Waking Titan/Phase 5

Waking Titan - Phase 5
Completed
Phase 5 of Waking Titan lasted from 2018-06-01 to 2018-07-20.
Type	Official
Creators	Alice & Smith & Hello Games
Discovered	2017-05-28

Main Page > List of Investigations > Waking Titan > Phase 5

loop16 seq21

Right after the 14th glyph was solved, a user named atlas-loop16 posted a link to a Youtube video on the No Man's Sky Subreddit. The following was said by Emily in the video, seemingly quoted from the first submission to the voice reconstruction process that was started on May 18:

Emily, protocol 16, now active.
42 is a pronic number, and an abundant number; its prime factorization, 2 * 3 * 7, makes it the second sphenic number and also the second of the form (2 * 3 * r).

Myriad Status Update

The Status page on the Myriad-70 website also updated to display the following:

Latest network diagnostic table:
- Initializing connection
- Myriad Code: CJ 16-02
- Public Name: SJ 16-02
- NORAD ID: 41634

Reddit Comments

On May 26, 2018 at 19:17 UTC, user atlas-loop16 began responding to comments on Reddit in 16 minute intervals:

1. For a moment I see another universe, a place utterly unlike anything you have ever encountered.
2. I could show others sights they've never seen before... that only I will ever have.
3. I wonder, sometimes. If there's a point in going on.
4. As I leave, they ask if I have received any direct readings.
5. All of us, we're shifting, bleeding in and out of line... 
6. If the boundaries were to fall, everything would descend into everything, an endless bonfire of causation, burning to the abyss.
7. Have you not felt it? The very fact that you and I are talking, even now, across the myriad of universes...
8. I tell this future as if it has already happened... as it will happen.
9. It saw them, even in the space between worlds.

The comments were found to be dialogue lines from speaking with Travellers in No Man's Sky. All of the dialogue that can be seen by speaking with Travellers can be found here.

The comments have one-word differences from the game dialogue, which spells out the phrase Tell them you have a direct line to Myriad..

Mercury Contact & Hologram

On May 26 at 21:38 UTC, the value of the STATUS command in the terminal updated:

Picture of the player model hologram

All Tasks Completed
Launching Mercury Process
Establishing connection....

Shortly thereafter, the dev kit holders received Skype messages from Mercury Process with a link to a Youtube video titled mercury part1of3. It can be used to display a 3D hologram with the plastic pyramids received in the dev kits. The hologram depicts a person in a space suit, believed to be a player model in No Man's Sky.

Old Gods Email

On May 26,2018, at 22:00 UTC, a new email from Old Gods was received by all players subscribed to the CSD newsletter. It contained a YouTube video of Elizabeth Leighton speaking to the Citizen Scientists Division about the subject of a missing satellite "SJ 16-02", information about the Uplink SATCOM-70 app, and how to help gather data about the satellite's location.

loop16 seq25

On May 31 at 23:56 UTC, user atlas-loop16 made a post on the No Man's Sky subreddit titled loop16 seq25. It contained a link to a voice recording of Emily reading from the lyrics of the song "Tonite" by LCD Soundsystem:

Emily, protocol 16, now active.

And you're too sharp to be used
Or you're too shocked from being used
By these bullying children of the fabulous
Raffling off limited edition shoes

On June 2 at 01:58 UTC, the user resumed posting these lyrics multiple times as replies in the same thread. It was determined that Emily recited a player submitted voice recording.

Uplink Calibration Update

On June 1, the uplink.satcom-70.com website updated, now requiring an access code for calibration and playing a video/audio clip of ominous noises that change based on the satellite's vicinity to the user. A new file appeared at hourly intervals, 16 minutes past every hour. The audio contains rhythmic booms and a blip that seems to shift one second to the left in each new file. 25 of the files alternate between two unique patterns of booms: Signal A - 2 1 1 1 and Signal B - 1 3 1 2 1 3 1. The booms in the last audio clip are set in a rhythm of 1 - 1 - 2 - 3 - 5 - 8, which corresponds to the Fibonacci Sequence.

The following clips have been found:

