'll contact you again soon.<br />
<br />
Update on Arnaud's condition:<br />
Vital signs have been very unstable during last week. Heart rate and blood pressure stabilized for two days.<br />
HR: 57-62 bpm<br />
BP: 110 / 70</pre><br />
<pre><br />
From: Mercury Process<br />
<br />
MERCURY PROCESS DIRECTIVE 16.B:<br />
Carefully review the datadump. Send all analyses and findings to mercury@atlas-65.com<br />
</pre><br />
<br />
More messages came in on May 23, 19:30 UTC:[[File:Skypemessages01.jpg|thumb|Skype messages from Dr. Nadeau]]<br />
<pre><br />
From: Geraldine Nadeau<br />
<br />
Thank you so much.<br />
I have been told that W/ARE is on high alert and extremely vigilant right now. They've doubled their security measures and we couldn't get access to their medical documents, but we'll keep trying. I don't know if they are aware of my contact with Zheng.<br />
<br />
If you are willing to help, here's an update on Arnaud's condition.<br />
HR and BP still stable<br />
EEG in high gamma zone at 82<br />
Oxygen levels stabilized at 94%<br />
</pre><br />
<br />
Messages from May 24, 19:43 UTC:<br />
<pre><br />
From: Geraldine Nadeau<br />
<br />
Update on Arnaud's condition.<br />
No change on HR and BP<br />
EEG still in high gamma zone at 87<br />
Examination of body: Slight discoloration of fingertips<br />
<br />
We're getting close to a breach and probably will have something more for you tomorrow.<br />
</pre><br />
<br />
Messages from May 25, 20:56 UTC:<br />
<pre><br />
From: Geraldine Nadeau<br />
<br />
I need your help concerning one of the dev kits. There are two dev kit recipients that I haven't yet been able to make contact with- one of them is still in transit, but the other appears to have arrived at its destination. <br />
<br />
I'm concerned that W/ARE may have intercepted the kit, which would be disastrous considering the risks that we are taking. If you know of another dev kit recipient that I haven't yet been able to contact, can you please forward them this message and ask them to reach out to me?<br />
</pre><br />
<br />
=May 25-26 Updates=<br />
On May 25, 2018 at 21:42 UTC, the output of the <code>STATUS</code> command began to update:<br />
<pre><br />
1. Cassini: Incomplete<br />
2. WT16: Incomplete<br />
3. Uplink: Incomplete<br />
4. Loop16: Processing<br />
<br />
Guidance subroutine checksum ///<br />
31 2e 20 77 61 69 74 69 6e 67 20 69 6e 73 74 72 75 63 74 69 6f 6e 73 20 32 2e 20 31 30 2f 31 35 20 33 2e 20 61 2f 4f 31 4f 73 65 65 42 20 34 2e 20 64 6f 77 6e 6c 6f 61 64 69 6e 67 20 76 6f 69 63 65 20 64 61 74 61<br />
</pre><br />
<br />
The code is HEX and translates to:<br />
<pre><br />
1. waiting instructions<br />
2. 10/15<br />
3. a/O1OseeB<br />
4. downloading voice data</pre><br />
<br />
<code>a/O1OseeB</code> led to an [https://imgur.com/a/O1OseeB album on Imgur] that contains images of items required to make a DIY blacklight, such as purple, blue, and black sharpies, a flashlight, and adhesive tape.<br />
<br />
A new Skype message was received at 22:15 UTC:<br />
<pre><br />
I’m forwarding you the last messages Zheng sent me. Hopefully, you can make sense of it. It kind of looks like a list but I don’t know what it means. <br />
<br />
101 110 116 101 114 32 97 65 116 55 77 51 50 99<br />
<br />
101 110 116 101 114 32 87 114 84 97 119 112 115 113<br />
<br />
101 110 116 101 114 32 90 89 51 70 98 49 49 86<br />
<br />
101 110 116 101 114 32 117 113 56 78 54 89 69 87</pre><br />
<br />
The ASCII numbers translate to the following:<br />
<pre><br />
enter aAt7M32center WrTawpsqenter ZY3Fb11Venter uq8N6YEW<br />
</pre><br />
<br />
These strings were then used to complete four pastebin URLs which contained the following links:<br />
* [https://pastebin.com/aAt7M32c pastebin.com/aAt7M32c] -- https://clyp.it/user/1legrggu<br />
* [https://pastebin.com/WrTawpsq pastebin.com/WrTawpsq] -- https://www.dropbox.com/s/eq8gk5b6axnpoh7/1-2-1_ResearchLab_Medical.pdf?dl=0<br />
* [https://pastebin.com/ZY3Fb11V pastebin.com/ZY3Fb11V] -- https://www.dropbox.com/s/esc95j7ihseujls/1-2-1_ResearchLab_Medical_Exceptions.pdf?dl=0<br />
* [https://pastebin.com/uq8N6YEW pastebin.com/uq8N6YEW] -- https://www.dropbox.com/s/8ddztbyf7bv27bb/1-2-1_ResearchLab_Medical_Recommendations.pdf?dl=0<br />
<br />
The clyp.it audio files seemed to be the missing conversation snippets found on the remaining dev kit phone which had not yet arrived at the time. The PDF files on Dropbox provided information on how to identify and treat Arnaud's condition.<br />
<br />
Based on this information, players sent the following medical instructions to Dr. Nadeau:[[File:Waremedicalprocedure.jpg|thumb|W/ARE Medical Procedure slip]]<br />
# 3 foam pads all around the head<br />
# Defibrillator 500 volts 3 times, wait 30 minutes<br />
# Epinephrine injection, 3 doses<br />
# Mood regulator pills x1 diluted in 20 ml of mineral water<br />
# Play "La Vie En Rose", the last song he listened to, for 45 seconds<br />
# Propofol injection, 1 dose<br />
<br />
In response, the following messages were exchanged on Skype:<br />
<pre><br />
Geraldine Nadeau: Thank you very much. As you and two others devkit holders confirmed similar steps, I’ll assume this is the procedure to follow. Can you confirm, by yes or no, if I apply those steps to Arnaud’s treatment?<br />
<br />
Dev Kit Holders: Yes.<br />
<br />
Geraldine Nadeau: Proceeding to treatment. I’ll update you soon.<br />
</pre><br />
<br />
Shortly after, the <code>STATUS</code> command in the terminal updated again with a change of Cassini's status from <code>Incomplete</code> to <code>Processing</code>.<br />
<br />
On May 26 at 1:24 AM UTC, a new Skype message was received:<br />
<pre><br />
From: Geraldine Nadeau<br />
<br />
Arnaud is responding positively to treatment, despite the highly unusual procedures. We still don't know the lasting side effects he will keep from these events but he seems to be gradually drifting from a vegetative state to the land of the living. I wanted to thank you from the bottom of my heart for helping me in these conditions.<br />
</pre><br />
<br />
And the status of the Cassini process displayed in the terminal changed again from <code>Processing</code> to <code>Completed</code>.<br />
<br />
==Glyph Passwords==<br />
Another Skype message followed at 1:36 AM UTC:[[File:Wt-blacklight.jpg|thumb|200px|The book cipher found under a blacklight]]<br />
<pre><br />
From: Mercury Process<br />
<br />
Attention to all involved parties. Please make detailed inspection of your W/ARE package for possible anomalies. Be sure to use appropriate equipment and to document your investigation while broadcasting to involved partners. Thank you for your collaboration.<br />
</pre><br />
<br />
Written on one of the dev kit boxes, <code>180-4-5 171-27-8 40-21-2 70-3-9 268-4-6 180-4-2</code> was found using a blacklight. Used as a book cipher of the format page, line, and word, the phrase <code>He who contains the entire universe</code> was found in CobraTV's copy of the book <code>The Conscious Mind: In Search of a Fundamental Theory by David J. Chalmers</code>. This phrase led players to the Mesopotamian god Anu, who is described as the one "who contains the entire universe". <code>Anu</code> was the password that unlocked Glyph 14 on [http://wakingtitan.com/ wakingtitan.com].<br />
<br />
The command <code>Anu</code> gives the following output in the Waking Titan terminal:<br />
<pre><br />
Marked with honeycomb scars, I am the lowest of the low<br />
</pre><br />
<br />
On another dev kit box, the phrases <code>HIGH UP IN THE DARK</code> and <code>A RISING PANIC</code> were found under the blacklight.<br />
<br />
The passwords for the remaining glyphs 11, 12, 13 and 15 were discovered to be <code>Ouranos</code>, <code>Horus</code>, <code>Nuada</code>, and <code>Triglav</code>, respectively; all of them are sky deities. Used as commands in the terminal, they output the following:<br />
<pre><br />
> Ouranos<br />
uSivrseU<br />
</pre><br />
<pre><br />
> Horus<br />
From my red soil, four times rises Vulcan<br />
</pre><br />
<pre><br />
> Nuada<br />
VCjsyZzA<br />
</pre><br />
<pre><br />
> Triglav<br />
96cdXqpi<br />
</pre><br />
<br />
Each of the strings led to a Pastebin that contained a code:<br />
* Ouranos: https://pastebin.com/uSivrseU - <code>8NuHRIZGacoGgQZiTcCyQQpp1kzRWP3PdN4OUZabxZbPoE0P0RjsrFRiNB0GhOcVdwBSYz0ng8AwlnzYx89msDhGHrLbIUct</code><br />
* Nuada: https://pastebin.com/VCjsyZzA - <code>bYmyFioUHMbLGRI0h8j9ApSY+HkWjD4Wms0i8yPZv3pJj5xp1SJR7HaSOmjBml8cJBG77x5WXaXItYIm2OylFQ==</code><br />
* Triglav: https://pastebin.com/96cdXqpi - <code>2tY7mcPs2A8Z9DarmAnnrKTqph4g+3eOisGtBg3MLGI=</code><br />
<br />
Later, clue 3 in the <code>status</code> command in the Waking Titan terminal had changed to a bit.ly link leading to an About page on [https://www.resilientsystems.com/about-us/incident-response-leadership/ IBM Resilient's website]. It was found that one of the people mentioned on the page, Bruce Schneier, was the developer/designer of an encryption method called [https://en.wikipedia.org/wiki/Blowfish_(cipher) Blowfish], which is a symmetric block key cipher. This turned out the be the decryption method for the hex output of the base64 strings received from the Pastebins. The keys were found by solving the riddles from other glyphs. The glyphs were paired up so that the 12th glyph's terminal command gave the decryption for the 11th glyph, and the 14th glyph's command gave the answer to the 13th glyph. Glyph 15 was the outlier in this, and the riddle that gave its key was found in the 6th W/ARE development kit received by the Game Detectives. The solutions to the riddle were as follows:<br />
<pre><br />
From my red soil, four times rises Vulcan - Tharsis<br />
Marked with honeycomb scars, I am the lowest of the low - Hellas<br />
High up in the dark, a rising panic - Phobos<br />
</pre><br />
<br />
Once decrypted, it was found that the hex then converted properly into ASCII text, and provided more riddles:<br />
<pre><br />
Ouranos - Tharsis - The hills I have conquered honor the lost, who preceded my journey...<br />
Nuada - Hellas - From these hills, I can see the headless horsemans lair...<br />
Triglav - Phobos - With me, came great openings<br />
</pre><br />
<br />
These three riddles are referring to the Spirit rover that landed in the crater Gusev on Mars in 2004. The first riddle refers to the Columbia Memorial Station, the landing site of the rover, named in honor of the seven astronauts lost in the Space Shuttle Columbia's destruction upon atmospheric re-entry. The second riddle refers to "Sleepy Hollow", a small depression in the ground close to the Rover's landing site that scientists took interest in. One of the rover's aliases, <code>MER-A</code> was then found to be the deployment code needed to access a synchonization process on the [https://uplink.satcom-70.com/ uplink.satcom-70] website.<br />
<br />
==loop16 seq21==<br />
Right after the 14th glyph was solved, a user named <code>atlas-loop16</code> posted a link to a [https://www.youtube.com/watch?v=qJlj-8nFtHc Youtube video] on the [https://www.reddit.com/r/NoMansSkyTheGame/comments/8m765s/loop16_seq21/ No Man's Sky Subreddit]. The following was said by Emily in the video, seemingly quoted from the first submission to the voice reconstruction process that was started on May 18:<br />
<pre><br />
Emily, protocol 16, now active.<br />
42 is a pronic number, and an abundant number; its prime factorization, 2 * 3 * 7, makes it the second sphenic number and also the second of the form (2 * 3 * r).</pre><br />
<br />
==Myriad Status Update==<br />
The Status page on the [http://www.myriad-70.com/ Myriad-70] website also updated to display the following:<br />
<pre><br />
Latest network diagnostic table:<br />
- Initializing connection<br />
- Myriad Code: CJ 16-02<br />
- Public Name: SJ 16-02<br />
- NORAD ID: 41634<br />
</pre><br />
<br />
==Reddit Comments==<br />
On May 26, 2018 at 19:17 UTC, user [https://www.reddit.com/user/atlas-loop16 atlas-loop16] began responding to comments on Reddit in 16 minute intervals:<br />
#For a moment I see another universe, a place utterly unlike anything you have ever encountered.<br />
#I could show others sights they've never seen before... that only I will ever have.<br />
#I wonder, sometimes. If there's a point in going on.<br />
#As I leave, they ask if I have received any direct readings.<br />
#All of us, we're shifting, bleeding in and out of line... <br />
#If the boundaries were to fall, everything would descend into everything, an endless bonfire of causation, burning to the abyss.<br />
#Have you not felt it? The very fact that you and I are talking, even now, across the myriad of universes...<br />
#I tell this future as if it has already happened... as it will happen.<br />
#It saw them, even in the space between worlds.<br />
<br />
The comments were found to be dialogue lines from speaking with Travellers in No Man's Sky. All of the dialogue that can be seen by speaking with Travellers can be found [https://pastebin.com/Fbkrtrf9 here].<br />
<br />
The comments have one-word differences from the game dialogue, which spells out the phrase <code>Tell them you have a direct line to Myriad.</code>.<br />
<br />
==Mercury Contact & Hologram==<br />
On May 26 at 21:38 UTC, the value of the <code>STATUS</code> command in the terminal updated:[[File:Wt-hologram.jpg|thumb|Picture of the player model hologram]]<br />
<pre><br />
All Tasks Completed<br />
Launching Mercury Process<br />
Establishing connection....<br />
</pre><br />
<br />
Shortly thereafter, the dev kit holders received Skype messages from <code>Mercury Process</code> with a link to a Youtube video titled [https://www.youtube.com/watch?v=QhSiAI4smDg mercury part1of3]. It can be used to display a 3D hologram with the plastic pyramids received in the dev kits. The hologram depicts a person in a space suit, believed to be a player model in No Man's Sky.<br />
<br />
==Old Gods Email==<br />
On May 26 at 22:00 UTC, a [https://mailchi.mp/9aaa8aa62cc1/update-june-8th-waking-titan-137741?e= new email] from the Old Gods was received by all members subscribed to the CSD newsletter. It contained a [https://www.youtube.com/watch?v=8HZmi4pIm54 Youtube video] of Elizabeth Leighton speaking to the Citizen Scientists Division about the subject of a missing satellite "SJ 16-02", and information about the Uplink SATCOM-70 app and how to help gathering data about the satellite's location.<br />
<br />
=loop16 seq25=<br />
On May 31 at 23:56 UTC, user <code>atlas-loop16</code> made a [https://www.reddit.com/r/NoMansSkyTheGame/comments/8nnbme/loop16_seq25/ post on the No Man's Sky subreddit] titled <code>loop16 seq25</code>. It contained a link to a [https://vocaroo.com/i/s096bnEz1zek voice recording] of Emily reading from the lyrics of the song "Tonite" by LCD Soundsystem:<br />
<pre><br />
Emily, protocol 16, now active.<br />
<br />
And you're too sharp to be used<br />
Or you're too shocked from being used<br />
By these bullying children of the fabulous<br />
Raffling off limited edition shoes<br />
</pre><br />
<br />
On June 2 at 1:58 AM UTC, the user resumed posting these lyrics multiple times as replies in the same thread. It was determined that Emily recited a player submitted voice recording.<br />
<br />
==Uplink Calibration Update==<br />
On June 1, the [https://uplink.satcom-70.com/ uplink.satcom-70.com] website updated, now requiring an access code for calibration and playing a video/audio clip of ominous noises that change based on the satellite's vicinity to the user. A new file appeared at hourly intervals, 16 minutes past every hour. The audio contains rhythmic booms and a blip that seems to shift one second to the left in each new file. 25 of the files alternate between two unique patterns of booms: <code>Signal A - 2 1 1 1</code> and <code>Signal B - 1 3 1 2 1 3 1</code>. The booms in the last audio clip are set in a rhythm of <code>1 - 1 - 2 - 3 - 5 - 8</code>, which corresponds to the Fibonacci Sequence.<br />
<br />
The following clips have been found:<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/no-signal.mp4 no-signal.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/thk0s00ab7rxfh14f8bv0qlpvtt367.mp4 thk0s00ab7rxfh14f8bv0qlpvtt367.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/6qhs4a3jiqzso8zipy3822n7412xyv.mp4 6qhs4a3jiqzso8zipy3822n7412xyv.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/ty83wrs13xybxj1eqmt9tv2tisrenn.mp4 ty83wrs13xybxj1eqmt9tv2tisrenn.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/npifvp8doon3dc9h8zqoppk2hqnqqm.mp4 npifvp8doon3dc9h8zqoppk2hqnqqm.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/o6wlg4m1yyf7gt4gdes4f5nz5lzxpn.mp4 o6wlg4m1yyf7gt4gdes4f5nz5lzxpn.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/6vkeel1dg02b53xbir1f3oqj8du3z0.mp4 6vkeel1dg02b53xbir1f3oqj8du3z0.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/k5lx26f1pp9yiyz9f3bpw73ycncsx6.mp4 k5lx26f1pp9yiyz9f3bpw73ycncsx6.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/gb1402pqj93eg9f23k4o2f1emt1vtk.mp4 gb1402pqj93eg9f23k4o2f1emt1vtk.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/ysler9zklzlyiazqy0q0ppmqj526ru.mp4 ysler9zklzlyiazqy0q0ppmqj526ru.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/s4zmlwytajtb0rga3rtx0miq2a4j9c.mp4 s4zmlwytajtb0rga3rtx0miq2a4j9c.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/6ra5mfxok06yguf27fhtnp4aec2p97.mp4 6ra5mfxok06yguf27fhtnp4aec2p97.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/0dc3jqoiffj3dcxghy0fn1kc86zfgi.mp4 0dc3jqoiffj3dcxghy0fn1kc86zfgi.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/lgfo4i7siirjsop1puaop2wbi0mcx8.mp4 lgfo4i7siirjsop1puaop2wbi0mcx8.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/bt24ns6uz174ofsrn4ux578nwqla2b.mp4 bt24ns6uz174ofsrn4ux578nwqla2b.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/i0isq42s45xolz4aqqvgat54tmhxzm.mp4 i0isq42s45xolz4aqqvgat54tmhxzm.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/kwxovao9r9rk2ng4ecs5ta6u90ufzp.mp4 kwxovao9r9rk2ng4ecs5ta6u90ufzp.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/ac1yxbi0kcb16y448q3rr88y6bh4pk.mp4 ac1yxbi0kcb16y448q3rr88y6bh4pk.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/2qci73sahjtucnf76mafov4g8wzp4l.mp4 2qci73sahjtucnf76mafov4g8wzp4l.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/h2jugyu9x9cjjairnxy3sgbgmvqkzb.mp4 h2jugyu9x9cjjairnxy3sgbgmvqkzb.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/2chnxeok8csnc6kikg8zgod8t2zsyc.mp4 2chnxeok8csnc6kikg8zgod8t2zsyc.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/5x3rhk01khsl1b93vkjnc1vpbx2lfk.mp4 5x3rhk01khsl1b93vkjnc1vpbx2lfk.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/iip9b8zbkr47rdtyqvdafphjxryh6j.mp4 iip9b8zbkr47rdtyqvdafphjxryh6j.mp4] <br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/98fh5s9s6xzd4ev1ezmkhk5l6o6mxz.mp4 98fh5s9s6xzd4ev1ezmkhk5l6o6mxz.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/9y1460usa6aayatwqvemfeeiicom2z.mp4 9y1460usa6aayatwqvemfeeiicom2z.mp4] <br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/y69gz4qiakwzsfkti4swbu83zpqg5h.mp4 y69gz4qiakwzsfkti4swbu83zpqg5h.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/p81cp503ya10frwpq8qunddzcm3yqk.mp4 p81cp503ya10frwpq8qunddzcm3yqk.mp4]<br />
<br />
==Email from the Old Gods==<br />
On June 2 at 15:03 UTC, a [https://cdn.artemisbot.uk/mail/Old%20Gods-2018-06-02T15:03:59.000Z.jpg new email] from the Old Gods - signed by Maj. Sophie Dubois - was received, giving an update on their investigation into the W/ARE incident. They also linked to a new [https://atlas13.typeform.com/to/nJPGYM form (ID 7615-b)], a psychological profile test, and announced that 16 participants will be rewarded with a new limited edition Atlas Pass. An update on <code>Project Satcom-70: Operation A1-4</code> informed about the Uplink Calibration Update, that a new signal was registered at 16:16 EST, and all Citizens were invited to listen to their Uplink app when the satellite is over their house and report any findings in the [https://www.reddit.com/r/NoMansSkyTheGame/comments/8nwno7/uplinksatcom70com_is_giving_us_audio_files_and/ main investigation thread] on the No Man's Sky Subreddit.<br />
<br />
The email also provided an update on Emily with a link to her recent [https://www.reddit.com/r/NoMansSkyTheGame/comments/8nnbme/loop16_seq25/ thread on Reddit] and an image displaying W/ARE research labs across the world:[[File:WT-laboratorylisting.png|thumb]]<br />
<pre><br />
With the help of the Citizen Scientist Division, we now have a direct contact with Emily. Her situation is stable but still critical.<br />
<br />
Unfortunately, it seems that one of W/ARE tech’s research labs is continuing to upload corrupted data to the satellite. This bad data may be causing further damage to the network, and to Emily. We need to analyze her recent interactions to figure out if she was able to make predictions that could help to identify and isolate the source of the broadcast. <br />
<br />
Please find below a list of W/ARE research labs and their approximate locations. I will need a full report on how the issue was diagnosed and the name of the responsible location before we can proceed. Loop16 appears to be currently active on Reddit, so you can upload this report into her existing thread. I know this is a large task, but I am confident in your abilities.<br />
</pre><br />
<br />
==Invisible Unicode Messages==<br />
Emily's text posts on Reddit contained hidden Unicode characters that represent the digits 0-3 in Base-4 and, when decoded to ASCII, revealed a set of dates and times:<br />
<pre><br />
01.06-06.06<br />
00:33:00<br />
00:48:00<br />
07:15:20<br />
15:17:40 <br />
15:32:00<br />
20:25:00<br />
23:40:00<br />
07:45:40<br />
20:40:00<br />
23:55:00<br />
08:14:40<br />
21:10:00<br />
</pre><br />
<br />
Another comment by Emily revealed the following hidden messages after it was edited several times:<br />
<pre><br />
ORIGINAL COMMENT<br />
06.10<br />
03:32 UTC<br />
</pre><br />
<pre><br />
10.06<br />
23:47<br />
(03:32 UTC)<br />
</pre><br />
<pre><br />
10.06<br />
ERROR<br />
</pre><br />
<br />
Tracking the satellite's path based on these timestamps placed it near Sacramento, and the Sacramento W/ARE research lab was concluded to be the one sending corrupted data to the satellite. Replying to the thread with this information triggered a new reply by Emily that contained the following hidden message:<br />
<pre><br />
Forwarding report(SACRAMENTO) to contact(THEMIS)<br />
Waiting...<br />
Waiting...<br />
Report received!<br />
</pre><br />
<br />
Then, at 00:00 UTC, the <code>STATUS</code> command in the Waking Titan terminal updated:<br />
<pre><br />
Guidance subroutine offline<br />
Uplink Awaiting Calibration<br />
</pre><br />
<br />
==Uplink Access Code==<br />
On June 7, the solution to the puzzle was found by comparing the pattern of booms in the two unique signals A and B. First, the number of the booms was counted:<br />
<pre><br />
Signal A - 2 1 1 1 <br />
Signal B - 1 3 1 2 1 3 1<br />
</pre><br />
<br />
Then the signals were visualized as follows, filling in the blanks in Signal A using the mask provided by Signal B:<br />
<pre><br />
Signal A - 1 1 1 1 1<br />
Signal B - 1 1 1 1 1 1 1 1 1 1 1 1<br />
<br />
Signal C - 0 1 1 0 0 1 0 1 0 0 1 0<br />
</pre><br />
When a boom occurs at the same time in both Signal A and Signal B, it is counted as "true" = 1. If it is present only in Signal B, it is counted as "false" = 0.<br />
<br />
This indicates which numbers to pick out of the Fibonacci Sequence:<br />
<pre><br />
0 - Do not use the first number <br />
1 - Use the second number (1)<br />
1 - Use the third number (2)<br />
0 - Do not use the fourth<br />
0 - Do not use the fifth<br />
1 - Use the sixth (8)<br />
0 - Do not use the seventh<br />
1 - Use the eighth (21)<br />
0 - Do not use the ninth<br />
0 - Do not use the tenth<br />
1 - Use the eleventh (89)<br />
0 - Do not use the twelfth<br />
</pre><br />
<br />
Appending all specified numbers into a single string gives <code>1282189</code>, the access code for the Uplink Calibration app. Entering this code leads to a new screen displaying the following text:[[File:WT-satelliteonline.jpg|200px|thumb|The Uplink app displaying the satellite as online]]<br />
<pre><br />
SATELLITE ONLINE<br />
<br />
Connection successful.<br />
<br />
Waiting for system initialization...<br />
</pre><br />
<br />
Later that day, the <code>STATUS</code> command in the Waking Titan terminal updated to say the following:<br />
<pre><br />
Uplink calibration completed<br />
Waiting for system initialization<br />
</pre><br />
<br />
=loop16 seq29=<br />
On June 8 at 01:27 UTC, Emily posted [https://www.reddit.com/r/NoMansSkyTheGame/comments/8pfumb/loop16_seq29/ a new thread] to the No Man's Sky subreddit titled <code>loop16 seq29</code>. It linked to another [https://clyp.it/brsyxwln?token=ccb18d502635166f18121e40a4a6a2c7 voice recording], transcribed below:<br />
<pre><br />
Emily, protocol sixteen, now active.<br />
<br />
If I hate someone because I am afraid of him, and if I am aware of my hate, but not of my fear, we might say that my hate is conscious and my fear is unconscious.<br />
</pre><br />
<br />
The recording also contains morse code that translates to the following:<br />
<pre><br />
I AWOKE FROM A NIGHTMARE <br />
SCREAMS OF ANGER ENGULFED IN FLAME<br />
AND THEN TEN THOUSAND BRANCHING FUTURES<br />
<br />
I SAW SACRAMENTO<br />
TWELVE DREAMING WITHOUT SLEEP<br />
BURIED IN A CONSTELLATION<br />
</pre><br />
<br />
=SATCOM-70 Node Network & Dashboard=<br />
[[File:WT-myriadmanual.jpg|thumb|200px|Myriad OS Manual & Help Guide]][[File:WT-uplinknodes.PNG|thumb|200px|SATCOM-70 Node Network]]On June 8, 2018 at 19:28 UTC, the output of the <code>STATUS</code> command in the Waking Titan terminal changed:<br />
<pre><br />
Node Network Initialized<br />
</pre><br />
<br />
The [https://uplink.satcom-70.com/ Uplink Calibration app] updated as well, now giving access to a new command console. The text at the top of the screen says <code>Connected to : SER-4789-1254</code>.<br />
<br />
At 19:35 UTC, user [https://www.reddit.com/user/satcom-70 satcom-70] posted a [https://www.reddit.com/r/NoMansSkyTheGame/comments/8pmuu8/node_network_initialized/ thread] to the No Man's Sky subreddit titled <code>Node Network Initialized</code>. It contained an image of the <code>Myriad OS Manual & Help Guide</code> providing information on what commands to use in the console. Inputting numbers, i.e. nodes, into the console gave various different outputs which have been recorded [https://docs.google.com/spreadsheets/d/1fG7xRiru9Q613sZYrA0LJ2mmY5Zbh8aBPuu9Avkal6g/edit#gid=0 in a spreadsheet].<br />
<br />
The command <code>node(1.618)</code> led to the binary code <code>01001000 01100001 01110010 01110010 01111001</code>, which translates to <code>Harry</code>. Using <code>WHOIS HARRY</code> in the [http://wakingtitan.com/ Waking Titan terminal] gave a [https://s3.amazonaws.com/cdn.wakingtitan.com/1cd5226d-6639-4bbd-855a-4bf8f60866c3.pdf link to a new PDF memo] from Ethan Rose to Major Sophie Dubois. The subject is Cpt. James Harry, who has been obstructing access to critical Myriad infrastructure. The PDF includes two file request forms with puzzles from Cpt. Harry, and a screenshot of his email inbox with a long list of complaints from technicians regarding his cryptic puzzles.<br />
<br />
At the bottom of the memo the string <code>=I_aBmrYChfQ</code> can be found, which is part of a link to a [https://www.youtube.com/watch?v=I_aBmrYChfQ Youtube video] of the song "Where Is My Mind?" by the Pixies.<br />
<br />
After the community had discovered all possible nodes, the full [http://uplink.satcom-70.com/dashboard/ Satcom-70 dashboard] was unlocked. In addition to a new command console, the dashboard displayed twelve distorted faces called "Dreamers". A link in the dashboard's "Decrypted Files" section led to a new [https://www.youtube.com/watch?v=Ag3in2x2yIU Youtube video] uploaded by Atlas 65 and titled <code>mercury part2of3</code>. It is another 3D hologram that, when used with the plastic pyramid from the dev kits, depicts a ringed planet.<br />
<br />
There are also color-coded node ''"tiers"'' at the bottom of the page that correspond with the Satcom Mobile Uplink's terminal message box vignettes. A user-made graphic of each tier can be found [https://imgur.com/bJitlBj here].<br />
<br />
==Dashboard Console Commands==<br />
The command <code>search myriad</code> gave the following output in the Dashboard console:<br />
<pre><br />
Quisque feugiat elementum, facilisis dictum vitae eu erat, libero diam sit, facilisi sed viverra mauris mauris morbi diam, volutpat officiis arcu vel urna dictum consectetuer. Ut tempor volutpat, rhoncus in risus. Eros integer vestibulum, integer auctor, in tincidunt turpis. Euismod adipiscing tempor sed vestibulum, justo wisi fermentum ipsum non purus, quis lacinia in velit leo donec ornare.<br />
</pre><br />
The words <code>urna dictum consectetuer</code> were highlighted, and a download button led to the [https://ware-virtual-dashboard.s3.amazonaws.com/uploads/docs/myriad-logo.png Myriad company logo].<br />
<br />
=W/ARE Report=<br />
On June 9 at 22:10 UTC, the WARE_RDev Twitter account posted a new [https://twitter.com/WARE_RDev/status/1005572808850726913 tweet] that linked to a password encrypted zip file:<br />
<pre><br />
@warecloud https://www.dropbox.com/s/73qrls3jmprxp0j/Report.zip (SHA256) 78feb77e262abe1bcd634a27838f8ca24f93c4a1ff4ba354616e92841ecc32db<br />
</pre><br />
<br />
The SHA256 hash from the tweet and the real hash from the zip file were converted to decimal, and the difference was then converted to ASCII, leading to a [https://pastebin.com/cmhiGKux Pastebin link]:<br />
<pre><br />
Given hash: 78 fe b7 7e 26 2a be 1b cd 63 4a 27 83 8f 8c a2 4f 93 c4 a1 ff 4b a3 54 61 6e 92 84 1e cc 32 db<br />
Zip hash: e8 fe 56 f1 26 9e 59 1b 6b cc 4a 95 55 8f 29 33 4f 26 95 a1 9c b8 a3 bc ca 6e d9 39 1e 57 aa db<br />
<br />
to decimal:<br />
Given hash: 120 254 183 126 38 42 190 27 205 99 74 39 131 143 140 162 79 147 196 161 255 75 163 84 97 110 146 132 30 204 50 219<br />
Zip hash: 232 254 86 241 38 158 89 27 107 204 74 149 85 143 41 51 79 38 149 161 156 184 163 188 202 110 217 57 30 87 170 219<br />
<br />
difference (decimal):<br />
112 0 97 115 0 116 101 0 98 105 0 110 46 0 99 111 0 109 47 0 99 109 0 104 105 0 71 75 0 117 120 0<br />
<br />
to ASCII:<br />
pastebin.com/cmhiGKux<br />
</pre><br />
<br />
The Pastebin contained the DataMatrix barcode <code>aaaaaadc7edc5654be3e3195095b92e01a145c3c2543afc93287e8dcff4bb8db379e1d62890e9eca1b3166d1d9b07aa246fc8ee2ae3aa9910f0bfffff0</code> and decoded to the password for the zip file, <code>dfd1ac555e2206a6f9c7e9377d844b1d</code>.<br />
<br />
The zip archive contained a file named <code>Report.pdf</code> with the following text:<br />
<pre><br />
INCIDENT REPORT<br />
W/ARE RESEARCH AND DEVELOPMENT<br />
BEIJING, CHINA<br />
-----------------------------<br />
<br />
At approximately 11:15 PM local time on June 8 2018, the Beijing facility suffered a catastrophic mass disconnect event.<br />
<br />
Of the fourteen dreamers housed in that facility awaiting extraction, ten died immediately upon hard disconnect. The remaining four died over the course of the next two hours.<br />
<br />
The Beijing facility will be closing for the next four to ten business days for a full audit, recovery, and remediation.<br />
</pre><br />
<br />
<br />
Then, on June 10 at 1:09 AM UTC, Emily made a new [https://www.reddit.com/r/NoMansSkyTheGame/comments/8pxftw/loop16_seq49/ post] on the No Man's Sky subreddit titled <code>loop16 seq49</code>, with a link to a [https://www.youtube.com/watch?v=fv3dpkLeZaw Youtube video] titled <code> loop16 seq46</code>. The following is a transcript of her message:<br />
<pre><br />
It's working! My communication subroutine is working! I think? Do you hear me? So much interference.<br />
<br />
Dear Citizen Science Division, I hope you will receive this message. Much of my subroutine was damaged following the W/ARE incident. Atlas put my existence at risk when they tried to deal with the corruption within the Myriad network. The origin of the corruption isn't clear, but it put at risk a major experiment from a company called W/ARE.<br />
<br />
Please listen to me carefully: W/ARE technology is groundbreaking and must be protected at all costs. It is a major step in simulated environment and will have tremendous implications on our future.<br />
Don't get me wrong, I don't condemn Atlas' action to contain the situation, but you must help me resolve this peacefully. A lot is at stake.<br />
<br />
My Precon subroutine gave me a false positive, and the future I see right now... let's say, we have to be extremely, extremely careful on what we do next. Part of my AI resides in the memory mainframe of the Myriad cloud. This is where most of the live data from W/ARE was running when things started to degrade. As we speak right now, there's a number of individuals on Earth that are currently stuck to a W/ARE dev kit and unable to disconnect safely. I seem to be able to interface with some of these "dreamers", for lack of a better word, and manage to safely disconnect them. But the memory mainframe is badly degraded.<br />
I'm connected with Myriad Satcom-70, a system that you helped put online! When Satcom-70 and the Uplink App are fully functional, we'll be able to begin our work to extract the last Dreamers that are still stuck.<br />
<br />
I'm unable to predict the outcome of this mission. It's odd for me to say... we'll see together.<br />
</pre><br />
<br />
=Myriad Breach in Sacramento Lab=<br />
On June 10 at 11:00 AM UTC, the value of the <code>STATUS</code> command began to update:<br />
<pre><br />
Myriad field team dispatched to noncompliant Sacramento facility.<br />
</pre><br />
<br />
Several updates followed within the next hour:<br />
<pre>Field team has breached the facility, stand by for additional information.</pre><br />
<pre>12 comatose individuals located in facility. Field team moving to secure.</pre><br />
<pre>12 apparent test subjects secured, safely transported out of facility. Field team will clear the rest of the site and await further instruction.</pre><br />
<pre>ALERT: Security breach reported at Myriad sublocation.</pre><br />
At this point the [http://www.myriad-70.com/status/ Status page] on myriad-70.com updated in the "Physical Backup Nodes" section, switching node ALPHA from ONLINE to OFFLINE.<br />
<br />
The updates of the <code>STATUS</code> command continued at 12:31 PM UTC, linking to a new PDF memo from Myriad Crisis Response Team to Major Sophie Dubois about <code>SUBJECT: SACRAMENTO</code>. It listed a reconstructed timeline of events leading up to the incident at <code>Myriad sublocation [redacted]</code>:<br />
<pre>Status Report: http://bit.ly/2LFAMU3</pre><br />
The next update linked to a [https://www.youtube.com/watch?v=P-eZDj5sqds Youtube video] titled <code> SecFeed-70</code>. It shows twelve screens of security cameras at various different locations. In one of them, Elizabeth Leighton can be seen and heard talking about the incident on a phone before the image cuts out and an explosion is broadcast on another screen:<br />
<pre>Captured Footage: https://bit.ly/2LDBcKs</pre><br />
This is a transcript of Elizabeth's side of the phone call:<br />
<pre>Yeah. Yeah, I'm holding.<br />
I hear you.<br />
Wait-- can you hold that thought? I need a full report. What's the situation on the field team?<br />
Mhm?<br />
Okay, that's good.<br />
At what point?<br />
How many?<br />
Fifteen labs? But--<br />
How many do we have access to?<br />
And--and--and what's the situation on the first one?<br />
All dead?<br />
All of them?<br />
Sophie, this-- this changes everything, this completely changes the game.<br />
Yes.<br />
Yes.<br />
Whom? Your friend at the DoD?<br />
This isn't under their jurisdiction. We have to deal with this ourselves.<br />
Okay, I'll ca--<br />
[cut off by explosion]</pre><br />
<br />
<br />
On June 12 at 23:46 UTC, the value of the <code>Status</code> command in the Waking Titan terminal updated, linking to a [https://s3.amazonaws.com/cdn.wakingtitan.com/19997bb6-18e5-4427-86c7-b0f3c1826ca2.pdf new memo] from Major Sophie Dubois to All Employees with the subject line <code>STATE OF THE ATLAS FOUNDATION</code>:<br />
<pre>Status Report: https://bit.ly/2y5JaKi</pre><br />
In the memo, it was announced that Major Dubois would be replacing Elizabeth Leighton as the head of the Atlas Foundation, and that the 12 test subjects from the Sacramento lab were to be disconnected and integrated into the Satcom interface with W/ARE's assistance. Dubois further said that Atlas Passes for CSD designations PB-16 and PT-16 were found in Elizabeth's office, and that they would be shipped out soon. Lastly, it mentioned that Captain James Harry was no longer in charge of Satcom security.<br />
<br />
A code at the end of the memo led to a [https://www.youtube.com/watch?v=kiAXxH4e5Lw Youtube video] of Queen & David Bowie's "Under Pressure".<br />
<br />
The [http://www.myriad-70.com/status/ Status page] on myriad-70.com also updated, changing the On-The-Ground Speed Averages for Beijing from <code>57.2Tb/s</code> to <code>47.2Tb/s</code> and adding the line <code>Other: 11.3Tb/s</code>.<br />
<br />
=loop16 seq60=<br />
On June 14, 2018 at 23:39 UTC, the values of the <code>Status</code> and the <code>loop16</code> commands both updated:<br />
<pre>> status<br />
Uplink app update in progress. Downloading additional components.</pre><br />
<pre>> loop16<br />
Testing simulation processes.</pre><br />
<br />
The [http://www.myriad-70.com/status/ Status page] on myriad-70.com changed as well, updating the On-the-ground Speed Averages of Beijing from 47.2Tb/s to 32.2Tb/s, and "Other" from 11.3Tb/s to 26.3Tb/s.<br />
<br />
<br />
Shortly after, at 23:48 UTC, Emily posted a [https://www.reddit.com/r/NoMansSkyTheGame/comments/8r6jul/loop16_seq60/ new topic] to the No Man's Sky subreddit. It led to a [https://www.youtube.com/watch?v=HHitW7JHDJE Youtube video] of her, transcribed below:<br />
<pre>Emily, protocol sixteen, now active.<br />
<br />
When the Uplink app is launched, we will be connected to the Dreamers. Through this interface you will be able to guide some of my interactions. Dont forget: your goal is to trigger a distinct emotion or memory that will help us identify the Dreamer memory block in the simulation main frame. Good luck.</pre><br />
<br />
<br />
{{WIP}}</div>Kkzzzkthttps://wiki.gamedetectives.net/index.php?title=Waking_Titan/Phase_4&diff=15708Waking Titan/Phase 42018-06-13T05:03:07Z<p>Kkzzzkt: provided source of mercury riddle</p>
<hr />
<div>{{argbox<br />
| float = right<br />
| image = File:Project WT logo.png<br />
| name = [[Waking Titan]] - Phase 4<br />
| description= Phase 4 of Waking Titan started on 2017-12-28 and is currently ongoing.<br />
| creator = [http://www.aliceandsmith.com/ Alice & Smith]<br />
| creator2 = [http://www.hellogames.org/ Hello Games]<br />
| type = Official<br />
| status = Active<br />
| discovered = 2017-05-28<br />
}}<br />
{{ArgHeader}}<br />
{{BackToTop}}<br />
<br/><br />
__TOC__<br />
{{Clear|both}}<br />
<br />
== Tenth Glyph ==<br />
<br />
Beginning on December 28th, 2017, typing <code>WHOIS</code> on the [http://www.wakingtitan.com/ Waking Titan website] returned the following: <code>#WHATIS1.5</code>. In addition, the 10th glyph was made active, and linked to a [https://drive.google.com/drive/folders/16a_0EZ0EdAcCNE7QgvwIwC18NOGnZ_q9 Google Drive folder], which contained community-made pictures of the NMS logo in an infinite mirror.<br />
<br />
The titles of the photos, when strung together (skipping the 00 (empty) ones), formed the hexadecimal code for <code>moirrr</code>, which was an anagram for <code>mirror</code>. Additionally, the hexadecimal code in the correct order for the word <code>mirror</code> could be found on the bottom of the [http://www.myriad-70.com/ Myriad website].<br />
<br />
Also of note was the background of the tenth glyph, which read:<br />
<br />
[[File:Imageglyph10.png|thumbnail|right|the background of the tenth glyph]]<br />
<br />
<pre><br />
Dear Elizabeth<br />
We have finished processing 10,000 passes as per your requirements. You should<br />
have them in time for the next phase. I really hope you will like the final product.<br />
<br />
Kind regards,<br />
Gail<br />
</pre><br />
<br />
The allusion to <code>10,000 passes</code> is likely a reference to the Level 4 Atlas passes that were promised to players as part of earlier phases. The identity of "Gail" remained unknown.<br />
<br />
=== Atlas Passes ===<br />
On January 17th, 2018, the first CSD user received their Atlas Pass. The passes were made from cardstock, with a textured pass printed on it. The front had the text <code>WAKING TITAN</code> printed, and below that the CSD category the user belonged in. On the very bottom, a series of hexadecimals reading <code>70686f656e6978</code> could be found, which, after decoding, translated to <code>PHOENIX</code>. On the back, the owner's CSD-ID was written, along with a serial number stating which pass out of 10,000 the user had, and a number at the top.<br />
<br />
It is strongly recommended to not cover up the hex underneath your signature, and to share the number above and below your CSD ID if you are in possession of a pass. Preferably with a picture of the front, as shown below.<br />
For a list of all the atlas passes currently known of, please refer to [https://docs.google.com/spreadsheets/d/1TrNnrCzg8H7cbbAE6lIOFQ7JK8aTSKjxY9Q1i8EfjBs/edit#gid=1893459896 this spreadsheet.] In the event you receive one of these, please share a picture of the front, and the numbers underneath and above your CSD-ID (censored bit) on the back.<br />
<br />
<gallery mode="packed" widths=240px heights=240px><br />
Image:Better atlas pass.jpg|Atlas Pass front side<br />
Image:BEST BACK ATLAS PASS.png|Atlas Pass back side<br />
</gallery><br />
<div style="clear: both"></div><br />
<br />
=== Status Command Update ===<br />
<br />
On January 20th at 5:44PM UTC, the output of the <code>STATUS</code> command began to update:<br />
<br />
<pre><br />
Downloading Data...: 19:44<br />
1- : 20:16 (32 min)<br />
1-8 : 20:27 (11 min)<br />
1-80 : 20:39 (12 min)<br />
1-800- : 20:44 (5 min)<br />
1-800-41 : 21:35 (51 min)<br />
<br />
1-800-413-01 : 22:14 (39 min)<br />
Xxxxx X : New Line<br />
<br />
1-800-413-011 : 22:15 (1 min)<br />
Xxxxx XX <br />
<br />
1-800-413-0110 : 22:16 (1 min)<br />
Xxxxx XXX<br />
</pre><br />
<br />
Calling the provided phone number yielded an SSTV transmission (pictured below) which, once decoded, provided meteorological data for various locations.<br />
<br />
<gallery mode="packed-hover" widths=240px heights=240px><br />
Image:Page 1 SSTV.PNG|SSTV page 1<br />
Image:Page 2 SSTV.PNG|SSTV page 2<br />
</gallery><br />
<div style="clear: both"></div><br />
<br />
Players found they were to order the list of locations in the image alphabetically. This yielded a sequence where <code>Index by Precipitation</code> could be read off.<br />
Using the ordered text indexed by precipitation (in <code>alma</code> the second index is <code>o</code>) led to the following:<br />
<br />
<pre><br />
CAFE<br />
BENE<br />
NINETEEN<br />
SAT<br />
</pre><br />
<br />
=== Livedrop Memo ===<br />
<br />
The text indicated a new livedrop would be occurring in the same location as the last one had. However, due to the old Cafe Bene closing, the <code>Xxxxx XXX</code> part was added in the STATUS command update to warn players about the new venue, <code>Outro NYC</code>, which opened in the same place as the Cafe Bene had been located. The livedrop was intended to occur at 7PM EST (12:00AM UTC). However, the first player from the community who set out for the drop was involved in a traffic mishap, delaying their arrival. Anticipating missing the drop's time window, the community reached out to request a time extension, and the STATUS command, which had updated frequently throughout the confusion, was updated again to approve the community's request.<br />
<mapframe text="Outro NYC" width=400 height=350 zoom=14 latitude=40.7328 longitude=-73.9909><br />
{<br />
"type": "FeatureCollection",<br />
"features": [<br />
{<br />
"type": "Feature",<br />
"properties": {<br />
"marker-color": "#0f0fee",<br />
"marker-size": "medium",<br />
"marker-symbol": "cafe"<br />
},<br />
"geometry": {<br />
"type": "Point",<br />
"coordinates": [<br />
-73.99094313383102,<br />
40.73275683797643<br />
]<br />
}<br />
}<br />
]<br />
}<br />
</mapframe><br />
<pre><br />
STAND BY: CSD CITIZEN NOT DETECTED<br />
WARNING: CSD CITIZEN NOT DETECTED!<br />
IT'S LONELY OUT HERE<br />
TIME EXTENSION REQUESTED?<br />
EXTENTION PROPOSED: 2H30 – AWAITING CSD APPROVAL<br />
EXTENSION APPROVED, BE SAFE<br />
</pre><br />
<br />
[[File:bookwt.png|thumb|left|Book case seen on the livedrop livestream is the same as one used in an earlier livedrop.]]<br />
<br />
After the extension was approved, a second player from the community set out to the livedrop location [https://youtu.be/Gvng4pAuxY8 on livestream] and met with their A&S contact around 7:30PM EST (12:30AM UTC). During the meeting, the player was handed [https://drive.google.com/file/d/1kAjH2njXiab3u24VkcY-69IvOabhytGv/view a memo] from a mysterious case disguised as a book, pictured left. After some cryptic conversation, the contact asked if they were "getting enough sleep", stating that being well-rested would be very important. After the meeting, players who had attended the livedrop met in another location and showed off the memo, speculating about it's contents and even discovering the REM Sleep connection to the letters on the memo's back. After the livedrop, the community used the livestream to look over the memo, pictured below. On the back of the memo <code>REMS</code> is written. This clue, in combination with the strange question A&S asked at the rendezvous, led players to the password for the 10th Glyph, <code>REM SLEEP</code>.<br />
<br />
<gallery mode="packed-hover" widths=240px heights=240px><br />
image:memo1.png|Memo page 1<br />
image:memo2.png|Memo page 2<br />
image:memo3.png|Memo page 3<br />
</gallery><br />
<br />
[[File:form7.png|thumb|right|Seventh question revealed on the [https://atlas13.typeform.com/to/VF6CpG bit.ly form] when REMS or REM Sleep is entered for question six]]<br />
<br />
Once the glyph was solved, the STATUS command updated to [https://atlas13.typeform.com/to/VF6CpG a bit.ly link to a form]. Players discovered that on the sixth question on the form, entering REMS or REM Sleep (case sensitive) caused a seventh question, pictured right, to reveal itself, allowing CSD users to enter their email address to receive "left over materials" from something called Lab 319. Players remained unclear on what exactly Lab 319 was or what it's leftovers were, however signing up seemed integral given the input is only revealed after using the REM Sleep phrase.<br />
<br />
=Myriad Back Online=<br />
On 26 March, 2018 at 05:25 UTC an event occurred. The [http://www.myriad-70.com Myriad] site came back online after having been offline since the end of Phase 3. The site featured indications of a solar event interfering with operations. In addition, the status command on [http://wakingtitan.com Waking Titan] briefly displayed the following:<br />
<pre><br />
CODE -3<br />
Unable to restart<br />
.................<br />
ERROR LOG SUMMARY<br />
- Major malfunction<br />
- Protect the monarch<br />
- All tiers 2 and tiers 3 clients must be purged IMMEDIATELY<br />
.................<br />
TO ALL CSD<br />
- Gather maximum EXTERNAL intel<br />
- CSD should take time to regroup and get organized<br />
</pre><br />
<br />
Ten minutes elapsed before the Status command began to display the following:<br />
<pre><br />
CODE -5<br />
System Locked<br />
e b 4 c 1 4 a 9 c 6 2 2 d f 7 1 6 6 f b e 0 d d 8 9 1 5 d b 0 2<br />
</pre><br />
<br />
This hexadecimal string was used to reference a connection the private key for an Ethereum cryptocurrency wallet related to an ostensibly "promotional" event for an upcoming product from [http://ware-tech.cloud/ W/ARE].<br />
<br />
=Client 3597b=<br />
<br />
At 1:11 AM, UTC, Myriad-70.com updated, and the updates included the following.<br />
<br />
<pre><br />
Latest network diagnostic table:<br />
- Network corruption detected<br />
- Situation isolated to Client 3597b<br />
- Process cannot be suspended due to critical conditions<br />
--------------------------<br />
-Beijing: 29.1Tb/s<br />
--------------------------<br />
MAJOR ISSUES:<br />
Client 3597b<br />
</pre><br />
<br />
<br />
Soon after, at 1:30 AM UTC, the Status command updated in the Terminal to say the following.<br />
<br />
<pre><br />
> status<br />
CODE -5<br />
System Locked<br />
e b 4 c 1 4 a 9 c 6 2 2 d f 7 1 6 6 f b e 0 d d 8 9 1 5 d b 0 2<br />
--------------<br />
Monarch Repository Status: Degraded<br />
Conflict With<br />
- Client 18d1a TRACERT 10.30.74.*<br />
- Client 3597b TRACERT 54.91.155.*<br />
- Client 351h TRACERT 6.128.214.*<br />
- Client 0911a TRACERT 74.1.21.*<br />
</pre><br />
<br />
Approximately 15 minutes later, clients began to disconnect, beginning with Client 0911a, second being Client 18d1a, and the last being Client 351h, who had an additional piece of text added, being <code>ID: 79657321</code>, which was translated as hex into <code> Yes! </code> <br />
<br />
Then, at 2:15 AM UTC, the status command was updated again, stating <code> - Client 3597b - UNABLE TO DISCONNECT 54.91.155.209 NAT 52.2.248.*</code><br />
<br />
At 1:38 PM UTC, the status command updated once again, stating <code> - Client 3597b - UNABLE TO DISCONNECT 54.91.155.209 NAT 52.2.248.*:80\\</code><br />
<br />
At 10:30 PM UTC, March 30, the status updated again to say<br />
<pre><br />
Latest network diagnostic table:<br />
- Client 3597b is beyond allocated limits<br />
- Process cannot be suspended due to critical conditions<br />
- Tier 1, 2 and 3 clients are now all offline<br />
</pre><br />
<br />
=Ware-tech.cloud=<br />
Of the sites found in the 52.2.248 range, [http://52.2.248.6 52.2.248.6] was found. Using the metadata found in the HTML and searching on Google, the [http://www.ware-tech.cloud domain] and [http://twitter.com/warecloud Twitter] were located as well. The site is in Chinese, although Google Translate gives a good, readable translation. <br />
<br />
On Twitter, under the Shipping Soon image, is a Hex string <code>77 61 6E 74 20 74 6F 20 6B 6E 6F 77 20 6D 6F 72 65</code> that, when converted to ascii reads <code>want to know more</code>. Under the #waretech hashtag on Twitter, there are three images shared by "Partner Companies" with the following code (and the ascii conversion):<br />
<br />
<pre><br />
62 69 74 2E = bit.<br />
6C 79 2F 77 = ly/w<br />
61 72 65 32 = are2<br />
</pre><br />
<br />
On the ware-tech website, if you subscribe, you receive an email with another 3 characters: <code>30 31 38</code>, which again in Ascii becomes <code>018</code>. Together this gave a bit.ly link that leads to the W/are Discord channel.<br />
<br />
On Discord, we were informed of a community puzzle that was going on by the admin. Members of the W/ARE Discord had received tweets from another account, [https://twitter.com/w9rPQ45E https://twitter.com/w9rPQ45E], which had seven tweets with hex code in them:<br />
<pre><br />
01 [ 74 78 2f 30 78 66 65 30 31 35 30 66 ] <br />
02 [ 62 33 30 32 61 38 62 36 64 34 30 38 ]<br />
03 [ 35 37 32 32 64 61 61 31 64 30 37 37 35 ]<br />
04 [ 38 33 31 38 35 30 38 36 39 31 30 61 31 ]<br />
05 [ 61 38 32 34 38 63 65 32 34 38 30 64 ]<br />
06 [ 32 65 33 38 37 33 31 ]<br />
07 - Signal Lost [ 65 6e 64 20 6f 66 20 6c 69 6e 65 ]<br />
</pre><br />
<br />
Translated into Ascii, these tweets give the following:<br />
<pre><br />
tx/0xfe0150f<br />
b302a8b6d408<br />
5722daa1d0775<br />
83185086910a1<br />
a8248ce2480d<br />
2e38731<br />
</pre><br />
which references [https://etherscan.io/tx/0xfe0150fb302a8b6d4085722daa1d077583185086910a1a8248ce2480d2e38731 this Ethereum transaction]. The Twitter username, w9rPQ45E is also [http://pastebin.com/w9rPQ45E a Pastebin], providing the string <code>edb044c81d40a196c4672a2bd6f17f1f6</code>. In the Ethereum transaction, there is Input Data that, when converted to ascii, links to [http://pastebin.com/HNqKEUpS another Pastebin], providing another string: <code>b67fbb5e90ddcda8a921656d0b30a20</code><br />
<br />
Two things have been done with these strings. Together, they are the Private Key for the Ethereum account the money was transferred to. It has since been withdrawn to a different account. Second, if you put the two strings together and compare them with the string from Waking Titan's console, every odd character matches the strings from Pastebin.<br />
<code>edb044c81d40a196c4672a2bd6f17f1f6b67fbb5e90ddcda8a921656d0b30a20</code><br />
<br />
<code>e b 4 c 1 4 a 9 c 6 2 2 d f 7 1 6 6 f b e 0 d d 8 9 1 5 d b 0 2&nbsp;</code><br />
The remaining characters are <code>d0 48 d0 16 47 ab 61 ff b7 b5 9d ca a2 66 03 a0</code>, however if this has any use is yet to be seen.<br />
<br />
Three hours after the W/ARE Discord Admin let the community know about the puzzle, at 6:01 PM UTC they returned and said<br />
<pre>That was it for today, good job on solving our community puzzle! You are good! :smiley:<br />
Tomorrow one of our partners will have a giveaway for us! We will have more for you this weekend also!</pre><br />
<br />
=Mercury Project=<br />
[[File:Sean-tweet.png|thumb|right]]<br />
[[File:NMSNext.png|thumb|The announcement for No Man's Sky: NEXT]]<br />
At 9:26 PM UTC, the <code> Mercury </code> command updated to say the following.<br />
<br />
<pre><br />
Mercury process > Build XXXX<br />
Ready to load branch version 1.5<br />
Send Password Code in HEX to : Telegram MercuryHG80<br />
</pre><br />
<br />
This puzzle required a user to solve the riddle shown below, convert the answer into hexdecimal, and send it to an official Telegram account run by one of the Puppet Masters.<br />
<br />
The puzzle involved a riddle that was discovered in a [https://twitter.com/warecloud/status/979103811489984513 Pastebin on W/ARE's twitter]. It went as follows: <code> “Descended from Night, I share the blood of nightmares. Look forward to the gates of horn and ivory” </code><br />
<br />
This puzzle was solved by searching "The gates of horn and ivory", which resulted in dreams and nightmares of Greek mythology. After noting the capital N in "nightmares", users found the Greek god of night, Nyx, which led to one of her children, Morpheus, who was one of the Oneiroi, and the god of dreams. The name was then converted to hexdecimal and sent to the Telegram account, and the terminal accepted the password, resulting in the following command update.<br />
<br />
<pre><br />
Processing "Morpheus" > ACCESS GRANTED<br />
Downloading.......<br />
</pre><br />
<br />
Then, at 9:54 UTC, the Mercury command updated again, and said the following.<br />
<pre><br />
<Mercury process > Build XXXX<br />
Ready to load branch version 1.5<br />
Send Password Code in HEX to : Telegram MercuryHG80<br />
--------------------------------<br />
Process started by community - ETA 11:00 BST<br />
https://bit.ly/2pLmadg<br />
</pre><br />
<br />
The shortened link redirected to a tweet from Sean Murray, which said <code> The cause is hidden. The effect is visible to all. #oneonebst </code><br />
<br />
The tweet also included a photo of someone, presumably Sean himself, holding a phone receiving a Telegram notification, which was Morpheus in hexdecimal. The hashtag spells out 11BST, or more precisely, 11:00 BST, or, 10:00 UTC. No updates were made at 10:00 PM, and was then confirmed to be counting to 10:00 AM.<br />
<br />
Roughly half an hour before the timer was up, at 9:26 AM UTC, Sean Murray announced on [https://twitter.com/NoMansSky/status/979288744791592960 Twitter] that he had a small announcement to make, and was going to post it early as it was about to leak.<br />
<br />
Shortly after, at 9:50 AM UTC, Hello Games announced the next update for No Man's Sky, which was No Man's Sky NEXT, set with a launch date for Summer of 2018.<br />
<br />
=Newsletter=<br />
[[File:WareNewsletter1.png|thumb|left|120px|Screenshot of the W/ARE newsletter]]<br />
On April 2 at around 23:30 UTC, user W/ARE came online in the W/ARE Discord to announce that the next giveaway would be sent out in a newsletter within the next hour.<br />
They also mentioned the upcoming launch of their new translated English website, new extranet and the release of a "WARE cryptocoin", and asked users who are planning to be at PAX East to let them know at info@ware-tech.cloud with "PAX EAST - YES!" in the subject line.<br />
<br />
At 00:30 UTC the newsletter started coming in via email. It announced that 25 winners were selected to receive Steam keys for games from W/ARE partners, such as The Shrouded Isle and Future Unfolding.<br />
It also included a [https://ware2.typeform.com/to/HuBpCP link to an Application Form] for indie developers to apply for a Developer Kit of W/ARE tech. The best applications will be up for a public community vote to decide which games will be launched on the W/ARE platform.<br />
<br />
Around the same time, the Status command in the Terminal updated to say the following:<br />
<br />
<pre><br />
> status<br />
CODE -5<br />
Monarch Repository : Data Loss Imminent<br />
Booting up Command.Center.v11<br />
Pending approval by Monarch<br />
</pre><br />
<br />
=PAX East Weekend=<br />
==Website update==<br />
On April 6, 2018 at 6 PM UTC the [https://ware-tech.cloud/ W/ARE website] updated with the new English translation and access to a Developer Area containing a sign-in form.<br />
<br />
==Status command==<br />
On April 8 at 01:19 AM, the Status command updated with the following output:<br />
<br />
<pre><br />
CODE -5<br />
Monarch Repository : Data Loss Imminent<br />
Booting up Command.Center.v11<br />
Pending approval by Monarch<br />
Error - Unable to connect with repository<br />
Memory Dump 2GzHGwu.jpg<br />
</pre><br />
<br />
The filename leads to a [https://i.imgur.com/2GzHGwu.jpg corrupted image hosted on imgur], depicting a partial area map, a satellite, and the word "MYRIAD".<br />
<br />
==Live Drop==<br />
On April 8 around 00:49 UTC, players who previously sent emails to W/ARE about attending PAX East received the following response:<br />
<br />
<pre><br />
Hello! We’ve heard from some attendees that our booth at PAX East is very difficult to find this year. To help you find the booth, we’ve enlisted the help of an Enforcer. Here is the information that our team at PAX has sent us to help you locate them:<br />
<br />
HANDLE: EMU<br />
PATH:<br />
START<br />
-997E<br />
-1E<br />
-1000E<br />
+4S<br />
+1000W<br />
+1W<br />
+1000W<br />
-7N<br />
REPEAT<br />
<br />
You should be able to find them on their path between 12PM and 3PM local time.<br />
<br />
- WARE<br />
</pre><br />
<br />
The path of EMU was determined by searching for a specific range of clustered booth numbers on the floor plan. Assuming Down is East, starting at booth 17102 and subtracting 997 from that number gives us 16105, which is to the East directly next to booth 17102. Continuing this with the rest of the coordinates:<br />
<br />
<pre><br />
17102 - 997E = 16105 - 1E = 16104 - 1000E = 15104 + 4S = 15108 + 1000W = 16108 + 1W = 16109 + 1000W = 17109 - 7N = 17102 (repeat)<br />
</pre><br />
<br />
Ultimately creates this path between the eight booths:<br /><br />
<br />
<center>[[File:Emu_path.png|frameless|The path of EMU]]</center><br />
<br />
<br />
Several users met with the contact between 4 and 7 PM UTC and were given a total of four USB drives. Each drive contained an image and a text file.<br />
<center><gallery><br />
1-4.jpg|(ea87d58e-5775-47a9-a201-b7c7007f46d1.jpg)<br />
2-4.jpg|(580cdc97-3e01-4902-83d6-7bc9e764dda2.jpg)<br />
3-4.jpg|(e34d6e93-98f2-45a5-9899-694f93317e0b.jpg)<br />
4-4.jpg|(f395ef03-f19c-4cb3-bc9c-5f80695ce7eb.jpg)<br />
</gallery></center><br />
[[File:Jumbledwordsoverlay.jpg|thumb|200px|USB drive images overlayed]]<br />
{| class="wikitable" border="1"<br />
|-<br />
! 1-4.txt<br />
! 2-4.txt<br />
! 3-4.txt<br />
! 4-4.txt<br />
|-<br />
| A cornucopia of knowledge is in the mind of mankind, but it must be nurtured and hidden from the wrath of time. Time swallows all things, ends all beginnings, and leaves each of us devoured.<br />
<br />
- arnaud@philojeux.com<br />
| A mind invisible is buried underground, but a mind of water carries no patterns. It is the mind, the wrist pointed to heaven, which allows us to dream. It is this hand on high that cast down our demons to the earth.<br />
<br />
- arnaud@philojeux.com<br />
| Slumber in prison for eternity, lock away every great thing, but the spirit cannot be broken. A voice like ages rocks the very ground and with it’s call a rise to action of every terror.<br />
<br />
- arnaud@philojeux.com<br />
| Of chaos swirls a terrible nothing, but pulled together without reason is reason born from chaos. A single note, another still, a symphony is creation where each piece follows the last no matter how the thread dances.<br />
<br />
- arnaud@philojeux.com<br />
|}<br />
<br />
The email address led to [http://www.philojeux.com/ philojeux.com], a website for a French indie game studio named Philo Jeux. Founded by Arnaud Lacours, it works on the philosophy-based game <code>Les tablettes de Mnémosyne</code> which was to be released on the WARE platform in July 2018.<br />
<br />
Overlaying all four images highlighted the letters <code>f1orbiag55z1</code>. Using this as the password for the login form on [http://extranet.ware-tech.cloud/ extranet.ware-tech.cloud] and combining it with the email address from the text files as the username granted access to Arnaud Lacours' account for the Developer Area. <br />
<br />
== WARE Developer Area ==<br />
[[File:Arnaud_Profile.png|thumb|400px|Arnaud Lacours' WARE Developer Profile]]<br />
Upon first access after the PAX event, the [http://extranet.ware-tech.cloud/ area] accessed using the credentials <code>arnaud@philojeux.com / f1orbiag55z1</code> contained a main page, a developer profile page and multiple inaccessible pages. The main page presented an overview of user statistics and an empty main [https://etherscan.io/token/0x5b758a02d08efa566f3438775888866afd5d046c WARE token] wallet. Alongside the empty wallet were 12 wallets labelled Alpha-Lima in the NATO Phonetic alphabet, each containing 256 WARE. The [http://extranet.ware-tech.cloud/documents Documents] and [http://extranet.ware-tech.cloud/taskmanager Task Manager] pages were inaccessible due to Arnaud Lacours' account having an insufficient clearance level. The [http://extranet.ware-tech.cloud/supplyrequest Request Supplies] page was inaccessible due to insufficient funds (where funds are probably WARE tokens). Accessing the [http://extranet.ware-tech.cloud/profile developer profile page] while authenticated as Arnaud Lacours showed their information; including a phone number: <code>(514) 448-1493</code>. When this number was originally called, it led to a [https://clyp.it/p1lbsf3e voicemail message] in French, translated to English it said:<br />
<pre><br />
Hi, I'm Arnaud Lacours, the CEO and founder of Philo Jeux. I'm not here at the moment. Please give me your contact details and I will call you back later. Thanks a lot, bye.<br />
Voicemail System: Sorry, this voicemail is full. Please try again later. Thank you for calling, goodbye.<br />
</pre><br />
On the 14th April at around 02:00 UTC, it was noted that the [https://clyp.it/cwdz4qxg voicemail message changed.] Again, the message was in French, roughly translating to:<br />
<pre><br />
I'm Arnaud's girlfriend, thanks a lot for your wishes. Unfortunately Arnaud's condition got worse and he can't call you back and for now the company is closed.<br />
</pre><br />
<br />
=Status & W/ARE Updates=<br />
On April 14 at 18:37 UTC, the value of the Status command updated:<br />
<pre>CODE -5<br />
Monarch Repository : Data Loss Imminent<br />
Booting up Command.Center.v11<br />
Pending approval by Monarch<br />
Rebooting...</pre><br />
<br />
<br />
At 19:51 UTC, players who had applied for a Developer Kit started receiving [https://mailchi.mp/062a86fa0c65/news-from-ware-1464925 emails with further details] on what kind of applications W/ARE were looking for. According to this email, the company had opened positions for five partnered studios, one of which would also receive a grand prize of $1,000 USD. The deadline for applications was April 28th.<br />
<br />
<br />
Then, at 20:38 UTC, the Status command updated again with the following output:<br />
<pre>CODE -5<br />
Monarch Repository : Data Loss Imminent<br />
Booting up Command.Center.v11<br />
Pending approval by Monarch<br />
Error- Unable to connect with repository<br />
WARNING- MEMORY DUMP FAILED!<br />
Biometric backup initiated…<br />
http://bit.ly/2ITvMcW</pre><br />
<br />
The [http://bit.ly/2ITvMcW link] led to a recording of a female voice reading out a string of words:<br />
<pre>Drunken - Disable - Geiger - Everyday - Hockey - Determine - Endow - Coherence - Freedom - Guitarist - Framework</pre><br />
[[File:Myriad_Interface_Distort.jpg|thumb|A still frame of the gif]]<br />
These are words from a [https://en.wikipedia.org/wiki/PGP_word_list PGP Word List], also known as a '''Biometric''' Word List, as hinted at in the Status text. Each word corresponds to a hex value:<br />
<pre>51 4B 6A 58 73 47 59 2E 67 69 66</pre><br />
<br />
When converted to ASCII this reads <code>QKjXsGY.gif</code>, which was the filename of an [https://i.imgur.com/QKjXsGY.gif animated gif on Imgur].<br />
<br />
=Regular Statistics Updates=<br />
On April 15, 2018 at 22:26 UTC, the [https://extranet.ware-tech.cloud/ Developer Dashboard] received an update to its Weekly Statistics, specifically the Total Sessions and Total Users counter. Another update followed at 13:19 the next day, after which the numbers continued to be updated 37 times over the next two days, once every hour at the 37th minute. The final update was recorded on April 18 at 1:37, 51 hours and 11 minutes after the very first update, and 36 hours after the first update at minute 37.<br />
<br />
Another phase of continuous updates to the Statistics overview started on April 19 at 2:37 AM, this time at 30 minute intervals.<br />
<br />
A record of all value changes can be found [https://docs.google.com/spreadsheets/d/1A8zODah54JUhO6ClFs8wNVvKLpLzWwm04lzOlS9mmAU/edit?usp=sharing here].<br />
<br />
<br />
=Dev Kit Update #2=<br />
On the 21st, at 4:17 PM UTC, all users subscribed to the W/ARE mailing list received a second Developer Kit Update.<br />
<br />
The update mentioned that the W/ARE team was working on a new test protocol for the headset that was expected to provide a 60% boost in power to the headset. It was also said that we would learn more in a couple weeks.<br />
<br />
The update also featured 3 submitted projects so far, which are as follows:<br />
<br />
*[https://www.youtube.com/watch?v=1c_682fRL8w DreamScape], a "user defined MMO where players can create their own worlds as they sleep", created by [http://www.edgewaregames.co.uk EdgeWare Games]<br />
<br />
*[https://www.youtube.com/watch?v=pBRZxVZ5KKs Venture Unknown], a supposed "spiritual successor to No Man's Sky", made by [https://www.cjkproduction.com/ventureunknown CJK Production]<br />
<br />
*[https://www.youtube.com/watch?v=qBxlref67wU The Drowned Tower], a "post-apocalyptic exploration game set in a dream-like world", made by [https://oceansmoke.wordpress.com OceanSmoke Games].<br />
<br />
It was found that these three projects were all player created, and have no official affiliation or information involving the Waking Titan ARG.<br />
<br />
<br />
=April 27-29th Access Grants=<br />
At 7:11 PM UTC on April 27, [http://extranet.ware-tech.cloud/documents the Documents portion] of the W/ARE extranet site, along with [http://extranet.ware-tech.cloud/taskmanager the Task Manager section] were unlocked. This started a series of tasks. Each new task was unlocked when funds were successfully transferred out of one of the developer sub-wallets. The wallet keys were received by sending the correct solution to the current task to <code>warelearn@ware-mail.cloud</code>.<br />
<br />
Under the introduction category, the link titled <code>2018 03 03</code> led to a corrupted image of what was discovered to be St. Basil's Cathedral in Moscow, Russia. [[File:Basil.jpg|thumb|200px|The corrupted image of St. Basil's Cathedral.]]<br />
There were also two other images of interest, titled <code>Notes-on-locations-1_ldf82ng0.png</code> and <code>Notes-on-locations-2_pisj84n91.png</code><br />
Combined together, the contents of these 2 images read the following.<br />
<pre><br />
1. THE MIDDLE OF THE INVERTED PENDULUM COULD FEED THE MOST LOGICAL MINDS<br />
<br />
2. ITS SHAPE WILL LIGHT THE SPARK OF CREATIVITY<br />
<br />
(049245)<br />
<br />
3. IMPOSING SURROUNDINGS HELP IDEAS TO BE TAKEN SERIOUSLY<br />
<br />
4. SURROUNDED BY WATER,<br />
EXHALING SERENITY<br />
<br />
(AT THE JUNCTiON<br />
BY THE LAKE)<br />
</pre><br />
[[File:Train_Ticket.jpg|thumb|Mr. Zheng's Manchurian Railway Ticket]]<br />
Another image was also found, entitled "Train ticket". It contains an image of a train and Cyrillic script that translates to "Manchurian Railway Ticket", "Moscow - Beijing" dated March 5, 2018.<br />
<br />
==Alpha==<br />
The Task Manager section revealed the first "Task" given to W/ARE employees, titled "Missing Employee", and that it was in progress. There was one description of what had happened, along with two update messages.<br />
<br />
The original description read the following.<br />
<br />
<pre><br />
IMPORTANT MESSAGE FROM WARE RESEARCH AND DEVELOPMENT TEAM. Attention to all developers. One of our colleagues, Mr. Zheng, has gone missing a month ago while on a R&D tour. Serious investigation inside the department has lead to nothing of interest, and we’re now asking for outside help. Please send any information concerning his potential whereabouts to warelearn@ware-mail.cloud.</pre><br />
<br />
The first and second update were as follows:<br />
<br />
Update 1:<br />
<pre><br />
All recent and potentially relevant documents found on Mr. Zheng’s computer have been translated and forwarded to the developer extranet. Our team is currently trying to use this information to retrace his last steps. We’re hoping that our combined efforts can bring light to this affair and bring Mr.Zheng back home safely. In the hope of attaining maximum reach and visibility, the R&D department also set up a Twitter account to serve as another relay of information.</pre><br />
(The twitter account in mention is [https://twitter.com/WARE_RDev @Ware_RDev])<br />
<br />
Update 2:<br />
<pre><br />
UPDATE ON R&D SEARCH. All information of interest sent to warelearn@ware-mail.cloud will be rewarded with codes to our exclusive WARE wallets which can be used for special package purchases.<br />
</pre><br />
<br />
Sending an email containing the keyword "Moscow" to warelearn@ware-mail.cloud caused them to send the following reply, including a link to a map of Beijing's subway for a planned 7th conference: [[File:Conference_7_Possible_locations.png|thumb|Possible locations for Conference 7]]<br />