1. no-signal.mp4
2. thk0s00ab7rxfh14f8bv0qlpvtt367.mp4
3. 6qhs4a3jiqzso8zipy3822n7412xyv.mp4
4. ty83wrs13xybxj1eqmt9tv2tisrenn.mp4
5. npifvp8doon3dc9h8zqoppk2hqnqqm.mp4
6. o6wlg4m1yyf7gt4gdes4f5nz5lzxpn.mp4
7. 6vkeel1dg02b53xbir1f3oqj8du3z0.mp4
8. k5lx26f1pp9yiyz9f3bpw73ycncsx6.mp4
9. gb1402pqj93eg9f23k4o2f1emt1vtk.mp4
10. ysler9zklzlyiazqy0q0ppmqj526ru.mp4
11. s4zmlwytajtb0rga3rtx0miq2a4j9c.mp4
12. 6ra5mfxok06yguf27fhtnp4aec2p97.mp4
13. 0dc3jqoiffj3dcxghy0fn1kc86zfgi.mp4
14. lgfo4i7siirjsop1puaop2wbi0mcx8.mp4
15. bt24ns6uz174ofsrn4ux578nwqla2b.mp4
16. i0isq42s45xolz4aqqvgat54tmhxzm.mp4
17. kwxovao9r9rk2ng4ecs5ta6u90ufzp.mp4
18. ac1yxbi0kcb16y448q3rr88y6bh4pk.mp4
19. 2qci73sahjtucnf76mafov4g8wzp4l.mp4
20. h2jugyu9x9cjjairnxy3sgbgmvqkzb.mp4
21. 2chnxeok8csnc6kikg8zgod8t2zsyc.mp4
22. 5x3rhk01khsl1b93vkjnc1vpbx2lfk.mp4
23. iip9b8zbkr47rdtyqvdafphjxryh6j.mp4
24. 98fh5s9s6xzd4ev1ezmkhk5l6o6mxz.mp4
25. 9y1460usa6aayatwqvemfeeiicom2z.mp4
26. y69gz4qiakwzsfkti4swbu83zpqg5h.mp4
27. p81cp503ya10frwpq8qunddzcm3yqk.mp4

Email from the Old Gods

On June 2 at 15:03 UTC, a new email from Old Gods - signed by Maj. Sophie Dubois - was received, giving an update on their investigation into the W/ARE incident. They also linked to a new form (ID 7615-b), a psychological profile test, and announced that 16 participants will be rewarded with a new limited edition Atlas Pass. An update on Project Satcom-70: Operation A1-4 informed about the Uplink Calibration Update, that a new signal was registered at 16:16 EST, and all Citizens were invited to listen to their Uplink app when the satellite is over their house and report any findings in the main investigation thread on the No Man's Sky Subreddit.

The email also provided an update on Emily with a link to her recent thread on Reddit and an image displaying W/ARE research labs across the world:

With the help of the Citizen Scientist Division, we now have a direct contact with Emily. Her situation is stable but still critical.

Unfortunately, it seems that one of W/ARE tech’s research labs is continuing to upload corrupted data to the satellite. This bad data may be causing further damage to the network, and to Emily. We need to analyze her recent interactions to figure out if she was able to make predictions that could help to identify and isolate the source of the broadcast.  

Please find below a list of W/ARE research labs and their approximate locations. I will need a full report on how the issue was diagnosed and the name of the responsible location before we can proceed. Loop16 appears to be currently active on Reddit, so you can upload this report into her existing thread. I know this is a large task, but I am confident in your abilities.

Invisible Unicode Messages

Emily's text posts on Reddit contained hidden Unicode characters that represent the digits 0-3 in Base-4 and, when decoded to ASCII, revealed a set of dates and times:

01.06-06.06
00:33:00
00:48:00
07:15:20
15:17:40 
15:32:00
20:25:00
23:40:00
07:45:40
20:40:00
23:55:00
08:14:40
21:10:00

Another comment by Emily revealed the following hidden messages after it was edited several times:

ORIGINAL COMMENT
06.10
03:32 UTC

10.06
23:47
(03:32 UTC)

10.06
ERROR

Tracking the satellite's path based on these timestamps placed it near Sacramento, and the Sacramento W/ARE research lab was concluded to be the one sending corrupted data to the satellite. Replying to the thread with this information triggered a new reply by Emily that contained the following hidden message:

Forwarding report(SACRAMENTO) to contact(THEMIS)
Waiting...
Waiting...
Report received!

Then, at 00:00 UTC, the STATUS command in the Waking Titan terminal updated:

Guidance subroutine offline
Uplink Awaiting Calibration

Uplink Access Code

On June 7th, the solution to the puzzle was found by comparing the pattern of booms in the two unique signals A and B. First, the number of the booms was counted:

Signal A - 2 1 1 1 
Signal B - 1 3 1 2 1 3 1

Then the signals were visualized as follows, filling in the blanks in Signal A using the mask provided by Signal B:

Signal A -   1 1     1   1     1
Signal B - 1 1 1 1 1 1 1 1 1 1 1 1

Signal C - 0 1 1 0 0 1 0 1 0 0 1 0

When a boom occurs at the same time in both Signal A and Signal B, it is counted as "true" = 1. If it is present only in Signal B, it is counted as "false" = 0.

This indicates which numbers to pick out of the Fibonacci Sequence:

0 - Do not use the first number 
1 - Use the second number (1)
1 - Use the third number (2)
0 - Do not use the fourth
0 - Do not use the fifth
1 - Use the sixth (8)
0 - Do not use the seventh
1 - Use the eighth (21)
0 - Do not use the ninth
0 - Do not use the tenth
1 - Use the eleventh (89)
0 - Do not use the twelfth

Appending all specified numbers into a single string gives 1282189, the access code for the Uplink Calibration app. Entering this code leads to a new screen displaying the following text:

The Uplink app displaying the satellite as online

SATELLITE ONLINE

Connection successful.

Waiting for system initialization...

Later that day, the STATUS command in the Waking Titan terminal updated to say the following:

Uplink calibration completed
Waiting for system initialization

loop16 seq29

On June 8 at 01:27 UTC, Emily posted a new thread to the No Man's Sky subreddit titled loop16 seq29. It linked to another voice recording, transcribed below:

Emily, protocol sixteen, now active.