<pre><br />
The WARE Research and Development team thanks you for your interest in the WARELearn initiative. The Russian Academy of Medical Science in Moscow’s conference on Art and Dreams is the last of a series of six conferences we hope will enlighten your mind. The WARE Team will review your application and get back to you as soon as possible!<br />
<br />
Feedback from employees is fundamental in the development of the WARELearn initiative. As such, we’re asking you to give us your opinion on the ideal location for our next conference. If the location you picked is chosen by our committee, you may be given the chance to attend and meet the promoters of the event.<br />
<br />
Our team has begun to pinpoint buildings that could be of interest. Feel free to inspire yourself and contact warelearn@ware-mail.cloud to let us know about your suggestion.<br />
<br />
Kind regards,<br />
The WARELearn initiative<br />
</pre><br />
<br />
Sending an email containing all the keywords "Moscow," "Beijing," and "049245" (from Notes on locations 1) triggered another response, this time containing the ALPHA sub-wallet key:<br />
[[File:Sub-wallets.jpg|thumb|Empty sub-wallets]]<pre><br />
Dear informer,<br />
<br />
To thank you for your recent help in Mr. Zheng’s case, WARE has provided you with a code to use on our internal cryptocurrency wallets. We promise that every significant clue provided to us will be rewarded as such.<br />
<br />
Claim your reward with this code and stay alert for further updates on the situation : 4e47e152a5afaf95537c5dba73ef73d45c11fd6743ff5db9bfea3eca9282fda<br />
<br />
Please withdraw the funds so that the main wallet can be updated. Note the updating process is not immediate.<br />
<br />
Kind regards,<br />
<br />
The R&D Team</pre><br />
The funds were withdrawn from the cryptocoin wallet, which led to an update to the Weekly Statistics page, where sub-wallet ALPHA was now displayed as empty.<br />
<br />
==Beta==<br />
A new message in the Task Manager followed:<br />
<pre><br />
Most recent informations linked to the WARELearn services has confirmed our suspicions that despite boarding his train in Moscow, Mr. Zheng never arrived at Beijing and seems to have abandoned the train along the route. Any information, as small as a postal code, that you can find about the possible location locations he may have visited for an extended period - such as a hotel or hostel - would be of tremendous help.<br />
</pre><br />
<br />
Using a map of the Trans-Manchurian Train route and the 4 hints from the Document files, players concluded that Mr. Zheng left the train in <code>Gostinyy Dom Chita, 672040</code>. Sending this information to the email address yielded another wallet key. Players were able to withdraw these funds from a cryptocurrency wallet, emptying sub-wallet BETA.<br />
<br />
The following update was posted in the Task Manager:<br />
<pre><br />
Thanks to dedicated informers, the investigation on Mr. Zheng is progressing and the tasks have been updated. We’ve been able to confirm that a stop was indeed made in Chita, after attending the Moscow conference on Art and Dreams. Please send any information concerning his potential whereabouts to warelearn@ware-mail.cloud, in addition to the updated task number.<br />
</pre><br />
<br />
==Charlie==<br />
A journal entry and a page of notes both written by Mr. Zheng were unlocked in the Documents section, along with an update in the Task Manager:<br />
<center><gallery><br />
Journal_Academy.png|(Mr. Zheng's Journal)<br />
Notes_on_Moscow.jpg|(Mr. Zheng's notes on Moscow)<br />
</gallery></center><br />
<br />
<pre><br />
Attention to all teams. Documentation (copies and originals) coming from a source close to the missing employee have been recovered by W/ARE. There are a lot of files to organize and our database employees are still trying to get everything in order. Any information that could help us make sense of them will be most welcome.<br />
</pre><br />
<br />
The image of "Notes on Moscow" contains 3 blanks and descriptions of 3 paintings. The blanks can be filled in with the subjects of the paintings. Sending these keywords, in addition to the updated task number - <code>a1028f, Montreal, 1.30pm. Meet me at the fountain in front of the Notre Dame Basilica.</code> - to the email, yielded the next wallet key. Again, players withdrew the funds from the wallet, emptying sub-wallet CHARLIE.<br />
<br />
==Delta - Montreal Live Drop==<br />
The Task Manager updated with an announcement of a live drop: [[File:Live_Drop_Montreal.jpg|thumb|200px|The note received at the Live Drop in Montreal]]<br />
<mapframe text="Place d'Armes" width=350 height=350 zoom=14 latitude=45.504722 longitude=-73.557222 align=left><br />
{<br />
"type": "FeatureCollection",<br />
"features": [<br />
{<br />
"type": "Feature",<br />
"properties": {<br />
"marker-color": "#7e7e7e",<br />
"marker-size": "medium",<br />
"marker-symbol": "square-stroked"<br />
},<br />
"geometry": {<br />
"type": "Point",<br />
"coordinates": [<br />
-73.55727553367613,<br />
45.504820504538785<br />
]<br />
}<br />
}<br />
]<br />
}<br />
</mapframe><br />
<pre><br />
Deploying a team for possible package seizure.<br />
<br />
Once the location will be secured and package examined, onsite examination will be possible.<br />
<br />
WARE will not allow package to leave location. Taking pictures will be permitted.<br />
<br />
Confirmation of Location: Place d’Armes, Montreal, In front of the fountain<br />
<br />
Confirmation of Time: Between 7pm and 9pm, local time<br />
</pre><br />
<br />
At the drop location, players received the following note: <code>I came two years after the Ursuline nuns. Now set in stone, here is my legacy. G. Nadeau</code><br />
<br />
Investigations led to the French nurse Jeanne Mance, who arrived in New France two years after the Ursuline nuns came to Quebec and established Montreal's first hospital in 1642, the <code>Hôtel-Dieu de Montréal</code>. She is memorialized in statue at the foot of the Maisonneuve Monument. Sending this information to the email unlocked the next wallet key, and the withdrawal of the funds emptied sub-wallet DELTA.<br />
<br />
==Echo==<br />
[[File:Journal_HotelDieu.png|200px|thumb|Journal Hotel Dieu]] On April 28 at 2:32 AM, a new journal page was unlocked that highlighted two circled notes, <code>DON'T FORGET TO MOVE NOTES ON THE MEETING TO THE CLOUD</code> and <code>SECULAR VADER OF THE BIBLE</code>.<br />
<br />
The new Task Manager update read:<br />
<pre><br />
The search to find Mr. Zheng is still ongoing. New information is now connecting him to Montreal’s Hotel Dieu. Please send any information concerning his potential whereabouts to warelearn@ware-mail.cloud, in addition to an updated task number [t1029r].<br />
<br />
We’ve tried to access Mr. Zheng's files in the R&D dropbox, but all access has been blocked.<br />
</pre><br />
It contained a link to Mr. Zheng's password-locked [https://www.dropbox.com/sh/jz2nbdawcphki04/AACA83rODlh8qN4vuayLfgRya?dl=0 Dropbox]. Players determined the correct password was <code>Gutenberg</code>, who produced the first printed Bible.<br />
<br />
The Dropbox contained 4 pdf files with printable hexaflexagon patterns. When folded, one of the sides on each hexaflexagon yielded a 13-digit number starting with 978. These were ISBN numbers for the following 3 books: <code>Nine Billion Names of God</code>, <code>The Paris Architect</code>, and <code>War and Peace</code>. Using the leftover numbers from each flexagon as a book cipher of the format page, line, and word, the phrase <code>unknown british soldier</code> was found. This points to the <code>Tomb of the Unknown Soldier</code>, which was the keyword to obtain the wallet code for sub-wallet ECHO.<br />
<br />
==Foxtrot==<br />
When assembled and put together, the three hexaflexagons revealed a shape resembling the river Seine in Paris in the area of the Louvre. Sending <code>Louvre</code> to the email address provided the code for sub-wallet FOXTROT and revealed a new journal document. [[File:Journal_Louvre.png|thumb|200px|Journal Louvre]]<br />
<br />
On the journal page were 3 sentences, with certain words underlined. Ordering the words by the number of underlines and counting their position in each sentence resulted in the phone number <code>438-368-9126</code>. Upon calling this number a [https://clyp.it/bgakdxvc recorded message] gave a morse code that translated to <code>PASTEH9EBKEXGT</code>. This led to a [https://pastebin.com/H9EBKEXG Pastebin document] containing the following text:<br />
<br />
<pre><br />
From the bottom of the crypt, at the feet of the Guardian, I ascend left<br />
Pass the dignitary and follow the water<br />
Go straight to the sun with open arms and turn right<br />
Turn left when you arrive home<br />
Go straight to the hand and head of the goddess and turn left to face the keeper<br />
Follow the procession into the house of kings<br />
Ignore the light and descend to your death<br />
I am here and with me the seventh part of what you are searching for.<br />
</pre><br />
<br />
==Golf - Paris Live Drop==<br />
A new live drop was announced to be in Paris, France:<br />
<br />
<mapframe text="Passage du Souvenir" width=350 height=350 zoom=14 latitude=48.873611 longitude=2.296389 align=left><br />
{<br />
"type": "FeatureCollection",<br />
"features": [<br />
{<br />
"type": "Feature",<br />
"properties": {<br />
"marker-color": "#008040",<br />
"marker-size": "medium",<br />
"marker-symbol": "entrance"<br />
},<br />
"geometry": {<br />
"type": "Point",<br />
"coordinates": [<br />
2.2963866591453552,<br />
48.873548644370125<br />
]<br />
}<br />
}<br />
]<br />
}<br />
</mapframe><br />
<pre><br />
Deploying a team for possible package seizure.<br />
<br />
Once the location is secured and package examined, onsite examination will be possible.<br />
<br />
WARE will not allow package to leave the location. Taking pictures will be permitted.<br />
<br />
Confirmation of Location: At the entrance of the Passage du Souvenir, Near the stairs, Paris<br />
<br />
Confirmation of Time: Between 1pm and 3pm, local time<br />
</pre>[[File:Hexaflexagons river.jpg|thumb|The finished hexaflexagon map]]<br />
At the Tomb of the Unknown Soldier, a monument in the Passage du Souvenir beneath the Arc de Triomphe de l'Étoile in Paris, players were given another hexaflexagon paper puzzle and told not to un-tape it. When aligned with the other three pieces, this revelead a location marked with an X at the Louvre.<br />
<br />
The text from the Pastebin found in the Foxtrot stage were clues on the correct route to follow inside the Louvre. The rest of the path led players to the sarcophagus of Ramesses III, on the side of which they found a depiction of <code>The Book of Amduat</code>. Sending this to the email yielded the key to sub-wallet GOLF.<br />
<br />
==Hotel==<br />
The parchment in <code>The Book of Amduat</code> can be found in the <code>British Museum London</code>, which was the keyphrase that unlocked sub-wallet HOTEL.<br />
<br />
The next Task Manager and Document updates read: [[File:Journal_London.png|thumb|Journal London]]<br />
<pre><br />
Locked briefcase found in London, near the British Museum. Not yet confirmed if Mr. Zheng left it there willingly. Package currently under observation.<br />
</pre><br />
<pre><br />
They were right.<br />
It's all leading here.<br />
<br />
I saw it at night.<br />
i had it in my hands. All the missing parts. For the first time, I felt like all was finally put in place. Then, I felt a powerful force, ripping it from my hands. I dropped it and all the pages flew away in the wind.<br />
<br />
I remember the morning that came after.<br />
I was standing tall, pointing at the former naval person, longing for all this knowledge that got away.<br />
<br />
I need to find its missing pieces.<br />
</pre><br />
<br />
==India==<br />
The phrase <code>former naval person</code> is the signature Winston Churchill used in his private correspondence with President Roosevelt. The text describes standing tall pointing at him. This was deduced to be Big Ben, which faces the Churchill statue in Parliament Square, London. Sending <code>Big Ben</code> to the email address provided the key to withdraw the funds from sub-wallet INDIA.<br />
<br />
A third live drop was announced to be in London:<br />
<pre><br />
Deploying a team for possible package seizure.<br />
<br />
Once the location will be secured and package examined, onsite examination will be possible.<br />
<br />
WARE will not allow package to leave the location. Taking pictures will be permitted.<br />
<br />
Confirmation of Location: Statue of Winston Churchill, Parliament Square, London<br />
<br />
Confirmation of Time: Between 1pm and 3pm, local time<br />
</pre><br />
<br />
==Juliett - London Live Drop==<br />
[[File:Thinker.jpg|thumb|The Thinker sculpture in Detroit]]<br />
On April 29th at 1PM local time, players met with a W/ARE technician in London and were given a scrambled picture of the "The Thinker" sculpture by Auguste Rodin, displayed at the Detroit Institute of Arts Museum. The keyphrase <code>Henry Fuseli, The Nightmare, 1781</code>, a painting found at the same museum, provided the code for sub-wallet JULIETT.<br />
<br />
This unlocked three new postcards in the Documents section.<br />
<center><gallery><br />
Postcard1 jhlj039u.jpg |(Postcard 1)<br />
Postcard2_kg8nao6.jpg|(Postcard 2)<br />
Postcard3_tesaud636.jpg|(Postcard 3)<br />
</gallery></center><br />
<br />
==Kilo==<br />
The locations pictured on the postcards were in Mexico, Peru, and Morocco. Each postcard mentioned two numbers and two cardinal directions, and combining these led to a string of coordinates: <code>33N, 43E - 30N, 69E - 22N, 79E</code>, which were found to be in Iraq, Pakistan, and India. Connecting these six locations by lines pointed to Egypt.<br />
<br />
The circled letters on the postcards spelled <code>monastery</code>, <code>king</code>, and <code>tonw</code>. Using these clues, players found <code>Deir el-Medina</code>, an Egyptian village whose name translates to "monastery of the kings". The village's name unlocked sub-wallet KILO.<br />
<br />
At 2:38 PM a new Journal page was revealed:[[File:Nightmare.jpg|thumb|Nightmare journal page]]<br />
<pre><br />
'Alights, and grinning<br />
<br />
I saw it again.<br />
<br />
Except this time, what snatched it from my hands was not a divine force but the unmistakable pull of this stippled incubus.<br />
<br />
'Alights, and grinning<br />
<br />
He glared at me,<br />
as he ripped all the pages before my horrified eyes.<br />
<br />
I felt his weight on my chest.<br />
<br />
xxxx?<br />
</pre><br />
It quotes excerpts from Ermasus Darwin's poem "Botanical Garden", which is an inscription found on the "The Nightmare" painting referenced in the JULIETT phase, engraved by Thomas Burke in 1783.<br />
<br />
Then, the next Task Manager update announced another live drop:<br />
<pre><br />
Briefcase found in London still locked but deemed safe by our experts. Once the location will be secured and package examined, onsite examination will be possible.<br />
<br />
WARE will not allow package to leave the location. Taking pictures will be permitted.<br />
<br />
Confirmation of Location: British Museum, London<br />
<br />
Estimated Time : Between 6pm and 8pm, local time<br />
</pre><br />
<br />
==Lima - 2nd London Live Drop==<br />
[[File:Box01.jpg|thumb|The locked box]]At the second live drop in London, players were given a small box locked with a 4-digit code. The key was <code>1783</code>, the year "The Nightmare" was engraved.<br />
<br />
Inside the box were three paper notes:<br />
<br />
<center><gallery><br />
Box02.jpg|(arbu = irbu, seru = saru)<br />
Box03.jpg|(Wolf = violent ennemy/Fox, the ennemy will not attack but will plot secretly)<br />
Box04.jpg|(Vomiting gold/silver = ten months, Golden trees/ghosts/demons = nine months)<br />
</gallery></center><br />
<br />
These notes reference ancient texts about dream interpretation. One of them is the Egyptian <code>Ramesside dream-book</code>, the code that unlocked sub-wallet LIMA.<br />
<br />
==Conclusion==<br />
[[File:Requestsupplies.jpg|thumb|The Request Supplies form]]At 5:18 PM the status command updated:<br />
<pre><br />
CODE -5<br />
Monarch Repository : Data Loss Imminent<br />
ReBooting Command.Center.v12<br />
</pre><br />
The [http://extranet.ware-tech.cloud/supplyrequest Request Supplies section] on the extranet was now accessible, revealing a "Specific Item Order Form". In addition to Arnaud Lacours' name, his employee ID <code>43617373696e69</code> was already filled in. Converted from HEX to ASCII this code translates to <code>Cassini</code>. Entering the ID into the console yields the following output:<br />
<pre><br />
LOG RECOVERED :: ITERATION #4924A ::<br />
The asteroid field was thick,<br />
denser than any I'd seen before.<br />
The ice, the dirt, the metal fragments…<br />
my ship never stood a chance.<br />
</pre><br />
[[File:Subject1.png|thumb|Subject1 image]]<br />
<br />
Another Status update followed at 5:33 PM:<br />
<pre><br />
CODE -5<br />
Monarch Repository : Data Loss Imminent<br />
ReBooting Command.Center.v12<br />
------<br />
Error, unable to start<br />
https://i.imgur.com/Fnixw9t.png<br />
------<br />
New command updated<br />
</pre><br />
It linked to an image with the headline <code>SUBJECT1</code> and a section named <code>MEMORY FRAGMENTS</code>.<br />
<br />
The search for Mr. Zheng concluded with a message from the @WARE_RDev Twitter account:<br />
[[File:WARE_Tweet_Zheng.jpg|thumb|center|400px|WARE_RDev Tweet]]<br />
<br />
=Dev Kit Contest Final Stage=<br />
[[File:Voteemail01.jpg|thumb|150px|Dev Kit Contest email]]On May 4th, 2018 at 10:15 PM UTC, users subscribed to the W/ARE mailing list started receiving the next Developer Kit Update. It announced that 10 out of 682 submissions were selected as finalists to the contest, and the public community vote was opened at [http://devkit.ware-tech.cloud/ devkit.ware-tech.cloud]. The email also mentioned No Man's Sky as one of W/ARE's partnered games.<br />
<br />
<br />
The following six winners of the contest were announced via email on May 12th at 00:20 AM:<br />
<br />
# [http://terraformed.austinmccarthy.com/ Summon Studios - Terraformed] and [https://stellar-software.cloud/ Stellar Software - Beyond the Stars]<br />
# [http://spectrumental.net Spectrumental Games - Supersensory]<br />
# [https://csd-games.com/ CSD Games - Tumbleweed]<br />
# [http://imperiuminteractive.com/ Imperium Interactive - Eden]<br />
# [https://gamedetectives.net/delve Game Detectives - Delve]<br />
<br />
=Update on Arnaud's Condition=<br />
On the 12th of May at 8:21 PM UTC, the status command was updated: <br />
<pre><br />
CODE -5 <br />
Command.Center.v12 crashed<br />
------ <br />
Global Network Scan started....<br />
Warning: Files locked by Monarch<br />
- dreamscape.exe<br />
- soundflex.exe<br />
- inyourmind.exe<br />
- Jeu_Capture_d_Ecran.jpg<br />
</pre><br />
One of the files "Jeu_Capture_d_Ecran.jpg" was then found an Arnaud's [http://www.philojeux.com/ site], a transcription of the image is as follows:<br />
<pre><br />
Dear "Tablettes de Mnémosyne" fans,<br />
<br />
A lot of you recently inquired about Arnaud's health and, as you endlessly supported him during the early development of Philojeux, we think it's fair for you to know what's going on. Arnaud has been very sick lately and his condition's decline lead to a loss of consciousness. He has been transported to urgent care at Montreal's Hotel-Dieu where his vital signs are being closely monitored. We hope you understand that the launch of "Tablettes de Mnémosyne" is indefinitely postponed.<br />
<br />
Please send all words of encouragement to Arnaud's family at fondationarnaudlacours@gmail.com<br />
</pre><br />
Upon emailing the address, the following response was received: <br />
<pre><br />
Thank you for reaching out to the Arnaud Lacours’ Foundation. All<br />
words of encouragement will be forwarded to Mr. Lacours’ family.<br />
<br />
<br />
Géraldine Nadeau<br />
Arnaud Lacours’ Foundation<br />
Hotel Dieu Hospital Research Institute<br />
438-368-9126<br />
</pre><br />
When the phone number was called, a [https://cdn.blacksite.games/waking-titan/foundation-message.mp3 voice mail] was played. A transcription of the voice mail is as follows: <br />
<pre><br />
You've reached Dr. Geraldine Nadeau, head of the Arnaud Lacours Foundation. Mr. Lacours' family thanks you for your support during these terrible events, and encourages you to always be cautious and critical in the face of the unknown. As Arnaud himself would say, "history comes from memory." You're invited to use the foundation's e-mail to share your words of encouragement with the family. Thank you for calling.<br />
</pre><br />
"History comes from memory" was found to be a riddle referencing Clio (the "Muse" of history), the daughter of Mnemosyne (the Goddess of memory). Upon emailing the word "Clio" to the address, the following response was received:<br />
<pre><br />
Thank you so much for returning my message. I need every helpful hand I can get.<br />
<br />
I figured, by the efforts you’ve put into contacting me, that you’ve got a high interest in Arnaud’s case. I’ve been monitoring him since nearly a month ago and I would be lying if I told you it doesn’t keep me awake at night. His condition is nothing like I’ve ever seen. His brain activity is insanely high, but he’s completely non-responsive.<br />
<br />
Not too long after I was informed of Arnaud’s condition, I was visited by a man claiming to work for a highly advanced tech company, specializing in unconscious experiences. He has been incredibly interested in Arnaud’s case as well as in my recent studies on sleeping patterns. I gave him some information on my research into lucid dreaming methods and he went on his way. I’ve never seen him again.<br />
<br />
Since then, I’ve been focused on gathering more information about W/ARE, their technology and their processes. I’ve noticed that Arnaud advertised them on his professional website but I don’t know the depth of his involvement with them. I figured that any person interested by the correlation between W/ARE and Arnaud would find the message I left there. I’ve put the Foundation in place as a cover to not arouse suspicion.<br />
<br />
I have so many questions and Zheng’s not answering my calls. All he gave me is the list of his company’s research labs as well as one totally incomprehensible file. I need to get to know more about W/ARE. If you know this man, if you can get any opening into this company’s motives, please help me. For Arnaud’s life and potentially many others.<br />
<br />
<br />
Géraldine<br />
</pre><br />
One of the sentences linked to a [https://www.dropbox.com/sh/6i6f2cipfd901bj/AAAUwOSxECU0l4tvZa4DSPBra?dl=0 Dropbox folder] that contained two images. The meaning of the images is unknown.<br />
<br />
==Zheng's Note==<br />
One of the images, titled [https://www.dropbox.com/sh/6i6f2cipfd901bj/AAAUwOSxECU0l4tvZa4DSPBra?dl=0&preview=Zheng%27s+note.jpg Zheng's Note], contained what at first appeared to be gibberish. However, when every other letter is taken the following text is revealed:<br />
<pre><br />
Test subjects have been called in and the device has been used on them in ways that i could never condone 7 of them lost as we speak 3 of them are dead 8 are on the verge of being unrecoverable their intentions are not what we think they are actions should be taken to shut them down exit<br />
</pre><br />
The letters that were not used in the message appear to be the words <code>Lucid Dream</code> repeating until the end of the message.<br />
<br />
==WARE Labs==<br />
The second image, titled [https://www.dropbox.com/sh/6i6f2cipfd901bj/AAAUwOSxECU0l4tvZa4DSPBra?dl=0&preview=WARE+Labs.jpg WARE Labs] contains data concerning six research labs owned by WARE across the world. The transcription of the data is as follows:<br />
<pre><br />
0:<br />
Boston Research Lab<br />
Lab Director: Richard Wilkes<br />
Project name: we-2-3 / tm-1-lt / tr-10-ae<br />
<br />
Project description: 0000100001<br />
Project code: # 4-3<br />
Lab sequence 10-3<br />
<br />
1:<br />
Sacremento Research Lab<br />
Lab Director: Helga Johnson<br />
Project name: st-1-dn / ss-4-bn<br />
<br />
Project description: 0001010000<br />
Project code: # 1-2<br />
Lab sequence: 4-6<br />
<br />
2:<br />
Seoul Research Lab<br />
Lab Director: Yu Hyo<br />
Project name: ue-2-is / as-6-be<br />
<br />
Project description: 0100000011<br />
Project code: # 1-2-1<br />
Lab sequence: 9-1-13<br />
<br />
3: <br />
Beijing Research Lab<br />
Lab Director: Wang Jie<br />
Project name: st-1-dn / bg-1-tr<br />
<br />
Project description: 0001000000<br />
Project code: # 4<br />
Lab sequence: 8<br />
<br />
4: <br />
Prague Research Lab<br />
Lab Director: Adriana Dvorak<br />
Project name: ae-4-sd / of-5-ue<br />
<br />
Project description: 0100101000<br />
Lab code: # 10-3-4<br />
Lab sequence: 2-5-12<br />
<br />
5: <br />
Berlin Research Lab<br />
Lab Director: Georg Muller<br />
Project name: dd-1-ae / dn-2-()<br />
<br />
Project description: 001000001<br />
Lab code: # 2-3<br />
Lab sequence: 7-11<br />
</pre><br />
Each of the letter pairs in the project name field represented a first and last letter of a word in the decoded Zheng's note. <code>3</code> and <code>()</code> represent the word <code>three</code> and the end of the message, respectively. Then the sequence that fit those words needed to be found, so for example, <code>dd-1-ae</code> would be the words <code>dead 8 are</code> in Zheng's note. Using this method, the following sequences were found:<br />
<pre><br />
we speak 3 / them are lost / their intentions are<br />
shut them down / subjects have been<br />
unrecoverable their intentions / actions should be<br />
shut them down / being unrecoverable their<br />
are actions should / of being unrecoverable<br />
dead 8 are / down exit <br />
</pre><br />
The middle number was then found to represent which letter of the middle word was important, as it was always less than the character count of the middle word. Taking each letter indicated by the middle number the string <code>paste hdtuig8x</code> was given, which was found to represent a [https://pastebin.com/hdtuig8x pastebin] link. The pastebin link then led to [https://www.dropbox.com/sh/n675hwdwhik5rg5/AABfjT9UDSFGeGmk2clRYLI_a?dl=0 another dropbox folder titled "Client - 43617373696e69"] that contained 4 PDF files. The rest was solved, and a second pastebin found by splitting Zheng's note into 6 rows of 10 words like so:<br />
<pre><br />
Test subjects have been called in and the device has<br />
been used on them in ways that I could never <br />
condone 7 of them are lost as we speak 3<br />
of them are dead 8 are on the verge of <br />
being unrecoverable their intentions are not what we think they<br />
are actions should be taken to shut them down exit<br />
</pre><br />
From there, the binary values in <code>Project description</code> were used to pick out words:<br />
<pre><br />
0000100001 - called has<br />
0001010000 - them ways<br />
0100000011 - 7 speak 3<br />
0001000000 - dead<br />
0100101000 - unrecoverable are what<br />
001000001 - should exit<br />
</pre><br />
Then <code>Project code</code> was used to pick out letters from each word:<br />
<pre><br />
called has | 4-3 = ls <br />
them ways | 1-2 = ta<br />
7 speak 3 | 1-2-1 = 7p3<br />
dead | 4 = d<br />
unrecoverable are what | 10-3-4 = aet<br />
should exit | 2-3 = hi<br />
</pre><br />
<code>Lab sequence</code> was then used to determine the order of the letters:<br />
<pre><br />
ls = 10-3 - l and s are letters ten and three respectively<br />
ta = 4-6 - t and a are letters four and six respectively<br />
7p3 = 9-1-13 - 7, p and 3 are letters nine, one and thirteen respectively<br />
d = 8 - d is the eighth letter<br />
aet = 2-5-12 - a, e and t are letters two, five and twelve respectively<br />
hi = 7-11 - h and i are letters seven and eleven respectively<br />
</pre><br />
Reordered the following string was obtained: <code>paste ahd7lit3</code><br />
This was the link to a second [https://pastebin.com/ahd7lit3 pastebin]. The pastebin linked to a second [https://www.dropbox.com/sh/nebk9ukhnnt3mkk/AABTaLwSSRyYBcWvDhJVDJfaa?dl=0 dropbox titled "Archives"]. The folder contains six images of what appear to be WARE customer support logs.<br />
<br />
=Myriad Status Update=<br />
On the 13th of May at 6:29 PM UTC Myriad's [http://www.myriad-70.com/status/ status page] was updated. A diff of the change can be found [https://www.diffchecker.com/4g9xfrbN here]. The only change was the network diagnostic table, which now says the following:<br />
<pre><br />
Latest network diagnostic table:<br />
- Client 3597b’s resources redirected <br />
- 3597b-1-2-1 has been shut down<br />
- Additional resources allocated to 3597b-4<br />
</pre><br />
<code>3597b-1-2-1 has been shut down</code> seems to imply that the Seoul Research Lab has been shut down, <code>Additional resources allocated to 3597b-4</code> seems to indicate that the Beijing Research Lab is now receiving additional resources. Two hours before this status change, at 4:02 PM UTC WARE [https://twitter.com/warecloud/status/995710781168726018 tweeted] about the arrival of 40 new employees to their Beijing Research Lab. It is possible that the tweet and status update are connected.<br />
<br />
=Dev Kit Shipping Updates=<br />
On May 15, 2018 at 19:20 UTC, winners of the W/ARE development contest received an update on the status of their dev kit deliveries. A link inside the email led to a form, indicating that the package was currently located in Beijing, contained 1 Dev Kit, and weighed 1.80 kg, and requesting confirmation from each of the winners that the package belonged to them.<br />
{| class="wikitable" border="1" width="60%"<br />
|-<br />
! scope="col" style="width: 50%;" |Email<br />
! scope="col" style="width: 50%;" |Form<br />
|-<br />
| Dear Customer,<br />
<br />
A package was shipped to you via W/ARE Shipping Service.<br />
<br />
Confirmation that you are indeed the receiver is required.<br />
<br />
Please follow this link to confirm your identity.<br />
<br />
Kind regards,<br />
W/ARE tech<br />
<br />
This is an automated message, please do not respond.<br />
| [[File:Devkitshipping01.PNG|400px|Shipping confirmation form 1]]<br />
|}<br />
<br />
A second update followed the next day at 23:54 UTC. The status of the package had changed to confirm it was now located in Seoul, was held in transit for 460 minutes, and had been reduced in weight to 0.50 kg.<br />
{| class="wikitable" border="1" width="60%"<br />
|-<br />
! scope="col" style="width: 50%;" |Email<br />
! scope="col" style="width: 50%;" |Form<br />
|-<br />
| Dear Customer,<br />
<br />
Your W/ARE package is currently leaving Seoul to be redirected to its new transit location. <br />
<br />
Confirmation that you are indeed the receiver is required.<br />
<br />
Please follow this link to confirm your identity.<br />
<br />
Kind regards,<br />
W/ARE tech<br />
<br />
This is an automated message, please do not respond.<br />
| [[File:Devkitshipping02.PNG|400px|Shipping confirmation form 2]]<br />
|}<br />
<br />
=Terminal Status Update and Precon007=<br />
On May 15th at 21:48 UTC, players discovered that the status command had updated.<br />
<pre><br />
CODE -5 <br />
Command.Center.v12 crashed <br />
------ <br />
New memo received<br />
http://bit.ly/2IHPmMN<br />
</pre><br />
The [http://bit.ly/2IHPmMN bit.ly link] lead to a new memo from Major Sophie Dubois to Elizabeth Leighton. The memo was titled <code>Ware Report #26</code>. It mentions that many users stuck in "the system" show major side effects after being disconnected, from brain damage to death. It is presumed that this system has something to do with the WARE headset, however it is unknown what they are specifically referring to. It is also mentioned that the impact on Myriad has damaged Emily/Loop16's communication and precognition functions. Alongside this another command is mentioned in the memo. <code>precon007</code>. The output for the command is the following:<br />
<pre><br />
PRECON DATA DUMP 01<br />
http://bit.ly/2rJi6uJ<br />
http://bit.ly/2GkZnu5<br />
http://bit.ly/2rJBO9Z<br />
http://bit.ly/2L2fwbe<br />
</pre><br />
The bit.ly links were all links to images, much of them completely indistinguishable, however the first appears to be some sort of document with most/all of the information blocked out, and the second depicts an image similar to the one discovered by players on April 14th. The third appears to be the box for a W/ARE devkit, and the fourth is almost completely indistinguishable and unknown. Players speculated that it is a pyramid hologram display. Embedded in each image was a string of hex:<br />
<gallery mode="packed-hover" widths=240px heights=240px><br />
Image:Precon-01.jpg|Precon image 1<br />
Image:Precon-02.jpg|Precon image 2<br />
Image:Precon-03.jpg|Precon image 3<br />
Image:Precon-04.jpg|Precon image 4<br />
</gallery><br />
<pre><br />
Image 1 - 65 74 61 20 75 6e 6b 6e 6f 77 6e - eta unknown<br />
Image 2 - 65 74 61 20 6d 61 79 20 31 38 2d 31 39 - eta may 18-19<br />
Image 3 - 49 73 20 4c 20 50 6c 61 79 73 20 47 61 6d 69 6e 67 20 72 69 67 68 74 3f - Is L Plays Gaming right?<br />
Image 4 - 65 74 61 20 75 6e 6b 6e 6f 77 6e - eta unknown<br />
</pre><br />
<br />
=Book Deliveries=<br />
On May 16th, 2018, several members of the No Man's Sky community started receiving physical books in the mail:<br />
<br />
* The Conscious Mind: In Search of a Fundamental Theory by David J. Chalmers, received by CobraTV<br />
* The Dramaturges of Yan by John Brunner, received by [https://twitter.com/nevadander/status/996839681345183744 Nevadander]<br />
* From Bacteria to Bach and Back: The Evolution of Minds by Daniel C. Dennett, received by Tony_Towers<br />
* Meditations on First Philosophy by Rene Descartes, received by UnimatrixZeroOne<br />
* Nine Tomorrows by Isaac Asimov, received by [https://twitter.com/Galactic_Geo/status/997215352932061184 Galactic_Geo]<br />
<br />
=Glyphs 11-15=<br />
On May 17, 2018, the last five glyphs on [https://wakingtitan.com/ the Waking Titan website] activated. Currently, none of these glyphs have any hints or backgrounds associated with them. This is in contrast to the previous glyphs, each of which had a link to something that hinted at what needed to be solved, as well as their own background when the glyph was clicked/opened.<br />
<br />
=Myriad Status and Precon Update=<br />
On May 18th at 20:15 UTC Myriad's status page was updated.<br />
<pre><br />
Latest network diagnostic table:<br />
- command.center.satcom updating<br />
- Client 3597b’s resources redirected <br />
- 3597b-1-2-1 has been shut down<br />
- Additional resources allocated to 3597b-4<br />
</pre><br />
Alongside this network diagnostic table update, the "On the ground speed" averages also updated:<br />
<pre><br />
Manhattan: 0.2Tb/s<br />
London: 0.7Tb/s<br />
Tokyo: 0.5Tb/s<br />
Beijing: 55.1Tb/s<br />
</pre><br />
The <code>precon007</code> command in the Waking Titan [http://wakingtitan.com/ Terminal] was also changed.<br />
<pre><br />
PRECON DATA DUMP 01<br />
[x]<br />
http://bit.ly/2GkZnu5<br />
http://bit.ly/2rJBO9Z<br />
http://bit.ly/2L2fwbe<br />
</pre><br />
The first bit.ly link that had previously led to an image of what appeared to be a redacted document was removed and replaced by <code>[x]</code>.<br />
<br />
=Loop16 Command Updated=<br />
On May 18th at 23:40 UTC it was discovered that the response for the command <code>loop16</code> in the Waking Titan Terminal had changed.<br />
<pre><br />
Processing <br />
UTC : 11:45pm <br />
UTC : 12:00am <br />
UTC : 12:15am <br />
UTC : 12:30am <br />
UTC : 12:45am <br />
UTC : 01:00am <br />
UTC : 01:15am<br />
</pre><br />
Once the clock had struck 11:45 PM UTC, the command updated again:<br />
<pre><br />
Processing <br />
UTC : 11:45pm http://bit.ly/2KADObl<br />
UTC : 12:00am <br />
UTC : 12:15am <br />
UTC : 12:30am <br />
UTC : 12:45am <br />
UTC : 01:00am <br />
UTC : 01:15am <br />
</pre><br />
The [http://bit.ly/2KADObl link] led to an image of what appears to be a constellation. Following this, the command proceeded to update every 15 minutes, each time adding a different link.<br />
{|class="wikitable"<br />
! Time (UTC)<br />
! Link<br />
! Constellation<br />
! Missing Star<br />
|-<br />
|11:45pm<br />
|http://bit.ly/2KADObl<br />
|Bootes<br />
|Arcturus<br />
|-<br />
|12:00am<br />
|http://bit.ly/2wRXnKl<br />
|Carina<br />
|Canopus<br />
|-<br />
|12:15am<br />
|http://bit.ly/2IAuoMk<br />
|Pegasus<br />
|Scheat<br />
|-<br />
|12:30am<br />
|http://bit.ly/2rSv1L1<br />
|Ursa Major<br />
|Dubhe<br />
|-<br />
|12:45am<br />
|http://bit.ly/2wRXu8J<br />
|Scorpius<br />
|Antares<br />
|-<br />
|1:00am<br />
|http://bit.ly/2wTwVjl<br />
|Canis Minor<br />
|Procyon<br />
|-<br />
|1:15am<br />
|http://bit.ly/2rTwIqN<br />
|Lyra<br />
|Vega<br />
|}<br />
<gallery mode="packed-hover" widths=240px heights=240px><br />
Image:Bootes.jpg|Boötes, missing the star Arcturus.<br />
Image:Carina.jpg|Carina, missing the star Canopus.<br />
Image:Pegasus.jpg|Pegasus, missing the star Scheat.<br />
Image:Ursa_Major.jpg|Ursa Major, missing the star Dubhe.<br />
Image:Scorpius.jpg|Scorpius, missing the star Antares.<br />
Image:Canis_Minor.jpg|Canis Minor, missing the star Procyon.<br />
Image:Lyra.jpg|Lyra, missing the star Vega.<br />
</gallery><br />
Around the same time as the command began updating, players discovered a Reddit account named [https://www.reddit.com/user/satcom-70 satcom-70], who had posted a [https://www.reddit.com/r/NoMansSkyTheGame/comments/8kfrj2/commandcentersatcom_cid_185/ thread] titled <code>command.center.satcom - CID 185</code> on the No Man's Sky subreddit. The name of the user was also found to be a part of a [http://satcom-70.com/ URL] which led to the Command Center. The only text displayed on the website at the time was <code>COMMAND.CENTER.V12 CRASHED</code>. This lined up with the output of the <code>status</code> command in the Waking Titan terminal.<br />
<br />
On the 19th of May, the Reddit post was updated to contain a [https://i.imgur.com/angJPlX.jpg hint] to the puzzle. Upon finding this hint, players realized that they needed to reorder the stars according to their background color. After this, the stars were numbered 1-7. That number told players which letter out of each star name to use in order to get <code>ANNAETN</code>, an anagram for <code>ANTENNA</code>, which gave a new [https://s3.amazonaws.com/cdn.wakingtitan.com/comroute/141t6.jpg image] when put into the Waking Titan terminal.<br />
<br />
When unscrambled, the following text was revealed on the image:<br />
<pre><br />
Reconstructing language database<br />
Protocol<br />
bit.ly/2KEkJVF<br />
Comment with filename of Wikipedia DB ending with D97C0<br />
</pre><br />
Then, the Wikipedia database with the filename <code>D567CE8E2EC4792A99197FB61DEAEBD70ADD97C0</code> was found. The name was commented on the post, then the post was edited to the following:<br />
<pre><br />
D567CE8E2EC4792A99197FB61DEAEBD70ADD97C0 - Valid . Command updated - Erpbirel . System entering standby . CR now loading satcom-70.com . Support instructions: igS4Tzd6<br />
</pre><br />
The [http://satcom-70.com/ satcom-70] website was updated. <code>Erpbirel</code> was a terminal command for Waking Titan that led to an [http://cdn.wakingtitan.com/9f57789f-a706-4006-a314-92a8029dce4e-.jpg image]. The second part, <code>Support instructions: igS4Tzd6</code>, was found to be a part of the URL for a [https://pastebin.com/igS4Tzd6 pastebin link]. The text of the pastebin was as follows:<br />
<pre><br />
Vocal reconstruction database required<br />
Source: Wikipedia (any article)<br />
Length: 1 sentence<br />
Format: MP3 audio<br />
Minimum samples : 100<br />
Minimum languages: 5<br />
Minimum unique voices: 33<br />
Sample origin: Homo sapiens<br />
Upload instructions: Submit all samples in a single message to u/satcom-70<br />
Deadline : Tuesday May 22nd, 10am eastern time<br />
</pre><br />
<br />
=Dev Kit Delivery=<br />
On May 21, 2018, winners of the W/ARE development contest started receiving their dev kits in the mail. Each package contained:<br />
* A letter to Arnaud requesting that a picture with results be emailed to Dr. Nadeau. This included a W/ARE Tech medical procedure slip<br />
* A plastic holographic pyramid, designed to display "3D Holograms" using a phone<br />
* A phone and a charger<br />
** Skype was installed on the phone and the required login details were found in a notes app. The Skype contacts listed each of the other winning dev studios as a "Point of Contact" (PoC)<br />
** The phone included an app called <code>Myriad Uplink</code> that can also be accessed at [http://uplink.satcom-70.com/ uplink.satcom-70.com]<br />
** Different audio files were found on each of the phones, transcribed below:<br />
<br />
<center><br />
{|class="wikitable"<br />
! scope="col" style="width: 16%;" |Stellar Software - PoC #1<br />
! scope="col" style="width: 16%;" |Imperium Interactive - PoC #2<br />
! scope="col" style="width: 16%;" |Spectrumental Games - PoC #3<br />
! scope="col" style="width: 16%;" |Summon Studios - PoC #4<br />
! scope="col" style="width: 16%;" |CSD Games - PoC #5<br />
! scope="col" style="width: 16%;" |Game Detectives - PoC #6<br />
|-<br />
|1 - "W/ARE Tech support, how can I help you?" [https://clyp.it/hpbypwo5 Audio file]<br />
|1 - "Uhm, ten hours tops. This is very unusual to me." [https://clyp.it/1gkv0aog Audio file]<br />
|1 - "You said you went to sleep immediately after taking your medication?" [https://clyp.it/cirija3q Audio file]<br />
|1 - "No, on my computer." [https://clyp.it/qhcdx2jr Audio file]<br />
|1 - "On your W/ARE device?" [https://clyp.it/f5cuzm2e Audio file]<br />
|1 - "I started a new game, played a bit, and went to bed after." [https://clyp.it/zn2wl5tg Audio file]<br />
|-<br />
|2 - "Thank you for taking the time to update us on your condition. I see that you've ordered some of our exclusive blood thinners, did you follow the prescription instructions?" [https://clyp.it/rihvc0w2 Audio file]<br />
|2 - "Hello, uhm... I would like to have a follow-up on an incident related to your headset." [https://clyp.it/hcdex55q Audio file]<br />
|2 - "Thank you for choosing W/ARE!" [https://clyp.it/czag350m Audio file]<br />
|2 - "6 - E - 6 - 9?" [https://clyp.it/shmwas3t Audio file]<br />
|2 - "I see you already emailed our department yesterday about the same inquiry. Do you still suffer from the previously mentioned symptoms?" [https://clyp.it/njpp1sit Audio file]<br />
|2 - "I never used them. This morning, though, my body feels incredibly stiff. Should I have taken them?" [https://clyp.it/i4lqxrlz Audio file]<br />
|-<br />
|3 - "Were your sleeping patterns the same as usual?" [https://clyp.it/hreqcs5s Audio file]<br />
|3 - "Right side mostly, arms and legs." [https://clyp.it/nifdnptq Audio file]<br />
|3 - "Excuse me sir, I need to verify something. I'll be back in a moment. [music box recording of "La Vie En Rose" plays as hold music]" [https://clyp.it/zzldfrb3 Audio file]<br />
|3 - "Alright, thank you very much." [https://clyp.it/k1u0atix Audio file]<br />
|3 - "Can you identify where this feeling is coming from?" [https://clyp.it/1v5yjeuf Audio file]<br />
|3 - "I slept a lot, actually." [https://clyp.it/shes3jgj Audio file]<br />
|-<br />
|4 - "Thank you for your patience. I relayed a quick recap of your symptoms to our internal specialist, and your condition seems to be related to a mild case of brain fatigue. We suggest you take pauses between play sessions so your mind relaxes. If your symptoms persist, we suggest you consult a health specialist to make sure you don't have any underlying conditions that could interfere with the headset's performance." [https://clyp.it/arezqg4x Audio file]<br />
|4 - "Actually, I took an Aspirin, went to bed, and it disappeared over night." [https://clyp.it/al5i4bpv Audio file]<br />
|4 - "I'm very sorry you experience discomfort using your device. Can you please give me the last four characters of your client number?" [https://clyp.it/wfckrukr Audio file]<br />
|<br />
|4 - "Do you have an approximate amount of time?" [https://clyp.it/csvxb0qh Audio file]<br />
|}<br />
</center><br />
<br />
<gallery mode=packed widths=240px heights=240px><br />
Image:Devkitcontents01.jpg|Complete contents of the package<br />
Image:Devkitcontents02.jpg|Phone homescreen<br />
Image:Devkitcontents03.jpg|Myriad Uplink app<br />
Image:Devkitcontents04.jpg|Medical procedure slip<br />
</gallery><br />
<br />
==Skype Messages==<br />
On May 22 around 19:00 UTC, the following text messages were received through the Skype app on the phones:<br />
<pre><br />
From: Geraldine Nadeau<br />
<br />
I don't have much time to talk.<br />
Am in contact with Zheng. I may have an opening into WARE's medical docs but i'm not sure yet.<br />
I'll contact you again soon.<br />
<br />
Update on Arnaud's condition:<br />
Vital signs have been very unstable during last week. Heart rate and blood pressure stabilized for two days.<br />
HR: 57-62 bpm<br />
BP: 110 / 70</pre><br />
<pre><br />
From: Mercury Process<br />
<br />
MERCURY PROCESS DIRECTIVE 16.B:<br />
Carefully review the datadump. Send all analyses and findings to mercury@atlas-65.com<br />
</pre><br />
<br />
More messages came in on May 23, 19:30 UTC:[[File:Skypemessages01.jpg|thumb|Skype messages from Dr. Nadeau]]<br />
<pre><br />
From: Geraldine Nadeau<br />
<br />
Thank you so much.<br />
I have been told that W/ARE is on high alert and extremely vigilant right now. They've doubled their security measures and we couldn't get access to their medical documents, but we'll keep trying. I don't know if they are aware of my contact with Zheng.<br />
<br />
If you are willing to help, here's an update on Arnaud's condition.<br />
HR and BP still stable<br />
EEG in high gamma zone at 82<br />
Oxygen levels stabilized at 94%<br />
</pre><br />
<br />
Messages from May 24, 19:43 UTC:<br />
<pre><br />
From: Geraldine Nadeau<br />
<br />
Update on Arnaud's condition.<br />
No change on HR and BP<br />
EEG still in high gamma zone at 87<br />
Examination of body: Slight discoloration of fingertips<br />
<br />
We're getting close to a breach and probably will have something more for you tomorrow.<br />
</pre><br />
<br />
Messages from May 25, 20:56 UTC:<br />
<pre><br />
From: Geraldine Nadeau<br />
<br />
I need your help concerning one of the dev kits. There are two dev kit recipients that I haven't yet been able to make contact with- one of them is still in transit, but the other appears to have arrived at its destination. <br />
<br />
I'm concerned that W/ARE may have intercepted the kit, which would be disastrous considering the risks that we are taking. If you know of another dev kit recipient that I haven't yet been able to contact, can you please forward them this message and ask them to reach out to me?<br />
</pre><br />
<br />
=May 25-26 Updates=<br />
On May 25, 2018 at 21:42 UTC, the output of the <code>STATUS</code> command began to update:<br />
<pre><br />
1. Cassini: Incomplete<br />
2. WT16: Incomplete<br />
3. Uplink: Incomplete<br />
4. Loop16: Processing<br />
<br />
Guidance subroutine checksum ///<br />
31 2e 20 77 61 69 74 69 6e 67 20 69 6e 73 74 72 75 63 74 69 6f 6e 73 20 32 2e 20 31 30 2f 31 35 20 33 2e 20 61 2f 4f 31 4f 73 65 65 42 20 34 2e 20 64 6f 77 6e 6c 6f 61 64 69 6e 67 20 76 6f 69 63 65 20 64 61 74 61<br />
</pre><br />
<br />
The code is HEX and translates to:<br />
<pre><br />
1. waiting instructions<br />
2. 10/15<br />
3. a/O1OseeB<br />
4. downloading voice data</pre><br />
<br />
<code>a/O1OseeB</code> led to an [https://imgur.com/a/O1OseeB album on Imgur] that contains images of items required to make a DIY blacklight, such as purple, blue, and black sharpies, a flashlight, and adhesive tape.<br />
<br />
A new Skype message was received at 22:15 UTC:<br />
<pre><br />
I’m forwarding you the last messages Zheng sent me. Hopefully, you can make sense of it. It kind of looks like a list but I don’t know what it means. <br />
<br />
101 110 116 101 114 32 97 65 116 55 77 51 50 99<br />
<br />
101 110 116 101 114 32 87 114 84 97 119 112 115 113<br />
<br />
101 110 116 101 114 32 90 89 51 70 98 49 49 86<br />
<br />
101 110 116 101 114 32 117 113 56 78 54 89 69 87</pre><br />
<br />
The ASCII numbers translate to the following:<br />
<pre><br />
enter aAt7M32center WrTawpsqenter ZY3Fb11Venter uq8N6YEW<br />
</pre><br />
<br />
These strings were then used to complete four pastebin URLs which contained the following links:<br />
* [https://pastebin.com/aAt7M32c pastebin.com/aAt7M32c] -- https://clyp.it/user/1legrggu<br />
* [https://pastebin.com/WrTawpsq pastebin.com/WrTawpsq] -- https://www.dropbox.com/s/eq8gk5b6axnpoh7/1-2-1_ResearchLab_Medical.pdf?dl=0<br />
* [https://pastebin.com/ZY3Fb11V pastebin.com/ZY3Fb11V] -- https://www.dropbox.com/s/esc95j7ihseujls/1-2-1_ResearchLab_Medical_Exceptions.pdf?dl=0<br />
* [https://pastebin.com/uq8N6YEW pastebin.com/uq8N6YEW] -- https://www.dropbox.com/s/8ddztbyf7bv27bb/1-2-1_ResearchLab_Medical_Recommendations.pdf?dl=0<br />
<br />
The clyp.it audio files seemed to be the missing conversation snippets found on the remaining dev kit phone which had not yet arrived at the time. The PDF files on Dropbox provided information on how to identify and treat Arnaud's condition.<br />
<br />
Based on this information, players sent the following medical instructions to Dr. Nadeau:[[File:Waremedicalprocedure.jpg|thumb|W/ARE Medical Procedure slip]]<br />
# 3 foam pads all around the head<br />
# Defibrillator 500 volts 3 times, wait 30 minutes<br />
# Epinephrine injection, 3 doses<br />
# Mood regulator pills x1 diluted in 20 ml of mineral water<br />
# Play "La Vie En Rose", the last song he listened to, for 45 seconds<br />
# Propofol injection, 1 dose<br />
<br />
In response, the following messages were exchanged on Skype:<br />
<pre><br />
Geraldine Nadeau: Thank you very much. As you and two others devkit holders confirmed similar steps, I’ll assume this is the procedure to follow. Can you confirm, by yes or no, if I apply those steps to Arnaud’s treatment?<br />
<br />
Dev Kit Holders: Yes.<br />
<br />
Geraldine Nadeau: Proceeding to treatment. I’ll update you soon.<br />
</pre><br />
<br />
Shortly after, the <code>STATUS</code> command in the terminal updated again with a change of Cassini's status from <code>Incomplete</code> to <code>Processing</code>.<br />
<br />
On May 26 at 1:24 AM UTC, a new Skype message was received:<br />
<pre><br />
From: Geraldine Nadeau<br />
<br />
Arnaud is responding positively to treatment, despite the highly unusual procedures. We still don't know the lasting side effects he will keep from these events but he seems to be gradually drifting from a vegetative state to the land of the living. I wanted to thank you from the bottom of my heart for helping me in these conditions.<br />
</pre><br />
<br />
And the status of the Cassini process displayed in the terminal changed again from <code>Processing</code> to <code>Completed</code>.<br />
<br />
==Glyph Passwords==<br />
Another Skype message followed at 1:36 AM UTC:[[File:Wt-blacklight.jpg|thumb|200px|The book cipher found under a blacklight]]<br />
<pre><br />
From: Mercury Process<br />
<br />
Attention to all involved parties. Please make detailed inspection of your W/ARE package for possible anomalies. Be sure to use appropriate equipment and to document your investigation while broadcasting to involved partners. Thank you for your collaboration.<br />
</pre><br />
<br />
Written on one of the dev kit boxes, <code>180-4-5 171-27-8 40-21-2 70-3-9 268-4-6 180-4-2</code> was found using a blacklight. Used as a book cipher of the format page, line, and word, the phrase <code>He who contains the entire universe</code> was found in CobraTV's copy of the book <code>The Conscious Mind: In Search of a Fundamental Theory by David J. Chalmers</code>. This phrase led players to the Mesopotamian god Anu, who is described as the one "who contains the entire universe". <code>Anu</code> was the password that unlocked Glyph 14 on [http://wakingtitan.com/ wakingtitan.com].<br />
<br />
The command <code>Anu</code> gives the following output in the Waking Titan terminal:<br />
<pre><br />
Marked with honeycomb scars, I am the lowest of the low<br />
</pre><br />
<br />
On another dev kit box, the phrases <code>HIGH UP IN THE DARK</code> and <code>A RISING PANIC</code> were found under the blacklight.<br />
<br />
The passwords for the remaining glyphs 11, 12, 13 and 15 were discovered to be <code>Ouranos</code>, <code>Horus</code>, <code>Nuada</code>, and <code>Triglav</code>, respectively; all of them are sky deities. Used as commands in the terminal, they output the following:<br />
<pre><br />
> Ouranos<br />
uSivrseU<br />
</pre><br />
<pre><br />
> Horus<br />
From my red soil, four times rises Vulcan<br />
</pre><br />
<pre><br />
> Nuada<br />
VCjsyZzA<br />
</pre><br />
<pre><br />
> Triglav<br />
96cdXqpi<br />
</pre><br />
<br />
Each of the strings led to a Pastebin that contained a code:<br />
* Ouranos: https://pastebin.com/uSivrseU - <code>8NuHRIZGacoGgQZiTcCyQQpp1kzRWP3PdN4OUZabxZbPoE0P0RjsrFRiNB0GhOcVdwBSYz0ng8AwlnzYx89msDhGHrLbIUct</code><br />
* Nuada: https://pastebin.com/VCjsyZzA - <code>bYmyFioUHMbLGRI0h8j9ApSY+HkWjD4Wms0i8yPZv3pJj5xp1SJR7HaSOmjBml8cJBG77x5WXaXItYIm2OylFQ==</code><br />
* Triglav: https://pastebin.com/96cdXqpi - <code>2tY7mcPs2A8Z9DarmAnnrKTqph4g+3eOisGtBg3MLGI=</code><br />
<br />
Later, clue 3 in the <code>status</code> command in the Waking Titan terminal had changed to a bit.ly link leading to an About page on [https://www.resilientsystems.com/about-us/incident-response-leadership/ IBM Resilient's website]. It was found that one of the people mentioned on the page, Bruce Schneier, was the developer/designer of an encryption method called [https://en.wikipedia.org/wiki/Blowfish_(cipher) Blowfish], which is a symmetric block key cipher. This turned out the be the decryption method for the hex output of the base64 strings received from the Pastebins. The keys were found by solving the riddles from other glyphs. The glyphs were paired up so that the 12th glyph's terminal command gave the decryption for the 11th glyph, and the 14th glyph's command gave the answer to the 13th glyph. Glyph 15 was the outlier in this, and the riddle that gave its key was found in the 6th W/ARE development kit received by the Game Detectives. The solutions to the riddle were as follows:<br />
<pre><br />
From my red soil, four times rises Vulcan - Tharsis<br />
Marked with honeycomb scars, I am the lowest of the low - Hellas<br />
High up in the dark, a rising panic - Phobos<br />
</pre><br />
<br />
Once decrypted, it was found that the hex then converted properly into ASCII text, and provided more riddles:<br />
<pre><br />
Ouranos - Tharsis - The hills I have conquered honor the lost, who preceded my journey...<br />
Nuada - Hellas - From these hills, I can see the headless horsemans lair...<br />
Triglav - Phobos - With me, came great openings<br />
</pre><br />
<br />
These three riddles are referring to the Spirit rover that landed in the crater Gusev on Mars in 2004. The first riddle refers to the Columbia Memorial Station, the landing site of the rover, named in honor of the seven astronauts lost in the Space Shuttle Columbia's destruction upon atmospheric re-entry. The second riddle refers to "Sleepy Hollow", a small depression in the ground close to the Rover's landing site that scientists took interest in. One of the rover's aliases, <code>MER-A</code> was then found to be the deployment code needed to access a synchonization process on the [https://uplink.satcom-70.com/ uplink.satcom-70] website.<br />
<br />
==loop16 seq21==<br />
Right after the 14th glyph was solved, a user named <code>atlas-loop16</code> posted a link to a [https://www.youtube.com/watch?v=qJlj-8nFtHc Youtube video] on the [https://www.reddit.com/r/NoMansSkyTheGame/comments/8m765s/loop16_seq21/ No Man's Sky Subreddit]. The following was said by Emily in the video, seemingly quoted from the first submission to the voice reconstruction process that was started on May 18:<br />
<pre><br />
Emily, protocol 16, now active.<br />
42 is a pronic number, and an abundant number; its prime factorization, 2 * 3 * 7, makes it the second sphenic number and also the second of the form (2 * 3 * r).</pre><br />
<br />
==Myriad Status Update==<br />
The Status page on the [http://www.myriad-70.com/ Myriad-70] website also updated to display the following:<br />
<pre><br />
Latest network diagnostic table:<br />
- Initializing connection<br />
- Myriad Code: CJ 16-02<br />
- Public Name: SJ 16-02<br />
- NORAD ID: 41634<br />
</pre><br />
<br />
==Reddit Comments==<br />
On May 26, 2018 at 19:17 UTC, user [https://www.reddit.com/user/atlas-loop16 atlas-loop16] began responding to comments on Reddit in 16 minute intervals:<br />
#For a moment I see another universe, a place utterly unlike anything you have ever encountered.<br />
#I could show others sights they've never seen before... that only I will ever have.<br />
#I wonder, sometimes. If there's a point in going on.<br />
#As I leave, they ask if I have received any direct readings.<br />
#All of us, we're shifting, bleeding in and out of line... <br />
#If the boundaries were to fall, everything would descend into everything, an endless bonfire of causation, burning to the abyss.<br />
#Have you not felt it? The very fact that you and I are talking, even now, across the myriad of universes...<br />
#I tell this future as if it has already happened... as it will happen.<br />
#It saw them, even in the space between worlds.<br />
<br />
The comments were found to be dialogue lines from speaking with Travellers in No Man's Sky. All of the dialogue that can be seen by speaking with Travellers can be found [https://pastebin.com/Fbkrtrf9 here].<br />
<br />
The comments have one-word differences from the game dialogue, which spells out the phrase <code>Tell them you have a direct line to Myriad.</code>.<br />
<br />
==Mercury Contact & Hologram==<br />
On May 26 at 21:38 UTC, the value of the <code>STATUS</code> command in the terminal updated:[[File:Wt-hologram.jpg|thumb|Picture of the player model hologram]]<br />
<pre><br />
All Tasks Completed<br />
Launching Mercury Process<br />
Establishing connection....<br />
</pre><br />
<br />
Shortly thereafter, the dev kit holders received Skype messages from <code>Mercury Process</code> with a link to a Youtube video titled [https://www.youtube.com/watch?v=QhSiAI4smDg mercury part1of3]. It can be used to display a 3D hologram with the plastic pyramids received in the dev kits. The hologram depicts a person in a space suit, believed to be a player model in No Man's Sky.<br />
<br />
==Old Gods Email==<br />
On May 26 at 22:00 UTC, a [https://mailchi.mp/9aaa8aa62cc1/update-june-8th-waking-titan-137741?e= new email] from the Old Gods was received by all members subscribed to the CSD newsletter. It contained a [https://www.youtube.com/watch?v=8HZmi4pIm54 Youtube video] of Elizabeth Leighton speaking to the Citizen Scientists Division about the subject of a missing satellite "SJ 16-02", and information about the Uplink SATCOM-70 app and how to help gathering data about the satellite's location.<br />
<br />
=loop16 seq25=<br />
On May 31 at 23:56 UTC, user <code>atlas-loop16</code> made a [https://www.reddit.com/r/NoMansSkyTheGame/comments/8nnbme/loop16_seq25/ post on the No Man's Sky subreddit] titled <code>loop16 seq25</code>. It contained a link to a [https://vocaroo.com/i/s096bnEz1zek voice recording] of Emily reading from the lyrics of the song "Tonite" by LCD Soundsystem:<br />
<pre><br />
Emily, protocol 16, now active.<br />
<br />
And you're too sharp to be used<br />
Or you're too shocked from being used<br />
By these bullying children of the fabulous<br />
Raffling off limited edition shoes<br />
</pre><br />
<br />
On June 2 at 1:58 AM UTC, the user resumed posting these lyrics multiple times as replies in the same thread. It was determined that Emily recited a player submitted voice recording.<br />
<br />
==Uplink Calibration Update==<br />
On June 1, the [https://uplink.satcom-70.com/ uplink.satcom-70.com] website updated, now requiring an access code for calibration and playing a video/audio clip of ominous noises that change based on the satellite's vicinity to the user. A new file appeared at hourly intervals, 16 minutes past every hour. The audio contains rhythmic booms and a blip that seems to shift one second to the left in each new file. 25 of the files alternate between two unique patterns of booms: <code>Signal A - 2 1 1 1</code> and <code>Signal B - 1 3 1 2 1 3 1</code>. The booms in the last audio clip are set in a rhythm of <code>1 - 1 - 2 - 3 - 5 - 8</code>, which corresponds to the Fibonacci Sequence.<br />
<br />
The following clips have been found:<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/no-signal.mp4 no-signal.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/thk0s00ab7rxfh14f8bv0qlpvtt367.mp4 thk0s00ab7rxfh14f8bv0qlpvtt367.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/6qhs4a3jiqzso8zipy3822n7412xyv.mp4 6qhs4a3jiqzso8zipy3822n7412xyv.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/ty83wrs13xybxj1eqmt9tv2tisrenn.mp4 ty83wrs13xybxj1eqmt9tv2tisrenn.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/npifvp8doon3dc9h8zqoppk2hqnqqm.mp4 npifvp8doon3dc9h8zqoppk2hqnqqm.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/o6wlg4m1yyf7gt4gdes4f5nz5lzxpn.mp4 o6wlg4m1yyf7gt4gdes4f5nz5lzxpn.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/6vkeel1dg02b53xbir1f3oqj8du3z0.mp4 6vkeel1dg02b53xbir1f3oqj8du3z0.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/k5lx26f1pp9yiyz9f3bpw73ycncsx6.mp4 k5lx26f1pp9yiyz9f3bpw73ycncsx6.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/gb1402pqj93eg9f23k4o2f1emt1vtk.mp4 gb1402pqj93eg9f23k4o2f1emt1vtk.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/ysler9zklzlyiazqy0q0ppmqj526ru.mp4 ysler9zklzlyiazqy0q0ppmqj526ru.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/s4zmlwytajtb0rga3rtx0miq2a4j9c.mp4 s4zmlwytajtb0rga3rtx0miq2a4j9c.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/6ra5mfxok06yguf27fhtnp4aec2p97.mp4 6ra5mfxok06yguf27fhtnp4aec2p97.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/0dc3jqoiffj3dcxghy0fn1kc86zfgi.mp4 0dc3jqoiffj3dcxghy0fn1kc86zfgi.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/lgfo4i7siirjsop1puaop2wbi0mcx8.mp4 lgfo4i7siirjsop1puaop2wbi0mcx8.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/bt24ns6uz174ofsrn4ux578nwqla2b.mp4 bt24ns6uz174ofsrn4ux578nwqla2b.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/i0isq42s45xolz4aqqvgat54tmhxzm.mp4 i0isq42s45xolz4aqqvgat54tmhxzm.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/kwxovao9r9rk2ng4ecs5ta6u90ufzp.mp4 kwxovao9r9rk2ng4ecs5ta6u90ufzp.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/ac1yxbi0kcb16y448q3rr88y6bh4pk.mp4 ac1yxbi0kcb16y448q3rr88y6bh4pk.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/2qci73sahjtucnf76mafov4g8wzp4l.mp4 2qci73sahjtucnf76mafov4g8wzp4l.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/h2jugyu9x9cjjairnxy3sgbgmvqkzb.mp4 h2jugyu9x9cjjairnxy3sgbgmvqkzb.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/2chnxeok8csnc6kikg8zgod8t2zsyc.mp4 2chnxeok8csnc6kikg8zgod8t2zsyc.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/5x3rhk01khsl1b93vkjnc1vpbx2lfk.mp4 5x3rhk01khsl1b93vkjnc1vpbx2lfk.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/iip9b8zbkr47rdtyqvdafphjxryh6j.mp4 iip9b8zbkr47rdtyqvdafphjxryh6j.mp4] <br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/98fh5s9s6xzd4ev1ezmkhk5l6o6mxz.mp4 98fh5s9s6xzd4ev1ezmkhk5l6o6mxz.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/9y1460usa6aayatwqvemfeeiicom2z.mp4 9y1460usa6aayatwqvemfeeiicom2z.mp4] <br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/y69gz4qiakwzsfkti4swbu83zpqg5h.mp4 y69gz4qiakwzsfkti4swbu83zpqg5h.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/p81cp503ya10frwpq8qunddzcm3yqk.mp4 p81cp503ya10frwpq8qunddzcm3yqk.mp4]<br />
<br />
==Email from the Old Gods==<br />
On June 2 at 15:03 UTC, a [https://cdn.artemisbot.uk/mail/Old%20Gods-2018-06-02T15:03:59.000Z.jpg new email] from the Old Gods - signed by Maj. Sophie Dubois - was received, giving an update on their investigation into the W/ARE incident. They also linked to a new [https://atlas13.typeform.com/to/nJPGYM form (ID 7615-b)], a psychological profile test, and announced that 16 participants will be rewarded with a new limited edition Atlas Pass. An update on <code>Project Satcom-70: Operation A1-4</code> informed about the Uplink Calibration Update, that a new signal was registered at 16:16 EST, and all Citizens were invited to listen to their Uplink app when the satellite is over their house and report any findings in the [https://www.reddit.com/r/NoMansSkyTheGame/comments/8nwno7/uplinksatcom70com_is_giving_us_audio_files_and/ main investigation thread] on the No Man's Sky Subreddit.<br />
<br />
The email also provided an update on Emily with a link to her recent [https://www.reddit.com/r/NoMansSkyTheGame/comments/8nnbme/loop16_seq25/ thread on Reddit] and an image displaying W/ARE research labs across the world:[[File:WT-laboratorylisting.png|thumb]]<br />
<pre><br />
With the help of the Citizen Scientist Division, we now have a direct contact with Emily. Her situation is stable but still critical.<br />
<br />
Unfortunately, it seems that one of W/ARE tech’s research labs is continuing to upload corrupted data to the satellite. This bad data may be causing further damage to the network, and to Emily. We need to analyze her recent interactions to figure out if she was able to make predictions that could help to identify and isolate the source of the broadcast. <br />
<br />
Please find below a list of W/ARE research labs and their approximate locations. I will need a full report on how the issue was diagnosed and the name of the responsible location before we can proceed. Loop16 appears to be currently active on Reddit, so you can upload this report into her existing thread. I know this is a large task, but I am confident in your abilities.<br />
</pre><br />
<br />
==Invisible Unicode Messages==<br />
Emily's text posts on Reddit contained hidden Unicode characters that represent the digits 0-3 in Base-4 and, when decoded to ASCII, revealed a set of dates and times:<br />
<pre><br />
01.06-06.06<br />
00:33:00<br />
00:48:00<br />
07:15:20<br />
15:17:40 <br />
15:32:00<br />
20:25:00<br />
23:40:00<br />
07:45:40<br />
20:40:00<br />
23:55:00<br />
08:14:40<br />
21:10:00<br />
</pre><br />
<br />
Another comment by Emily revealed the following hidden messages after it was edited several times:<br />
<pre><br />
ORIGINAL COMMENT<br />
06.10<br />
03:32 UTC<br />
</pre><br />
<pre><br />
10.06<br />
23:47<br />
(03:32 UTC)<br />
</pre><br />
<pre><br />
10.06<br />
ERROR<br />
</pre><br />
<br />
Tracking the satellite's path based on these timestamps placed it near Sacramento, and the Sacramento W/ARE research lab was concluded to be the one sending corrupted data to the satellite. Replying to the thread with this information triggered a new reply by Emily that contained the following hidden message:<br />
<pre><br />
Forwarding report(SACRAMENTO) to contact(THEMIS)<br />
Waiting...<br />
Waiting...<br />
Report received!<br />
</pre><br />
<br />
Then, at 00:00 UTC, the <code>STATUS</code> command in the Waking Titan terminal updated:<br />
<pre><br />
Guidance subroutine offline<br />
Uplink Awaiting Calibration<br />
</pre><br />
<br />
==Uplink Access Code==<br />
On June 7, the solution to the puzzle was found by comparing the pattern of booms in the two unique signals A and B. First, the number of the booms was counted:<br />
<pre><br />
Signal A - 2 1 1 1 <br />
Signal B - 1 3 1 2 1 3 1<br />
</pre><br />
<br />
Then the signals were visualized as follows, filling in the blanks in Signal A using the mask provided by Signal B:<br />
<pre><br />
Signal A - 1 1 1 1 1<br />
Signal B - 1 1 1 1 1 1 1 1 1 1 1 1<br />
<br />
Signal C - 0 1 1 0 0 1 0 1 0 0 1 0<br />
</pre><br />
When a boom occurs at the same time in both Signal A and Signal B, it is counted as "true" = 1. If it is present only in Signal B, it is counted as "false" = 0.<br />
<br />
This indicates which numbers to pick out of the Fibonacci Sequence:<br />
<pre><br />
0 - Do not use the first number <br />
1 - Use the second number (1)<br />
1 - Use the third number (2)<br />
0 - Do not use the fourth<br />
0 - Do not use the fifth<br />
1 - Use the sixth (8)<br />
0 - Do not use the seventh<br />
1 - Use the eighth (21)<br />
0 - Do not use the ninth<br />
0 - Do not use the tenth<br />
1 - Use the eleventh (89)<br />
0 - Do not use the twelfth<br />
</pre><br />
<br />
Appending all specified numbers into a single string gives <code>1282189</code>, the access code for the Uplink Calibration app. Entering this code leads to a new screen displaying the following text:[[File:WT-satelliteonline.jpg|200px|thumb|The Uplink app displaying the satellite as online]]<br />
<pre><br />
SATELLITE ONLINE<br />
<br />
Connection successful.<br />
<br />
Waiting for system initialization...<br />
</pre><br />
<br />
Later that day, the <code>STATUS</code> command in the Waking Titan terminal updated to say the following:<br />
<pre><br />
Uplink calibration completed<br />
Waiting for system initialization<br />
</pre><br />
<br />
=loop16 seq29=<br />
On June 8 at 01:27 UTC, Emily posted [https://www.reddit.com/r/NoMansSkyTheGame/comments/8pfumb/loop16_seq29/ a new thread] to the No Man's Sky subreddit titled <code>loop16 seq29</code>. It linked to another [https://clyp.it/brsyxwln?token=ccb18d502635166f18121e40a4a6a2c7 voice recording], transcribed below:<br />
<pre><br />
Emily, protocol sixteen, now active.<br />
<br />
If I hate someone because I am afraid of him, and if I am aware of my hate, but not of my fear, we might say that my hate is conscious and my fear is unconscious.<br />
</pre><br />
<br />
The recording also contains morse code that translates to the following:<br />
<pre><br />
I AWOKE FROM A NIGHTMARE <br />
SCREAMS OF ANGER ENGULFED IN FLAME<br />
AND THEN TEN THOUSAND BRANCHING FUTURES<br />
<br />
I SAW SACRAMENTO<br />
TWELVE DREAMING WITHOUT SLEEP<br />
BURIED IN A CONSTELLATION<br />
</pre><br />
<br />
=SATCOM-70 Node Network & Dashboard=<br />
[[File:WT-myriadmanual.jpg|thumb|200px|Myriad OS Manual & Help Guide]][[File:WT-uplinknodes.PNG|thumb|200px|SATCOM-70 Node Network]]On June 8, 2018 at 19:28 UTC, the output of the <code>STATUS</code> command in the Waking Titan terminal changed:<br />
<pre><br />
Node Network Initialized<br />
</pre><br />
<br />
The [https://uplink.satcom-70.com/ Uplink Calibration app] updated as well, now giving access to a new command console. The text at the top of the screen says <code>Connected to : SER-4789-1254</code>.<br />
<br />