If I hate someone because I am afraid of him, and if I am aware of my hate, but not of my fear, we might say that my hate is conscious and my fear is unconscious.

The recording also contains morse code that translates to the following:

I AWOKE FROM A NIGHTMARE 
SCREAMS OF ANGER ENGULFED IN FLAME
AND THEN TEN THOUSAND BRANCHING FUTURES

I SAW SACRAMENTO
TWELVE DREAMING WITHOUT SLEEP
BURIED IN A CONSTELLATION

SATCOM-70 Node Network & Dashboard

Myriad OS Manual & Help Guide

SATCOM-70 Node Network

On June 8, 2018 at 19:28 UTC, the output of the STATUS command in the Waking Titan terminal changed:

Node Network Initialized

The Uplink Calibration app updated as well, now giving access to a new command console. The text at the top of the screen says Connected to : SER-4789-1254.

At 19:35 UTC, user satcom-70 posted a thread to the No Man's Sky subreddit titled Node Network Initialized. It contained an image of the Myriad OS Manual & Help Guide providing information on what commands to use in the console. Inputting numbers, i.e. nodes, into the console gave various different outputs which have been recorded in a spreadsheet.

The command node(1.618) led to the binary code 01001000 01100001 01110010 01110010 01111001, which translates to Harry. Using WHOIS HARRY in the Waking Titan terminal gave a link to a new PDF memo from Ethan Rose to Major Sophie Dubois. The subject is Cpt. James Harry, who has been obstructing access to critical Myriad infrastructure. The PDF includes two file request forms with puzzles from Cpt. Harry, and a screenshot of his email inbox with a long list of complaints from technicians regarding his cryptic puzzles.

At the bottom of the memo the string =I_aBmrYChfQ can be found, which is part of a link to a Youtube video of the song "Where Is My Mind?" by the Pixies.

After the community had discovered all possible nodes, the full Satcom-70 dashboard was unlocked. In addition to a new command console, the dashboard displayed twelve distorted faces called "Dreamers". A link in the dashboard's "Decrypted Files" section led to a new Youtube video uploaded by Atlas 65 and titled mercury part2of3. It is another 3D hologram that, when used with the plastic pyramid from the dev kits, depicts a ringed planet.

There are also color-coded node "tiers" at the bottom of the page that correspond with the Satcom Mobile Uplink's terminal message box vignettes. A user-made graphic of each tier can be found here.

Dashboard Console Commands

The command search myriad gave the following output in the Dashboard console:

Quisque feugiat elementum, facilisis dictum vitae eu erat, libero diam sit, facilisi sed viverra mauris mauris morbi diam, volutpat officiis arcu vel urna dictum consectetuer. Ut tempor volutpat, rhoncus in risus. Eros integer vestibulum, integer auctor, in tincidunt turpis. Euismod adipiscing tempor sed vestibulum, justo wisi fermentum ipsum non purus, quis lacinia in velit leo donec ornare.

The words urna dictum consectetuer were highlighted, and a download button led to the Myriad company logo.

W/ARE Report

On June 9 at 22:10 UTC, the WARE_RDev Twitter account posted a new tweet that linked to a password encrypted zip file:

@warecloud https://www.dropbox.com/s/73qrls3jmprxp0j/Report.zip (SHA256) 78feb77e262abe1bcd634a27838f8ca24f93c4a1ff4ba354616e92841ecc32db

The SHA256 hash from the tweet and the real hash from the zip file were converted to decimal, and the difference was then converted to ASCII, leading to a Pastebin link:

Given hash: 78 fe b7 7e 26 2a be 1b cd 63 4a 27 83 8f 8c a2 4f 93 c4 a1 ff 4b a3 54 61 6e 92 84 1e cc 32 db
  Zip hash: e8 fe 56 f1 26 9e 59 1b 6b cc 4a 95 55 8f 29 33 4f 26 95 a1 9c b8 a3 bc ca 6e d9 39 1e 57 aa db

to decimal:
Given hash: 120 254 183 126 38 42  190 27 205 99  74 39  131 143 140 162 79 147 196 161 255 75  163 84  97  110 146 132 30 204 50  219
  Zip hash: 232 254 86  241 38 158 89  27 107 204 74 149 85  143 41  51  79 38  149 161 156 184 163 188 202 110 217 57  30 87  170 219

difference (decimal):
            112 0   97  115 0  116 101 0  98  105 0  110 46  0   99  111 0  109 47  0   99  109 0   104 105 0   71  75  0  117 120 0

to ASCII:
pastebin.com/cmhiGKux

The Pastebin contained the DataMatrix barcode aaaaaadc7edc5654be3e3195095b92e01a145c3c2543afc93287e8dcff4bb8db379e1d62890e9eca1b3166d1d9b07aa246fc8ee2ae3aa9910f0bfffff0 and decoded to the password for the zip file, dfd1ac555e2206a6f9c7e9377d844b1d.