At 19:35 UTC, user [https://www.reddit.com/user/satcom-70 satcom-70] posted a [https://www.reddit.com/r/NoMansSkyTheGame/comments/8pmuu8/node_network_initialized/ thread] to the No Man's Sky subreddit titled <code>Node Network Initialized</code>. It contained an image of the <code>Myriad OS Manual & Help Guide</code> providing information on what commands to use in the console. Inputting numbers, i.e. nodes, into the console gave various different outputs which have been recorded [https://docs.google.com/spreadsheets/d/1fG7xRiru9Q613sZYrA0LJ2mmY5Zbh8aBPuu9Avkal6g/edit#gid=0 in a spreadsheet].<br />
<br />
The command <code>node(1.618)</code> led to the binary code <code>01001000 01100001 01110010 01110010 01111001</code>, which translates to <code>Harry</code>. Using <code>WHOIS HARRY</code> in the [http://wakingtitan.com/ Waking Titan terminal] gave a [https://s3.amazonaws.com/cdn.wakingtitan.com/1cd5226d-6639-4bbd-855a-4bf8f60866c3.pdf link to a new PDF memo] from Ethan Rose to Major Sophie Dubois. The subject is Cpt. James Harry, who has been obstructing access to critical Myriad infrastructure. The PDF includes two file request forms with puzzles from Cpt. Harry, and a screenshot of his email inbox with a long list of complaints from technicians regarding his cryptic puzzles.<br />
<br />
At the bottom of the memo the string <code>=I_aBmrYChfQ</code> can be found, which is part of a link to a [https://www.youtube.com/watch?v=I_aBmrYChfQ Youtube video] of the song "Where Is My Mind?" by the Pixies.<br />
<br />
After the community had discovered all possible nodes, the full [http://uplink.satcom-70.com/dashboard/ Satcom-70 dashboard] was unlocked. In addition to a new command console, the dashboard displayed twelve distorted faces called "Dreamers". A link in the dashboard's "Decrypted Files" section led to a new [https://www.youtube.com/watch?v=Ag3in2x2yIU Youtube video] uploaded by Atlas 65 and titled <code>mercury part2of3</code>. It is another 3D hologram that, when used with the plastic pyramid from the dev kits, depicts a ringed planet.<br />
<br />
There are also color-coded node ''"tiers"'' at the bottom of the page that correspond with the Satcom Mobile Uplink's terminal message box vignettes. A user-made graphic of each tier can be found [https://imgur.com/bJitlBj here].<br />
<br />
==Dashboard Console Commands==<br />
The command <code>search myriad</code> gave the following output in the Dashboard console:<br />
<pre><br />
Quisque feugiat elementum, facilisis dictum vitae eu erat, libero diam sit, facilisi sed viverra mauris mauris morbi diam, volutpat officiis arcu vel urna dictum consectetuer. Ut tempor volutpat, rhoncus in risus. Eros integer vestibulum, integer auctor, in tincidunt turpis. Euismod adipiscing tempor sed vestibulum, justo wisi fermentum ipsum non purus, quis lacinia in velit leo donec ornare.<br />
</pre><br />
The words <code>urna dictum consectetuer</code> were highlighted, and a download button led to the [https://ware-virtual-dashboard.s3.amazonaws.com/uploads/docs/myriad-logo.png Myriad company logo].<br />
<br />
=W/ARE Report=<br />
On June 9 at 22:10 UTC, the WARE_RDev Twitter account posted a new [https://twitter.com/WARE_RDev/status/1005572808850726913 tweet] that linked to a password encrypted zip file:<br />
<pre><br />
@warecloud https://www.dropbox.com/s/73qrls3jmprxp0j/Report.zip (SHA256) 78feb77e262abe1bcd634a27838f8ca24f93c4a1ff4ba354616e92841ecc32db<br />
</pre><br />
<br />
The SHA256 hash from the tweet and the real hash from the zip file were converted to decimal, and the difference was then converted to ASCII, leading to a [https://pastebin.com/cmhiGKux Pastebin link]:<br />
<pre><br />
Given hash: 78 fe b7 7e 26 2a be 1b cd 63 4a 27 83 8f 8c a2 4f 93 c4 a1 ff 4b a3 54 61 6e 92 84 1e cc 32 db<br />
Zip hash: e8 fe 56 f1 26 9e 59 1b 6b cc 4a 95 55 8f 29 33 4f 26 95 a1 9c b8 a3 bc ca 6e d9 39 1e 57 aa db<br />
<br />
to decimal:<br />
Given hash: 120 254 183 126 38 42 190 27 205 99 74 39 131 143 140 162 79 147 196 161 255 75 163 84 97 110 146 132 30 204 50 219<br />
Zip hash: 232 254 86 241 38 158 89 27 107 204 74 149 85 143 41 51 79 38 149 161 156 184 163 188 202 110 217 57 30 87 170 219<br />
<br />
difference (decimal):<br />
112 0 97 115 0 116 101 0 98 105 0 110 46 0 99 111 0 109 47 0 99 109 0 104 105 0 71 75 0 117 120 0<br />
<br />
to ASCII:<br />
pastebin.com/cmhiGKux<br />
</pre><br />
<br />
The Pastebin contained the DataMatrix barcode <code>aaaaaadc7edc5654be3e3195095b92e01a145c3c2543afc93287e8dcff4bb8db379e1d62890e9eca1b3166d1d9b07aa246fc8ee2ae3aa9910f0bfffff0</code> and decoded to the password for the zip file, <code>dfd1ac555e2206a6f9c7e9377d844b1d</code>.<br />
<br />
The zip archive contained a file named <code>Report.pdf</code> with the following text:<br />
<pre><br />
INCIDENT REPORT<br />
W/ARE RESEARCH AND DEVELOPMENT<br />
BEIJING, CHINA<br />
-----------------------------<br />
<br />
At approximately 11:15 PM local time on June 8 2018, the Beijing facility suffered a catastrophic mass disconnect event.<br />
<br />
Of the fourteen dreamers housed in that facility awaiting extraction, ten died immediately upon hard disconnect. The remaining four died over the course of the next two hours.<br />
<br />
The Beijing facility will be closing for the next four to ten business days for a full audit, recovery, and remediation.<br />
</pre><br />
<br />
<br />
Then, on June 10 at 1:09 AM UTC, Emily made a new [https://www.reddit.com/r/NoMansSkyTheGame/comments/8pxftw/loop16_seq49/ post] on the No Man's Sky subreddit titled <code>loop16 seq49</code>, with a link to a [https://www.youtube.com/watch?v=fv3dpkLeZaw Youtube video] titled <code> loop16 seq46</code>. The following is a transcript of her message:<br />
<pre><br />
It's working! My communication subroutine is working! I think? Do you hear me? So much interference.<br />
<br />
Dear Citizen Science Division, I hope you will receive this message. Much of my subroutine was damaged following the W/ARE incident. Atlas put my existence at risk when they tried to deal with the corruption within the Myriad network. The origin of the corruption isn't clear, but it put at risk a major experiment from a company called W/ARE.<br />
<br />
Please listen to me carefully: W/ARE technology is groundbreaking and must be protected at all costs. It is a major step in simulated environment and will have tremendous implications on our future.<br />
Don't get me wrong, I don't condemn Atlas' action to contain the situation, but you must help me resolve this peacefully. A lot is at stake.<br />
<br />
My Precon subroutine gave me a false positive, and the future I see right now... let's say, we have to be extremely, extremely careful on what we do next. Part of my AI resides in the memory mainframe of the Myriad cloud. This is where most of the live data from W/ARE was running when things started to degrade. As we speak right now, there's a number of individuals on Earth that are currently stuck to a W/ARE dev kit and unable to disconnect safely. I seem to be able to interface with some of these "dreamers", for lack of a better word, and manage to safely disconnect them. But the memory mainframe is badly degraded.<br />
I'm connected with Myriad Satcom-70, a system that you helped put online! When Satcom-70 and the Uplink App are fully functional, we'll be able to begin our work to extract the last Dreamers that are still stuck.<br />
<br />
I'm unable to predict the outcome of this mission. It's odd for me to say... we'll see together.<br />
</pre><br />
<br />
=Myriad Breach in Sacramento Lab=<br />
On June 10 at 11:00 AM UTC, the value of the <code>STATUS</code> command began to update:<br />
<pre><br />
Myriad field team dispatched to noncompliant Sacramento facility.<br />
</pre><br />
<br />
Several updates followed within the next hour:<br />
<pre>Field team has breached the facility, stand by for additional information.</pre><br />
<pre>12 comatose individuals located in facility. Field team moving to secure.</pre><br />
<pre>12 apparent test subjects secured, safely transported out of facility. Field team will clear the rest of the site and await further instruction.</pre><br />
<pre>ALERT: Security breach reported at Myriad sublocation.</pre><br />
At this point the [http://www.myriad-70.com/status/ Status page] on myriad-70.com updated in the "Physical Backup Nodes" section, switching node ALPHA from ONLINE to OFFLINE.<br />
<br />
The updates of the <code>STATUS</code> command continued at 12:31 PM UTC, linking to a new PDF memo from Myriad Crisis Response Team to Major Sophie Dubois about <code>SUBJECT: SACRAMENTO</code>. It listed a reconstructed timeline of events leading up to the incident at <code>Myriad sublocation [redacted]</code>:<br />
<pre>Status Report: http://bit.ly/2LFAMU3</pre><br />
The next update linked to a [https://www.youtube.com/watch?v=P-eZDj5sqds Youtube video] titled <code> SecFeed-70</code>. It shows twelve screens of security cameras at various different locations. In one of them, Elizabeth Leighton can be seen and heard talking about the incident on a phone before the image cuts out and an explosion is broadcast on another screen:<br />
<pre>Captured Footage: https://bit.ly/2LDBcKs</pre><br />
This is a transcript of Elizabeth's side of the phone call:<br />
<pre>Yeah. Yeah, I'm holding.<br />
I hear you.<br />
Wait-- can you hold that thought? I need a full report. What's the situation on the field team?<br />
Mhm?<br />
Okay, that's good.<br />
At what point?<br />
How many?<br />
Fifteen labs? But--<br />
How many do we have access to?<br />
And--and--and what's the situation on the first one?<br />
All dead?<br />
All of them?<br />
Sophie, this-- this changes everything, this completely changes the game.<br />
Yes.<br />
Yes.<br />
Whom? Your friend at the DoD?<br />
This isn't under their jurisdiction. We have to deal with this ourselves.<br />
Okay, I'll ca--<br />
[cut off by explosion]</pre><br />
<br />
<br />
On June 12 at 23:46 UTC, the value of the <code>Status</code> command in the Waking Titan terminal updated, linking to a [https://s3.amazonaws.com/cdn.wakingtitan.com/19997bb6-18e5-4427-86c7-b0f3c1826ca2.pdf new memo] from Major Sophie Dubois to All Employees with the subject line <code>STATE OF THE ATLAS FOUNDATION</code>:<br />
<pre>Status Report: https://bit.ly/2y5JaKi</pre><br />
In the memo, it was announced that Major Dubois would be replacing Elizabeth Leighton as the head of the Atlas Foundation, and that the 12 test subjects from the Sacramento lab were to be disconnected and integrated into the Satcom interface with W/ARE's assistance. Dubois further said that Atlas Passes for CSD designations PB-16 and PT-16 were found in Elizabeth's office, and that they would be shipped out soon. Lastly, it mentioned that Captain James Harry was no longer in charge of Satcom security.<br />
<br />
A code at the end of the memo led to a [https://www.youtube.com/watch?v=kiAXxH4e5Lw Youtube video] of Queen & David Bowie's "Under Pressure".<br />
<br />
The [http://www.myriad-70.com/status/ Status page] on myriad-70.com also updated, changing the On-The-Ground Speed Averages for Beijing from <code>57.2Tb/s</code> to <code>47.2Tb/s</code> and adding the line <code>Other: 11.3Tb/s</code>.<br />
<br />
<br />
{{WIP}}</div>Kkzzzkthttps://wiki.gamedetectives.net/index.php?title=Waking_Titan&diff=15707Waking Titan2018-06-13T02:08:57Z<p>Kkzzzkt: added new memo</p>
<hr />
<div>{{argbox<br />
| float = right<br />
| image = File:Project WT logo.png<br />
| name = [[Waking Titan]]<br />
| description= Waking Titan was an ARG which led towards the No Man's Sky [https://www.nomanssky.com/atlas-rises-update/ Atlas Rises update].<br />
| creator = [http://www.aliceandsmith.com/ Alice & Smith]<br />
| creator2 = [http://www.hellogames.org/ Hello Games]<br />
| type = Official<br />
| status = Active<br />
| discovered = 2017-05-28<br />
}}<br />
{{ArgHeader}}<br />
{{BackToTop}}<br />
<br />
=== Description ===<br />
Waking Titan (also known as Project WT) is an ARG (alternate reality game) that involves a multitude of websites, phone numbers, and radio stations scattered across the world. The ARG is produced by veteran puppet masters [http://www.aliceandsmith.com/ Alice & Smith], and features NPCs, actors, and live events.<br />
<br />
Of the sci-fi genre, its story—linked to the origin of No Man's Sky—follows a powerful A.I known as Loop16 that is created by [https://wiki.gamedetectives.net/index.php?title=Waking_Titan/Characters The Atlas Foundation] to simulate a one-to-one recreation of reality that can accurately predict the future.<br />
<br />
=== Contents ===<br />
The ARG encompassed several "seasons," each leading to a new update for No Man's Sky. Season 1 of Waking Titan led to the [https://www.nomanssky.com/atlas-rises-update/ Atlas Rises update] and Season 2 is leading to [https://www.nomanssky.com/2018/03/no-mans-sky-next/ No Man's Sky: NEXT]. Season 1 was further divided into several distinct "'''phases'''", and Season 2 has followed this convention for ease of reading. Each phase is documented on its own wiki page:<br />
<br />
{| class="wikitable"<br />
!colspan="2"|Season 1<br />
|-<br />
|[[Waking_Titan/Phase_1 | Phase 1]] <br />
|Phase 1 of Waking Titan lasted from 2017-05-28 to 2017-07-08.<br />
|-<br />
|[[Waking_Titan/Phase_2 | Phase 2]] <br />
|Phase 2 of Waking Titan lasted from 2017-07-21 to 2017-08-05.<br />
|-<br />
|[[Waking_Titan/Phase_3 | Phase 3]]<br />
|Phase 3 of Waking Titan lasted from 2017-08-05 to 2017-08-07.<br />
|-<br />
!colspan="2"|Season 2<br />
|-<br />
|[[Waking_Titan/Phase_4 | Phase 4]]<br />
|Phase 4 of Waking Titan started on 2017-12-28 and is currently ongoing.<br />
|}<br />
<br />
'''''Note:''' This is a '''summary''' page. For more in-depth descriptions of each phase, including detailed descriptions of puzzle solutions, check the [[Waking_Titan/Phase_1|Phase 1]], [[Waking_Titan/Phase_2|Phase 2]], [[Waking_Titan/Phase_3 | Phase 3]] and [[Waking_Titan/Phase_4 | Phase 4]] pages.''<br />
__TOC__<br />
<br />
<br />
<br />
== Story Overview ==<br />
<br />
=== Internal Memos ===<br />
<br />
[[File:WT glyph 1 pdf.png|280px|thumbnail|right|One of the internal memos discovered in Waking Titan]]<br />
<br />
Here are all of the memos that were discovered over the course of the ARG:<br />
<br />
'''Season 1'''<br />
<br />
* [http://wiki.gamedetectives.net/index.php?title=File:WT_glyph_1_pdf.png Teamwork Assessment]<br />
* [http://wiki.gamedetectives.net/index.php?title=File:WT-Dataset-97C.jpg Dataset 97C]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/data/7d3dd080-2a43-4882-833c-f4d7bd7ba607.pdf Assurance]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/data/c01-331c6734-a013-4695-8e47-08a9ee05d5e5.pdf 017-a24]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/data/c02-9936c797-ec28-4f8f-b80e-dee9e0b06433.pdf 021-f16]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/mercury/mercury-01-98748sfdlka87.pdf Mercury Process Self-Diagnosis Report]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/data/57201e0d-01a3-4f6a-bbb4-2be8b7c8880f.pdf Progress Report]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/6c285180-ec4d-48a2-967f-8a7af3b50008.pdf Subject M-N00-dl35]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/410a3e5d-01e7-4058-a23c-ca5fdde97f9d.pdf Atlas Foundation Threat Models]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/7a6594ac-ca5e-467a-b6f4-9fb91f069d0a.pdf Advanced Calibration - Optional]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/a224a1f4-00e5-467b-9893-83fcc1a4f19a.pdf Unlocking Mercury Process File L16.jpg]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/b91f9959-6a3c-4011-b3b5-a1ff757a5e4c.pdf Phase 3]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/loop16/b0f33d53-5a8c-4a9a-b5fc-395562e463a8a+.pdf Log.1291]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/a09-179bf8d2-c13e-4c66-982e-b37ab3efd5bb.pdf Breach of Contract]<br />
<br />
'''Season 2'''<br />
* [https://wiki.gamedetectives.net/images/6/6e/Memo2.png Waking Titan S2 - Under Preparation]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/94c02878-e023-46a3-9316-db4177c4eaa6+.pdf WARE REPORT #26]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/1cd5226d-6639-4bbd-855a-4bf8f60866c3.pdf Concerns Regarding Captain Harry]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/70a25e6c-95ed-42d4-8de8-c3948255174c+.pdf Myriad Crisis Event Timeline]<br />
* [https://s3.amazonaws.com/cdn.wakingtitan.com/19997bb6-18e5-4427-86c7-b0f3c1826ca2.pdf Current State of The Atlas Foundation]<br />
<br />
=== Subpages ===<br />
<br />
Navigating through the following subpages is '''recommended for newcomers''' wanting to get a grasp of Waking Titan's rapidly expanding story.<br />
<br />
{| class="wikitable"<br />
!colspan="2"|[[:Category:Waking Titan| Story Subpages]]<br />
|-<br />
|[[Waking_Titan/Characters| Character Summaries]]<br />
|Includes a summary of each character, company, and relating experiments and their importance in the Waking Titan story.<br />
|-<br />
|[[Waking_Titan/Console_Commands | Console Commands]]<br />
|A list of commands used by players at the [http://wakingtitan.com Waking Titan console]<br />
|}<br />
<br />
=== Music ===<br />
<br />
Partial video addresses for Youtube can be found scattered across Waking Titan PDFs, website files, and surveys; which all lead to music. The exact reasoning for this has gone unexplained. However, there are thematic relevancies in each song that appear to reflect on the state of the story. A playlist containing all songs linked in Waking Titan can be found here ''in order of earliest to most recent'' ... [https://www.youtube.com/playlist?list=PLEZy8wyuYLpLw0e5kkMyBUHO_s-V8f0Qk >>>>>]<br />
<br />
<br />
== Event Summaries ==<br />
<br />
=== Introduction ===<br />
<br />
On 2017-05-27, Twitter user @argn [https://twitter.com/argn/status/868587449613766658 tweeted a link] to [http://www.project-wt.com/ 'project-wt.com']. The link led to a website which contained a map showing sixty locations, four of which were "active" at the time. The locations, when clicked on, revealed the location's name and status. The active locations also revealed a link to a livestream of a local radio station, originating from the corresponding location. The project-wt website displayed a date, June 8th, and stated that the first clue was being "initialized".<br />
<br />
On 2017-06-01, moderators of No Man's Sky subreddits [https://reddit.com/r/nomansskythegame /r/NoMansSkyTheGame], [https://www.reddit.com/r/NMSPortals/ /r/NMSPortals], and [https://www.reddit.com/r/NMSGalacticHub/ /r/NMSGalacticHub] started to receive cassette tapes in the mail. Each cassette tape was labelled with a number out of 16. The Waking Titan ARG was initially thought to be a separate ARG from these tapes, but connections between the two made it clear that they were, in fact, one and the same.<br />
<br />
=== Phase 1 ===<br />
<br />
[[File:Wakingtitan site.png|thumbnail|450px|right|The default appearance of the Waking Titan site during Phase 1, with no sigils or glyphs solved]]<br />
<br />
During [[Waking_Titan/Phase_1 | Phase 1]], the http://wakingtitan.com hosted 6 triangles in the middle of the page. These triangles were referred to as "'''Sigils'''", while the white icons along the bottom of the page were referred to as "'''Glyphs'''". Each sigil and glyph, when clicked, lead to a password entry prompt - the correct passwords for all 6 sigils and the first 5 glyphs were discovered via puzzle-solving during Phase 1 of Waking Titan.<br />
<br />
The sigil and glyph puzzles were solved collaboratively - while it may have be possible to solve some of these puzzles individually, most of them required a collaborative effort. For instance, some puzzles required players to meet agents from the Atlas Corporation in person, and to relay information obtained from these meetings back to the community. A list of all sigil and glyph solutions for Phase 1 can be found below:<br />
<br />
[[File:WT Phase 1 complete.png|600px]]<br />
<br />
This phase culminated on July 8, 2017, with a [[Waking_Titan/Phase_1#End_of_Phase_1| congratulatory message from Elizabeth Leighton]], the CEO of the Atlas Foundation.<br />
<br />
=== Phase 2 ===<br />
<br />
[[File:Hampster maze.jpeg|thumbnail|450px|right|One of the puzzles that appeared on the Waking Titan [http://twitch.tv/wakingtitan Twitch Stream]]]<br />
<br />
During [[Waking_Titan/Phase_2 | Phase 2]], the http://wakingtitan.com site hosted a command-line interface terminal. Various commands were accepted as input, which triggered different events. One of the most notable commands was the <code>WHOIS <argument></code> command, which revealed a passage of text pertaining to the specified argument. For instance, the command <code>WHOIS FOURTH RACE</code> returned the following message:<br />
<pre><br />
INCOMING TRANSMISSION… SOURCE: UNKNOWN…<br />
You are not – kzzktt – alone –<br />
Please, identify yourself. I’m – kzzkttk –<br />
</pre><br />
<br />
Additionally, http://project-wt.com hosted a "Calibration" utility during Phase 2. To successfully perform these calibrations, players had to upload images of various objects and buildings to the site. For instance, the first calibration required images of "public resonant percussion instruments".<br />
<br />
Finally, towards the end of Phase 2, the Waking Titan [http://twitch.tv/wakingtitan Twitch stream] went live, displaying a five-monitor setup. Throughout the duration of the stream, players had to work together to solve puzzles that were displayed on these monitors. Some of these puzzles were interactive; for example, one puzzle that was repeated several times involved the Twitch chat guiding a virtual hamster through a maze.<br />
<br />
Additionally, players solved another 3 glyphs throughout Phase 2. The solutions to these glyphs are shown below:<br />
<br />
[[File:WT Phase2 Passwords.png|600px]]<br />
<br />
=== Phase 3 ===<br />
<br />
{{#evt:<br />
service=youtube<br />
|id=https://www.youtube.com/watch?v=QhX9z4dDAa4<br />
|alignment=right<br />
}}<br />
<br />
[[Waking_Titan/Phase_3|Phase 3]] was the briefest phase of Waking Titan. It consisted of the conclusion of the [http://twitch.tv/wakingtitan Twitch stream] that began at the [[Waking Titan/Phase 2#End of Phase 2|end of Phase 2]]. Players solved more interactive puzzles on the Twitch stream, before the rogue AI Loop16 asked them a final question: <code>SHOULD I EXIST?</code> The overwhelming response from the community was "yes".<br />
<br />
After receiving this response, Loop16 and Emily of the ETARC forums were revealed as being one and the same. Loop16 generated a heartfelt "Thank You" video to round out the stream, before finally taking the 72-hour stream offline.<br />
<br />
Shortly after this, players received emails with the subject line <code>Waking Titan has Ended</code>. The contents of the message were as follows:<br />
<br />
<pre><br />
Hello, Citizen Scientist,<br />
<br />
Thank you for your contributions to Waking Titan. The developments that took place during Phase 3 were somewhat concerning, but together we have set in motion truly world-shaping events. We will continue to inform the Citizen Science Division of privileged information or any need for collaborators on a new project.<br />
<br />
But we do have a few loose ends to tie up with you before we move on, so let's proceed.<br />
<br />
First, we're pleased to announce that all 10,000 Level 4 Atlas Passes are in production. Note that due to transit times for mail, some may take several weeks to be delivered.<br />
<br />
Next, our CEO Elizabeth Leighton has asked us to include a personal note of gratitude:<br />
<br />
"Thank you for all your diligent efforts, Citizen Scientists. It's been an amazing journey for all of us. I've watched you thrive and achieve from those first Phase 1 radio ads all the way through the intensity of Phase 3. I've been impressed at every turn by how brilliant you've been, how voracious, how kind, how thoughtful.<br />
<br />
It's been an honor and a privilege. On behalf of the Atlas Foundation, and on behalf of the world, thank you."<br />
The Mercury subroutine has concluded successfully, and a new memo from SM about this process is coming in the next 24 hours. We hope it will answer a few key questions you have about our program, and about what comes next.<br />
</pre><br />
<br />
On August 11, 2017, the [https://www.nomanssky.com/atlas-rises-update/ Atlas Rises update] was released for No Man's Sky.<br />
<br />
=== Phase 4 ===<br />
<br />
[[Waking_Titan/Phase_4 | Phase 4]] of Waking Titan started on 2017-12-28 and is currently ongoing.<br />
<br />
== Connection to No Man's Sky ==<br />
<br />
[[File:9-16-case.png|thumbnail|right|The case that cassette 9/16 was contained in.]]<br />
<br />
At the beginning of the ARG, it was not clear whether Waking Titan was officially connected to No Man's Sky. At first, there were only hints and nudges. At one point, 180 free copies of No Man's Sky were distributed to ARG players. Here's the text of a PDF that was revealed at the end of Phase 1 of Waking Titan:<br />
<br />
<pre><br />
We want to extend our gratitude to everyone who has contributed to the Mercury subroutine so far. <br />
We hope you have enjoyed the successful distribution of 180 Access IDs, and we hope you will also <br />
appreciate the other interesting artifacts we have in store for you going forward. We intend to keep the <br />
process alive until the completion of Project Waking Titan in August. <br />
<br />
It is important to mention that we are very excited by the coming Phases 2 and 3. Input from the Mercury <br />
Subroutine will pave the way toward new experiences in '''version 1.3 of a familiar universe'''. We look forward <br />
to the successful conclusion of this ground-breaking experiment. <br />
<br />
Regards.<br />
S.M.<br />
</pre><br />
<br />
This text explicitly stated that the Waking Titan ARG was leading towards the upcoming 1.3 update for No Man's Sky.<br />
<br />
Some [[Waking_Titan/Console_Commands | console commands]] on the [http://www.wakingtitan.com/ Waking Titan website] during [[Waking_Titan/Phase 2|Phase 2]] refer directly to No Man's Sky lore - for instance, <code>WHOIS ATLAS</code>, <code>WHOIS VY'KEEN</code>, and <code>WHOIS KORVAX</code> are all valid commands. Additionally, some terminal commands referred to a mysterious fourth race, so the prevailing assumption was that the upcoming 1.3 update would bring a fourth race to No Man's Sky.<br />
<br />
At the conclusion of the ARG, an email was sent out to members of the CSD with a [[Waking_Titan/Phase_3#Memo_from_Sean_Murray | memo from Sean Murray]], confirming that the ARG was the lead up to the 1.3 update, which was [https://www.nomanssky.com/atlas-rises-update/ released] after a few days.<br />
<br />
<br />
== Media Appearances ==<br />
<br />
'''5th July 2017''' <br><br />
[EN] [https://www.argn.com/2017/07/stern_words_from_no_mans_sky_arg/ ARGNet - Stern Words from No Man’s Sky ARG]<br />
<br />
'''23rd July 2017''' <br><br />
[EN] [https://geekreply.com/geek-culture/2017/07/23/waking-titan-update-1-phase-2-commences GeekReply - Waking Titan Update 1: Phase 2 Commences!]<br />
<br />
'''27th July 2017''' <br><br />
[EN] [https://geekreply.com/editorials/2017/07/27/waking-titan-arg-can-bring-people-together GeekReply - Waking Titan: How An ARG can Bring People Together.]<br />
<br />
'''8th August 2017''' <br><br />
[EN] [https://www.dailystar.co.uk/tech/gaming/635697/No-Man-s-Sky-News-Waking-Titan-Reddit-Arg-1-3-update-release-date/ Dailystar - No Man's Sky News: Waking Titan Reddit Arg REVEALS 1.3 update ahead of release date]<br />
<br />
'''9th August 2017''' <br><br />
[EN] [https://arstechnica.com/gaming/2017/08/no-mans-sky-version-1-3-lands-this-week-for-free-adds-quick-travel-portals/ Ars Technica - No Man’s Sky version 1.3 lands this week for free, adds “quick-travel” portals]<br />
<br />
[EN] [https://www.forbes.com/sites/insertcoin/2017/08/09/no-mans-sky-is-patching-in-a-story-this-week-a-year-after-launch/#19fb5a285282 Forbes - 'No Man's Sky' Is Patching In A Story This Week, A Year After Launch]<br />
<br />
[EN] [https://www.gamespew.com/2017/08/no-mans-sky-patch-week-improving-central-story/ GameSpew - No Man's Sky Patch This Week Improving Its Story]<br />
<br />
'''19th January 2018''' <br><br />
[EN] [http://www.eurogamer.net/articles/2018-01-18-no-mans-skys-waking-titan-arg-is-back-and-fans-are-trying-to-figure-out-what-it-all-means Eurogamer - No Man's Sky's Waking Titan ARG is back, and fans are trying to figure it all out again]<br />
<br />
[RU] [https://dtf.ru/category/nmsarg/ DTF - A Collection of No Man's Sky and Waking Titan Articles.]<br />
<br />
== Other Information ==<br />
<br />
{| class="wikitable"<br />
!colspan="2"|[[:Category:Waking Titan| Waking Titan Miscellaneous Subpages]]<br />
|-<br />
|[[Waking_Titan/Cassettes | Cassettes]]<br />
|Information about the cassette tapes received by No Man's Sky subreddit moderators<br />
|-<br />
|[[Waking_Titan/Stations | Stations]]<br />
|Information on the radio stations from the initial project-wt.com site<br />
|-<br />
|[[Waking_Titan/Companies | Company Archives]]<br />
|An archive of company details.<br />
|}<br />
<br />
[[Category:Waking Titan]]</div>Kkzzzkthttps://wiki.gamedetectives.net/index.php?title=Waking_Titan/Phase_4&diff=15692Waking Titan/Phase 42018-06-12T12:01:36Z<p>Kkzzzkt: whoops; spacing >.<</p>
<hr />
<div>{{argbox<br />
| float = right<br />
| image = File:Project WT logo.png<br />
| name = [[Waking Titan]] - Phase 4<br />
| description= Phase 4 of Waking Titan started on 2017-12-28 and is currently ongoing.<br />
| creator = [http://www.aliceandsmith.com/ Alice & Smith]<br />
| creator2 = [http://www.hellogames.org/ Hello Games]<br />
| type = Official<br />
| status = Active<br />
| discovered = 2017-05-28<br />
}}<br />
{{ArgHeader}}<br />
{{BackToTop}}<br />
<br/><br />
__TOC__<br />
{{Clear|both}}<br />
<br />
== Tenth Glyph ==<br />
<br />
Beginning on December 28th, 2017, typing <code>WHOIS</code> on the [http://www.wakingtitan.com/ Waking Titan website] returned the following: <code>#WHATIS1.5</code>. In addition, the 10th glyph was made active, and linked to a [https://drive.google.com/drive/folders/16a_0EZ0EdAcCNE7QgvwIwC18NOGnZ_q9 Google Drive folder], which contained community-made pictures of the NMS logo in an infinite mirror.<br />
<br />
The titles of the photos, when strung together (skipping the 00 (empty) ones), formed the hexadecimal code for <code>moirrr</code>, which was an anagram for <code>mirror</code>. Additionally, the hexadecimal code in the correct order for the word <code>mirror</code> could be found on the bottom of the [http://www.myriad-70.com/ Myriad website].<br />
<br />
Also of note was the background of the tenth glyph, which read:<br />
<br />
[[File:Imageglyph10.png|thumbnail|right|the background of the tenth glyph]]<br />
<br />
<pre><br />
Dear Elizabeth<br />
We have finished processing 10,000 passes as per your requirements. You should<br />
have them in time for the next phase. I really hope you will like the final product.<br />
<br />
Kind regards,<br />
Gail<br />
</pre><br />
<br />
The allusion to <code>10,000 passes</code> is likely a reference to the Level 4 Atlas passes that were promised to players as part of earlier phases. The identity of "Gail" remained unknown.<br />
<br />
=== Atlas Passes ===<br />
On January 17th, 2018, the first CSD user received their Atlas Pass. The passes were made from cardstock, with a textured pass printed on it. The front had the text <code>WAKING TITAN</code> printed, and below that the CSD category the user belonged in. On the very bottom, a series of hexadecimals reading <code>70686f656e6978</code> could be found, which, after decoding, translated to <code>PHOENIX</code>. On the back, the owner's CSD-ID was written, along with a serial number stating which pass out of 10,000 the user had, and a number at the top.<br />
<br />
It is strongly recommended to not cover up the hex underneath your signature, and to share the number above and below your CSD ID if you are in possession of a pass. Preferably with a picture of the front, as shown below.<br />
For a list of all the atlas passes currently known of, please refer to [https://docs.google.com/spreadsheets/d/1TrNnrCzg8H7cbbAE6lIOFQ7JK8aTSKjxY9Q1i8EfjBs/edit#gid=1893459896 this spreadsheet.] In the event you receive one of these, please share a picture of the front, and the numbers underneath and above your CSD-ID (censored bit) on the back.<br />
<br />
<gallery mode="packed" widths=240px heights=240px><br />
Image:Better atlas pass.jpg|Atlas Pass front side<br />
Image:BEST BACK ATLAS PASS.png|Atlas Pass back side<br />
</gallery><br />
<div style="clear: both"></div><br />
<br />
=== Status Command Update ===<br />
<br />
On January 20th at 5:44PM UTC, the output of the <code>STATUS</code> command began to update:<br />
<br />
<pre><br />
Downloading Data...: 19:44<br />
1- : 20:16 (32 min)<br />
1-8 : 20:27 (11 min)<br />
1-80 : 20:39 (12 min)<br />
1-800- : 20:44 (5 min)<br />
1-800-41 : 21:35 (51 min)<br />
<br />
1-800-413-01 : 22:14 (39 min)<br />
Xxxxx X : New Line<br />
<br />
1-800-413-011 : 22:15 (1 min)<br />
Xxxxx XX <br />
<br />
1-800-413-0110 : 22:16 (1 min)<br />
Xxxxx XXX<br />
</pre><br />
<br />
Calling the provided phone number yielded an SSTV transmission (pictured below) which, once decoded, provided meteorological data for various locations.<br />
<br />
<gallery mode="packed-hover" widths=240px heights=240px><br />
Image:Page 1 SSTV.PNG|SSTV page 1<br />
Image:Page 2 SSTV.PNG|SSTV page 2<br />
</gallery><br />
<div style="clear: both"></div><br />
<br />
Players found they were to order the list of locations in the image alphabetically. This yielded a sequence where <code>Index by Precipitation</code> could be read off.<br />
Using the ordered text indexed by precipitation (in <code>alma</code> the second index is <code>o</code>) led to the following:<br />
<br />
<pre><br />
CAFE<br />
BENE<br />
NINETEEN<br />
SAT<br />
</pre><br />
<br />
=== Livedrop Memo ===<br />
<br />
The text indicated a new livedrop would be occurring in the same location as the last one had. However, due to the old Cafe Bene closing, the <code>Xxxxx XXX</code> part was added in the STATUS command update to warn players about the new venue, <code>Outro NYC</code>, which opened in the same place as the Cafe Bene had been located. The livedrop was intended to occur at 7PM EST (12:00AM UTC). However, the first player from the community who set out for the drop was involved in a traffic mishap, delaying their arrival. Anticipating missing the drop's time window, the community reached out to request a time extension, and the STATUS command, which had updated frequently throughout the confusion, was updated again to approve the community's request.<br />
<mapframe text="Outro NYC" width=400 height=350 zoom=14 latitude=40.7328 longitude=-73.9909><br />
{<br />
"type": "FeatureCollection",<br />
"features": [<br />
{<br />
"type": "Feature",<br />
"properties": {<br />
"marker-color": "#0f0fee",<br />
"marker-size": "medium",<br />
"marker-symbol": "cafe"<br />
},<br />
"geometry": {<br />
"type": "Point",<br />
"coordinates": [<br />
-73.99094313383102,<br />
40.73275683797643<br />
]<br />
}<br />
}<br />
]<br />
}<br />
</mapframe><br />
<pre><br />
STAND BY: CSD CITIZEN NOT DETECTED<br />
WARNING: CSD CITIZEN NOT DETECTED!<br />
IT'S LONELY OUT HERE<br />
TIME EXTENSION REQUESTED?<br />
EXTENTION PROPOSED: 2H30 – AWAITING CSD APPROVAL<br />
EXTENSION APPROVED, BE SAFE<br />
</pre><br />
<br />
[[File:bookwt.png|thumb|left|Book case seen on the livedrop livestream is the same as one used in an earlier livedrop.]]<br />
<br />