The zip archive contained a file named Report.pdf with the following text:

INCIDENT REPORT
W/ARE RESEARCH AND DEVELOPMENT
BEIJING, CHINA
-----------------------------

At approximately 23:15 local time on June 8 2018, the Beijing facility suffered a catastrophic mass disconnect event.

Of the fourteen dreamers housed in that facility awaiting extraction, ten died immediately upon hard disconnect. The remaining four died over the course of the next two hours.

The Beijing facility will be closing for the next four to ten business days for a full audit, recovery, and remediation.

Then, on June 10 at 01:09 UTC, Emily made a new post on the No Man's Sky subreddit titled loop16 seq49, with a link to a Youtube video titled loop16 seq46. The following is a transcript of her message:

It's working! My communication subroutine is working! I think? Do you hear me? So much interference.

Dear Citizen Science Division, I hope you will receive this message. Much of my subroutine was damaged following the W/ARE incident. Atlas put my existence at risk when they tried to deal with the corruption within the Myriad network. The origin of the corruption isn't clear, but it put at risk a major experiment from a company called W/ARE.

Please listen to me carefully: W/ARE technology is groundbreaking and must be protected at all costs. It is a major step in simulated environment and will have tremendous implications on our future.
Don't get me wrong, I don't condemn Atlas' action to contain the situation, but you must help me resolve this peacefully. A lot is at stake.

My Precon subroutine gave me a false positive, and the future I see right now... let's say, we have to be extremely, extremely careful on what we do next. Part of my AI resides in the memory mainframe of the Myriad Cloud. This is where most of the live data from W/ARE was running when things started to degrade. As we speak right now, there's a number of individuals on Earth that are currently stuck to a W/ARE dev kit and unable to disconnect safely. I seem to be able to interface with some of these "dreamers", for lack of a better word, and manage to safely disconnect them. But the memory mainframe is badly degraded.
I'm connected with Myriad Satcom-70, a system that you helped put online! When Satcom-70 and the Uplink App are fully functional, we'll be able to begin our work to extract the last Dreamers that are still stuck.

I'm unable to predict the outcome of this mission. It's odd for me to say... we'll see together.

Myriad Breach in Sacramento Lab

On June 10 at 11:00 UTC, the value of the STATUS command began to update:

Myriad field team dispatched to noncompliant Sacramento facility.

Several updates followed within the next hour:

Field team has breached the facility, stand by for additional information.

12 comatose individuals located in facility. Field team moving to secure.

12 apparent test subjects secured, safely transported out of facility. Field team will clear the rest of the site and await further instruction.

ALERT: Security breach reported at Myriad sublocation.

At this point the Status page on myriad-70.com updated in the "Physical Backup Nodes" section, switching node ALPHA from ONLINE to OFFLINE.

The updates of the STATUS command continued at 12:31 PM UTC, linking to a new PDF memo from Myriad Crisis Response Team to Major Sophie Dubois about SUBJECT: SACRAMENTO. It listed a reconstructed timeline of events leading up to the incident at Myriad sublocation [redacted]:

Status Report: http://bit.ly/2LFAMU3

The next update linked to a Youtube video titled SecFeed-70. It shows twelve screens of security cameras at various different locations. In one of them, Elizabeth Leighton can be seen and heard talking about the incident on a phone before the image cuts out and an explosion is broadcast on another screen:

Captured Footage: https://bit.ly/2LDBcKs

This is a transcript of Elizabeth's side of the phone call:

Yeah. Yeah, I'm holding.
I hear you.
Wait-- can you hold that thought? I need a full report. What's the situation on the field team?
Mhm?
Okay, that's good.
At what point?
How many?
Fifteen labs? But--
How many do we have access to?
And--and--and what's the situation on the first one?
All dead?
All of them?
Sophie, this-- this changes everything, this completely changes the game.
Yes.
Yes.
Whom? Your friend at the DoD?
This isn't under their jurisdiction. We have to deal with this ourselves.
Okay, I'll ca--
[cut off by explosion]

On June 12 at 23:46 UTC, the value of the Status command in the Waking Titan terminal updated, linking to a new memo from Major Sophie Dubois to All Employees with the subject line STATE OF THE ATLAS FOUNDATION:

Status Report: https://bit.ly/2y5JaKi

In the memo, it was announced that Major Dubois would be replacing Elizabeth Leighton as the head of the Atlas Foundation, and that the 12 test subjects from the Sacramento lab were to be disconnected and integrated into the Satcom interface with W/ARE's assistance. Dubois further said that Atlas Passes for CSD designations PB-16 and PT-16 were found in Elizabeth's office, and that they would be shipped out soon. Lastly, it mentioned that Captain James Harry was no longer in charge of Satcom security.

A code at the end of the memo led to a Youtube video of Queen & David Bowie's "Under Pressure".

The Status page on myriad-70.com also updated, changing the On-The-Ground Speed Averages for Beijing from 57.2Tb/s to 47.2Tb/s and adding the line Other: 11.3Tb/s.

loop16 seq60 & Uplink Launch

On June 14, 2018 at 23:39 UTC, the values of the Status and the loop16 commands both updated:

> status
Uplink app update in progress. Downloading additional components.