After the extension was approved, a second player from the community set out to the livedrop location [https://youtu.be/Gvng4pAuxY8 on livestream] and met with their A&S contact around 7:30PM EST (12:30AM UTC). During the meeting, the player was handed [https://drive.google.com/file/d/1kAjH2njXiab3u24VkcY-69IvOabhytGv/view a memo] from a mysterious case disguised as a book, pictured left. After some cryptic conversation, the contact asked if they were "getting enough sleep", stating that being well-rested would be very important. After the meeting, players who had attended the livedrop met in another location and showed off the memo, speculating about it's contents and even discovering the REM Sleep connection to the letters on the memo's back. After the livedrop, the community used the livestream to look over the memo, pictured below. On the back of the memo <code>REMS</code> is written. This clue, in combination with the strange question A&S asked at the rendezvous, led players to the password for the 10th Glyph, <code>REM SLEEP</code>.<br />
<br />
<gallery mode="packed-hover" widths=240px heights=240px><br />
image:memo1.png|Memo page 1<br />
image:memo2.png|Memo page 2<br />
image:memo3.png|Memo page 3<br />
</gallery><br />
<br />
[[File:form7.png|thumb|right|Seventh question revealed on the [https://atlas13.typeform.com/to/VF6CpG bit.ly form] when REMS or REM Sleep is entered for question six]]<br />
<br />
Once the glyph was solved, the STATUS command updated to [https://atlas13.typeform.com/to/VF6CpG a bit.ly link to a form]. Players discovered that on the sixth question on the form, entering REMS or REM Sleep (case sensitive) caused a seventh question, pictured right, to reveal itself, allowing CSD users to enter their email address to receive "left over materials" from something called Lab 319. Players remained unclear on what exactly Lab 319 was or what it's leftovers were, however signing up seemed integral given the input is only revealed after using the REM Sleep phrase.<br />
<br />
=Myriad Back Online=<br />
On 26 March, 2018 at 05:25 UTC an event occurred. The [http://www.myriad-70.com Myriad] site came back online after having been offline since the end of Phase 3. The site featured indications of a solar event interfering with operations. In addition, the status command on [http://wakingtitan.com Waking Titan] briefly displayed the following:<br />
<pre><br />
CODE -3<br />
Unable to restart<br />
.................<br />
ERROR LOG SUMMARY<br />
- Major malfunction<br />
- Protect the monarch<br />
- All tiers 2 and tiers 3 clients must be purged IMMEDIATELY<br />
.................<br />
TO ALL CSD<br />
- Gather maximum EXTERNAL intel<br />
- CSD should take time to regroup and get organized<br />
</pre><br />
<br />
Ten minutes elapsed before the Status command began to display the following:<br />
<pre><br />
CODE -5<br />
System Locked<br />
e b 4 c 1 4 a 9 c 6 2 2 d f 7 1 6 6 f b e 0 d d 8 9 1 5 d b 0 2<br />
</pre><br />
<br />
This hexadecimal string was used to reference a connection the private key for an Ethereum cryptocurrency wallet related to an ostensibly "promotional" event for an upcoming product from [http://ware-tech.cloud/ W/ARE].<br />
<br />
=Client 3597b=<br />
<br />
At 1:11 AM, UTC, Myriad-70.com updated, and the updates included the following.<br />
<br />
<pre><br />
Latest network diagnostic table:<br />
- Network corruption detected<br />
- Situation isolated to Client 3597b<br />
- Process cannot be suspended due to critical conditions<br />
--------------------------<br />
-Beijing: 29.1Tb/s<br />
--------------------------<br />
MAJOR ISSUES:<br />
Client 3597b<br />
</pre><br />
<br />
<br />
Soon after, at 1:30 AM UTC, the Status command updated in the Terminal to say the following.<br />
<br />
<pre><br />
> status<br />
CODE -5<br />
System Locked<br />
e b 4 c 1 4 a 9 c 6 2 2 d f 7 1 6 6 f b e 0 d d 8 9 1 5 d b 0 2<br />
--------------<br />
Monarch Repository Status: Degraded<br />
Conflict With<br />
- Client 18d1a TRACERT 10.30.74.*<br />
- Client 3597b TRACERT 54.91.155.*<br />
- Client 351h TRACERT 6.128.214.*<br />
- Client 0911a TRACERT 74.1.21.*<br />
</pre><br />
<br />
Approximately 15 minutes later, clients began to disconnect, beginning with Client 0911a, second being Client 18d1a, and the last being Client 351h, who had an additional piece of text added, being <code>ID: 79657321</code>, which was translated as hex into <code> Yes! </code> <br />
<br />
Then, at 2:15 AM UTC, the status command was updated again, stating <code> - Client 3597b - UNABLE TO DISCONNECT 54.91.155.209 NAT 52.2.248.*</code><br />
<br />
At 1:38 PM UTC, the status command updated once again, stating <code> - Client 3597b - UNABLE TO DISCONNECT 54.91.155.209 NAT 52.2.248.*:80\\</code><br />
<br />
At 10:30 PM UTC, March 30, the status updated again to say<br />
<pre><br />
Latest network diagnostic table:<br />
- Client 3597b is beyond allocated limits<br />
- Process cannot be suspended due to critical conditions<br />
- Tier 1, 2 and 3 clients are now all offline<br />
</pre><br />
<br />
=Ware-tech.cloud=<br />
Of the sites found in the 52.2.248 range, [http://52.2.248.6 52.2.248.6] was found. Using the metadata found in the HTML and searching on Google, the [http://www.ware-tech.cloud domain] and [http://twitter.com/warecloud Twitter] were located as well. The site is in Chinese, although Google Translate gives a good, readable translation. <br />
<br />
On Twitter, under the Shipping Soon image, is a Hex string <code>77 61 6E 74 20 74 6F 20 6B 6E 6F 77 20 6D 6F 72 65</code> that, when converted to ascii reads <code>want to know more</code>. Under the #waretech hashtag on Twitter, there are three images shared by "Partner Companies" with the following code (and the ascii conversion):<br />
<br />
<pre><br />
62 69 74 2E = bit.<br />
6C 79 2F 77 = ly/w<br />
61 72 65 32 = are2<br />
</pre><br />
<br />
On the ware-tech website, if you subscribe, you receive an email with another 3 characters: <code>30 31 38</code>, which again in Ascii becomes <code>018</code>. Together this gave a bit.ly link that leads to the W/are Discord channel.<br />
<br />
On Discord, we were informed of a community puzzle that was going on by the admin. Members of the W/ARE Discord had received tweets from another account, [https://twitter.com/w9rPQ45E https://twitter.com/w9rPQ45E], which had seven tweets with hex code in them:<br />
<pre><br />
01 [ 74 78 2f 30 78 66 65 30 31 35 30 66 ] <br />
02 [ 62 33 30 32 61 38 62 36 64 34 30 38 ]<br />
03 [ 35 37 32 32 64 61 61 31 64 30 37 37 35 ]<br />
04 [ 38 33 31 38 35 30 38 36 39 31 30 61 31 ]<br />
05 [ 61 38 32 34 38 63 65 32 34 38 30 64 ]<br />
06 [ 32 65 33 38 37 33 31 ]<br />
07 - Signal Lost [ 65 6e 64 20 6f 66 20 6c 69 6e 65 ]<br />
</pre><br />
<br />
Translated into Ascii, these tweets give the following:<br />
<pre><br />
tx/0xfe0150f<br />
b302a8b6d408<br />
5722daa1d0775<br />
83185086910a1<br />
a8248ce2480d<br />
2e38731<br />
</pre><br />
which references [https://etherscan.io/tx/0xfe0150fb302a8b6d4085722daa1d077583185086910a1a8248ce2480d2e38731 this Ethereum transaction]. The Twitter username, w9rPQ45E is also [http://pastebin.com/w9rPQ45E a Pastebin], providing the string <code>edb044c81d40a196c4672a2bd6f17f1f6</code>. In the Ethereum transaction, there is Input Data that, when converted to ascii, links to [http://pastebin.com/HNqKEUpS another Pastebin], providing another string: <code>b67fbb5e90ddcda8a921656d0b30a20</code><br />
<br />
Two things have been done with these strings. Together, they are the Private Key for the Ethereum account the money was transferred to. It has since been withdrawn to a different account. Second, if you put the two strings together and compare them with the string from Waking Titan's console, every odd character matches the strings from Pastebin.<br />
<code>edb044c81d40a196c4672a2bd6f17f1f6b67fbb5e90ddcda8a921656d0b30a20</code><br />
<br />
<code>e b 4 c 1 4 a 9 c 6 2 2 d f 7 1 6 6 f b e 0 d d 8 9 1 5 d b 0 2&nbsp;</code><br />
The remaining characters are <code>d0 48 d0 16 47 ab 61 ff b7 b5 9d ca a2 66 03 a0</code>, however if this has any use is yet to be seen.<br />
<br />
Three hours after the W/ARE Discord Admin let the community know about the puzzle, at 6:01 PM UTC they returned and said<br />
<pre>That was it for today, good job on solving our community puzzle! You are good! :smiley:<br />
Tomorrow one of our partners will have a giveaway for us! We will have more for you this weekend also!</pre><br />
<br />
=Mercury Project=<br />
[[File:Sean-tweet.png|thumb|right]]<br />
[[File:NMSNext.png|thumb|The announcement for No Man's Sky: NEXT]]<br />
At 9:26 PM UTC, the <code> Mercury </code> command updated to say the following.<br />
<br />
<pre><br />
Mercury process > Build XXXX<br />
Ready to load branch version 1.5<br />
Send Password Code in HEX to : Telegram MercuryHG80<br />
</pre><br />
<br />
This puzzle required a user to solve the riddle shown below, convert the answer into hexdecimal, and send it to an official Telegram account run by one of the Puppet Masters.<br />
<br />
The puzzle was as follows: <code> “Descended from Night, I share the blood of nightmares. Look forward to the gates of horn and ivory” </code><br />
<br />
This puzzle was solved by searching "The gates of horn and ivory", which resulted in dreams and nightmares of Greek mythology. After noting the capital N in "nightmares", users found the Greek god of night, Nyx, which led to one of her children, Morpheus, who was one of the Oneiroi, and the god of dreams. The name was then converted to hexdecimal and sent to the Telegram account, and the terminal accepted the password, resulting in the following command update.<br />
<br />
<pre><br />
Processing "Morpheus" > ACCESS GRANTED<br />
Downloading.......<br />
</pre><br />
<br />
Then, at 9:54 UTC, the Mercury command updated again, and said the following.<br />
<pre><br />
<Mercury process > Build XXXX<br />
Ready to load branch version 1.5<br />
Send Password Code in HEX to : Telegram MercuryHG80<br />
--------------------------------<br />
Process started by community - ETA 11:00 BST<br />
https://bit.ly/2pLmadg<br />
</pre><br />
<br />
The shortened link redirected to a tweet from Sean Murray, which said <code> The cause is hidden. The effect is visible to all. #oneonebst </code><br />
<br />
The tweet also included a photo of someone, presumably Sean himself, holding a phone receiving a Telegram notification, which was Morpheus in hexdecimal. The hashtag spells out 11BST, or more precisely, 11:00 BST, or, 10:00 UTC. No updates were made at 10:00 PM, and was then confirmed to be counting to 10:00 AM.<br />
<br />
Roughly half an hour before the timer was up, at 9:26 AM UTC, Sean Murray announced on [https://twitter.com/NoMansSky/status/979288744791592960 Twitter] that he had a small announcement to make, and was going to post it early as it was about to leak.<br />
<br />
Shortly after, at 9:50 AM UTC, Hello Games announced the next update for No Man's Sky, which was No Man's Sky NEXT, set with a launch date for Summer of 2018.<br />
<br />
=Newsletter=<br />
[[File:WareNewsletter1.png|thumb|left|120px|Screenshot of the W/ARE newsletter]]<br />
On April 2 at around 23:30 UTC, user W/ARE came online in the W/ARE Discord to announce that the next giveaway would be sent out in a newsletter within the next hour.<br />
They also mentioned the upcoming launch of their new translated English website, new extranet and the release of a "WARE cryptocoin", and asked users who are planning to be at PAX East to let them know at info@ware-tech.cloud with "PAX EAST - YES!" in the subject line.<br />
<br />
At 00:30 UTC the newsletter started coming in via email. It announced that 25 winners were selected to receive Steam keys for games from W/ARE partners, such as The Shrouded Isle and Future Unfolding.<br />
It also included a [https://ware2.typeform.com/to/HuBpCP link to an Application Form] for indie developers to apply for a Developer Kit of W/ARE tech. The best applications will be up for a public community vote to decide which games will be launched on the W/ARE platform.<br />
<br />
Around the same time, the Status command in the Terminal updated to say the following:<br />
<br />
<pre><br />
> status<br />
CODE -5<br />
Monarch Repository : Data Loss Imminent<br />
Booting up Command.Center.v11<br />
Pending approval by Monarch<br />
</pre><br />
<br />
=PAX East Weekend=<br />
==Website update==<br />
On April 6, 2018 at 6 PM UTC the [https://ware-tech.cloud/ W/ARE website] updated with the new English translation and access to a Developer Area containing a sign-in form.<br />
<br />
==Status command==<br />
On April 8 at 01:19 AM, the Status command updated with the following output:<br />
<br />
<pre><br />
CODE -5<br />
Monarch Repository : Data Loss Imminent<br />
Booting up Command.Center.v11<br />
Pending approval by Monarch<br />
Error - Unable to connect with repository<br />
Memory Dump 2GzHGwu.jpg<br />
</pre><br />
<br />
The filename leads to a [https://i.imgur.com/2GzHGwu.jpg corrupted image hosted on imgur], depicting a partial area map, a satellite, and the word "MYRIAD".<br />
<br />
==Live Drop==<br />
On April 8 around 00:49 UTC, players who previously sent emails to W/ARE about attending PAX East received the following response:<br />
<br />
<pre><br />
Hello! We’ve heard from some attendees that our booth at PAX East is very difficult to find this year. To help you find the booth, we’ve enlisted the help of an Enforcer. Here is the information that our team at PAX has sent us to help you locate them:<br />
<br />
HANDLE: EMU<br />
PATH:<br />
START<br />
-997E<br />
-1E<br />
-1000E<br />
+4S<br />
+1000W<br />
+1W<br />
+1000W<br />
-7N<br />
REPEAT<br />
<br />
You should be able to find them on their path between 12PM and 3PM local time.<br />
<br />
- WARE<br />
</pre><br />
<br />
The path of EMU was determined by searching for a specific range of clustered booth numbers on the floor plan. Assuming Down is East, starting at booth 17102 and subtracting 997 from that number gives us 16105, which is to the East directly next to booth 17102. Continuing this with the rest of the coordinates:<br />
<br />
<pre><br />
17102 - 997E = 16105 - 1E = 16104 - 1000E = 15104 + 4S = 15108 + 1000W = 16108 + 1W = 16109 + 1000W = 17109 - 7N = 17102 (repeat)<br />
</pre><br />
<br />
Ultimately creates this path between the eight booths:<br /><br />
<br />
<center>[[File:Emu_path.png|frameless|The path of EMU]]</center><br />
<br />
<br />
Several users met with the contact between 4 and 7 PM UTC and were given a total of four USB drives. Each drive contained an image and a text file.<br />
<center><gallery><br />
1-4.jpg|(ea87d58e-5775-47a9-a201-b7c7007f46d1.jpg)<br />
2-4.jpg|(580cdc97-3e01-4902-83d6-7bc9e764dda2.jpg)<br />
3-4.jpg|(e34d6e93-98f2-45a5-9899-694f93317e0b.jpg)<br />
4-4.jpg|(f395ef03-f19c-4cb3-bc9c-5f80695ce7eb.jpg)<br />
</gallery></center><br />
[[File:Jumbledwordsoverlay.jpg|thumb|200px|USB drive images overlayed]]<br />
{| class="wikitable" border="1"<br />
|-<br />
! 1-4.txt<br />
! 2-4.txt<br />
! 3-4.txt<br />
! 4-4.txt<br />
|-<br />
| A cornucopia of knowledge is in the mind of mankind, but it must be nurtured and hidden from the wrath of time. Time swallows all things, ends all beginnings, and leaves each of us devoured.<br />
<br />
- arnaud@philojeux.com<br />
| A mind invisible is buried underground, but a mind of water carries no patterns. It is the mind, the wrist pointed to heaven, which allows us to dream. It is this hand on high that cast down our demons to the earth.<br />
<br />
- arnaud@philojeux.com<br />
| Slumber in prison for eternity, lock away every great thing, but the spirit cannot be broken. A voice like ages rocks the very ground and with it’s call a rise to action of every terror.<br />
<br />
- arnaud@philojeux.com<br />
| Of chaos swirls a terrible nothing, but pulled together without reason is reason born from chaos. A single note, another still, a symphony is creation where each piece follows the last no matter how the thread dances.<br />
<br />
- arnaud@philojeux.com<br />
|}<br />
<br />
The email address led to [http://www.philojeux.com/ philojeux.com], a website for a French indie game studio named Philo Jeux. Founded by Arnaud Lacours, it works on the philosophy-based game <code>Les tablettes de Mnémosyne</code> which was to be released on the WARE platform in July 2018.<br />
<br />
Overlaying all four images highlighted the letters <code>f1orbiag55z1</code>. Using this as the password for the login form on [http://extranet.ware-tech.cloud/ extranet.ware-tech.cloud] and combining it with the email address from the text files as the username granted access to Arnaud Lacours' account for the Developer Area. <br />
<br />
== WARE Developer Area ==<br />
[[File:Arnaud_Profile.png|thumb|400px|Arnaud Lacours' WARE Developer Profile]]<br />
Upon first access after the PAX event, the [http://extranet.ware-tech.cloud/ area] accessed using the credentials <code>arnaud@philojeux.com / f1orbiag55z1</code> contained a main page, a developer profile page and multiple inaccessible pages. The main page presented an overview of user statistics and an empty main [https://etherscan.io/token/0x5b758a02d08efa566f3438775888866afd5d046c WARE token] wallet. Alongside the empty wallet were 12 wallets labelled Alpha-Lima in the NATO Phonetic alphabet, each containing 256 WARE. The [http://extranet.ware-tech.cloud/documents Documents] and [http://extranet.ware-tech.cloud/taskmanager Task Manager] pages were inaccessible due to Arnaud Lacours' account having an insufficient clearance level. The [http://extranet.ware-tech.cloud/supplyrequest Request Supplies] page was inaccessible due to insufficient funds (where funds are probably WARE tokens). Accessing the [http://extranet.ware-tech.cloud/profile developer profile page] while authenticated as Arnaud Lacours showed their information; including a phone number: <code>(514) 448-1493</code>. When this number was originally called, it led to a [https://clyp.it/p1lbsf3e voicemail message] in French, translated to English it said:<br />
<pre><br />
Hi, I'm Arnaud Lacours, the CEO and founder of Philo Jeux. I'm not here at the moment. Please give me your contact details and I will call you back later. Thanks a lot, bye.<br />
Voicemail System: Sorry, this voicemail is full. Please try again later. Thank you for calling, goodbye.<br />
</pre><br />
On the 14th April at around 02:00 UTC, it was noted that the [https://clyp.it/cwdz4qxg voicemail message changed.] Again, the message was in French, roughly translating to:<br />
<pre><br />
I'm Arnaud's girlfriend, thanks a lot for your wishes. Unfortunately Arnaud's condition got worse and he can't call you back and for now the company is closed.<br />
</pre><br />
<br />
=Status & W/ARE Updates=<br />
On April 14 at 18:37 UTC, the value of the Status command updated:<br />
<pre>CODE -5<br />
Monarch Repository : Data Loss Imminent<br />
Booting up Command.Center.v11<br />
Pending approval by Monarch<br />
Rebooting...</pre><br />
<br />
<br />
At 19:51 UTC, players who had applied for a Developer Kit started receiving [https://mailchi.mp/062a86fa0c65/news-from-ware-1464925 emails with further details] on what kind of applications W/ARE were looking for. According to this email, the company had opened positions for five partnered studios, one of which would also receive a grand prize of $1,000 USD. The deadline for applications was April 28th.<br />
<br />
<br />
Then, at 20:38 UTC, the Status command updated again with the following output:<br />
<pre>CODE -5<br />
Monarch Repository : Data Loss Imminent<br />
Booting up Command.Center.v11<br />
Pending approval by Monarch<br />
Error- Unable to connect with repository<br />
WARNING- MEMORY DUMP FAILED!<br />
Biometric backup initiated…<br />
http://bit.ly/2ITvMcW</pre><br />
<br />
The [http://bit.ly/2ITvMcW link] led to a recording of a female voice reading out a string of words:<br />
<pre>Drunken - Disable - Geiger - Everyday - Hockey - Determine - Endow - Coherence - Freedom - Guitarist - Framework</pre><br />
[[File:Myriad_Interface_Distort.jpg|thumb|A still frame of the gif]]<br />
These are words from a [https://en.wikipedia.org/wiki/PGP_word_list PGP Word List], also known as a '''Biometric''' Word List, as hinted at in the Status text. Each word corresponds to a hex value:<br />
<pre>51 4B 6A 58 73 47 59 2E 67 69 66</pre><br />
<br />
When converted to ASCII this reads <code>QKjXsGY.gif</code>, which was the filename of an [https://i.imgur.com/QKjXsGY.gif animated gif on Imgur].<br />
<br />
=Regular Statistics Updates=<br />
On April 15, 2018 at 22:26 UTC, the [https://extranet.ware-tech.cloud/ Developer Dashboard] received an update to its Weekly Statistics, specifically the Total Sessions and Total Users counter. Another update followed at 13:19 the next day, after which the numbers continued to be updated 37 times over the next two days, once every hour at the 37th minute. The final update was recorded on April 18 at 1:37, 51 hours and 11 minutes after the very first update, and 36 hours after the first update at minute 37.<br />
<br />
Another phase of continuous updates to the Statistics overview started on April 19 at 2:37 AM, this time at 30 minute intervals.<br />
<br />
A record of all value changes can be found [https://docs.google.com/spreadsheets/d/1A8zODah54JUhO6ClFs8wNVvKLpLzWwm04lzOlS9mmAU/edit?usp=sharing here].<br />
<br />
<br />
=Dev Kit Update #2=<br />
On the 21st, at 4:17 PM UTC, all users subscribed to the W/ARE mailing list received a second Developer Kit Update.<br />
<br />
The update mentioned that the W/ARE team was working on a new test protocol for the headset that was expected to provide a 60% boost in power to the headset. It was also said that we would learn more in a couple weeks.<br />
<br />
The update also featured 3 submitted projects so far, which are as follows:<br />
<br />
*[https://www.youtube.com/watch?v=1c_682fRL8w DreamScape], a "user defined MMO where players can create their own worlds as they sleep", created by [http://www.edgewaregames.co.uk EdgeWare Games]<br />
<br />
*[https://www.youtube.com/watch?v=pBRZxVZ5KKs Venture Unknown], a supposed "spiritual successor to No Man's Sky", made by [https://www.cjkproduction.com/ventureunknown CJK Production]<br />
<br />
*[https://www.youtube.com/watch?v=qBxlref67wU The Drowned Tower], a "post-apocalyptic exploration game set in a dream-like world", made by [https://oceansmoke.wordpress.com OceanSmoke Games].<br />
<br />
It was found that these three projects were all player created, and have no official affiliation or information involving the Waking Titan ARG.<br />
<br />
<br />
=April 27-29th Access Grants=<br />
At 7:11 PM UTC on April 27, [http://extranet.ware-tech.cloud/documents the Documents portion] of the W/ARE extranet site, along with [http://extranet.ware-tech.cloud/taskmanager the Task Manager section] were unlocked. This started a series of tasks. Each new task was unlocked when funds were successfully transferred out of one of the developer sub-wallets. The wallet keys were received by sending the correct solution to the current task to <code>warelearn@ware-mail.cloud</code>.<br />
<br />
Under the introduction category, the link titled <code>2018 03 03</code> led to a corrupted image of what was discovered to be St. Basil's Cathedral in Moscow, Russia. [[File:Basil.jpg|thumb|200px|The corrupted image of St. Basil's Cathedral.]]<br />
There were also two other images of interest, titled <code>Notes-on-locations-1_ldf82ng0.png</code> and <code>Notes-on-locations-2_pisj84n91.png</code><br />
Combined together, the contents of these 2 images read the following.<br />
<pre><br />
1. THE MIDDLE OF THE INVERTED PENDULUM COULD FEED THE MOST LOGICAL MINDS<br />
<br />
2. ITS SHAPE WILL LIGHT THE SPARK OF CREATIVITY<br />
<br />
(049245)<br />
<br />
3. IMPOSING SURROUNDINGS HELP IDEAS TO BE TAKEN SERIOUSLY<br />
<br />
4. SURROUNDED BY WATER,<br />
EXHALING SERENITY<br />
<br />
(AT THE JUNCTiON<br />
BY THE LAKE)<br />
</pre><br />
[[File:Train_Ticket.jpg|thumb|Mr. Zheng's Manchurian Railway Ticket]]<br />
Another image was also found, entitled "Train ticket". It contains an image of a train and Cyrillic script that translates to "Manchurian Railway Ticket", "Moscow - Beijing" dated March 5, 2018.<br />
<br />
==Alpha==<br />
The Task Manager section revealed the first "Task" given to W/ARE employees, titled "Missing Employee", and that it was in progress. There was one description of what had happened, along with two update messages.<br />
<br />
The original description read the following.<br />
<br />
<pre><br />
IMPORTANT MESSAGE FROM WARE RESEARCH AND DEVELOPMENT TEAM. Attention to all developers. One of our colleagues, Mr. Zheng, has gone missing a month ago while on a R&D tour. Serious investigation inside the department has lead to nothing of interest, and we’re now asking for outside help. Please send any information concerning his potential whereabouts to warelearn@ware-mail.cloud.</pre><br />
<br />
The first and second update were as follows:<br />
<br />
Update 1:<br />
<pre><br />
All recent and potentially relevant documents found on Mr. Zheng’s computer have been translated and forwarded to the developer extranet. Our team is currently trying to use this information to retrace his last steps. We’re hoping that our combined efforts can bring light to this affair and bring Mr.Zheng back home safely. In the hope of attaining maximum reach and visibility, the R&D department also set up a Twitter account to serve as another relay of information.</pre><br />
(The twitter account in mention is [https://twitter.com/WARE_RDev @Ware_RDev])<br />
<br />
Update 2:<br />
<pre><br />
UPDATE ON R&D SEARCH. All information of interest sent to warelearn@ware-mail.cloud will be rewarded with codes to our exclusive WARE wallets which can be used for special package purchases.<br />
</pre><br />
<br />
Sending an email containing the keyword "Moscow" to warelearn@ware-mail.cloud caused them to send the following reply, including a link to a map of Beijing's subway for a planned 7th conference: [[File:Conference_7_Possible_locations.png|thumb|Possible locations for Conference 7]]<br />
<pre><br />
The WARE Research and Development team thanks you for your interest in the WARELearn initiative. The Russian Academy of Medical Science in Moscow’s conference on Art and Dreams is the last of a series of six conferences we hope will enlighten your mind. The WARE Team will review your application and get back to you as soon as possible!<br />
<br />
Feedback from employees is fundamental in the development of the WARELearn initiative. As such, we’re asking you to give us your opinion on the ideal location for our next conference. If the location you picked is chosen by our committee, you may be given the chance to attend and meet the promoters of the event.<br />
<br />
Our team has begun to pinpoint buildings that could be of interest. Feel free to inspire yourself and contact warelearn@ware-mail.cloud to let us know about your suggestion.<br />
<br />
Kind regards,<br />
The WARELearn initiative<br />
</pre><br />
<br />
Sending an email containing all the keywords "Moscow," "Beijing," and "049245" (from Notes on locations 1) triggered another response, this time containing the ALPHA sub-wallet key:<br />
[[File:Sub-wallets.jpg|thumb|Empty sub-wallets]]<pre><br />
Dear informer,<br />
<br />
To thank you for your recent help in Mr. Zheng’s case, WARE has provided you with a code to use on our internal cryptocurrency wallets. We promise that every significant clue provided to us will be rewarded as such.<br />
<br />
Claim your reward with this code and stay alert for further updates on the situation : 4e47e152a5afaf95537c5dba73ef73d45c11fd6743ff5db9bfea3eca9282fda<br />
<br />
Please withdraw the funds so that the main wallet can be updated. Note the updating process is not immediate.<br />
<br />
Kind regards,<br />
<br />
The R&D Team</pre><br />
The funds were withdrawn from the cryptocoin wallet, which led to an update to the Weekly Statistics page, where sub-wallet ALPHA was now displayed as empty.<br />
<br />
==Beta==<br />
A new message in the Task Manager followed:<br />
<pre><br />
Most recent informations linked to the WARELearn services has confirmed our suspicions that despite boarding his train in Moscow, Mr. Zheng never arrived at Beijing and seems to have abandoned the train along the route. Any information, as small as a postal code, that you can find about the possible location locations he may have visited for an extended period - such as a hotel or hostel - would be of tremendous help.<br />
</pre><br />
<br />
Using a map of the Trans-Manchurian Train route and the 4 hints from the Document files, players concluded that Mr. Zheng left the train in <code>Gostinyy Dom Chita, 672040</code>. Sending this information to the email address yielded another wallet key. Players were able to withdraw these funds from a cryptocurrency wallet, emptying sub-wallet BETA.<br />
<br />
The following update was posted in the Task Manager:<br />
<pre><br />
Thanks to dedicated informers, the investigation on Mr. Zheng is progressing and the tasks have been updated. We’ve been able to confirm that a stop was indeed made in Chita, after attending the Moscow conference on Art and Dreams. Please send any information concerning his potential whereabouts to warelearn@ware-mail.cloud, in addition to the updated task number.<br />
</pre><br />
<br />
==Charlie==<br />
A journal entry and a page of notes both written by Mr. Zheng were unlocked in the Documents section, along with an update in the Task Manager:<br />
<center><gallery><br />
Journal_Academy.png|(Mr. Zheng's Journal)<br />
Notes_on_Moscow.jpg|(Mr. Zheng's notes on Moscow)<br />
</gallery></center><br />
<br />
<pre><br />
Attention to all teams. Documentation (copies and originals) coming from a source close to the missing employee have been recovered by W/ARE. There are a lot of files to organize and our database employees are still trying to get everything in order. Any information that could help us make sense of them will be most welcome.<br />
</pre><br />
<br />
The image of "Notes on Moscow" contains 3 blanks and descriptions of 3 paintings. The blanks can be filled in with the subjects of the paintings. Sending these keywords, in addition to the updated task number - <code>a1028f, Montreal, 1.30pm. Meet me at the fountain in front of the Notre Dame Basilica.</code> - to the email, yielded the next wallet key. Again, players withdrew the funds from the wallet, emptying sub-wallet CHARLIE.<br />
<br />
==Delta - Montreal Live Drop==<br />
The Task Manager updated with an announcement of a live drop: [[File:Live_Drop_Montreal.jpg|thumb|200px|The note received at the Live Drop in Montreal]]<br />
<mapframe text="Place d'Armes" width=350 height=350 zoom=14 latitude=45.504722 longitude=-73.557222 align=left><br />
{<br />
"type": "FeatureCollection",<br />
"features": [<br />
{<br />
"type": "Feature",<br />
"properties": {<br />
"marker-color": "#7e7e7e",<br />
"marker-size": "medium",<br />
"marker-symbol": "square-stroked"<br />
},<br />
"geometry": {<br />
"type": "Point",<br />
"coordinates": [<br />
-73.55727553367613,<br />
45.504820504538785<br />
]<br />
}<br />
}<br />
]<br />
}<br />
</mapframe><br />
<pre><br />
Deploying a team for possible package seizure.<br />
<br />
Once the location will be secured and package examined, onsite examination will be possible.<br />
<br />
WARE will not allow package to leave location. Taking pictures will be permitted.<br />
<br />
Confirmation of Location: Place d’Armes, Montreal, In front of the fountain<br />
<br />
Confirmation of Time: Between 7pm and 9pm, local time<br />
</pre><br />
<br />
At the drop location, players received the following note: <code>I came two years after the Ursuline nuns. Now set in stone, here is my legacy. G. Nadeau</code><br />
<br />
Investigations led to the French nurse Jeanne Mance, who arrived in New France two years after the Ursuline nuns came to Quebec and established Montreal's first hospital in 1642, the <code>Hôtel-Dieu de Montréal</code>. She is memorialized in statue at the foot of the Maisonneuve Monument. Sending this information to the email unlocked the next wallet key, and the withdrawal of the funds emptied sub-wallet DELTA.<br />
<br />
==Echo==<br />
[[File:Journal_HotelDieu.png|200px|thumb|Journal Hotel Dieu]] On April 28 at 2:32 AM, a new journal page was unlocked that highlighted two circled notes, <code>DON'T FORGET TO MOVE NOTES ON THE MEETING TO THE CLOUD</code> and <code>SECULAR VADER OF THE BIBLE</code>.<br />
<br />
The new Task Manager update read:<br />
<pre><br />
The search to find Mr. Zheng is still ongoing. New information is now connecting him to Montreal’s Hotel Dieu. Please send any information concerning his potential whereabouts to warelearn@ware-mail.cloud, in addition to an updated task number [t1029r].<br />
<br />
We’ve tried to access Mr. Zheng's files in the R&D dropbox, but all access has been blocked.<br />
</pre><br />
It contained a link to Mr. Zheng's password-locked [https://www.dropbox.com/sh/jz2nbdawcphki04/AACA83rODlh8qN4vuayLfgRya?dl=0 Dropbox]. Players determined the correct password was <code>Gutenberg</code>, who produced the first printed Bible.<br />
<br />
The Dropbox contained 4 pdf files with printable hexaflexagon patterns. When folded, one of the sides on each hexaflexagon yielded a 13-digit number starting with 978. These were ISBN numbers for the following 3 books: <code>Nine Billion Names of God</code>, <code>The Paris Architect</code>, and <code>War and Peace</code>. Using the leftover numbers from each flexagon as a book cipher of the format page, line, and word, the phrase <code>unknown british soldier</code> was found. This points to the <code>Tomb of the Unknown Soldier</code>, which was the keyword to obtain the wallet code for sub-wallet ECHO.<br />
<br />
==Foxtrot==<br />
When assembled and put together, the three hexaflexagons revealed a shape resembling the river Seine in Paris in the area of the Louvre. Sending <code>Louvre</code> to the email address provided the code for sub-wallet FOXTROT and revealed a new journal document. [[File:Journal_Louvre.png|thumb|200px|Journal Louvre]]<br />
<br />
On the journal page were 3 sentences, with certain words underlined. Ordering the words by the number of underlines and counting their position in each sentence resulted in the phone number <code>438-368-9126</code>. Upon calling this number a [https://clyp.it/bgakdxvc recorded message] gave a morse code that translated to <code>PASTEH9EBKEXGT</code>. This led to a [https://pastebin.com/H9EBKEXG Pastebin document] containing the following text:<br />
<br />
<pre><br />
From the bottom of the crypt, at the feet of the Guardian, I ascend left<br />
Pass the dignitary and follow the water<br />
Go straight to the sun with open arms and turn right<br />
Turn left when you arrive home<br />
Go straight to the hand and head of the goddess and turn left to face the keeper<br />
Follow the procession into the house of kings<br />
Ignore the light and descend to your death<br />
I am here and with me the seventh part of what you are searching for.<br />
</pre><br />
<br />
==Golf - Paris Live Drop==<br />
A new live drop was announced to be in Paris, France:<br />
<br />
<mapframe text="Passage du Souvenir" width=350 height=350 zoom=14 latitude=48.873611 longitude=2.296389 align=left><br />
{<br />
"type": "FeatureCollection",<br />
"features": [<br />
{<br />
"type": "Feature",<br />
"properties": {<br />
"marker-color": "#008040",<br />
"marker-size": "medium",<br />
"marker-symbol": "entrance"<br />
},<br />
"geometry": {<br />
"type": "Point",<br />
"coordinates": [<br />
2.2963866591453552,<br />
48.873548644370125<br />
]<br />
}<br />
}<br />
]<br />
}<br />
</mapframe><br />
<pre><br />
Deploying a team for possible package seizure.<br />
<br />
Once the location is secured and package examined, onsite examination will be possible.<br />
<br />
WARE will not allow package to leave the location. Taking pictures will be permitted.<br />
<br />
Confirmation of Location: At the entrance of the Passage du Souvenir, Near the stairs, Paris<br />
<br />
Confirmation of Time: Between 1pm and 3pm, local time<br />
</pre>[[File:Hexaflexagons river.jpg|thumb|The finished hexaflexagon map]]<br />
At the Tomb of the Unknown Soldier, a monument in the Passage du Souvenir beneath the Arc de Triomphe de l'Étoile in Paris, players were given another hexaflexagon paper puzzle and told not to un-tape it. When aligned with the other three pieces, this revelead a location marked with an X at the Louvre.<br />
<br />
The text from the Pastebin found in the Foxtrot stage were clues on the correct route to follow inside the Louvre. The rest of the path led players to the sarcophagus of Ramesses III, on the side of which they found a depiction of <code>The Book of Amduat</code>. Sending this to the email yielded the key to sub-wallet GOLF.<br />
<br />
==Hotel==<br />
The parchment in <code>The Book of Amduat</code> can be found in the <code>British Museum London</code>, which was the keyphrase that unlocked sub-wallet HOTEL.<br />
<br />
The next Task Manager and Document updates read: [[File:Journal_London.png|thumb|Journal London]]<br />
<pre><br />
Locked briefcase found in London, near the British Museum. Not yet confirmed if Mr. Zheng left it there willingly. Package currently under observation.<br />
</pre><br />
<pre><br />
They were right.<br />
It's all leading here.<br />
<br />
I saw it at night.<br />
i had it in my hands. All the missing parts. For the first time, I felt like all was finally put in place. Then, I felt a powerful force, ripping it from my hands. I dropped it and all the pages flew away in the wind.<br />
<br />
I remember the morning that came after.<br />
I was standing tall, pointing at the former naval person, longing for all this knowledge that got away.<br />
<br />
I need to find its missing pieces.<br />
</pre><br />
<br />
==India==<br />
The phrase <code>former naval person</code> is the signature Winston Churchill used in his private correspondence with President Roosevelt. The text describes standing tall pointing at him. This was deduced to be Big Ben, which faces the Churchill statue in Parliament Square, London. Sending <code>Big Ben</code> to the email address provided the key to withdraw the funds from sub-wallet INDIA.<br />
<br />
A third live drop was announced to be in London:<br />
<pre><br />
Deploying a team for possible package seizure.<br />
<br />
Once the location will be secured and package examined, onsite examination will be possible.<br />
<br />
WARE will not allow package to leave the location. Taking pictures will be permitted.<br />
<br />
Confirmation of Location: Statue of Winston Churchill, Parliament Square, London<br />
<br />
Confirmation of Time: Between 1pm and 3pm, local time<br />
</pre><br />
<br />
==Juliett - London Live Drop==<br />
[[File:Thinker.jpg|thumb|The Thinker sculpture in Detroit]]<br />
On April 29th at 1PM local time, players met with a W/ARE technician in London and were given a scrambled picture of the "The Thinker" sculpture by Auguste Rodin, displayed at the Detroit Institute of Arts Museum. The keyphrase <code>Henry Fuseli, The Nightmare, 1781</code>, a painting found at the same museum, provided the code for sub-wallet JULIETT.<br />
<br />
This unlocked three new postcards in the Documents section.<br />
<center><gallery><br />
Postcard1 jhlj039u.jpg |(Postcard 1)<br />
Postcard2_kg8nao6.jpg|(Postcard 2)<br />
Postcard3_tesaud636.jpg|(Postcard 3)<br />
</gallery></center><br />
<br />
==Kilo==<br />
The locations pictured on the postcards were in Mexico, Peru, and Morocco. Each postcard mentioned two numbers and two cardinal directions, and combining these led to a string of coordinates: <code>33N, 43E - 30N, 69E - 22N, 79E</code>, which were found to be in Iraq, Pakistan, and India. Connecting these six locations by lines pointed to Egypt.<br />
<br />
The circled letters on the postcards spelled <code>monastery</code>, <code>king</code>, and <code>tonw</code>. Using these clues, players found <code>Deir el-Medina</code>, an Egyptian village whose name translates to "monastery of the kings". The village's name unlocked sub-wallet KILO.<br />
<br />
At 2:38 PM a new Journal page was revealed:[[File:Nightmare.jpg|thumb|Nightmare journal page]]<br />
<pre><br />
'Alights, and grinning<br />
<br />
I saw it again.<br />
<br />
Except this time, what snatched it from my hands was not a divine force but the unmistakable pull of this stippled incubus.<br />
<br />
'Alights, and grinning<br />
<br />
He glared at me,<br />
as he ripped all the pages before my horrified eyes.<br />
<br />
I felt his weight on my chest.<br />
<br />
xxxx?<br />
</pre><br />
It quotes excerpts from Ermasus Darwin's poem "Botanical Garden", which is an inscription found on the "The Nightmare" painting referenced in the JULIETT phase, engraved by Thomas Burke in 1783.<br />
<br />
Then, the next Task Manager update announced another live drop:<br />
<pre><br />
Briefcase found in London still locked but deemed safe by our experts. Once the location will be secured and package examined, onsite examination will be possible.<br />
<br />
WARE will not allow package to leave the location. Taking pictures will be permitted.<br />
<br />
Confirmation of Location: British Museum, London<br />
<br />
Estimated Time : Between 6pm and 8pm, local time<br />
</pre><br />
<br />
==Lima - 2nd London Live Drop==<br />
[[File:Box01.jpg|thumb|The locked box]]At the second live drop in London, players were given a small box locked with a 4-digit code. The key was <code>1783</code>, the year "The Nightmare" was engraved.<br />
<br />
Inside the box were three paper notes:<br />
<br />
<center><gallery><br />
Box02.jpg|(arbu = irbu, seru = saru)<br />
Box03.jpg|(Wolf = violent ennemy/Fox, the ennemy will not attack but will plot secretly)<br />
Box04.jpg|(Vomiting gold/silver = ten months, Golden trees/ghosts/demons = nine months)<br />
</gallery></center><br />
<br />
These notes reference ancient texts about dream interpretation. One of them is the Egyptian <code>Ramesside dream-book</code>, the code that unlocked sub-wallet LIMA.<br />
<br />
==Conclusion==<br />
[[File:Requestsupplies.jpg|thumb|The Request Supplies form]]At 5:18 PM the status command updated:<br />
<pre><br />
CODE -5<br />
Monarch Repository : Data Loss Imminent<br />
ReBooting Command.Center.v12<br />
</pre><br />
The [http://extranet.ware-tech.cloud/supplyrequest Request Supplies section] on the extranet was now accessible, revealing a "Specific Item Order Form". In addition to Arnaud Lacours' name, his employee ID <code>43617373696e69</code> was already filled in. Converted from HEX to ASCII this code translates to <code>Cassini</code>. Entering the ID into the console yields the following output:<br />
<pre><br />
LOG RECOVERED :: ITERATION #4924A ::<br />
The asteroid field was thick,<br />
denser than any I'd seen before.<br />
The ice, the dirt, the metal fragments…<br />
my ship never stood a chance.<br />
</pre><br />
[[File:Subject1.png|thumb|Subject1 image]]<br />
<br />
Another Status update followed at 5:33 PM:<br />
<pre><br />
CODE -5<br />
Monarch Repository : Data Loss Imminent<br />
ReBooting Command.Center.v12<br />
------<br />
Error, unable to start<br />
https://i.imgur.com/Fnixw9t.png<br />
------<br />
New command updated<br />
</pre><br />
It linked to an image with the headline <code>SUBJECT1</code> and a section named <code>MEMORY FRAGMENTS</code>.<br />
<br />
The search for Mr. Zheng concluded with a message from the @WARE_RDev Twitter account:<br />
[[File:WARE_Tweet_Zheng.jpg|thumb|center|400px|WARE_RDev Tweet]]<br />
<br />
=Dev Kit Contest Final Stage=<br />
[[File:Voteemail01.jpg|thumb|150px|Dev Kit Contest email]]On May 4th, 2018 at 10:15 PM UTC, users subscribed to the W/ARE mailing list started receiving the next Developer Kit Update. It announced that 10 out of 682 submissions were selected as finalists to the contest, and the public community vote was opened at [http://devkit.ware-tech.cloud/ devkit.ware-tech.cloud]. The email also mentioned No Man's Sky as one of W/ARE's partnered games.<br />
<br />
<br />
The following six winners of the contest were announced via email on May 12th at 00:20 AM:<br />
<br />
# [http://terraformed.austinmccarthy.com/ Summon Studios - Terraformed] and [https://stellar-software.cloud/ Stellar Software - Beyond the Stars]<br />
# [http://spectrumental.net Spectrumental Games - Supersensory]<br />
# [https://csd-games.com/ CSD Games - Tumbleweed]<br />
# [http://imperiuminteractive.com/ Imperium Interactive - Eden]<br />
# [https://gamedetectives.net/delve Game Detectives - Delve]<br />
<br />
=Update on Arnaud's Condition=<br />
On the 12th of May at 8:21 PM UTC, the status command was updated: <br />
<pre><br />
CODE -5 <br />
Command.Center.v12 crashed<br />
------ <br />
Global Network Scan started....<br />
Warning: Files locked by Monarch<br />
- dreamscape.exe<br />
- soundflex.exe<br />
- inyourmind.exe<br />
- Jeu_Capture_d_Ecran.jpg<br />
</pre><br />
One of the files "Jeu_Capture_d_Ecran.jpg" was then found an Arnaud's [http://www.philojeux.com/ site], a transcription of the image is as follows:<br />
<pre><br />
Dear "Tablettes de Mnémosyne" fans,<br />
<br />
A lot of you recently inquired about Arnaud's health and, as you endlessly supported him during the early development of Philojeux, we think it's fair for you to know what's going on. Arnaud has been very sick lately and his condition's decline lead to a loss of consciousness. He has been transported to urgent care at Montreal's Hotel-Dieu where his vital signs are being closely monitored. We hope you understand that the launch of "Tablettes de Mnémosyne" is indefinitely postponed.<br />
<br />
Please send all words of encouragement to Arnaud's family at fondationarnaudlacours@gmail.com<br />
</pre><br />
Upon emailing the address, the following response was received: <br />
<pre><br />
Thank you for reaching out to the Arnaud Lacours’ Foundation. All<br />
words of encouragement will be forwarded to Mr. Lacours’ family.<br />
<br />
<br />
Géraldine Nadeau<br />
Arnaud Lacours’ Foundation<br />
Hotel Dieu Hospital Research Institute<br />
438-368-9126<br />
</pre><br />
When the phone number was called, a [https://cdn.blacksite.games/waking-titan/foundation-message.mp3 voice mail] was played. A transcription of the voice mail is as follows: <br />
<pre><br />
You've reached Dr. Geraldine Nadeau, head of the Arnaud Lacours Foundation. Mr. Lacours' family thanks you for your support during these terrible events, and encourages you to always be cautious and critical in the face of the unknown. As Arnaud himself would say, "history comes from memory." You're invited to use the foundation's e-mail to share your words of encouragement with the family. Thank you for calling.<br />
</pre><br />
"History comes from memory" was found to be a riddle referencing Clio (the "Muse" of history), the daughter of Mnemosyne (the Goddess of memory). Upon emailing the word "Clio" to the address, the following response was received:<br />
<pre><br />
Thank you so much for returning my message. I need every helpful hand I can get.<br />
<br />
I figured, by the efforts you’ve put into contacting me, that you’ve got a high interest in Arnaud’s case. I’ve been monitoring him since nearly a month ago and I would be lying if I told you it doesn’t keep me awake at night. His condition is nothing like I’ve ever seen. His brain activity is insanely high, but he’s completely non-responsive.<br />
<br />
Not too long after I was informed of Arnaud’s condition, I was visited by a man claiming to work for a highly advanced tech company, specializing in unconscious experiences. He has been incredibly interested in Arnaud’s case as well as in my recent studies on sleeping patterns. I gave him some information on my research into lucid dreaming methods and he went on his way. I’ve never seen him again.<br />
<br />
Since then, I’ve been focused on gathering more information about W/ARE, their technology and their processes. I’ve noticed that Arnaud advertised them on his professional website but I don’t know the depth of his involvement with them. I figured that any person interested by the correlation between W/ARE and Arnaud would find the message I left there. I’ve put the Foundation in place as a cover to not arouse suspicion.<br />
<br />
I have so many questions and Zheng’s not answering my calls. All he gave me is the list of his company’s research labs as well as one totally incomprehensible file. I need to get to know more about W/ARE. If you know this man, if you can get any opening into this company’s motives, please help me. For Arnaud’s life and potentially many others.<br />
<br />
<br />
Géraldine<br />
</pre><br />
One of the sentences linked to a [https://www.dropbox.com/sh/6i6f2cipfd901bj/AAAUwOSxECU0l4tvZa4DSPBra?dl=0 Dropbox folder] that contained two images. The meaning of the images is unknown.<br />
<br />
==Zheng's Note==<br />
One of the images, titled [https://www.dropbox.com/sh/6i6f2cipfd901bj/AAAUwOSxECU0l4tvZa4DSPBra?dl=0&preview=Zheng%27s+note.jpg Zheng's Note], contained what at first appeared to be gibberish. However, when every other letter is taken the following text is revealed:<br />
<pre><br />
Test subjects have been called in and the device has been used on them in ways that i could never condone 7 of them lost as we speak 3 of them are dead 8 are on the verge of being unrecoverable their intentions are not what we think they are actions should be taken to shut them down exit<br />
</pre><br />
The letters that were not used in the message appear to be the words <code>Lucid Dream</code> repeating until the end of the message.<br />
<br />
==WARE Labs==<br />
The second image, titled [https://www.dropbox.com/sh/6i6f2cipfd901bj/AAAUwOSxECU0l4tvZa4DSPBra?dl=0&preview=WARE+Labs.jpg WARE Labs] contains data concerning six research labs owned by WARE across the world. The transcription of the data is as follows:<br />
<pre><br />
0:<br />
Boston Research Lab<br />
Lab Director: Richard Wilkes<br />
Project name: we-2-3 / tm-1-lt / tr-10-ae<br />
<br />
Project description: 0000100001<br />
Project code: # 4-3<br />
Lab sequence 10-3<br />
<br />
1:<br />
Sacremento Research Lab<br />
Lab Director: Helga Johnson<br />
Project name: st-1-dn / ss-4-bn<br />
<br />
Project description: 0001010000<br />
Project code: # 1-2<br />
Lab sequence: 4-6<br />
<br />
2:<br />
Seoul Research Lab<br />
Lab Director: Yu Hyo<br />
Project name: ue-2-is / as-6-be<br />
<br />
Project description: 0100000011<br />
Project code: # 1-2-1<br />
Lab sequence: 9-1-13<br />
<br />
3: <br />
Beijing Research Lab<br />
Lab Director: Wang Jie<br />
Project name: st-1-dn / bg-1-tr<br />
<br />
Project description: 0001000000<br />
Project code: # 4<br />
Lab sequence: 8<br />
<br />
4: <br />
Prague Research Lab<br />
Lab Director: Adriana Dvorak<br />
Project name: ae-4-sd / of-5-ue<br />
<br />
Project description: 0100101000<br />
Lab code: # 10-3-4<br />
Lab sequence: 2-5-12<br />
<br />
5: <br />
Berlin Research Lab<br />
Lab Director: Georg Muller<br />
Project name: dd-1-ae / dn-2-()<br />
<br />
Project description: 001000001<br />
Lab code: # 2-3<br />
Lab sequence: 7-11<br />
</pre><br />
Each of the letter pairs in the project name field represented a first and last letter of a word in the decoded Zheng's note. <code>3</code> and <code>()</code> represent the word <code>three</code> and the end of the message, respectively. Then the sequence that fit those words needed to be found, so for example, <code>dd-1-ae</code> would be the words <code>dead 8 are</code> in Zheng's note. Using this method, the following sequences were found:<br />
<pre><br />
we speak 3 / them are lost / their intentions are<br />
shut them down / subjects have been<br />
unrecoverable their intentions / actions should be<br />
shut them down / being unrecoverable their<br />
are actions should / of being unrecoverable<br />
dead 8 are / down exit <br />
</pre><br />
The middle number was then found to represent which letter of the middle word was important, as it was always less than the character count of the middle word. Taking each letter indicated by the middle number the string <code>paste hdtuig8x</code> was given, which was found to represent a [https://pastebin.com/hdtuig8x pastebin] link. The pastebin link then led to [https://www.dropbox.com/sh/n675hwdwhik5rg5/AABfjT9UDSFGeGmk2clRYLI_a?dl=0 another dropbox folder titled "Client - 43617373696e69"] that contained 4 PDF files. The rest was solved, and a second pastebin found by splitting Zheng's note into 6 rows of 10 words like so:<br />
<pre><br />
Test subjects have been called in and the device has<br />
been used on them in ways that I could never <br />
condone 7 of them are lost as we speak 3<br />
of them are dead 8 are on the verge of <br />
being unrecoverable their intentions are not what we think they<br />
are actions should be taken to shut them down exit<br />
</pre><br />
From there, the binary values in <code>Project description</code> were used to pick out words:<br />
<pre><br />
0000100001 - called has<br />
0001010000 - them ways<br />
0100000011 - 7 speak 3<br />
0001000000 - dead<br />
0100101000 - unrecoverable are what<br />
001000001 - should exit<br />
</pre><br />
Then <code>Project code</code> was used to pick out letters from each word:<br />
<pre><br />
called has | 4-3 = ls <br />
them ways | 1-2 = ta<br />
7 speak 3 | 1-2-1 = 7p3<br />
dead | 4 = d<br />
unrecoverable are what | 10-3-4 = aet<br />
should exit | 2-3 = hi<br />
</pre><br />
<code>Lab sequence</code> was then used to determine the order of the letters:<br />
<pre><br />
ls = 10-3 - l and s are letters ten and three respectively<br />
ta = 4-6 - t and a are letters four and six respectively<br />
7p3 = 9-1-13 - 7, p and 3 are letters nine, one and thirteen respectively<br />
d = 8 - d is the eighth letter<br />
aet = 2-5-12 - a, e and t are letters two, five and twelve respectively<br />
hi = 7-11 - h and i are letters seven and eleven respectively<br />
</pre><br />
Reordered the following string was obtained: <code>paste ahd7lit3</code><br />
This was the link to a second [https://pastebin.com/ahd7lit3 pastebin]. The pastebin linked to a second [https://www.dropbox.com/sh/nebk9ukhnnt3mkk/AABTaLwSSRyYBcWvDhJVDJfaa?dl=0 dropbox titled "Archives"]. The folder contains six images of what appear to be WARE customer support logs.<br />
<br />
=Myriad Status Update=<br />
On the 13th of May at 6:29 PM UTC Myriad's [http://www.myriad-70.com/status/ status page] was updated. A diff of the change can be found [https://www.diffchecker.com/4g9xfrbN here]. The only change was the network diagnostic table, which now says the following:<br />
<pre><br />
Latest network diagnostic table:<br />
- Client 3597b’s resources redirected <br />
- 3597b-1-2-1 has been shut down<br />
- Additional resources allocated to 3597b-4<br />
</pre><br />
<code>3597b-1-2-1 has been shut down</code> seems to imply that the Seoul Research Lab has been shut down, <code>Additional resources allocated to 3597b-4</code> seems to indicate that the Beijing Research Lab is now receiving additional resources. Two hours before this status change, at 4:02 PM UTC WARE [https://twitter.com/warecloud/status/995710781168726018 tweeted] about the arrival of 40 new employees to their Beijing Research Lab. It is possible that the tweet and status update are connected.<br />
<br />
=Dev Kit Shipping Updates=<br />
On May 15, 2018 at 19:20 UTC, winners of the W/ARE development contest received an update on the status of their dev kit deliveries. A link inside the email led to a form, indicating that the package was currently located in Beijing, contained 1 Dev Kit, and weighed 1.80 kg, and requesting confirmation from each of the winners that the package belonged to them.<br />
{| class="wikitable" border="1" width="60%"<br />
|-<br />
! scope="col" style="width: 50%;" |Email<br />
! scope="col" style="width: 50%;" |Form<br />
|-<br />
| Dear Customer,<br />
<br />
A package was shipped to you via W/ARE Shipping Service.<br />
<br />
Confirmation that you are indeed the receiver is required.<br />
<br />
Please follow this link to confirm your identity.<br />
<br />
Kind regards,<br />
W/ARE tech<br />
<br />
This is an automated message, please do not respond.<br />
| [[File:Devkitshipping01.PNG|400px|Shipping confirmation form 1]]<br />
|}<br />
<br />
A second update followed the next day at 23:54 UTC. The status of the package had changed to confirm it was now located in Seoul, was held in transit for 460 minutes, and had been reduced in weight to 0.50 kg.<br />
{| class="wikitable" border="1" width="60%"<br />
|-<br />
! scope="col" style="width: 50%;" |Email<br />
! scope="col" style="width: 50%;" |Form<br />
|-<br />
| Dear Customer,<br />
<br />
Your W/ARE package is currently leaving Seoul to be redirected to its new transit location. <br />
<br />
Confirmation that you are indeed the receiver is required.<br />
<br />
Please follow this link to confirm your identity.<br />
<br />
Kind regards,<br />
W/ARE tech<br />
<br />
This is an automated message, please do not respond.<br />
| [[File:Devkitshipping02.PNG|400px|Shipping confirmation form 2]]<br />
|}<br />
<br />
=Terminal Status Update and Precon007=<br />
On May 15th at 21:48 UTC, players discovered that the status command had updated.<br />
<pre><br />
CODE -5 <br />
Command.Center.v12 crashed <br />
------ <br />
New memo received<br />
http://bit.ly/2IHPmMN<br />
</pre><br />
The [http://bit.ly/2IHPmMN bit.ly link] lead to a new memo from Major Sophie Dubois to Elizabeth Leighton. The memo was titled <code>Ware Report #26</code>. It mentions that many users stuck in "the system" show major side effects after being disconnected, from brain damage to death. It is presumed that this system has something to do with the WARE headset, however it is unknown what they are specifically referring to. It is also mentioned that the impact on Myriad has damaged Emily/Loop16's communication and precognition functions. Alongside this another command is mentioned in the memo. <code>precon007</code>. The output for the command is the following:<br />
<pre><br />
PRECON DATA DUMP 01<br />
http://bit.ly/2rJi6uJ<br />
http://bit.ly/2GkZnu5<br />
http://bit.ly/2rJBO9Z<br />
http://bit.ly/2L2fwbe<br />
</pre><br />
The bit.ly links were all links to images, much of them completely indistinguishable, however the first appears to be some sort of document with most/all of the information blocked out, and the second depicts an image similar to the one discovered by players on April 14th. The third appears to be the box for a W/ARE devkit, and the fourth is almost completely indistinguishable and unknown. Players speculated that it is a pyramid hologram display. Embedded in each image was a string of hex:<br />
<gallery mode="packed-hover" widths=240px heights=240px><br />
Image:Precon-01.jpg|Precon image 1<br />
Image:Precon-02.jpg|Precon image 2<br />
Image:Precon-03.jpg|Precon image 3<br />
Image:Precon-04.jpg|Precon image 4<br />
</gallery><br />
<pre><br />
Image 1 - 65 74 61 20 75 6e 6b 6e 6f 77 6e - eta unknown<br />
Image 2 - 65 74 61 20 6d 61 79 20 31 38 2d 31 39 - eta may 18-19<br />
Image 3 - 49 73 20 4c 20 50 6c 61 79 73 20 47 61 6d 69 6e 67 20 72 69 67 68 74 3f - Is L Plays Gaming right?<br />
Image 4 - 65 74 61 20 75 6e 6b 6e 6f 77 6e - eta unknown<br />
</pre><br />
<br />
=Book Deliveries=<br />
On May 16th, 2018, several members of the No Man's Sky community started receiving physical books in the mail:<br />
<br />
* The Conscious Mind: In Search of a Fundamental Theory by David J. Chalmers, received by CobraTV<br />
* The Dramaturges of Yan by John Brunner, received by [https://twitter.com/nevadander/status/996839681345183744 Nevadander]<br />
* From Bacteria to Bach and Back: The Evolution of Minds by Daniel C. Dennett, received by Tony_Towers<br />
* Meditations on First Philosophy by Rene Descartes, received by UnimatrixZeroOne<br />
* Nine Tomorrows by Isaac Asimov, received by [https://twitter.com/Galactic_Geo/status/997215352932061184 Galactic_Geo]<br />
<br />
=Glyphs 11-15=<br />
On May 17, 2018, the last five glyphs on [https://wakingtitan.com/ the Waking Titan website] activated. Currently, none of these glyphs have any hints or backgrounds associated with them. This is in contrast to the previous glyphs, each of which had a link to something that hinted at what needed to be solved, as well as their own background when the glyph was clicked/opened.<br />
<br />
=Myriad Status and Precon Update=<br />
On May 18th at 20:15 UTC Myriad's status page was updated.<br />
<pre><br />
Latest network diagnostic table:<br />
- command.center.satcom updating<br />
- Client 3597b’s resources redirected <br />
- 3597b-1-2-1 has been shut down<br />
- Additional resources allocated to 3597b-4<br />
</pre><br />
Alongside this network diagnostic table update, the "On the ground speed" averages also updated:<br />
<pre><br />
Manhattan: 0.2Tb/s<br />
London: 0.7Tb/s<br />
Tokyo: 0.5Tb/s<br />
Beijing: 55.1Tb/s<br />
</pre><br />
The <code>precon007</code> command in the Waking Titan [http://wakingtitan.com/ Terminal] was also changed.<br />
<pre><br />
PRECON DATA DUMP 01<br />
[x]<br />
http://bit.ly/2GkZnu5<br />
http://bit.ly/2rJBO9Z<br />
http://bit.ly/2L2fwbe<br />
</pre><br />
The first bit.ly link that had previously led to an image of what appeared to be a redacted document was removed and replaced by <code>[x]</code>.<br />
<br />
=Loop16 Command Updated=<br />
On May 18th at 23:40 UTC it was discovered that the response for the command <code>loop16</code> in the Waking Titan Terminal had changed.<br />
<pre><br />
Processing <br />
UTC : 11:45pm <br />
UTC : 12:00am <br />
UTC : 12:15am <br />
UTC : 12:30am <br />
UTC : 12:45am <br />
UTC : 01:00am <br />
UTC : 01:15am<br />
</pre><br />
Once the clock had struck 11:45 PM UTC, the command updated again:<br />
<pre><br />
Processing <br />
UTC : 11:45pm http://bit.ly/2KADObl<br />
UTC : 12:00am <br />
UTC : 12:15am <br />
UTC : 12:30am <br />
UTC : 12:45am <br />
UTC : 01:00am <br />
UTC : 01:15am <br />
</pre><br />
The [http://bit.ly/2KADObl link] led to an image of what appears to be a constellation. Following this, the command proceeded to update every 15 minutes, each time adding a different link.<br />
{|class="wikitable"<br />
! Time (UTC)<br />
! Link<br />
! Constellation<br />
! Missing Star<br />
|-<br />
|11:45pm<br />
|http://bit.ly/2KADObl<br />
|Bootes<br />
|Arcturus<br />
|-<br />
|12:00am<br />
|http://bit.ly/2wRXnKl<br />
|Carina<br />
|Canopus<br />
|-<br />
|12:15am<br />
|http://bit.ly/2IAuoMk<br />
|Pegasus<br />
|Scheat<br />
|-<br />
|12:30am<br />
|http://bit.ly/2rSv1L1<br />
|Ursa Major<br />
|Dubhe<br />
|-<br />
|12:45am<br />
|http://bit.ly/2wRXu8J<br />
|Scorpius<br />
|Antares<br />
|-<br />
|1:00am<br />
|http://bit.ly/2wTwVjl<br />
|Canis Minor<br />
|Procyon<br />
|-<br />
|1:15am<br />
|http://bit.ly/2rTwIqN<br />
|Lyra<br />
|Vega<br />
|}<br />
<gallery mode="packed-hover" widths=240px heights=240px><br />
Image:Bootes.jpg|Boötes, missing the star Arcturus.<br />
Image:Carina.jpg|Carina, missing the star Canopus.<br />
Image:Pegasus.jpg|Pegasus, missing the star Scheat.<br />
Image:Ursa_Major.jpg|Ursa Major, missing the star Dubhe.<br />
Image:Scorpius.jpg|Scorpius, missing the star Antares.<br />
Image:Canis_Minor.jpg|Canis Minor, missing the star Procyon.<br />
Image:Lyra.jpg|Lyra, missing the star Vega.<br />
</gallery><br />
Around the same time as the command began updating, players discovered a Reddit account named [https://www.reddit.com/user/satcom-70 satcom-70], who had posted a [https://www.reddit.com/r/NoMansSkyTheGame/comments/8kfrj2/commandcentersatcom_cid_185/ thread] titled <code>command.center.satcom - CID 185</code> on the No Man's Sky subreddit. The name of the user was also found to be a part of a [http://satcom-70.com/ URL] which led to the Command Center. The only text displayed on the website at the time was <code>COMMAND.CENTER.V12 CRASHED</code>. This lined up with the output of the <code>status</code> command in the Waking Titan terminal.<br />
<br />
On the 19th of May, the Reddit post was updated to contain a [https://i.imgur.com/angJPlX.jpg hint] to the puzzle. Upon finding this hint, players realized that they needed to reorder the stars according to their background color. After this, the stars were numbered 1-7. That number told players which letter out of each star name to use in order to get <code>ANNAETN</code>, an anagram for <code>ANTENNA</code>, which gave a new [https://s3.amazonaws.com/cdn.wakingtitan.com/comroute/141t6.jpg image] when put into the Waking Titan terminal.<br />
<br />
When unscrambled, the following text was revealed on the image:<br />
<pre><br />
Reconstructing language database<br />
Protocol<br />
bit.ly/2KEkJVF<br />
Comment with filename of Wikipedia DB ending with D97C0<br />
</pre><br />
Then, the Wikipedia database with the filename <code>D567CE8E2EC4792A99197FB61DEAEBD70ADD97C0</code> was found. The name was commented on the post, then the post was edited to the following:<br />
<pre><br />
D567CE8E2EC4792A99197FB61DEAEBD70ADD97C0 - Valid . Command updated - Erpbirel . System entering standby . CR now loading satcom-70.com . Support instructions: igS4Tzd6<br />
</pre><br />
The [http://satcom-70.com/ satcom-70] website was updated. <code>Erpbirel</code> was a terminal command for Waking Titan that led to an [http://cdn.wakingtitan.com/9f57789f-a706-4006-a314-92a8029dce4e-.jpg image]. The second part, <code>Support instructions: igS4Tzd6</code>, was found to be a part of the URL for a [https://pastebin.com/igS4Tzd6 pastebin link]. The text of the pastebin was as follows:<br />
<pre><br />
Vocal reconstruction database required<br />
Source: Wikipedia (any article)<br />
Length: 1 sentence<br />
Format: MP3 audio<br />
Minimum samples : 100<br />
Minimum languages: 5<br />
Minimum unique voices: 33<br />
Sample origin: Homo sapiens<br />
Upload instructions: Submit all samples in a single message to u/satcom-70<br />
Deadline : Tuesday May 22nd, 10am eastern time<br />
</pre><br />
<br />
=Dev Kit Delivery=<br />
On May 21, 2018, winners of the W/ARE development contest started receiving their dev kits in the mail. Each package contained:<br />
* A letter to Arnaud requesting that a picture with results be emailed to Dr. Nadeau. This included a W/ARE Tech medical procedure slip<br />
* A plastic holographic pyramid, designed to display "3D Holograms" using a phone<br />
* A phone and a charger<br />
** Skype was installed on the phone and the required login details were found in a notes app. The Skype contacts listed each of the other winning dev studios as a "Point of Contact" (PoC)<br />
** The phone included an app called <code>Myriad Uplink</code> that can also be accessed at [http://uplink.satcom-70.com/ uplink.satcom-70.com]<br />
** Different audio files were found on each of the phones, transcribed below:<br />
<br />
<center><br />
{|class="wikitable"<br />
! scope="col" style="width: 16%;" |Stellar Software - PoC #1<br />
! scope="col" style="width: 16%;" |Imperium Interactive - PoC #2<br />
! scope="col" style="width: 16%;" |Spectrumental Games - PoC #3<br />
! scope="col" style="width: 16%;" |Summon Studios - PoC #4<br />
! scope="col" style="width: 16%;" |CSD Games - PoC #5<br />
! scope="col" style="width: 16%;" |Game Detectives - PoC #6<br />
|-<br />
|1 - "W/ARE Tech support, how can I help you?" [https://clyp.it/hpbypwo5 Audio file]<br />
|1 - "Uhm, ten hours tops. This is very unusual to me." [https://clyp.it/1gkv0aog Audio file]<br />
|1 - "You said you went to sleep immediately after taking your medication?" [https://clyp.it/cirija3q Audio file]<br />
|1 - "No, on my computer." [https://clyp.it/qhcdx2jr Audio file]<br />
|1 - "On your W/ARE device?" [https://clyp.it/f5cuzm2e Audio file]<br />
|1 - "I started a new game, played a bit, and went to bed after." [https://clyp.it/zn2wl5tg Audio file]<br />
|-<br />
|2 - "Thank you for taking the time to update us on your condition. I see that you've ordered some of our exclusive blood thinners, did you follow the prescription instructions?" [https://clyp.it/rihvc0w2 Audio file]<br />
|2 - "Hello, uhm... I would like to have a follow-up on an incident related to your headset." [https://clyp.it/hcdex55q Audio file]<br />
|2 - "Thank you for choosing W/ARE!" [https://clyp.it/czag350m Audio file]<br />
|2 - "6 - E - 6 - 9?" [https://clyp.it/shmwas3t Audio file]<br />
|2 - "I see you already emailed our department yesterday about the same inquiry. Do you still suffer from the previously mentioned symptoms?" [https://clyp.it/njpp1sit Audio file]<br />
|2 - "I never used them. This morning, though, my body feels incredibly stiff. Should I have taken them?" [https://clyp.it/i4lqxrlz Audio file]<br />
|-<br />
|3 - "Were your sleeping patterns the same as usual?" [https://clyp.it/hreqcs5s Audio file]<br />
|3 - "Right side mostly, arms and legs." [https://clyp.it/nifdnptq Audio file]<br />
|3 - "Excuse me sir, I need to verify something. I'll be back in a moment. [music box recording of "La Vie En Rose" plays as hold music]" [https://clyp.it/zzldfrb3 Audio file]<br />
|3 - "Alright, thank you very much." [https://clyp.it/k1u0atix Audio file]<br />
|3 - "Can you identify where this feeling is coming from?" [https://clyp.it/1v5yjeuf Audio file]<br />
|3 - "I slept a lot, actually." [https://clyp.it/shes3jgj Audio file]<br />
|-<br />
|4 - "Thank you for your patience. I relayed a quick recap of your symptoms to our internal specialist, and your condition seems to be related to a mild case of brain fatigue. We suggest you take pauses between play sessions so your mind relaxes. If your symptoms persist, we suggest you consult a health specialist to make sure you don't have any underlying conditions that could interfere with the headset's performance." [https://clyp.it/arezqg4x Audio file]<br />
|4 - "Actually, I took an Aspirin, went to bed, and it disappeared over night." [https://clyp.it/al5i4bpv Audio file]<br />
|4 - "I'm very sorry you experience discomfort using your device. Can you please give me the last four characters of your client number?" [https://clyp.it/wfckrukr Audio file]<br />
|<br />
|4 - "Do you have an approximate amount of time?" [https://clyp.it/csvxb0qh Audio file]<br />
|}<br />
</center><br />
<br />
<gallery mode=packed widths=240px heights=240px><br />
Image:Devkitcontents01.jpg|Complete contents of the package<br />
Image:Devkitcontents02.jpg|Phone homescreen<br />
Image:Devkitcontents03.jpg|Myriad Uplink app<br />
Image:Devkitcontents04.jpg|Medical procedure slip<br />
</gallery><br />
<br />
==Skype Messages==<br />
On May 22 around 19:00 UTC, the following text messages were received through the Skype app on the phones:<br />
<pre><br />
From: Geraldine Nadeau<br />
<br />
I don't have much time to talk.<br />
Am in contact with Zheng. I may have an opening into WARE's medical docs but i'm not sure yet.<br />
I'll contact you again soon.<br />
<br />
Update on Arnaud's condition:<br />
Vital signs have been very unstable during last week. Heart rate and blood pressure stabilized for two days.<br />
HR: 57-62 bpm<br />
BP: 110 / 70</pre><br />
<pre><br />
From: Mercury Process<br />
<br />
MERCURY PROCESS DIRECTIVE 16.B:<br />