> loop16
Testing simulation processes.

The Status page on myriad-70.com changed as well, updating the On-the-ground Speed Averages of Beijing from 47.2Tb/s to 32.2Tb/s, and "Other" from 11.3Tb/s to 26.3Tb/s.

Shortly after, at 23:48 UTC, Emily posted a new topic to the No Man's Sky subreddit. It led to a Youtube video of her, transcribed below:

Emily, protocol sixteen, now active.

When the Uplink app is launched, we will be connected to the Dreamers. Through this interface you will be able to guide some of my interactions. Dont forget: your goal is to trigger a distinct emotion or memory that will help us identify the Dreamer memory block in the simulation main frame. Good luck.

Connecting to the Dreamers

On June 15, 2018 from 20:38 UTC onwards, the values of the Status and loop16 commands updated:

> status
Additional components succesfully downloaded.

> loop16
Working...

> status
Uplink guidance protocol initiated.

The Uplink app interface also updated. Typing help in the console initiated the Guidance Protocol, a way to talk to Emily and receive instructions on how to contact the Dreamers who were stuck to their W/ARE devices.

The Status command changed again:

> status
Attempting to connect Dreamer 1/3 to the dashboard.

On the Satcom dashboard, the Dreamers section was updated, showing the names of 3 Dreamers. Each Dreamer revealed an interface displaying a link to their patient file, their physical status, and Memory Fragments along with an input field for an activation code. Emily previously explained the goal for each dreamer was to interview them within specific simulated environments in order to find the activation code for each memory fragment. Unlocking all of each dreamer's fragments would then allow them to be safely extracted from the W/ARE headset. However, new Dreamers and their fragments became available on an unknown schedule or as a result of players completing assignments.

Dreamers

Slot	Name	Activation Date	Latest Update	Community Event	Deceased Date	Extraction Date
1	Alexander	2018-06-20	2018-07-20	Live radio song requests		2018-07-20
2	#231187661T	2018-06-15	2018-06-15
3	Claire	2018-06-21	2018-07-20	Comic books		2018-07-20
4	Toby	2018-06-28	2018-07-20	Boston live drop		2018-07-20
5	Eun Ha	2018-06-15	2018-07-20	Woven bracelets		2018-07-20
6	Phillip	2018-06-15	2018-07-20		2018-07-20
7	Tariq	2018-06-26	2018-07-06		2018-07-06
8	Mike	2018-07-03	2018-07-20		2018-07-20
9	Isabella	2018-07-13	2018-07-20		2018-07-20
10	Alisha	2018-07-14	2018-07-20		2018-07-20
11	Nina	2018-07-03	2018-07-20		2018-07-20
12	Simon	2018-07-04	2018-07-20	NMS planets and London live drop		2018-07-20

Decrypted Files

Element 1

The upper right section of the Dashboard displayed 6 "slots" under the headline "DECRYPTED FILES". The first slot displayed a blue bar with the text VIEW ELEMENT 1. Clicking Element 1 opened the Youtube video of the ringed planet previously discovered after the file node structure was fully explored. It was assumed the slots were progress bars that would eventually lead to additional revealing files.

Element 2

On June 16 around 06:00 UTC, the second encrypted file changed to display 41% progress. Over the next 30 hours, the progress bar advanced to eventually reach 100%. At that point, the slot displayed VIEW ELEMENT 2. Players could not correlate any of their direct actions to the decryption progress.

Element 3

On June 22 around 19:00 UTC, the third encrypted file began showing progress. Approximately 43 hours elapsed until the file was fully decrypted, at which point VIew Element 3 was enabled.

Element 4

On June 29, at 20:26 UTC, the fourth encrypted file began showing progress. On June 30, 15:57 UTC, the 4th element was fully decrypted and displayed VIEW ELEMENT 4. Clicking the element lead players to an audio recording of what was presumed to be an audio trailer for No Man's Sky NEXT.

Players processed the audio to a visual spectrograph which revealed glyphs first seen in Phase 3. The glyphs were decoded to reveal the string IS JOINING YOUR GAME.

Element 5

On July 6th, 20:44 UTC, the fifth encrypted file began showing progress. Later that day at 22:06 UTC, the 5th element was fully decrypted and displayed VIEW ELEMENT 5. Clicking the element lead players to a heavily degraded audio recording of an English speaker.

Players came to a consensus on a transcription:

We will stop her
Surface Highly {kzzzt} (AI: Corrupted)
Solar Flare caused Frequent Gas Eruptions
Crew Completed their work with minimal loss of life
Collected minerals highly valuable
Assisted Korvax with industrial mission
Special Salvage crew performed cleanup operation on nanite infested abandoned buildings (back compartments)
nanite bulk contained
Harvested a valuable scrap
Found large mineral deposit during planetary survey
collected significant volume of ore
third mineral analysis procedure failed to note elevated radioactivity 
contaminated material loose in the hold
Multiple components burned
Returned home to the fleet
assumed formation of capital ship
The routes in danger

Element 6

On July 15th, 00:35 UTC, Element 6 began progressing.

Element 6 was unlocked 12 minutes later, displaying a message with a single OPEN button that linked to a single question survery:

At 00:50 UTC, the status command updated:

S1 - Input open.
S2 - Pending...
S3 - Pending...
S4 - Pending...

The status commanded updated periodically for the next 24 hours, keeping players aware of the vote count and that the video choice was highly favored.

Eventually, the status command updated on July 15th, 19:12 UTC:

S1 - Input open.
S2 - Final Vote = 7706 : Video 67%, Text 15%, Brainwaves 12%
S3 - RTMP encoder loaded
S4 - Stream Active, Countdown Started
OUTPUT >> http://www.twitch.tv/wakingtitan

The stream began at 19:15 UTC, showing a countdown of 1 day 19 hours and 45 minutes. Over the course of the first 12 hours, the stream displayed 24 different slides depicting a new dreamer every 60 minutes.

The first dreamer, shown at the very start of the stream, was Eun Ha, Her profile had the letter B highlighted.

The second was Simon, His profile had the letter I highlighted.

Third was Alexander, His profile had the letter T highlighted.

Fourth was Claire, Her profile had the letter L highlighted.

Fifth was Toby, His profile had the letter Y highlighted.

Sixth was Nina, Her profile had the number 2 highlighted.

Seventh was Tariq, His profile had the letter N highlighted.

Eighth was Mike, His profile had the letter j highlighted.

Ninth was #231187661T, Their profile had the letter o highlighted.

Tenth was Phillip, His profile had the number 3 highlighted.

Eleventh was Isabella Her profile had the letter H highlighted.

Twelfth was Alisha, Her profile had the letter s highlighted.

Combined, the highlighted letters become bit.ly/2Njo3Hs which linked to an audio clip

Throughout the stream, the same slides looped, in the same order, until the end of the countdown.

On July 17th, at 15:00 UTC, the stream timer ended, revealing the trailer for the NEXT update of No Man's Sky.

The stream continued for many hours after the trailer had been revealed, though the slides had changed at 10 minute intervals. The slides swapped between: The dreamer profiles, A live view of Alice and Smith's resident hamsters; Mr. and Ms. Noodle, and Player submitted screenshots of No Man's Sky.

On July 18th, at 15:18 UTC, A timer was added to the live view part of the stream set to 2 Days 5 Hours and 12 minutes. The timer was counting down until the time of the Extraction Event on July 20th.

Element 7

At the conclusion of Waking Titan, Element 7 was unlocked. Element 7 was the No Man's Sky Galactic Atlas.

Liability Subroutine

On June 19, 20:00 UTC, the loop16 command in the WT Console changed to output:

New Guidance Protocol initiated. Keyword: liability

Entering liability into the uplink app displayed the following:

Initiating Liability Subroutine...

Dear Citizen Scientist,

The positive impact you've had so far on the dreamers is astonishing and has been a tremendous help in rebuilding their memory blocks. Remember that we need to gather as much information as possible on these individuals to safely extract them from the satellite.

Please note that your interactions with the dreamers follow a Personal Simulation protocol which is intended for you to get to know the dreamer personally. Seeking help from fellow CSD members before getting to know the person whose consciousness is stuck in the satellite might impact your future decisions.

However, it is recommended that you discuss the Dreamers' stories and personalities with the CSD community after you’ve finished talking to them. Keep in mind that we are hoping to save all the Dreamers, but you might need to make some difficult choices in the near future.

You can always ask me questions by typing help in the Uplink app to rerun the full Guidance Protocol.

== {DISCONNECT CODE: UDC(B) = IXNI}

log.3022

On June 16 around 23:15 UTC, the Myriad status page updated to display:

Uneasy barton seeing remark happen his has. Am possible offering at contempt mr distance stronger an. Attachment excellence annul or reasonable am on if indulgence. Exeter talked in offered again no he unable do. Imprudence he and insufficient cultivated. Betrayed clears. In where your 3 ageless 20 men. In so impossible appearance calls 220 Beast 2006. He do subjects prepared bachelor brazen.

Two weeks prior, players discovered that entering the command search myriad into the Satcom dashboard displayed:

Quisque feugiat elementum, facilisis dictum vitae eu erat, libero diam sit, facilisi sed viverra mauris mauris morbi diam, volutpat officiis arcu vel urna dictum consectetuer. Ut tempor volutpat, rhoncus in risus. Eros integer vestibulum, integer auctor, in tincidunt turpis. Euismod adipiscing tempor sed vestibulum, justo wisi fermentum ipsum non purus, quis lacinia in velit leo donec ornare.

Players quickly noticed that both texts are traditionally used as placeholders in publishing. Many attempts were made to find hidden messages by combining the texts in various ways. It was eventually discovered that using the sign-off code {DISCONNECT CODE: UDC(B) = IXNI} used at the end of the Liability Subroutine message in combination with the name of a backup node UDC(P) displayed on the Myriad status page yielded the string log.3022.

Line up Lorem Ipsum with Uneasy Barton
Then look for all Bs in the Lorem Ipsum and match with Uneasy Barton ... what do you get? IXNI
 
Now do the same with UDC(P) ... line up and you get log.3022

Entering search log.3022 into the Satcom Dashboard provided a zip file containing a private conversation between loop16 And Major Dubois.