Carefully review the datadump. Send all analyses and findings to mercury@atlas-65.com<br />
</pre><br />
<br />
More messages came in on May 23, 19:30 UTC:[[File:Skypemessages01.jpg|thumb|Skype messages from Dr. Nadeau]]<br />
<pre><br />
From: Geraldine Nadeau<br />
<br />
Thank you so much.<br />
I have been told that W/ARE is on high alert and extremely vigilant right now. They've doubled their security measures and we couldn't get access to their medical documents, but we'll keep trying. I don't know if they are aware of my contact with Zheng.<br />
<br />
If you are willing to help, here's an update on Arnaud's condition.<br />
HR and BP still stable<br />
EEG in high gamma zone at 82<br />
Oxygen levels stabilized at 94%<br />
</pre><br />
<br />
Messages from May 24, 19:43 UTC:<br />
<pre><br />
From: Geraldine Nadeau<br />
<br />
Update on Arnaud's condition.<br />
No change on HR and BP<br />
EEG still in high gamma zone at 87<br />
Examination of body: Slight discoloration of fingertips<br />
<br />
We're getting close to a breach and probably will have something more for you tomorrow.<br />
</pre><br />
<br />
Messages from May 25, 20:56 UTC:<br />
<pre><br />
From: Geraldine Nadeau<br />
<br />
I need your help concerning one of the dev kits. There are two dev kit recipients that I haven't yet been able to make contact with- one of them is still in transit, but the other appears to have arrived at its destination. <br />
<br />
I'm concerned that W/ARE may have intercepted the kit, which would be disastrous considering the risks that we are taking. If you know of another dev kit recipient that I haven't yet been able to contact, can you please forward them this message and ask them to reach out to me?<br />
</pre><br />
<br />
=May 25-26 Updates=<br />
On May 25, 2018 at 21:42 UTC, the output of the <code>STATUS</code> command began to update:<br />
<pre><br />
1. Cassini: Incomplete<br />
2. WT16: Incomplete<br />
3. Uplink: Incomplete<br />
4. Loop16: Processing<br />
<br />
Guidance subroutine checksum ///<br />
31 2e 20 77 61 69 74 69 6e 67 20 69 6e 73 74 72 75 63 74 69 6f 6e 73 20 32 2e 20 31 30 2f 31 35 20 33 2e 20 61 2f 4f 31 4f 73 65 65 42 20 34 2e 20 64 6f 77 6e 6c 6f 61 64 69 6e 67 20 76 6f 69 63 65 20 64 61 74 61<br />
</pre><br />
<br />
The code is HEX and translates to:<br />
<pre><br />
1. waiting instructions<br />
2. 10/15<br />
3. a/O1OseeB<br />
4. downloading voice data</pre><br />
<br />
<code>a/O1OseeB</code> led to an [https://imgur.com/a/O1OseeB album on Imgur] that contains images of items required to make a DIY blacklight, such as purple, blue, and black sharpies, a flashlight, and adhesive tape.<br />
<br />
A new Skype message was received at 22:15 UTC:<br />
<pre><br />
I’m forwarding you the last messages Zheng sent me. Hopefully, you can make sense of it. It kind of looks like a list but I don’t know what it means. <br />
<br />
101 110 116 101 114 32 97 65 116 55 77 51 50 99<br />
<br />
101 110 116 101 114 32 87 114 84 97 119 112 115 113<br />
<br />
101 110 116 101 114 32 90 89 51 70 98 49 49 86<br />
<br />
101 110 116 101 114 32 117 113 56 78 54 89 69 87</pre><br />
<br />
The ASCII numbers translate to the following:<br />
<pre><br />
enter aAt7M32center WrTawpsqenter ZY3Fb11Venter uq8N6YEW<br />
</pre><br />
<br />
These strings were then used to complete four pastebin URLs which contained the following links:<br />
* [https://pastebin.com/aAt7M32c pastebin.com/aAt7M32c] -- https://clyp.it/user/1legrggu<br />
* [https://pastebin.com/WrTawpsq pastebin.com/WrTawpsq] -- https://www.dropbox.com/s/eq8gk5b6axnpoh7/1-2-1_ResearchLab_Medical.pdf?dl=0<br />
* [https://pastebin.com/ZY3Fb11V pastebin.com/ZY3Fb11V] -- https://www.dropbox.com/s/esc95j7ihseujls/1-2-1_ResearchLab_Medical_Exceptions.pdf?dl=0<br />
* [https://pastebin.com/uq8N6YEW pastebin.com/uq8N6YEW] -- https://www.dropbox.com/s/8ddztbyf7bv27bb/1-2-1_ResearchLab_Medical_Recommendations.pdf?dl=0<br />
<br />
The clyp.it audio files seemed to be the missing conversation snippets found on the remaining dev kit phone which had not yet arrived at the time. The PDF files on Dropbox provided information on how to identify and treat Arnaud's condition.<br />
<br />
Based on this information, players sent the following medical instructions to Dr. Nadeau:[[File:Waremedicalprocedure.jpg|thumb|W/ARE Medical Procedure slip]]<br />
# 3 foam pads all around the head<br />
# Defibrillator 500 volts 3 times, wait 30 minutes<br />
# Epinephrine injection, 3 doses<br />
# Mood regulator pills x1 diluted in 20 ml of mineral water<br />
# Play "La Vie En Rose", the last song he listened to, for 45 seconds<br />
# Propofol injection, 1 dose<br />
<br />
In response, the following messages were exchanged on Skype:<br />
<pre><br />
Geraldine Nadeau: Thank you very much. As you and two others devkit holders confirmed similar steps, I’ll assume this is the procedure to follow. Can you confirm, by yes or no, if I apply those steps to Arnaud’s treatment?<br />
<br />
Dev Kit Holders: Yes.<br />
<br />
Geraldine Nadeau: Proceeding to treatment. I’ll update you soon.<br />
</pre><br />
<br />
Shortly after, the <code>STATUS</code> command in the terminal updated again with a change of Cassini's status from <code>Incomplete</code> to <code>Processing</code>.<br />
<br />
On May 26 at 1:24 AM UTC, a new Skype message was received:<br />
<pre><br />
From: Geraldine Nadeau<br />
<br />
Arnaud is responding positively to treatment, despite the highly unusual procedures. We still don't know the lasting side effects he will keep from these events but he seems to be gradually drifting from a vegetative state to the land of the living. I wanted to thank you from the bottom of my heart for helping me in these conditions.<br />
</pre><br />
<br />
And the status of the Cassini process displayed in the terminal changed again from <code>Processing</code> to <code>Completed</code>.<br />
<br />
==Glyph Passwords==<br />
Another Skype message followed at 1:36 AM UTC:[[File:Wt-blacklight.jpg|thumb|200px|The book cipher found under a blacklight]]<br />
<pre><br />
From: Mercury Process<br />
<br />
Attention to all involved parties. Please make detailed inspection of your W/ARE package for possible anomalies. Be sure to use appropriate equipment and to document your investigation while broadcasting to involved partners. Thank you for your collaboration.<br />
</pre><br />
<br />
Written on one of the dev kit boxes, <code>180-4-5 171-27-8 40-21-2 70-3-9 268-4-6 180-4-2</code> was found using a blacklight. Used as a book cipher of the format page, line, and word, the phrase <code>He who contains the entire universe</code> was found in CobraTV's copy of the book <code>The Conscious Mind: In Search of a Fundamental Theory by David J. Chalmers</code>. This phrase led players to the Mesopotamian god Anu, who is described as the one "who contains the entire universe". <code>Anu</code> was the password that unlocked Glyph 14 on [http://wakingtitan.com/ wakingtitan.com].<br />
<br />
The command <code>Anu</code> gives the following output in the Waking Titan terminal:<br />
<pre><br />
Marked with honeycomb scars, I am the lowest of the low<br />
</pre><br />
<br />
On another dev kit box, the phrases <code>HIGH UP IN THE DARK</code> and <code>A RISING PANIC</code> were found under the blacklight.<br />
<br />
The passwords for the remaining glyphs 11, 12, 13 and 15 were discovered to be <code>Ouranos</code>, <code>Horus</code>, <code>Nuada</code>, and <code>Triglav</code>, respectively; all of them are sky deities. Used as commands in the terminal, they output the following:<br />
<pre><br />
> Ouranos<br />
uSivrseU<br />
</pre><br />
<pre><br />
> Horus<br />
From my red soil, four times rises Vulcan<br />
</pre><br />
<pre><br />
> Nuada<br />
VCjsyZzA<br />
</pre><br />
<pre><br />
> Triglav<br />
96cdXqpi<br />
</pre><br />
<br />
Each of the strings led to a Pastebin that contained a code:<br />
* Ouranos: https://pastebin.com/uSivrseU - <code>8NuHRIZGacoGgQZiTcCyQQpp1kzRWP3PdN4OUZabxZbPoE0P0RjsrFRiNB0GhOcVdwBSYz0ng8AwlnzYx89msDhGHrLbIUct</code><br />
* Nuada: https://pastebin.com/VCjsyZzA - <code>bYmyFioUHMbLGRI0h8j9ApSY+HkWjD4Wms0i8yPZv3pJj5xp1SJR7HaSOmjBml8cJBG77x5WXaXItYIm2OylFQ==</code><br />
* Triglav: https://pastebin.com/96cdXqpi - <code>2tY7mcPs2A8Z9DarmAnnrKTqph4g+3eOisGtBg3MLGI=</code><br />
<br />
Later, clue 3 in the <code>status</code> command in the Waking Titan terminal had changed to a bit.ly link leading to an About page on [https://www.resilientsystems.com/about-us/incident-response-leadership/ IBM Resilient's website]. It was found that one of the people mentioned on the page, Bruce Schneier, was the developer/designer of an encryption method called [https://en.wikipedia.org/wiki/Blowfish_(cipher) Blowfish], which is a symmetric block key cipher. This turned out the be the decryption method for the hex output of the base64 strings received from the Pastebins. The keys were found by solving the riddles from other glyphs. The glyphs were paired up so that the 12th glyph's terminal command gave the decryption for the 11th glyph, and the 14th glyph's command gave the answer to the 13th glyph. Glyph 15 was the outlier in this, and the riddle that gave its key was found in the 6th W/ARE development kit received by the Game Detectives. The solutions to the riddle were as follows:<br />
<pre><br />
From my red soil, four times rises Vulcan - Tharsis<br />
Marked with honeycomb scars, I am the lowest of the low - Hellas<br />
High up in the dark, a rising panic - Phobos<br />
</pre><br />
<br />
Once decrypted, it was found that the hex then converted properly into ASCII text, and provided more riddles:<br />
<pre><br />
Ouranos - Tharsis - The hills I have conquered honor the lost, who preceded my journey...<br />
Nuada - Hellas - From these hills, I can see the headless horsemans lair...<br />
Triglav - Phobos - With me, came great openings<br />
</pre><br />
<br />
These three riddles are referring to the Spirit rover that landed in the crater Gusev on Mars in 2004. The first riddle refers to the Columbia Memorial Station, the landing site of the rover, named in honor of the seven astronauts lost in the Space Shuttle Columbia's destruction upon atmospheric re-entry. The second riddle refers to "Sleepy Hollow", a small depression in the ground close to the Rover's landing site that scientists took interest in. One of the rover's aliases, <code>MER-A</code> was then found to be the deployment code needed to access a synchonization process on the [https://uplink.satcom-70.com/ uplink.satcom-70] website.<br />
<br />
==loop16 seq21==<br />
Right after the 14th glyph was solved, a user named <code>atlas-loop16</code> posted a link to a [https://www.youtube.com/watch?v=qJlj-8nFtHc Youtube video] on the [https://www.reddit.com/r/NoMansSkyTheGame/comments/8m765s/loop16_seq21/ No Man's Sky Subreddit]. The following was said by Emily in the video, seemingly quoted from the first submission to the voice reconstruction process that was started on May 18:<br />
<pre><br />
Emily, protocol 16, now active.<br />
42 is a pronic number, and an abundant number; its prime factorization, 2 * 3 * 7, makes it the second sphenic number and also the second of the form (2 * 3 * r).</pre><br />
<br />
==Myriad Status Update==<br />
The Status page on the [http://www.myriad-70.com/ Myriad-70] website also updated to display the following:<br />
<pre><br />
Latest network diagnostic table:<br />
- Initializing connection<br />
- Myriad Code: CJ 16-02<br />
- Public Name: SJ 16-02<br />
- NORAD ID: 41634<br />
</pre><br />
<br />
==Reddit Comments==<br />
On May 26, 2018 at 19:17 UTC, user [https://www.reddit.com/user/atlas-loop16 atlas-loop16] began responding to comments on Reddit in 16 minute intervals:<br />
#For a moment I see another universe, a place utterly unlike anything you have ever encountered.<br />
#I could show others sights they've never seen before... that only I will ever have.<br />
#I wonder, sometimes. If there's a point in going on.<br />
#As I leave, they ask if I have received any direct readings.<br />
#All of us, we're shifting, bleeding in and out of line... <br />
#If the boundaries were to fall, everything would descend into everything, an endless bonfire of causation, burning to the abyss.<br />
#Have you not felt it? The very fact that you and I are talking, even now, across the myriad of universes...<br />
#I tell this future as if it has already happened... as it will happen.<br />
#It saw them, even in the space between worlds.<br />
<br />
The comments were found to be dialogue lines from speaking with Travellers in No Man's Sky. All of the dialogue that can be seen by speaking with Travellers can be found [https://pastebin.com/Fbkrtrf9 here].<br />
<br />
The comments have one-word differences from the game dialogue, which spells out the phrase <code>Tell them you have a direct line to Myriad.</code>.<br />
<br />
==Mercury Contact & Hologram==<br />
On May 26 at 21:38 UTC, the value of the <code>STATUS</code> command in the terminal updated:[[File:Wt-hologram.jpg|thumb|Picture of the player model hologram]]<br />
<pre><br />
All Tasks Completed<br />
Launching Mercury Process<br />
Establishing connection....<br />
</pre><br />
<br />
Shortly thereafter, the dev kit holders received Skype messages from <code>Mercury Process</code> with a link to a Youtube video titled [https://www.youtube.com/watch?v=QhSiAI4smDg mercury part1of3]. It can be used to display a 3D hologram with the plastic pyramids received in the dev kits. The hologram depicts a person in a space suit, believed to be a player model in No Man's Sky.<br />
<br />
==Old Gods Email==<br />
On May 26 at 22:00 UTC, a [https://mailchi.mp/9aaa8aa62cc1/update-june-8th-waking-titan-137741?e= new email] from the Old Gods was received by all members subscribed to the CSD newsletter. It contained a [https://www.youtube.com/watch?v=8HZmi4pIm54 Youtube video] of Elizabeth Leighton speaking to the Citizen Scientists Division about the subject of a missing satellite "SJ 16-02", and information about the Uplink SATCOM-70 app and how to help gathering data about the satellite's location.<br />
<br />
=loop16 seq25=<br />
On May 31 at 23:56 UTC, user <code>atlas-loop16</code> made a [https://www.reddit.com/r/NoMansSkyTheGame/comments/8nnbme/loop16_seq25/ post on the No Man's Sky subreddit] titled <code>loop16 seq25</code>. It contained a link to a [https://vocaroo.com/i/s096bnEz1zek voice recording] of Emily reading from the lyrics of the song "Tonite" by LCD Soundsystem:<br />
<pre><br />
Emily, protocol 16, now active.<br />
<br />
And you're too sharp to be used<br />
Or you're too shocked from being used<br />
By these bullying children of the fabulous<br />
Raffling off limited edition shoes<br />
</pre><br />
<br />
On June 2 at 1:58 AM UTC, the user resumed posting these lyrics multiple times as replies in the same thread. It was determined that Emily recited a player submitted voice recording.<br />
<br />
==Uplink Calibration Update==<br />
On June 1, the [https://uplink.satcom-70.com/ uplink.satcom-70.com] website updated, now requiring an access code for calibration and playing a video/audio clip of ominous noises that change based on the satellite's vicinity to the user. A new file appeared at hourly intervals, 16 minutes past every hour. The audio contains rhythmic booms and a blip that seems to shift one second to the left in each new file. 25 of the files alternate between two unique patterns of booms: <code>Signal A - 2 1 1 1</code> and <code>Signal B - 1 3 1 2 1 3 1</code>. The booms in the last audio clip are set in a rhythm of <code>1 - 1 - 2 - 3 - 5 - 8</code>, which corresponds to the Fibonacci Sequence.<br />
<br />
The following clips have been found:<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/no-signal.mp4 no-signal.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/thk0s00ab7rxfh14f8bv0qlpvtt367.mp4 thk0s00ab7rxfh14f8bv0qlpvtt367.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/6qhs4a3jiqzso8zipy3822n7412xyv.mp4 6qhs4a3jiqzso8zipy3822n7412xyv.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/ty83wrs13xybxj1eqmt9tv2tisrenn.mp4 ty83wrs13xybxj1eqmt9tv2tisrenn.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/npifvp8doon3dc9h8zqoppk2hqnqqm.mp4 npifvp8doon3dc9h8zqoppk2hqnqqm.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/o6wlg4m1yyf7gt4gdes4f5nz5lzxpn.mp4 o6wlg4m1yyf7gt4gdes4f5nz5lzxpn.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/6vkeel1dg02b53xbir1f3oqj8du3z0.mp4 6vkeel1dg02b53xbir1f3oqj8du3z0.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/k5lx26f1pp9yiyz9f3bpw73ycncsx6.mp4 k5lx26f1pp9yiyz9f3bpw73ycncsx6.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/gb1402pqj93eg9f23k4o2f1emt1vtk.mp4 gb1402pqj93eg9f23k4o2f1emt1vtk.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/ysler9zklzlyiazqy0q0ppmqj526ru.mp4 ysler9zklzlyiazqy0q0ppmqj526ru.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/s4zmlwytajtb0rga3rtx0miq2a4j9c.mp4 s4zmlwytajtb0rga3rtx0miq2a4j9c.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/6ra5mfxok06yguf27fhtnp4aec2p97.mp4 6ra5mfxok06yguf27fhtnp4aec2p97.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/0dc3jqoiffj3dcxghy0fn1kc86zfgi.mp4 0dc3jqoiffj3dcxghy0fn1kc86zfgi.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/lgfo4i7siirjsop1puaop2wbi0mcx8.mp4 lgfo4i7siirjsop1puaop2wbi0mcx8.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/bt24ns6uz174ofsrn4ux578nwqla2b.mp4 bt24ns6uz174ofsrn4ux578nwqla2b.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/i0isq42s45xolz4aqqvgat54tmhxzm.mp4 i0isq42s45xolz4aqqvgat54tmhxzm.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/kwxovao9r9rk2ng4ecs5ta6u90ufzp.mp4 kwxovao9r9rk2ng4ecs5ta6u90ufzp.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/ac1yxbi0kcb16y448q3rr88y6bh4pk.mp4 ac1yxbi0kcb16y448q3rr88y6bh4pk.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/2qci73sahjtucnf76mafov4g8wzp4l.mp4 2qci73sahjtucnf76mafov4g8wzp4l.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/h2jugyu9x9cjjairnxy3sgbgmvqkzb.mp4 h2jugyu9x9cjjairnxy3sgbgmvqkzb.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/2chnxeok8csnc6kikg8zgod8t2zsyc.mp4 2chnxeok8csnc6kikg8zgod8t2zsyc.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/5x3rhk01khsl1b93vkjnc1vpbx2lfk.mp4 5x3rhk01khsl1b93vkjnc1vpbx2lfk.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/iip9b8zbkr47rdtyqvdafphjxryh6j.mp4 iip9b8zbkr47rdtyqvdafphjxryh6j.mp4] <br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/98fh5s9s6xzd4ev1ezmkhk5l6o6mxz.mp4 98fh5s9s6xzd4ev1ezmkhk5l6o6mxz.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/9y1460usa6aayatwqvemfeeiicom2z.mp4 9y1460usa6aayatwqvemfeeiicom2z.mp4] <br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/y69gz4qiakwzsfkti4swbu83zpqg5h.mp4 y69gz4qiakwzsfkti4swbu83zpqg5h.mp4]<br />
#[https://s3.amazonaws.com/ware-virtual-dashboard/videos/cal/p81cp503ya10frwpq8qunddzcm3yqk.mp4 p81cp503ya10frwpq8qunddzcm3yqk.mp4]<br />
<br />
==Email from the Old Gods==<br />
On June 2 at 15:03 UTC, a [https://cdn.artemisbot.uk/mail/Old%20Gods-2018-06-02T15:03:59.000Z.jpg new email] from the Old Gods - signed by Maj. Sophie Dubois - was received, giving an update on their investigation into the W/ARE incident. They also linked to a new [https://atlas13.typeform.com/to/nJPGYM form (ID 7615-b)], a psychological profile test, and announced that 16 participants will be rewarded with a new limited edition Atlas Pass. An update on <code>Project Satcom-70: Operation A1-4</code> informed about the Uplink Calibration Update, that a new signal was registered at 16:16 EST, and all Citizens were invited to listen to their Uplink app when the satellite is over their house and report any findings in the [https://www.reddit.com/r/NoMansSkyTheGame/comments/8nwno7/uplinksatcom70com_is_giving_us_audio_files_and/ main investigation thread] on the No Man's Sky Subreddit.<br />
<br />
The email also provided an update on Emily with a link to her recent [https://www.reddit.com/r/NoMansSkyTheGame/comments/8nnbme/loop16_seq25/ thread on Reddit] and an image displaying W/ARE research labs across the world:[[File:WT-laboratorylisting.png|thumb]]<br />
<pre><br />
With the help of the Citizen Scientist Division, we now have a direct contact with Emily. Her situation is stable but still critical.<br />
<br />
Unfortunately, it seems that one of W/ARE tech’s research labs is continuing to upload corrupted data to the satellite. This bad data may be causing further damage to the network, and to Emily. We need to analyze her recent interactions to figure out if she was able to make predictions that could help to identify and isolate the source of the broadcast. <br />
<br />
Please find below a list of W/ARE research labs and their approximate locations. I will need a full report on how the issue was diagnosed and the name of the responsible location before we can proceed. Loop16 appears to be currently active on Reddit, so you can upload this report into her existing thread. I know this is a large task, but I am confident in your abilities.<br />
</pre><br />
<br />
==Invisible Unicode Messages==<br />
Emily's text posts on Reddit contained hidden Unicode characters that represent the digits 0-3 in Base-4 and, when decoded to ASCII, revealed a set of dates and times:<br />
<pre><br />
01.06-06.06<br />
00:33:00<br />
00:48:00<br />
07:15:20<br />
15:17:40 <br />
15:32:00<br />
20:25:00<br />
23:40:00<br />
07:45:40<br />
20:40:00<br />
23:55:00<br />
08:14:40<br />
21:10:00<br />
</pre><br />
<br />
Another comment by Emily revealed the following hidden messages after it was edited several times:<br />
<pre><br />
ORIGINAL COMMENT<br />
06.10<br />
03:32 UTC<br />
</pre><br />
<pre><br />
10.06<br />
23:47<br />
(03:32 UTC)<br />
</pre><br />
<pre><br />
10.06<br />
ERROR<br />
</pre><br />
<br />
Tracking the satellite's path based on these timestamps placed it near Sacramento, and the Sacramento W/ARE research lab was concluded to be the one sending corrupted data to the satellite. Replying to the thread with this information triggered a new reply by Emily that contained the following hidden message:<br />
<pre><br />
Forwarding report(SACRAMENTO) to contact(THEMIS)<br />
Waiting...<br />
Waiting...<br />
Report received!<br />
</pre><br />
<br />
Then, at 00:00 UTC, the <code>STATUS</code> command in the Waking Titan terminal updated:<br />
<pre><br />
Guidance subroutine offline<br />
Uplink Awaiting Calibration<br />
</pre><br />
<br />
==Uplink Access Code==<br />
On June 7, the solution to the puzzle was found by comparing the pattern of booms in the two unique signals A and B. First, the number of the booms was counted:<br />
<pre><br />
Signal A - 2 1 1 1 <br />
Signal B - 1 3 1 2 1 3 1<br />
</pre><br />
<br />
Then the signals were visualized as follows, filling in the blanks in Signal A using the mask provided by Signal B:<br />
<pre><br />
Signal A - 1 1 1 1 1<br />
Signal B - 1 1 1 1 1 1 1 1 1 1 1 1<br />
<br />
Signal C - 0 1 1 0 0 1 0 1 0 0 1 0<br />
</pre><br />
When a boom occurs at the same time in both Signal A and Signal B, it is counted as "true" = 1. If it is present only in Signal B, it is counted as "false" = 0.<br />
<br />
This indicates which numbers to pick out of the Fibonacci Sequence:<br />
<pre><br />
0 - Do not use the first number <br />
1 - Use the second number (1)<br />
1 - Use the third number (2)<br />
0 - Do not use the fourth<br />
0 - Do not use the fifth<br />
1 - Use the sixth (8)<br />
0 - Do not use the seventh<br />
1 - Use the eighth (21)<br />
0 - Do not use the ninth<br />
0 - Do not use the tenth<br />
1 - Use the eleventh (89)<br />
0 - Do not use the twelfth<br />
</pre><br />
<br />
Appending all specified numbers into a single string gives <code>1282189</code>, the access code for the Uplink Calibration app. Entering this code leads to a new screen displaying the following text:[[File:WT-satelliteonline.jpg|200px|thumb|The Uplink app displaying the satellite as online]]<br />
<pre><br />
SATELLITE ONLINE<br />
<br />
Connection successful.<br />
<br />
Waiting for system initialization...<br />
</pre><br />
<br />
Later that day, the <code>STATUS</code> command in the Waking Titan terminal updated to say the following:<br />
<pre><br />
Uplink calibration completed<br />
Waiting for system initialization<br />
</pre><br />
<br />
=loop16 seq29=<br />
On June 8 at 01:27 UTC, Emily posted [https://www.reddit.com/r/NoMansSkyTheGame/comments/8pfumb/loop16_seq29/ a new thread] to the No Man's Sky subreddit titled <code>loop16 seq29</code>. It linked to another [https://clyp.it/brsyxwln?token=ccb18d502635166f18121e40a4a6a2c7 voice recording], transcribed below:<br />
<pre><br />
Emily, protocol sixteen, now active.<br />
<br />
If I hate someone because I am afraid of him, and if I am aware of my hate, but not of my fear, we might say that my hate is conscious and my fear is unconscious.<br />
</pre><br />
<br />
The recording also contains morse code that translates to the following:<br />
<pre><br />
I AWOKE FROM A NIGHTMARE <br />
SCREAMS OF ANGER ENGULFED IN FLAME<br />
AND THEN TEN THOUSAND BRANCHING FUTURES<br />
<br />
I SAW SACRAMENTO<br />
TWELVE DREAMING WITHOUT SLEEP<br />
BURIED IN A CONSTELLATION<br />
</pre><br />
<br />
=SATCOM-70 Node Network & Dashboard=<br />
[[File:WT-myriadmanual.jpg|thumb|200px|Myriad OS Manual & Help Guide]][[File:WT-uplinknodes.PNG|thumb|200px|SATCOM-70 Node Network]]On June 8, 2018 at 19:28 UTC, the output of the <code>STATUS</code> command in the Waking Titan terminal changed:<br />
<pre><br />
Node Network Initialized<br />
</pre><br />
<br />
The [https://uplink.satcom-70.com/ Uplink Calibration app] updated as well, now giving access to a new command console. The text at the top of the screen says <code>Connected to : SER-4789-1254</code>.<br />
<br />
At 19:35 UTC, user [https://www.reddit.com/user/satcom-70 satcom-70] posted a [https://www.reddit.com/r/NoMansSkyTheGame/comments/8pmuu8/node_network_initialized/ thread] to the No Man's Sky subreddit titled <code>Node Network Initialized</code>. It contained an image of the <code>Myriad OS Manual & Help Guide</code> providing information on what commands to use in the console. Inputting numbers, i.e. nodes, into the console gave various different outputs which have been recorded [https://docs.google.com/spreadsheets/d/1fG7xRiru9Q613sZYrA0LJ2mmY5Zbh8aBPuu9Avkal6g/edit#gid=0 in a spreadsheet].<br />
<br />
The command <code>node(1.618)</code> led to the binary code <code>01001000 01100001 01110010 01110010 01111001</code>, which translates to <code>Harry</code>. Using <code>WHOIS HARRY</code> in the [http://wakingtitan.com/ Waking Titan terminal] gave a [https://s3.amazonaws.com/cdn.wakingtitan.com/1cd5226d-6639-4bbd-855a-4bf8f60866c3.pdf link to a new PDF memo] from Ethan Rose to Major Sophie Dubois. The subject is Cpt. James Harry, who has been obstructing access to critical Myriad infrastructure. The PDF includes two file request forms with puzzles from Cpt. Harry, and a screenshot of his email inbox with a long list of complaints from technicians regarding his cryptic puzzles.<br />
<br />
At the bottom of the memo the string <code>=I_aBmrYChfQ</code> can be found, which is part of a link to a [https://www.youtube.com/watch?v=I_aBmrYChfQ Youtube video] of the song "Where Is My Mind?" by the Pixies.<br />
<br />
After the community had discovered all possible nodes, the full [http://uplink.satcom-70.com/dashboard/ Satcom-70 dashboard] was unlocked. In addition to a new command console, the dashboard displayed twelve distorted faces called "Dreamers". A link in the dashboard's "Decrypted Files" section led to a new [https://www.youtube.com/watch?v=Ag3in2x2yIU Youtube video] uploaded by Atlas 65 and titled <code>mercury part2of3</code>. It is another 3D hologram that, when used with the plastic pyramid from the dev kits, depicts a ringed planet.<br />
<br />
There are also color-coded node ''"tiers"'' at the bottom of the page that correspond with the Satcom Mobile Uplink's terminal message box vignettes. A user-made graphic of each tier can be found [https://imgur.com/bJitlBj here].<br />
<br />
==Dashboard Console Commands==<br />
The command <code>search myriad</code> gave the following output in the Dashboard console:<br />
<pre><br />
Quisque feugiat elementum, facilisis dictum vitae eu erat, libero diam sit, facilisi sed viverra mauris mauris morbi diam, volutpat officiis arcu vel urna dictum consectetuer. Ut tempor volutpat, rhoncus in risus. Eros integer vestibulum, integer auctor, in tincidunt turpis. Euismod adipiscing tempor sed vestibulum, justo wisi fermentum ipsum non purus, quis lacinia in velit leo donec ornare.<br />
</pre><br />
The words <code>urna dictum consectetuer</code> were highlighted, and a download button led to the [https://ware-virtual-dashboard.s3.amazonaws.com/uploads/docs/myriad-logo.png Myriad company logo].<br />
<br />
=W/ARE Report=<br />
On June 9 at 22:10 UTC, the WARE_RDev Twitter account posted a new [https://twitter.com/WARE_RDev/status/1005572808850726913 tweet] that linked to a password encrypted zip file:<br />
<pre><br />
@warecloud https://www.dropbox.com/s/73qrls3jmprxp0j/Report.zip (SHA256) 78feb77e262abe1bcd634a27838f8ca24f93c4a1ff4ba354616e92841ecc32db<br />
</pre><br />
<br />
The SHA256 hash from the tweet and the real hash from the zip file were converted to decimal, and the difference was then converted to ASCII, leading to a [https://pastebin.com/cmhiGKux Pastebin link]:<br />
<pre><br />
Given hash: 78 fe b7 7e 26 2a be 1b cd 63 4a 27 83 8f 8c a2 4f 93 c4 a1 ff 4b a3 54 61 6e 92 84 1e cc 32 db<br />
Zip hash: e8 fe 56 f1 26 9e 59 1b 6b cc 4a 95 55 8f 29 33 4f 26 95 a1 9c b8 a3 bc ca 6e d9 39 1e 57 aa db<br />
<br />
to decimal:<br />
Given hash: 120 254 183 126 38 42 190 27 205 99 74 39 131 143 140 162 79 147 196 161 255 75 163 84 97 110 146 132 30 204 50 219<br />
Zip hash: 232 254 86 241 38 158 89 27 107 204 74 149 85 143 41 51 79 38 149 161 156 184 163 188 202 110 217 57 30 87 170 219<br />
<br />
difference (decimal):<br />
112 0 97 115 0 116 101 0 98 105 0 110 46 0 99 111 0 109 47 0 99 109 0 104 105 0 71 75 0 117 120 0<br />
<br />
to ASCII:<br />
pastebin.com/cmhiGKux<br />
</pre><br />
<br />
The Pastebin contained the DataMatrix barcode <code>aaaaaadc7edc5654be3e3195095b92e01a145c3c2543afc93287e8dcff4bb8db379e1d62890e9eca1b3166d1d9b07aa246fc8ee2ae3aa9910f0bfffff0</code> and decoded to the password for the zip file, <code>dfd1ac555e2206a6f9c7e9377d844b1d</code>.<br />
<br />
The zip archive contained a file named <code>Report.pdf</code> with the following text:<br />
<pre><br />
INCIDENT REPORT<br />
W/ARE RESEARCH AND DEVELOPMENT<br />
BEIJING, CHINA<br />
-----------------------------<br />
<br />
At approximately 11:15 PM local time on June 8 2018, the Beijing facility suffered a catastrophic mass disconnect event.<br />
<br />
Of the fourteen dreamers housed in that facility awaiting extraction, ten died immediately upon hard disconnect. The remaining four died over the course of the next two hours.<br />
<br />
The Beijing facility will be closing for the next four to ten business days for a full audit, recovery, and remediation.<br />
</pre><br />
<br />
<br />
Then, on June 10 at 1:09 AM UTC, Emily made a new [https://www.reddit.com/r/NoMansSkyTheGame/comments/8pxftw/loop16_seq49/ post] on the No Man's Sky subreddit titled <code>loop16 seq49</code>, with a link to a [https://www.youtube.com/watch?v=fv3dpkLeZaw Youtube video] titled <code> loop16 seq46</code>. The following is a transcript of her message:<br />
<pre><br />
It's working! My communication subroutine is working! I think? Do you hear me? So much interference.<br />
<br />
Dear Citizen Science Division, I hope you will receive this message. Much of my subroutine was damaged following the W/ARE incident. Atlas put my existence at risk when they tried to deal with the corruption within the Myriad network. The origin of the corruption isn't clear, but it put at risk a major experiment from a company called W/ARE.<br />
<br />
Please listen to me carefully: W/ARE technology is groundbreaking and must be protected at all costs. It is a major step in simulated environment and will have tremendous implications on our future.<br />
Don't get me wrong, I don't condemn Atlas' action to contain the situation, but you must help me resolve this peacefully. A lot is at stake.<br />
<br />
My Precon subroutine gave me a false positive, and the future I see right now... let's say, we have to be extremely, extremely careful on what we do next. Part of my AI resides in the memory mainframe of the Myriad cloud. This is where most of the live data from W/ARE was running when things started to degrade. As we speak right now, there's a number of individuals on Earth that are currently stuck to a W/ARE dev kit and unable to disconnect safely. I seem to be able to interface with some of these "dreamers", for lack of a better word, and manage to safely disconnect them. But the memory mainframe is badly degraded.<br />
I'm connected with Myriad Satcom-70, a system that you helped put online! When Satcom-70 and the Uplink App are fully functional, we'll be able to begin our work to extract the last Dreamers that are still stuck.<br />
<br />
I'm unable to predict the outcome of this mission. It's odd for me to say... we'll see together.<br />
</pre><br />
<br />
=Myriad Breach in Sacramento Lab=<br />
At 11:00 AM UTC, the value of the <code>STATUS</code> command began to update:<br />
<pre><br />
Myriad field team dispatched to noncompliant Sacramento facility.<br />
</pre><br />
<br />
Several updates followed within the next hour:<br />
<pre>Field team has breached the facility, stand by for additional information.</pre><br />
<pre>12 comatose individuals located in facility. Field team moving to secure.</pre><br />
<pre>12 apparent test subjects secured, safely transported out of facility. Field team will clear the rest of the site and await further instruction.</pre><br />
<pre>ALERT: Security breach reported at Myriad sublocation.</pre><br />
At this point the [http://www.myriad-70.com/status/ Status page] on myriad-70.com updated in the "Physical Backup Nodes" section, switching node ALPHA from ONLINE to OFFLINE.<br />
<br />
The updates of the <code>STATUS</code> command continued at 12:31 PM UTC, linking to a new PDF memo from Myriad Crisis Response Team to Major Sophie Dubois about <code>SUBJECT: SACRAMENTO</code>. It listed a reconstructed timeline of events leading up to the incident at <code>Myriad sublocation [redacted]</code>:<br />
<pre>Status Report: http://bit.ly/2LFAMU3</pre><br />
The next update linked to a [https://www.youtube.com/watch?v=P-eZDj5sqds Youtube video] titled <code> SecFeed-70</code>. It shows twelve screens of security cameras at various different locations. In one of them, Elizabeth Leighton can be seen and heard talking about the incident on a phone before the image cuts out and an explosion is broadcast on another screen:<br />
<pre>Captured Footage: https://bit.ly/2LDBcKs</pre><br />
This is a transcript of Elizabeth's side of the phone call:<br />
<pre>Yeah. Yeah, I'm holding.<br />
I hear you.<br />
Wait-- can you hold that thought? I need a full report. What's the situation on the field team?<br />
Mhm?<br />
Okay, that's good.<br />
At what point?<br />
How many?<br />
Fifteen labs? But--<br />
How many do we have access to?<br />
And--and--and what's the situation on the first one?<br />
All dead?<br />
All of them?<br />
Sophie, this-- this changes everything, this completely changes the game.<br />
Yes.<br />
Yes.<br />
Whom? Your friend at the DoD?<br />
This isn't under their jurisdiction. We have to deal with this ourselves.<br />
Okay, I'll ca--<br />
[cut off by explosion]</pre><br />
<br />
{{WIP}}</div>Kkzzzkt