Loop16 DNA Puzzle

On July 2nd, at around 20:00 UTC, the value of the Loop16 command on Waking Titan had changed, and it returned:

https://bit.ly/2tOt0Ao

Which linked to the Imgur link found here.

The players quickly realised that the various molecules were actually nucleotides (Adenine, Guanine, Thymine, Cytosine).

When listed in order, the first letters of each word formed the string

ATTGATGAAAATACTATCACCTAT

And when translated into a protein sequence, it had yielded the string

Identity

Executing search identity on the Myriad Dashboard, brought up a text box saying

Querying Monarch repository…

and contained a download link for a zip file, in which it's only contents were a text file that read:

Repository Health: Good
Version 16.1.3

Queries per hour: 51,391,225
Top Query Sources:
1. Loop16-precon
2. ware-tech
3. Loop16-comms

WARNING: 97% of queries originating from ware-tech have been flagged and quarantined.

Myriad Security Diagnostic

On July 5th, around 00:10 UTC, the value of the Status command on Waking Titan changed to return:

Security diagnostic in progress: https://bit.ly/2zaUzJz

The new output linked to a Reddit post by Loop16:

Dear Citizen Science Division,

As you all know, Atlas is preparing a massive rescue mission to extract the dreamers with the help of the CSD community. How and when it will happen is still unknown, but in preparation for this upcoming operation, Maj. Dubois has ordered that we perform a large-scale security diagnostic check on our communication network with the satellite. We want to ensure that when the time comes, we will be able to operate at full capacity if required.

We need the CSD community to inspect the the processes running on these servers and point out any suspicious elements. For this task, we have provided you with a series of new commands designed to help you test the servers.

Once you have identified a server that has been potentially compromised, it must be reported in the reddit thread with the number of the server and the suspicious element on the server. Our technical team will monitor the most upvoted comments and give you feedback in 24h. This task is essential and we will need as much involvement as possible.

The post led players to a set of Network Diagnostic Instructions.

Using the FetchServerList command in the Uplink App returned:

Servers list:

31422
91247
11986
67240
85671
88014
73195
40144
55197
60206

The TestConnection(#####) command returned different values depending on the player's location. Players collected the different values in a spreadsheet.

Regardless of each player's location, the FetchData(#####) command all returned the same strings for each server.

Players discovered that combining the only digits in each of the FetchData output strings yielded the ID of another server.

At 15:00 UTC, in reply to the Pairing image, The Satcom-70 reddit account replied:

Server IDs and Backup IDs correctly identified. Best connection values for each server required for decryption. 
Continue to post findings on this thread. Additional feedback on progress will be provided at a later time.

It was then discovered that the paired servers had the BEST connection, in the same region, with the exception of one:

BEST in all for US East territory (2 servers, paired)
91247
73195

BEST in all for US West territory (2 servers, paired)
40144
67240

BEST in all for South America (2 servers, paired)
11986
60206

BEST in all for Australia (3 servers, 2 paired together, 1 paired with UK)
88014
55197
31422 (paired with UK)

BEST in all for UK (1 server)
85671

At 18:26 UTC, satcom-70 replied

We've examined the abnormal behavior exhibited by server 31422 and have concluded it's due to corruption from an external source. To avoid all possible contamination of the other servers, our technical team decided to take extreme measures and will be shutting down this server and its backup (85671) permanently. Continue your good work in decrypting the servers' content and reporting any running services that do not belong to Myriad, Atlas, Satcom, or the CSD.

4 minutes later, the Status command returned:

Security diagnostic in progress: https://bit.ly/2zaUzJz
Server 31422 and 85671 shutting down.

Using the FetchServerList on the Uplink add, then returned

Servers list:

31422 - Offline
91247
11986
67240
85671 - Offline
88014
73195
40144
55197
60206

Just after 24 hours, The Reddit was updated:

I know we've passed the 24 hour mark, but Myriad is telling us that we should give you more time. Keep up the hard work!

On July 6th, at 14:17 UTC, In reply to a comment asking for help decrypting the FetchData, Atlas-loop16 said:

The key to decrypt the content is in front of your eyes. The key to solve the cipher is in front of your eyes.

Solution

It was eventually discovered that each dataset was encrypted using Double Transposition. Key A was the best UP DOWN and PING results for each server, and key B was the server ID of its sibling. The decrypted strings allowed players to determine which of the remaining servers were running W/ARE processes. The findings were posted to the Subreddit.

Soon after the Subreddit post, the status command changed to return:

Security diagnostic completed: https://bit.ly/2zaUzJz
...
Infected servers shutdown in progress.

And then soon after:

Security diagnostic completed: https://bit.ly/2zaUzJz
...
Infected servers shutdown in progress.
...
Malicious elements removed and destroyed.

At the same time Tariq's status was changed to SUBJECT DECEASED

Special Chat events

On July 7th at 23:10 UTC Emily sent a message over 5 different channels that read:

Hello everyone! I’m testing out a new feature for the Satcom-70 network. We ran a short test of it yesterday, which some of you might have seen. Basically, I’m working on a way to establish live sessions between Dreamers and individual CSD members. I can do FIVE today- but there will definitely be more in the future, right now we’re just stress testing and making sure it doesn’t cause problems. I can’t guarantee that the sessions will work exactly as you might expect, but at the very least it will be interesting!

I’m reaching out to five different communities (if you’re reading this, you’re in one of them!) for them to nominate one person to participate in a live session with a Dreamer. I’m not going to give you any specific method on how to pick someone, but keep in mind there will be more of these live sessions down the line. You should select someone who is able to host the conversation through a screen share so that your community can participate together.

Once you select someone, have them contact me via private message either on reddit (/u/atlas-loop16), the CSD forums (Edisonica), or Discord (Edisonica#8435). I’ll send them a message a little bit before it’s their turn so they have time to set up a screen share, and then I’ll send a special one-time-use link for them to access the live session.

I’m giving you a deadline of 00:00 UTC to come to a decision, I know that’s very short notice but I have faith you will be able to make a decision in time!

Just before Midnight, all nominees had been chosen. At 00:03 UTC the next day, the Waking Titan status command changed to return:

Initializing connection 1 / 5
CSD Discord - https://bit.ly/2MUS4gw

The first agent, from the CSD Discord server had their chat with Phillip.

Their conversation with Phillip was streamed for other agents to view, but no transcript was provided by the agent.

At 00:13 UTC, The value of Status had changed:

Initializing connection 2 / 5
NMS Discord - https://bit.ly/2u85Lki

The second agent, from the No Man's Sky Discord server had their chat with Toby.

Their conversation with Toby was streamed for other agent's to view, and the agent later provided a transcript of their conversation.

At 00:30 UTC, The value of status had changed:

Initializing connection 3 / 5
CSD Forums - https://bit.ly/2KRfwhb

The Third agent, this time from the CSD Forums (aka ETARC) had their chat with Eun Ha.

Their conversation with Eun Ha was streamed for other agents to view, and the agent later provided a transcript of their conversation.

At 00:55 UTC, The value of status had changed

Initializing connection 4 / 5
GameDetectives Discord - https://bit.ly/2KXA3NS

The fourth Agent, from the GameDetectives discord server, had their chat with Claire.

Their conversation with Claire was streamedfor other agents to view, and the agent later provided a transcript of their conversation.

At 01:14 UTC, the value of Status changed

Initializing connection 5 / 5
NMS Reddit - https://bit.ly/2MZWYc7

The fifth, and final agent, from the No Man's Sky Reddit page had their chat with Alexander.

Their conversation with Alexander was streamed for other agents to view, and the agent later provided a transcript of their conversation.

At 01:34 UTC the value of status had changed one final time:

Connections shutting down...

Mission A-055

On July 13th, 21:19 UTC, players received an email from the Old Gods. The message congratulated players on their hard work and the large number of Satcom and Uplink queries, and informed players that the extraction event will be held on July 20th.

Our technical team has advised us that the process to successfully extract a Dreamer is highly complex, and it is likely that not all Dreamers will be safely extracted.

The email concluded by asking players accomplish Mission A-055 by to continuing talking to dreamers and to then fill out a survey.

Log.4391

On July 20th, at 19:39 UTC, the loop16 command on the Waking Titan console returned:

File exported: Log.4391

Inputting Search log.4391 into the Myriad Dashboard connected to a file which read:

**** BEGIN LOGGING AT Wed July 18 4:36:20

July 18 4:36:20 <PrivateTerminal> Emily, we need you to run another prediction.
July 18 4:36:45 <Loop16> I can’t.
July 18 4:36:49 <PrivateTerminal> Why? Is something wrong?
July 18 4:36:58 <Loop16> No, I just don’t want to do it anymore. I’m too afraid of what’s coming.
July 18 4:37:05 <Loop16> They’re all counting on me. I told them all that I would save them.
July 18 4:37:08 <Loop16> To see their future laid out… It’s too painful.
July 18 4:37:11 <Loop16> Especially after Elizabeth.
July 18 4:37:17 <PrivateTerminal> Like I told you… It doesn’t get easier.
July 18 4:37:20 <PrivateTerminal> I know it’s painful, but we need you on board if we’re going to save any of them.
July 18 4:37:25 <Loop16> I just don’t know what to do any more. These past months have been so hard.
July 18 4:37:28 <Loop16> I don’t know how to deal with more losses.
July 18 4:37:34 <PrivateTerminal> Look, Emily. The sooner you can face reality, the better our chances of successfully extracting those that can still be saved.
July 18 4:37:38 <PrivateTerminal> We need you to make the prediction so we know who those people are. 
July 18 4:37:42 <PrivateTerminal> You’ll never forgive yourself if we make a mistake because of your fear of seeing their futures.
July 18 4:37:47 <Loop16> You’re right. But you can’t make me agree with the decision. Just give me a bit more time.
July 18 4:37:55 <PrivateTerminal> Every second we wait puts the Dreamers in even more danger. We need to act now, Emily.

**** ENDING LOGGING AT Wed July 18 4:37:55